1

University of Southern California Sea Grant Proposal PROJECT TITLE: DOCUMENTING MULTIPLE PHYCOTOXINS IN COASTAL ECOSYSTEMS OF THE CALIFORNIA COAST PRINCIPAL INVESTIGATORS: David A. Caron, Professor, University of Southern California Avery O. Tatters, Postdoctoral Investigator, University of Southern California Eric A. Webb, Associate Professor, University of Southern California FUNDING REQUESTED: 2016-2017 $60,183 Federal/State $40,836 Match 2017-2018 $61,232 Federal/State $42,060 Match STATEMENT OF THE PROBLEM The widespread occurrence and distribution of marine Harmful Algal Blooms (HABs) and their toxins in coastal waters of California have been documented during the last 15 years (Scholin et al., 2000; Anderson et al., 2006; Schnetzer et al., 2007; Kudela et al., 2008; Schnetzer et al., 2013). In contrast to these now-well-characterized ‘showcase’ marine phycotoxins such as domoic acid and saxitoxins, there is a paucity of research relating to many other algal and cyanobacterial-derived toxins that can occur in coastal environments. Specifically, discharges into estuaries and along the open coast from freshwater sources (e.g. rivers, creeks, coastal lagoons) can also contribute harmful freshwater cyanobacteria or algae and their toxins to the ocean, posing significant health risks to marine animals in close proximity to these sources (Miller et al., 2010) and also potentially threatening human seafood safety. We hypothesize that these freshwater species, together with marine-sourced toxins, result in elevated levels of diverse phycotoxins in coastal marine ecosystems in close proximity to freshwater discharges, creating matrices of toxins in estuaries that are much more complex than presently recognized. Our lack of knowledge regarding this important problem in coastal marine ecosystems stems from the fact that previous studies of harmful algal bloom-forming species and their toxins in these ecosystems have focused almost exclusively on marine taxa, with very little consideration that fresh or brackish water phycotoxins may be influencing marine mammals, birds, shellfish, finfish, and ecosystem health in general. In large part, this lack of attention is related to state and federal agencies that typically provide support for studying exclusively oceanic or freshwater ecosystems, but not their convergence. Consequently, the occurrence of ‘freshwater’ toxic species and/or toxins in regional estuaries has only rarely been considered or investigated (Lehman et al., 2005; Miller et al., 2010; Gibble and Kudela, 2014).

2

During the Fall of 2014, ad-hoc sampling of brackish/estuarine and coastal interface waters along the coast of southern California revealed the consistent and simultaneous presence of several toxin-producing species of algae and cyanobacteria, and/or multiple toxins in discrete water samples (see MOTIVATION for details). The identities of these species and the toxins they produce indicate a freshwater source even though they were detected in estuarine and coastal waters. These toxins, together with well-characterized marine algal toxins occurring in coastal waters, create the potential for multiple stressors for estuarine and near-coast marine communities. The existence of numerous, undocumented phycotoxins is highly concerning, given that these toxins have rarely been recognized or characterized within coastal ecosystems. This proposal will assess known and presently understudied algal and cyanobacterial toxins, and their producers, in coastal ecosystems in close proximity to freshwater discharges throughout southern California. Our work will focus on the land-sea interface, and encompass both highly urbanized regions as well as relatively undeveloped regions along the coast of the Southern California Bight. This is largely a discovery-based project because, while our preliminary data indicate that the accumulation of multiple phycotoxins may be a common situation in brackish/estuarine habitats of Southern California, the diversity of toxins and the species that produce some of them are unknown at this time. The primary goal of this project is therefore to establish baseline information on the number and identity of the toxins, and relate them to the species producing them. As part of this study, we will build on our existing culture collection of toxin-producing species of algae and cyanobacteria in order to create a community resource for studying these species. We will identify the cultured species by both traditional morphological criteria and genetic means. Through experimental studies that will be a part of this project, we will begin to understand the physiology and ecology of these species, and thereby determine if these organisms are ‘transients’ in brackish and marine ecosystems (i.e. produced in fresh water and merely transported into marine ecosystems), or capable of growth and toxin production in marine waters. We will perform experimental studies with cultured species to investigate their response to environmental stimuli (temperature, salinity), as we believe these are fundamental factors controlling their ability to growth in fresh, brackish and marine waters. We hypothesize that the current extreme drought throughout the region, as well as large-scale climate change forecasted to persist throughout the southwestern U.S., may be producing environmental conditions conducive to blooms of toxic species and subsequent ecosystem level toxin accumulations in fresh and estuarine ecosystems. Our experimental studies will help test this possibility. The information resulting from this study will begin to assess the significance of these species and their toxins for ecosystem health and sustainability. INVESTIGATORY QUESTIONS Our investigatory questions revolve around studies to address three basic aspects of cyanobacterial and algal toxins along the coast of the Southern California Bight: i. establishing the diversity and concentrations of previously undocumented phycotoxins present in estuarine and coastal regions, ii. identifying the source of these toxins (i.e. marine or freshwater) and the

3

species that are producing them, and iii. experimental studies aimed at understanding if these species are growing and producing toxins in these estuaries, or if their presence is a result of transport from freshwater or marine ecosystems. Specifically, we will address the following major questions, and aspects related to them: What is the extent of cyanobacterial and algal-derived toxins at the land-sea interface?

• What is the geographical distribution and diversity of ‘freshwater’ cyanobacterial or algal toxins along the coast of the Southern California Bight?

• What is their proximity to sources/inputs of fresh and coastal water? • Do toxins co-occur at a single site, and what concentration of toxins are present?

Can we link toxins observed in estuarine and coastal waters along the coast of the Southern California Bight to putative toxin producers?

• Which species of cyanobacteria or algae are producing the observed toxins? • Can individual species biosynthesize complex mixtures of toxins? • What toxins are being produced by cultured species? • What are the salinity and temperature optima and tolerances of toxic algae and

cyanobacteria in our study area? Are near-coast freshwater environments along urbanized regions of the southern California coast major sources of high abundances and/or diversity of toxic cyanobacteria and algae to the coastal ecosystem?

• Is estuarine or coastal contamination with HAB species and toxins related to urbanization along the drainage system?

• What are the monitoring needs, related to the findings of this study, that must be developed and where should they be enacted to track potentially dangerous situations in our coastal ecosystems?

MOTIVATION The coastline of Southern California is arguably one of the most beautiful and valuable coastlines in the United States but in specific regions it is also one of the most impacted, in part due to extreme population density. The Greater Los Angeles area is the second largest metropolitan region in the U.S. (determined either by total population, or population density per unit area). The highly urbanized region of its coastline extends from Santa Monica Bay to the northern shores of Orange County, a coastline of only ≈50 miles that supports a massive population that is presently estimated at 18.5 million people and continues to grow at a rapid rate (U.S. Census Bureau. 2015. Annual Estimates of the Resident Population: April 1, 2010 to July 1, 2014 – Combined Statistical Area). The region is economically vibrant, and vital to the state because of its ports/harbors, fisheries, agriculture, recreational opportunities and tourism. However, high population density and its many consequent land uses (e.g. industry, agriculture, sewage and waste disposal) have created significant negative impacts on downstream estuarine and coastal environments. These impacts include negative feedback for humans through the microbiological contamination of estuaries and beaches, and for marine animals through the accumulation of various chemical contaminants (e.g. PCBs and DDT) or endocrine disruptors

4

that alter behavior and development (McDermott-Ehrlich et al., 1978; Jiang et al., 2001; Baker et al., 2009; McQuaig et al., 2012). Another well documented issue for both human and marine animal health is the contamination of marine food resources via the stimulation of toxic marine algae as a consequence of human-sourced nutrient enrichment of the coastal ocean (Glibert et al., 2005; Reifel et al., 2013; Schnetzer et al., 2013). Most notably in our region, domoic acid (the cause of Amnesic Shellfish Poisoning: ASP) and saxitoxins (the cause of Paralytic Shellfish Poisoning: PSP) are known to be common constituents in the coastal ocean. Both the species that produce these phycotoxins and the chemicals themselves are regularly monitored in the plankton and in sentinel marine animals (e.g. mussels), as well as seafood resources, by the California Department of Public Health. These powerful neurotoxins are also the topics of monitoring and research to understand the environmental factors leading to the success of the toxin-producing species in plankton communities, and their effects on marine and human food chains. Marine algal toxins produced along the California coast are presently recognized as a significant, episodic source of mortality for our ‘charismatic macrofauna’ (Scholin et al., 2000; Gulland and Hall, 2007), and algal blooms and their toxins are an important consideration for seafood safety (Etheridge, 2010) and a variety of water uses (Caron et al., 2010). It has recently been determined that human mediated discharges (e.g. sewage effluent, storm drains) in urbanized regions of southern California result in nutrient loading of our coastal waters that are now similar in magnitude to natural sources of nutrients such as upwelling (Howard et al., 2014). That is, anthropogenic sources of nutrients along the urbanized coast of southern California may be contributing to the growth and toxin production of marine algae. In Greater Los Angeles alone, nearly one billion gallons of treated sewage effluent is released into the coastal ocean on a daily basis. The issues noted above relating to HABs in marine ecosystems are now well documented, and constitute an area of active scientific research and environmental monitoring. On the freshwater side of the equation, cyanobacterial and algal toxins have also become a major concern for drinking water quality, recreational exposure, and animal mortality (Backer et al., 2008; Roelke et al., 2011; Wilhelm et al., 2011), and these events appear to be increasing as a consequence of climate change and human-induced eutrophication (Davis et al., 2009; Paerl and Huisman, 2009; Paerl and Paul, 2011; Paerl, 2014). One important aspect concerning the health of coastal ecosystems related to HABs and their toxins that has gone completely ‘under the radar’ until very recently, however, is the potential contribution of cyanobacterial and algal toxins produced in freshwater ecosystems that are subsequently transported to the coast via creeks, rivers or breaches of coastal lagoons. This issue garnered considerable public attention with the recent documentation of sea otter deaths in Monterey Bay that were attributed to cyanobacterial toxins (microcystins) produced in rivers flowing into the Monterey Bay National Marine Sanctuary, where the otters were exposed to the toxins via accumulation in the marine food web (Miller et al., 2010). Cyanobacterial toxins were extraordinarily high in some local lakes and rivers, presumably due to agricultural activity in the area that contributed to nutrient loading and cyanobacterial growth. Movement of this water into the coastal ecosystem exposed the marine organisms in the estuaries and coastal ocean to these

5

chemicals, creating trophic links between the freshwater toxin and marine animals. The incident described above raised awareness of the potential for a ‘freshwater’ class of toxins as a significant concern in coastal California, but microcystins are certainly not the whole story with respect to cyanotoxins (or algal toxins) in marine ecosystems along the coast. Nodularins have been documented in food webs of the Baltic Sea (Sivonen et al., 1989; Repka et al., 2004), and threats to seafood safety by cyanobacterial toxins have been documented from estuaries in other parts of the world (Falconer et al., 1992; Mulvenna et al., 2012). We recently obtained very preliminary findings that highlight the co-occurrence of multiple toxin-producing cyanobacteria/algae, and mixtures of phycotoxin classes, in a variety of locations along the southern California coastline (Table 1). Table 1. Preliminary results (only a single sample was analyzed from each location) of toxin screening from estuarine and coastal locations within the Southern California Bight, showing widespread occurrence of algal/cyanobacterial toxins. An asterisk (*) indicates a toxin detected in an environmental sample and in a cultured organism from the same location.

Our results clearly indicate a presently overlooked, potentially significant environmental and public health concern in estuarine/coastal ecosystems that span the geographic breadth of the Southern California Bight. A wide variety of previously undocumented phycotoxins were

Toxin/class detected

Mode of action in mammals

Estuary (1-33ppt) Locality detected likely producer

Marine ( > 33ppt) Locality detected likely producer

Domoic Acid KA/GLU receptor binding antagonist ? Pseudo-nitzschia spp. ubiquitous Pseudo-nitzschia

spp.

Paralytic Shellfish Poisoning Toxins

(PSPs)

Na+ channel antagonist, neurotoxins

San Elijo Lagoon, Batiquitos Lagoon

Alexandrium sp.*, Aphanizomenon sp.,

Cylindrospermopsis sp.*, Lyngbya sp.*,

Phormidium sp.*

Newport Point, Ventura Harbor, Jalama

Alexandrium spp.*,

Lyngbya sp.,

Diarrhetic Shellfish Poisoning Toxins

(DSPs)

Protein Phosphatase inhibitor (PPi) ? Dinophysis spp. ? Dinophysis spp.

Microcystins hepatotoxins, PPi San Elijo Lagoon Microcystis spp.* ? -

Anatoxins nAChR agonists Lagoon at Pt.

Mugu, Santa Clara River estuary

Anabaena spp., Dolichospermum sp.,

Oscillatoria spp.? ? Oscillatoria spp.

Cylindrospermopsins Potent hepatotoxins, multiple effects

upstream from lagoon at Pt. Mugu, Santa Clara River

Cylindrospermopsis raciborskii ? -

Nodularin potent PPi Santa Clara River Nodularia sp. * ? -

Cycloimines nAChR and mAChR

antagonists, neurotoxins

? ? Newport Point,

Point Dume, Ventura Harbor

Gymnodimium sp., Alexandrium

spp. *

Lyngbyatoxin A Dermatitis, tumor promoters, other

Ventura County, Los Penasquitos

Lagoon Lyngbya spp.* Ventura

County Lyngbya spp.*

Phormidolide unknown Santa Clara River estuary, Jalama

creek Phormidium spp.* ? Phormidium spp.

Microginins metalloprotease inhibitor San Elijo Lagoon Microcystis sp. ? ?

Microviridins PPi, elastase inhibitor San Elijo Lagoon Microcystis sp. ? ?

Karlotoxins cytotoxins ? Karlodinium veneficum ? Karlodinium

veneficum

6

observed across the estuaries sampled. Moreover, some of the locations had multiple toxins. These data indicate that the accumulation of multiple phycotoxins may be a common situation in brackish/estuarine habitats of Southern California, but the number of co-occurring species and toxins within the estuaries in the region, their concentrations, seasonality, and their relationship to human activities on land, are poorly understood at this time. Additionally, we currently have only circumstantial information linking putative toxin-producing species (which can be numerous in a given ecosystem) to actual toxin production. Without that information, a monitoring plan that specifically targets toxic cyanobacteria and algae cannot be developed. In order to generate an accurate risk assessment related to phycotoxins, we propose a coordinated sampling and research effort to establish baseline information on the occurrence of various toxins and their producers in a wide array of estuarine environments in the Southern California Bight. We feel that characterizing the extent of toxic algae and associated chemicals within estuarine ecosystems throughout the region is an important first step in establishing the extent of this problem, and expanding our awareness of the presence of multiple stressors in urbanized regions of the coastal ocean. Consequently our primary motivation in this proposal is the discovery and characterization of a diversity of compounds/organisms in the coastal ecosystems of southern California. The proposed work is cutting edge in that these species and compounds have thus far gone undocumented. We propose to survey all estuarine/lagoonal/river/creek entry points to the coastline across the length of the Southern California Bight in order to assess which freshwater ecosystems are contributing phycotoxins, and to identify the major producers of these toxins. Co-occurrence of multiple marine- or freshwater-derived toxins in estuaries creates the potential for multiple stressors of the organisms living in these environments. This project will bring fuller awareness of the connections between freshwater, estuarine and marine habitats by improving our understanding of the cyanobacterial/algal toxins at the land-sea interface. It is highly likely that the contribution of freshwater phycotoxins to estuaries and along the coast is strongly influenced by rain events (i.e. flushing), land use of the areas drained by freshwater creeks/lagoons, seasonality, climate, and potentially other factors. A number of freshwater discharges into the ocean in southern California are seasonal. Accumulations of algal biomass and toxins in lagoons and creeks therefore can occur over several months, with massive ‘dosing’ occurring when rainfall is sufficient to allow discharge, or breaching of coastal land barriers to the ocean. We are therefore motivated to synchronize our sampling with major weather/seasonal events such as a ‘first flush’, the first major rain event in the region which brings large amounts of rainwater into local waterways and for many creeks and lagoons results in the reestablishment of connectivity to the ocean. Additionally, there is little to no baseline information on the role of human activities in influencing cyanobacterial/algal communities in water discharging to coastal ecosystems in the region. We will establish baseline information for southern Californian estuaries so that future assessments can identify changes in response to land use, climate change, etc. Our expectation is that fresh waters in highly developed areas will accumulate large amounts of anthropogenically-derived substances including nutrient-rich runoff and wastes that could dramatically stimulate the development of freshwater cyanobacterial/algal abundances relative to undeveloped areas.

7

Connectivity of those freshwater bodies to the coast (location and timing) will be fundamental determinants of the areas of the coastline that experience multiple freshwater phycotoxins. Water quality concerns stemming from rapid human population growth along the coast in southern California may be exacerbated by the large-scale drought presently taking place in the region as well as erratic annual weather patterns. Therefore, we hypothesize that urbanization (and the attendant eutrophication that can accompany it), possibly enhanced by present climatic conditions in the region, are major factors affecting the number and concentrations of toxins in freshwater entering marine ecosystems. Ultimately, we want to understand not only the presence of previously undocumented phycotoxins in the environment, but which cyanobacterial or algal species are producing them. Populations of the same species in disparate areas may biosynthesize different compounds due to site-specific environmental drivers, and specific classes of toxins may be synthesized by very different species. Due to this anticipated inter- and intra-specific variability, we are motivated to establish a well-curated culture collection of putative toxin producers that can be assessed for their ability to produce toxins, and ultimately studied to better understand their physiology and ecology. It is generally thought that the mere presence of some of these organisms within a system is cause for concern. One of the goals of this proposal is establishing a biological reference collection that will facilitate toxin discovery, and provide an essential source of reference material for the community that can be used to design and building region- and site-specific monitoring programs as well as support the development of research into the molecular taxonomy of important toxin-producing species identified in this work. Thus, the culture collection is fundamental for defining candidate species for future HAB monitoring programs. An indirect motivation for this proposed Sea Grant project relates to our desire to characterize ‘what’s in the water’. In this case, the focus is on the fresh and brackish waterbodies impinging on coastal ecosystems. This water is now and will be used/considered for public/private use in the future (e.g. irrigation), and thus this topic should be of interest to all consumers. Our preliminary findings highlight a variety of previously undocumented toxins in estuarine waters, and many of these are almost certainly sourced from nearby freshwaters. GOALS AND OBJECTIVES The overarching goals of this research project are to build awareness of the presence of undocumented phycotoxins in estuaries and coastal regions adjacent to freshwater discharge along the coast of the Southern California Bight, to provide insight into the causative species for these toxins, and to perform experimentation aimed at understanding if these species are growing and producing toxins in these estuaries or if their presence is a result of transport from freshwater or marine ecosystems. Ultimately, this work will contribute to establishment of guidelines for monitoring potentially toxic species and their products in the environment. As noted above and supported by our preliminary results (Table 1), the confluence of freshwater and marine ecosystems along the coast of southern California can be affected by multiple toxins of both freshwater and marine origin. The geographic distribution and types of these chemical threats is presently unknown. Given these overarching goals, the specific objectives of the project are:

8

(1) Determine the extent of known or presently-undocumented phycotoxins in southern Californian coastal waters and estuarine ecosystems: This objective will be accomplished by conducting an extensive spatial survey of toxic algae and cyanobacteria along the coast of the Southern California Bight during Year 1 of the project. The survey will also provide live material for visually identifying potentially toxic species of algae and cyanobacteria, which will then be targeted for isolation and culture. (2) Isolate, culture and identify the causative cyanobacteria/algae that are the origin of toxins observed in the Year 1 survey: A culture collection consisting of both marine and freshwater toxic cyanobacteria and algae will be initiated from the survey samples, and used to directly link toxins to putative producers. Toxin-producing species will be identified by morphological and molecular approaches, and made publicly available to the scientific community. The biological collection and databases will be melded in future with other regional collections and databases now emerging within the state to provide a source of reference organisms and toxins in support of statewide monitoring and management practices of toxic algae and cyanobacteria. (3) Conduct field work (Year 2) to obtain greater temporal resolution on the presence of phycotoxins at 3-5 ‘hot spots’ within the region: Study sites exhibiting multiple phycotoxins or high concentrations during the Year 1 field survey will be sampled at higher frequency (monthly) during the second year to provide information on the seasonality of toxins appearing at the sites, with concomitant characterization of the putative producers at the sites. (4) Establish the basic physiological tolerances of these species and their effects on toxin production: Experimental work will be conducted to examine the temperature and salinity optima of the cultured species, which will help identify the source of toxic species (marine or freshwater) and help establish if these species are likely growing within estuarine environments along the coast, or being transported there from marine or freshwater ecosystems. 5) Provide information for the development of future monitoring practices: Information resulting from this study will identify regional hot spots, the phycotoxins appearing in those areas, and the seasonality of their appearances. This information will be conveyed to the Regional Water Quality Control Boards and other agencies charged with water quality in the region. METHODS AND APPROACH A spatial survey will be conducted that encompasses major estuaries within the middle and northern Southern California Bight, dovetailing with a complementary program sampling by colleagues in the southern region of the Bight (Howard et al, SCCWRP). The survey will constitute a baseline determination of presently-overlooked phycotoxins along the coast (preliminary data in Table 1), conducted three times between early summer and late fall (when cyanobacterial abundances in freshwaters typically reach maximal abundances), and also repeated once after the first significant rainfall of the year (‘first flush’) when freshwater discharge into the coastal ocean is most likely to contribute high concentrations of phycotoxins

9

to estuarine and coastal ecosystems. The first year’s field work will provide material for culturing and identifying potentially toxic cyanobacteria and algae, and also identify locations that exhibit multiple phycotoxins or particularly high concentrations. The second year of field work will focus on 3-5 of these latter locations. Spatial survey collection sites: The collection sites, shown in Figure 1 and listed below, represent virtually all connections (permanent or seasonal) between freshwater ecosystems and the ocean, along the coast of southern California from Santa Barbara in the north to Torrey Pines in the south. This geographical range extends from relatively undeveloped coastline north of the Greater Los Angeles region, through the highly urbanized coastline of LA, and then from southern Orange County to the south through relatively undeveloped regions. Note, three major river systems will specifically not be sampled (Los Angeles, San Gabriel and Santa Ana Rivers). Those rivers will be sampled as part of a new NOAA-funded program beginning in Fall 2015 (see RELATED RESEARCH below), and thus our sampling program is completely complementary to that study.

Figure 1. Site of specific sampling locations throughout the Southern California Bight (from north to south): (1) Atascadero Creek/San Jose Creek/San Pedro Creek/Tecolotito Creek confluences to Goleta Slough; (2) Ventura Harbor; (3) Santa Clara River Estuary/Lagoon; (4) Oxnard-Channel Islands Harbor; (5) Mugu Lagoon; (6) Zuma Lagoon; (7) Malibu Creek/Lagoon; (8) Topanga Creek/Lagoon; (9) Rustic Creek; (10) Ballona Lagoon; (11) Marina Del Rey; (12) Ballona Creek; (13) Del Rey Lagoon; (14) King Harbor, City of Redondo Beach; (15) Malaga Creek; (16) Colorado Lagoon Park/Alamitos Bay; (17) Anaheim Bay; (18) Bolsa Chica Channel/Basin; (19) Seal Beach National Wildlife Refuge; (20) Huntington Beach

10

Channel/Harbour; (21) Upper Newport Beach Nature Preserve; (22) Aliso Creek; (23) Salt Creek; (24) Dana Point Harbor; (25) San Juan Creek ; (26) San Mateo Creek; (27) Santa Margarita River; (28) Oceanside Harbor; (29) San Luis Rey River; (30) Buena Vista Creek/Lagoon; (31) Agua Hendionda Carlsbad; (32) Batiquitos Lagoon State Marine Conservation Area; (33) San Eljjo Lagoon; (34) San Dieguito River/Lagoon; (35) Los Penasquitos Creek/Lagoon. Whole water and benthic grab samples will be collected at all localities. Dominant algae and cyanobacteria will be evaluated by microscopy and samples will be screened for toxins using HPLC and/or ELISA (see below). We will also deploy Solid Phase Adsorption Toxin Tracking (SPATT)(Lane et al., 2010), that will be retrieved for analysis after one week of exposure, in order to characterize phycotoxins that might be present at concentrations too low to be detected by direct sample analysis. SPATT technology allows for highly sensitive toxin determinations by adsorbing toxins from the water throughout the period of deployment. In this way, SPATT also provides a temporal integration of the presence of toxins at the site. Optimization of resins used for the application of SPATT for various toxins will be accomplished as part of the recently funded NOAA project in which Caron and Tatters are participants (see RELATED RESEARCH). Focused field work in second year: Based on findings from Year 1, we will narrow our field efforts to a more extensive study of 3-5 of the original sites. This strategy will permit increased sampling frequency and resolution of the most ‘active or interesting’ locations. We propose a monthly scheme (Feb-Nov 2017) that involves whole water and benthic sampling flanking deployment and retrieval of SPATT bags. The specific number of stations will be determined by the distance (and therefore travel time) between the most interesting sites (i.e. those site that show either high toxin concentrations, multiple co-occurring toxins, or both). Small scale spatial heterogeneity in the various source waters will be characterized at sites that have more than one freshwater input (e.g. the confluence of the Atascadero, San Jose, San Pedro and Tecolotito Creeks at Goleta Slough). Toxin analyses: For both field samples and samples of established cultures, filtered samples and SPATT bag elutions will be screened and analyzed for a suite of toxins using HPLC and/or ELISA (Table 2). HPLC will serve as our primary screening tool in addition to immunoassay and a receptor binding assay. A synthesis of literature for the toxins listed in Table 2 allowed us to devise HPLC methods that are able to detect, not quantify, several of these compounds in a single run (Astrachan and Archer, 1981; Ohtani et al., 1992; Lawton et al., 1994; Lawton et al., 1995; Hawkins et al., 1997; Kodania et al., 1999; Gugger et al., 2005; Meriluoto and Spoof, 2005; Tonk et al., 2009). We will screen for domoic acid, microcystins (LR, RR, YR), anatoxin-a, nodularin, cylindrospermopsin, lyngbyatoxin a, microginins, microviridins, karlotoxins, gymnodimines and various cyclic imines using an Agilent 1290 UHPLC equipped with UV-vis/DAD/FL detection (Table 2). Putative identification of toxins will be accomplished by comparison with reference standards, predicted retention times and absorbance spectra. Screening for the other toxins, okadaic acid and PSPs, will be performed using commercially available ELISA kits from Abraxis. Quantification of domoic acid, microcystins, nodularin, cylindrospermopsin and gymnodimine will be performed by HPLC with minor modifications to

11

published methods (Harada et al., 1994; Lawton et al., 1994; Lawton et al., 1995; Marrouchi et al., 2010; Tatters et al., 2012). Measurements of okadaic acid and PSPs will be made with ELISA (Sassolas et al., 2013; Casero et al., 2014). Lastly, anatoxin-a and cyclic imine concentrations will be determined using colormetric receptor binding assays also available from Abraxis (Rubio et al., 2014). Table 2. Overview of the toxins that will be analyzed from field samples. Putative producers obtained in culture will also be assayed for the toxins they may produce.

Compound(s) Screening method

Quantification method

Domoic Acid HPLC/ELISA HPLC/ELISA Okadaic Acid ELISA ELISA

PSPs ELISA ELISA Microcystins HPLC/ELISA HPLC/ELISA Anatoxin-a HPLC RBA Nodularin HPLC HPLC

Cylindrospermopsin HPLC HPLC Lyngbyatoxin A HPLC -

Microginins HPLC - Microviridins HPLC -

Gymnodimines HPLC HPLC other Cyclic imines HPLC RBA

Karlotoxins HPLC - Establishment of cultures: Potential toxin-producing cyanobacterial and algal species (identities based on morphological identifications) will be collected and isolated from the field samples, which will be subsequently analyzed for phycotoxins. Algae/cyanobacteria will be brought into culture in an attempt to relate toxins at the sites to specific microbial taxa. These strains will be used to confirm toxin production, and to conduct simple experimental studies to examine growth conditions and toxin production (see immediately below). Cultured algae and cyanobacterial species will be identified based on morphological details (i.e. classical taxonomic criteria). In addition, small subunit ribosomal RNA genes (16S genes) of the cyanobacterial strains will be sequenced using ‘cyanobacterial specific’ PCR primers (Nübel et al., 1997) as recently described (Momper et al., 2015). If the 16S molecule does not provide enough information to positively identify the isolate, the internal transcribed spacer (ITS) region will also be sequenced (Orcutt et al., 2002; Webb et al., 2009). This effort will provide molecular identifications and comparison with national and international databases of known toxic and nontoxic cyanobacteria. As mentioned above, toxic species of cyanobacteria and algae cultured during this study will be made available to the scientific community, to serve as source material for the development of methodology for monitoring important species and studies of specific toxins and their production. Experimental studies with cultured algae and cyanobacteria: Lab studies will be conducted with toxin-producing cyanobacteria or algae to determine the ability of these species to grow and produce toxins across a range of salinities and temperatures.

12

Where possible and where time permits, we will clean cultures of co-occurring heterotrophic bacteria, as growth or toxin production may be affected by these microbial associates (Shen et al., 2011). We anticipate that many of the toxins (and toxic cells) that we will encounter in the estuaries will be freshwater species transported from upstream locations, rather than endemic to saline environments. We will conduct experimental studies to determine optimal salinity, as well as salt tolerance of selected isolates. Growth across a range of temperatures will also be measured in order to determine the responsiveness of growth and toxin production to environmental temperature. Since it has been shown that cyanobacteria become a more significant fraction of algal blooms in shallow freshwater lakes as temperature increases (Kosten et al., 2012), these empirical data will be valuable for predicting local outcomes as climate change increases the average annual temperature in southern California. RELATED RESEARCH This project strongly leverages two research and monitoring efforts presently coming on-line in California. One effort (funded through the Regional Water Quality Control Boards) will begin this summer, and will investigate the production of cyanobacterial toxins and the causative species of those toxins in two freshwater, inland lakes in southern California (Lake Elsinore, Canyon Lake). This project is the beginning of what is planned to be a statewide effort to expand assessment of the occurrence of potentially toxic cyanobacteria (and a few eukaryotic algae) in the state’s freshwater waterways. Second, a NOAA based program is presently recommended for funding (start date Fall 2015; NOAA Monitoring and Event Response for Harmful Algal Blooms, MERHAB; Title: “Improving tools for monitoring multiple HAB toxins at the land-sea interface in Coastal California, HAB-SICC”). The latter program will focus on understanding the occurrence and impact of cyanobacterial toxins produced in freshwater ecosystems along the coastline of California as physiological stressors, at a few selected coastal locations. The study will examine locations in central and northern California beyond the geographical range of this Sea Grant project, as well as freshwater cyanobacteria and their toxins in three large river systems in southern California (Los Angeles, Santa Ana and San Gabriel rivers) and two estuaries in San Diego County (San Onofre, San Diego). The MERHAB locations will not be sampled as a part of this Sea Grant project in order to avoid overlap between the projects and maximize geographical coverage between them. Because the sites chosen for the Sea Grant work proposed here will complement the MERHAB sites, this project will expand and greatly improve the spatial resolution with which to assess potential links between urbanization and cyanobacterial occurrences in waterways leading to the coast. The Caron lab is involved in both of the projects described above, so coordination and cooperation among the three programs will greatly increase the chances of accomplishig the goals set forth in this Sea Grant project (see Letter of Support from Meredith Howard, Southern California Coastal Water Research Project, who is lead PI on both projects). The first component of the MERHAB project to be undertaken is an evaluation of the effectiveness of various resins for binding various cyanotoxins (for use in SPATT), and

13

validation with field/culture samples of the SPATT approach. That information will be applied in the present Sea Grant project. SPATT validation is slated for the first year of the MERHAB project, and therefore the SPATT method for cyanobacterial toxins will be vetted by the time the first field season of this project would be conducted. SPATT technology for binding and analyzing marine toxins is well worked out, and has been applied in field studies for several years by the Caron lab. BUDGET-RELATED INFORMATION Personnel support for this project is requested for Avery O. Tatters (4 mos./year in both years), who is a Postdoctoral Investigator in Caron’s lab and who is partially supported on other grants. Tatters has extensive expertise in algal and cyanobacterial culturing and taxonomy and is an essential component of the culture establishment and morphological identifications. Funds ($1,000) are requested to support a part-time undergraduate student on the project to assist with the culture work and photographic documentation of the field samples and laboratory cultures established in the project. A Sea Grant Traineeship is also requested (For Joshua Kling), who is a Ph.D. graduate student in Webb’s lab, and who will be instrumental in the molecular identification of cyanobacterial cultures established in the project. Funds requested for materials and supplies ($11,500 in Years 1 and 2) will provide sampling containers, preservatives, culture vessels (flasks, tissue culture dishes, etc.), culture media and vessels, PCR primers and supplies, sequencing costs, as well as the large amounts of disposal tubes, gloves, pipettes, and miscellaneous reagents required for the work. Travel funds ($2,788/yr) are requested to cover substantial costs (mileage charges) for conducting the extensive field sampling programs that will be conducted in both years. No permanent equipment is requested, all facilities necessary to conduct the research are present in the PIs labs (incubators, microscopes, plate readers for ELISAs, a departmental HPLC, and various instruments for genetic analyses,). Matching Funds for this project will be provided by USC for 0.5 months/year academic salary (and associated fringe) for Caron and Webb. ANTICIPATED BENEFITS In a general sense, the outcomes of the study will be directly applicable to Sea Grant’s sustainable seafood and aquaculture initiatives. Characterizing the extent of toxic algae and their phycotoxins within estuarine ecosystems in the Southern California Bight is an important step in our growing awareness of the presence of multiple toxins in urbanized regions of the coastal ocean. Our very preliminary findings regarding the co-occurrence of multiple toxin producers

14

and mixtures of toxin classes (Table 1) suggest a presently overlooked but potentially important environmental and public health concern in estuarine/coastal ecosystems. In order to enable an accurate risk assessment, a coordinated sampling effort is needed to establish the presence of these toxins, and their producers. Our present lack of understanding regarding the prevalence, diversity and geographical distribution of these toxins thwarts Sea Grant’s goal of achieving sustainable coastal ecosystems and the services they provide. The culture collection and toxin discovery provided by the study will be an essential source of reference material for designing and building region- and site-specific monitoring programs, support the development of a molecular taxonomy for species with difficult or ambiguous morphologies (many cyanobacteria), and research that might explain the distributions of these species. Several wetlands and estuarine preservation or conservation groups managing various sites (see list of sampling locations) will directly benefit from a knowledge of the toxins present in their ecosystems, the species of cyanobacteria and/or algae producing those substances, and their putative sources (i.e. upstream growth of freshwater species, introduced from the coastal ocean, or produced in-situ in the estuarine environment). This work also has direct implications for the location of proposed aquaculture operations in the region as well as seafood safety monitoring. The proposed physiological studies to understand the temperature and salinity limits of the species, and the responsiveness of toxin production to these variables, will help identify possible management strategies for these groups and agencies. This work will also contribute to an ongoing effort to generate a Southern California regionally-specific cyanobacteria guide. This identification manual will include photomicrographs of natural communities and culture material as well as morphological, physiological and phylogenetic information for select, ecologically important strains. This identification and overall ecological resource will immediately be useful to educators, HAB monitoring groups, water quality personnel; individuals and entities that routinely have difficulties identifying these cryptic organisms. COMMUNICATION OF RESULTS We have a variety of venues through which we have communicated our scientific results in the past, and which we will continue to use in the future. Our findings will be communicated to the scientific community through the normal venues of publication and scientific meetings in which we participate. An example of the latter is the upcoming meeting of the 8th Symposium on Harmful Algae in the U.S., Long Beach, CA, November 15-19, 2015, which Caron is co-hosting (with Meredith Howard; Southern California Coastal Water Research Project). That symposium takes place every 2 years, and we anticipate that our participation in 2017 will focus on the results of this study. The information resulting from our research will also be made available to water managers and regulators. Caron serves on the Technical Advisory Board of the Surface Water Ambient

15

Monitoring Program (SWAMP) of the State Water Resources Control Board of California, formed to review and contribute to a statewide strategy for monitoring, assessing and reporting on cyanotoxins in California waterbodies. His presence on that Board provides direct interactions with many of the state groups and individuals developing criteria for assessing and managing freshwater toxic cyanobacteria/algae (e.g. California Cyanotoxin Harmful Algal Bloom network (CCHABs) and coastal water quality. His participation in a local workshop, Offshore Aquaculture in the Southern California Bight, Aquarium of the Pacific, Long Beach, CA, April 2829, 2015 also provided a means of informing state and federal agencies of the issues surrounding harmful algae and their toxins in California coastal waters. Our outreach and education activities make extensive use of USC Sea Grant’s outreach activities through a citizen-based harmful algal bloom monitoring program (HABWatch) that we have conducted during the past several years. This program is designed to incorporate the public, and personnel at public aquaria and informal learning centers into HAB-related monitoring of coastal waters. Participating groups (we have 11 groups that have or are participating) receive simple equipment and training in sample collection, processing and HAB species identification. Each group carries out weekly sampling and HAB monitoring at a locale near them, and the results are submitted and made available through a web portal. In addition to increasing public awareness and understanding of HABs, some of these groups have employed the program to develop teaching/exhibition modules for the public. Our results are made available to the general public through a number of activities. For example, recent public presentations of HAB-related information by Caron included a Discovery Lecture Series presentation at Cabrillo Marine Aquarium, San Pedro, CA, April 3, 2015 (Harmful Algal Blooms Along the California Coast: Their Ecosystem Impacts and Our Present Understanding). REFERENCES Anderson, C.R., Brzezinski, M.A., Washburn, L., Kudela, R., 2006. Circulation and

environmental conditions during a toxigenic Pseudo-nitzschia australis bloom in the Santa Barbara Channel, California. Mar. Ecol. Prog. Ser. 327, 119-133.

Astrachan, N.B., Archer, B.G. 1981. Simplified monitoring of anatoxin- a by reverse phase HPLC and sub-acute effects of anatoxin-a in rats. In: Carmichael, W.W. (ed.) The Water Environment--Algal Toxins and Health. Plenum Press, New York and London. 437-447.

Backer, L., Carmichael, W., Kirkpatrick, B., Williams, C., Irvin, M., Zhou, Y., Johnson, T., Nierenberg, K., Hill, V., Kieszak, S., Cheng, Y.-S., 2008. Recreational exposure to low concentrations of microcystins during an algal bloom in a small lake. Marine Drugs 6, 389.

Baker, M., Ruggeri, B., Sprague, L., Eckhardt-Ludka, C., Lapira, J., Wick, I., Soverchia, L., baldi, M., Polzonetti-Magni, A., Vidal-Dorsch, D., Bay, S., Gully, J., Reyes, J., Kelley, K., Schlenk, D., Breen, E., Šášik, R., Hardiman, G., 2009. Analysis of Endocrine Disruption in Southern California Coastal Fish Using an Aquatic Multispecies Microarray. Enviornmental Health Perspective 117, 223-230.

16

Caron, D.A., Garneau, M.-v., Seubert, E., Howard, M.D.A., Darjany, L., Schnetzer, A., Cetinic, I., Filteau, G., Lauri, P., Jones, B., Trussell, S., 2010. Harmful algae and their potential impacts on desalination operations off southern California. Water Res. 44, 385-416.

Casero, M.C., Ballot, A., Agha, R., Quesada, A., Cires, S., 2014. Characterization of saxitoxin production and release and phylogeny of sxt genes in paralytic shellfish poisoning toxin-producing Aphanizomenon gracile. Harmful Algae 37, 28-37.

Davis, T.W., Berry, D.L., Boyer, G.L., Gobler, C.J., 2009. The effects of temperature and nutrients on the growth and dynamics of toxic and non-toxic strains of Microcystis during cyanobacteria blooms. Harmful Algae 8, 715-725.

Etheridge, S.M., 2010. Paralytic shellfish poisoning: Seafood safety and human health perspectives. Toxicon 56, 108-122.

Falconer, I.R., Choice, A., Hosja, W., 1992. Toxicity of edible mussels (Mytilus edulis) growing naturally in an estuary during a water bloom of the blue-green alga Nodularia spumigena. Environ. Toxicol. Water Qual. 7, 119-123.

Gibble, C.M., Kudela, R.M., 2014. Detection of persistent microcystin toxins at the land–sea interface in Monterey Bay, California. Harmful Algae 39, 146-153.

Glibert, P.M., Seitzinger, S., Heil, C.A., Burkholder, J.M., Parrow, M.W., Codispoti, L.A., Kelly, V., 2005. The role of eutrophication in the global proliferation of harmful algal blooms. Oceanography 18, 198-209.

Gugger, M., Lenoir, S., Berger, C., Ledreux, A., Druart, J.C., Humbert, J.F., Guette, C., Bernard, C., 2005. First report in a river in France of the benthic cyanobacterium Phormidium favosum producing anatoxin-a associated with dog neurotoxicosis. Toxicon 45, 919-928.

Gulland, F.M.D., Hall, A.J., 2007. Is Marine Mammal Health Deteriorating? Trends in the Global Reporting of Marine Mammal Disease. EcoHealth 4, 135-150.

Harada, K.I., Ohtani, I., Iwamoto, K., Suzuki, M., Watanabe, M.F., Watanabe, M., Terao, K., 1994. Isolation of cylindrospermopsin from a cyanobacterium Umezakia natans and its screening method. Toxicon 32, 73-84.

Hawkins, P.R., Chandrasena, N.R., Jones, G.J., Humpage, A.R., Falconer, I.R., 1997. Isolation and toxicity of Cylindrospermopsis raciborskii from an ornamental lake. Toxicon 35, 341-346.

Howard, M.D.A., Sutula, M., Caron, D.A., Chao, Y., Farrara, J.D., Frenzel, H., Jones, B., Robertson, G., McLaughlin, K., Sengupta, A., 2014. Anthropogenic nutrient sources rival natural sources on small scales in the coastal waters of the Southern California Bight. Limnol. Oceanogr. 59, 285-297.

Jiang, S., Noble, R., Chu, W., 2001. Human adenoviruses and coliphages in urban runoff-impacted coastal waters of southern California. Appl. Environ. Microbiol. 67, 179-184.

Kodania, S., Suzuukia, S., Ishidaa, K., Murakamia, M., 1999. Five new cyanobacterial peptides from water bloom materials of lake Teganuma (Japan). FEMS Microbiol. Lett. 178, 343-348.

Kosten, S., Huszar, V.L.M., Bécares, E., Costa, L.S., van Donk, E., Hansson, L.-A., Jeppesen, E., Kruk, C., Lacerot, G., Mazzeo, N., De Meester, L., Moss, B., Lürling, M., Nõges, T., Romo, S., Scheffer, M., 2012. Warmer climates boost cyanobacterial dominance in shallow lakes. Global Change Biol. 18, 118-126.

Kudela, R.M., Lane, J.Q., Cochlan, W.P., 2008. The potential role of anthropogenically derived nitrogen in the growth of harmful algae in California, USA. Harmful Algae 8, 103-110.

17

Lane, J.Q., Roddam, C.M., Langlois, G.W., Kudela, R.M., 2010. Application of Solid Phase Adsorption Toxin Tracking (SPATT) for field detection of the hydrophilic phycotoxins domoic acid and saxitoxin in coastal California. Limnology and Oceanography, Methods 8, 645-660.

Lawton, L.A., Edwards, C., Codd, G.A., 1994. Extraction and high-performance liquid-chromatographic method for the determination of microcystins in raw and treated waters. Analyst 119, 1525-1530.

Lawton, L.A., Edwards, C., Beattie, K.A., Pleasance, S., Dear, G.J., Codd, G.A., 1995. Isolation and characterization of microcystins from laboratory cultures and environmental samples of Microcystis aeruginosa and from an associated animal toxicosis. Natural Toxins 3, 50-57.

Lehman, P.W., Boyer, G., Hall, C., Waller, S., Gehrts, K., 2005. Distribution and toxicity of a new colonial Microcystis aeruginosa bloom in the San Francisco Bay Estuary, California. Hydrobiologia 541, 87-99.

Marrouchi, R., Dziri, F., Belayouni, N., Hamza, A., Benoit, E., Molgo, J., Kharrat, R., 2010. Quantitative determination of gymnodimine-A by high performance liquid chromatography in contaminated clams from Tunisia coastline. Mar. Biotechnol. 12, 579-585.

McDermott-Ehrlich, D., Young, D.R., Heesen, T.C., 1978. DDT and PCB in flatfish around southern California municipal outfalls. Chemosphere 7, 453-461.

McQuaig, S., Griffith, J., Harwood, V.J., 2012. Association of fecal indicator bacteria with human viruses and microbial source tracking markers at coastal beaches impacted by nonpoint source pollution. Appl. Environ. Microbiol. 78, 6423-6432.

Meriluoto, J., Spoof, L. 2005. SOP: Analysis of microcystins by high-performance liquid chromatography with photodiode-array detection. In: Meriluoto, J., Codd, G.A. (eds.) Toxic cyanobacterial monitoring and cyanotoxinanalysis. Abo Akademi University Press, Finland. 77-84.

Miller, M.A., Kudela, R.M., Mekebri, A., Crane, D., Oates, S.C., Tinker, M.T., Staedler, M., Miller, W.A., Toy-Choutka, S., Dominik, C., Hardin, D., Langlois, G., Murray, M., Ward, K., Jessup, D.A., 2010. Evidence for a Novel Marine Harmful Algal Bloom: Cyanotoxin (Microcystin) Transfer from Land to Sea Otters. PLoS One 5, e12576.

Momper, L.M., Reese, B.K., Carvalho, G., Lee, P., Webb, E.A., 2015. A novel cohabitation between two diazotrophic cyanobacteria in the oligotrophic ocean. ISME J. 9, 882-893.

Mulvenna, V., Dale, K., Priestly, B., Mueller, U., Humpage, A., Shaw, G., Allinson, G., Falconer, I., 2012. Health risk assessment for cyanobacterial toxins in seafood. J. Environ. Res. Public Health 9, 807-820.

Nübel, U., Garcia-Pichel, F., Muyzer, G., 1997. PCR primers to amplify 16S rRNA genes from cyanobacteria. Appl. Environ. Microbiol. 63, 3327-3332.

Ohtani, I., Moore, R.E., Runnegar, M.T.C., 1992. Cylindrospermopsin: a potent hepatotoxin from the blue-green alga Cylindrospermopsis raciborskii. J. Am. Chem. Soc. 114, 7941-7942.

Orcutt, K.M., Rasmussen, U., Webb, E.A., Waterbury, J.B., Gundersen, K., Bergman, B., 2002. Characterization of Trichodesmium spp. by genetic techniques. Appl. Environ. Microbiol. 68, 2236-2245.

Paerl, H.W., 2014. Mitigating harmful cyanobacterial blooms in a human- and climatically-impacted world. Life 4, 988-1012.

18

Paerl, H.W., Paul, V.J., 2011. Climate change: Links to global expansion of harmful cyanobacteria. Water Res. 46, 1349-1363.

Paerl, H.W., Huisman, J., 2009. Climate change: a catalyst for global expansion of harmful cyanobacterial blooms. Environ. Microbiol. Rep. 1, 27-37.

Reifel, K.M., Corcoran, A.A., Cash, C., Shipe, R., Jones, B.H., 2013. Effects of a surfacing effluent plume on a coastal phytoplankton community. Cont. Shelf Res. 60, 38-50.

Repka, S., Meyerhöfer, M., von Bröckel, K., Sivonen, K., 2004. Associations of cyanobacterial toxin, nodularin, with environmental factors and zooplankton in the Baltic Sea. Microb. Ecol. 47, 350-358.

Roelke, D.L., Grover, J.P., Brooks, B.W., Glass, J., Buzan, D., Southard, G.M., Fries, L., Gable, G.M., Schwierzke-Wade, L., Byrd, M., Nelson, J., 2011. A decade of fish-killing Prymnesium parvum blooms in Texas: roles of inflow and salinity. J. Plankton Res. 33, 243-253.

Rubio, F., Kamp, L., Carpino, J., Faltin, E., Loftin, K., Molgo, J., Araoz, R., 2014. Colorimetric microtiter plate receptor-binding assay for the detection of freshwater and marine neurotoxins targeting the nicotinic acetylcholine receptors. Toxicon 91, 45-56.

Sassolas, A., Catananta, G., Hayat, A., Stewart, L., Elliott, C., Marty, J., 2013. Improvement of the efficiency and simplification of ELISA tests for rapid and ultrasensitive detection of okadaic acid in shellfish. Food Control 30, 144-149.

Schnetzer, A., Jones, B.H., Schaffner, R.A., Cetinic, I., Fitzpatrick, E., Miller, P.E., Seubert, E.L., Caron, D.A., 2013. Coastal upwelling linked to toxic Pseudo-nitzschia australis blooms in Los Angeles coastal waters, 2005-2007. J. Plankton Res.

Schnetzer, A., Miller, P.E., Schnaffner, R.A., Stauffer, B.A., Jones, B.H., Weisberg, S.B., DiGiacomo, P.M., Berelson, W.M., Caron, D.A., 2007. Blooms of Pseudo-nitzschia and domoic acid in the San Pedro Channel and Los Angeles harbor areas of the Southern California Bight, 2003-2004. Harmful Algae 6, 372-387.

Scholin, C.A., Gulland, F., Doucette, G.J., Benson, S., Busman, M., Chavez, F.P., Cordaro, J., DeLong, R., De Vogelaere, A., Harvey, J., Haulena, M., Lefebvre, K., Lipscomb, T., Loscutoff, S., Lowenstine, L.J., Marin, R., Miller, P.E., McLellan, W.A., Moeller, P.D.R., Powell, C.L., Rowles, T., Silvagni, P., Silver, M., Spraker, T., Trainer, V., Van Dolah, F.M., 2000. Mortality of sea lions along the central California coast linked to a toxic diatom bloom. Nature 403, 80-84.

Shen, H., Niu, Y., Xie, P., Tao, M., Yang, X.I., 2011. Morphological and physiological changes in Microcystis aeruginosa as a result of interactions with heterotrophic bacteria. Freshwater Biol. 56, 1065-1080.

Sivonen, K., Kononen, K., Carmichael, W.W., Dahlem, A.M., Rinehart, K.L., Kiviranta, J., Niemela, S.I., 1989. Occurrence of the hepatotoxic cyanobacterium Nodularia spumigena in the Baltic Sea and the structure of the toxin. Appl. Environ. Microbiol. 55, 1990-1995.

Tatters, A.O., Fu, F.-X., Hutchins, D.A., 2012. High CO2 and silicate limitation synergistically increase the toxicity of Pseudo-nitzschia fraudulenta. PLoS One 7, e32116.

Tonk, L., Welker, M., Huisman, J., Visser, P.M., 2009. A production of cyanopeptolins, anabaenopetins, and microcystins by the harmful cyanobacteria Anabaena 90 and Microcystis PCC 786. Harmful Algae 8, 219-224.

Webb, E.A., Ehrenreich, I.M., Brown, S.L., Valois, F.W., Waterbury, J.B., 2009. Phenotypic and genotypic characterization of multiple strains of the diazotrophic cyanobacterium, Crocosphaera watsonii, isolated from the open ocean. Environ. Microbiol. 11, 338-348.

19

Wilhelm, S.W., Farnsley, S.E., LeCleir, G.R., Layton, A.C., Satchwell, M.F., DeBruyn, J.M., Boyer, G.L., Zhu, G., Paerl, H.W., 2011. The relationship between nutrients, cyanobacterial toxin and the microbial community in Lake Tai (Taihu),China. Harmful Algae 10, 207-215.

20

PROJECTED WORK SCHEDULE TITLE: DOCUMENTING MULTIPLE PHYCOTOXINS IN COASTAL ECOSYSTEMS OF THE CALIFORNIA COAST

20

BUDGET (Year 1)

21

BUDGET (Year 2)

22

BRIEF CURRICULUM VITA (Caron) NAME DAVID A. CARON Address Dept of Biological Sciences, University of Southern California 3616 Trousdale Parkway, Los Angeles, CA 90089-0371 Phone (work) 213-740-0203 (home) 310-455-1659 Email dcaron@usc.edu EDUCATION 1975 B.S. University of Rhode Island, Microbiology 1977 M.S. University of Rhode Island, Oceanography 1984 Ph.D. Massachusetts Inst. of Technology and Woods Hole Oceanographic Inst., Joint Program in Biol. Oceanography POSITIONS HELD 1984 - 1985 Associate Research Scientist, LDEO of Columbia University. 1985 - 1989 Assistant Scientist, Woods Hole Oceanographic Institution. 1989 - 1993 Associate Scientist, Woods Hole Oceanographic Institution. 1993 - 1997 Associate Scientist with tenure, WHOI. 1997 - 1999 Senior Scientist, WHOI. 1999 - present Professor, University of Southern California 2010 - 2011 Interim Director, Wrigley Institute for Environmental Studies 2000 - 2003 Section Head, Marine Environmental Biology Section 2003 - 2006 Chair of the Department of Biological Sciences, USC SELECTED PUBLICATIONS (out of 207 published and in-press articles & book chapters) Das, J., F. Py, J. Harvey, J. Ryan, A. Gellene, R. Grahamk, D.A. Caron, K. Rajan and G,S. Sukhatme. 2015. Data-driven robotic sampling for marine ecosystem monitoring. International Journal of Robotics Research. In press. Liu, Z., A.E. Koid, R. Terrado, V. Campbell, D.A. Caron and K.B. Heidelberg. 2015. Changes in gene expression of Prymnesium parvum due to nitrogen and phosphorus limitation. Frontiers in Microbiology, Aquatic Microbiology. DOI: 10.3389/fmicb.2015.00319. Caron, D.A., P.D. Countway, A.C. Jones, D.Y. Kim, A. Schnetzer. Marine Protistan Diversity. 2012. Marine Protistan Diversity. Annual Review of Marine Science 4: 467-493. Liu, Z., A.C. Jones, V. Campbell, K.D. Hambright, K.B. Heidelberg and D.A. Caron. Gene expression in the mixotrophic prymnesiophyte, Prymnesium parvum, responds to prey availability. Frontiers in Microbiology 6 (2015). DOI: 10.3389/fmicb.2015.00319.

23

Seegers, B.N., J.M. Birch, R. Marin III, C.A. Scholin, D.A. Caron, E.L. Seubert, M.D.A. Howard, G.L. Roberston and B.H. Jones. 2015. Subsurface seeding of surface harmful algal blooms observed through the integration of autonomous gliders, moored Environmental Sample Processors, and satellite remote sensing in Southern California. Limnology and Oceanography. 60: 754-764. Hu, S., Z. Liu, A.A. Y. Lie, P.D. Countway, D.Y. Kim, A.C. Jones, R.J. Gast, E.B. Sherr, B.F. Sherr, S.C. Cary and D.A. Caron. 2015. Marine microbial eukaryote diversity and biogeography inferred from three different approaches for processing DNA information. Journal of Eukaryotic Microbiology. DOI: 10.1111/jeu.12217. Howard, M.D.A., M. Sutula, D.A. Caron, Y. Chao, J.D. Farrara, H. Frenzel, B. Jones, G. Robertson, K. McLaughlin and A. Sengupta. 2014. Anthropogenic nutrient sources rival natural sources on small scales in the coastal waters of the Southern California Bight. Limnology and Oceanography. 59: 285-297. Seubert, E.L., M.D.A. Howard, R.M. Kudela, T.N. Stewart, R.W. Litaker, R. Evans and D.A. Caron. 2014. Development, comparison and validation using ELISAs for the analysis of domoic acid in California sea lion body fluids. Journal of AOAC International. 97: 345-355. Caron, D.A. 2013. Towards a molecular taxonomy for protists: benefits, risks and applications in plankton ecology. J. Euk. Microbiol. 60: 407-413. Jones, A.C., T.S. Vivian Liao, F.Z. Najar, B.A. Roe, K.D. Hambright and D.A. Caron. 2013. Seasonality and disturbance: annual pattern and response of the bacterial and microbial eukaryotic assemblages in a freshwater ecosystem. Environ. Microbiol. 15: 2557–2572. Seubert, E.L., A.G. Gellene, M.D.A. Howard, P. Connell, M. Ragan, B.H. Jones, J. Runyan, D.A. Caron. 2013. Seasonal and annual dynamics of harmful algae and algal toxins revealed through weekly monitoring at two coastal ocean sites off southern California, USA. Environ. Sci. Poll. Res. 20: 6878–6895. Lewitus A.J., R.A. Horner, D.A. Caron, E. Garcia-Mendoza, B.M. Hickey, M. Hunter, D.D. Huppert, D. Kelly, R.M. Kudela, G.W. Langlois, J.L. Largier, E.J. Lessard, R. RaLonde, J.E. Rensell, P.G. Strutton, V.L. Trainer, J.F. Tweddle. 2012. Harmful algal blooms in the North American west coast region: history, trends, causes, and impacts. Harmful Algae. 19: 133-159. Seubert, E.L., S. Trussell, J. Eagleton, A. Schnetzer, I. Cetinić, P. Lauri, B.H. Jones and D.A. Caron. 2012. Algal toxins and reverse osmosis desalination operations: laboratory bench testing and field monitoring of domoic acid, saxitoxin, brevetoxin and okadaic acid. Water Research. 46: 6563-6573. Caron, D.A. and D.A. Hutchins. 2013. The effects of changing climate on microzooplankton grazing and community structure: drivers, predictions and knowledge gaps. Journal of Plankton Research. 35: 235-252.

24

BRIEF CURRICULUM VITA (Tatters) NAME AVERY O. TATTERS Address Dept. of Biological Sciences, University of Southern California 3616 Trousdale Parkway, Los Angeles, CA 90089 Phone (work) 910-393-7078 (home) 910-393-7078 Email tatters@usc.edu EDUCATION

2004 B.S. Biology, University of North Carolina-Wilmington 2007 Emerging Infectious Disease/Pathology, University of Texas Medical Branch 2009 M.S. Marine Science, University of North Carolina-Wilmington 2014 Ph.D. Marine Environmental Biology/Marine Biology and Biological

Oceanography, University of Southern California POSITIONS HELD

2003 - 2004 Research Assistant, University of North Carolina-Wilmington 2004 - 2005 Research Associate, University of North Carolina-Wilmington 2005 - 2007 Graduate Research Assistant, University of Texas Medical Branch 2007 - 2009 Graduate Research Assistant, University of North Carolina- Wilmington 2009 - 2014 Ph.D. Student- University of Southern California 2014 - present Postdoctoral Research Associate, University of Southern California

SELECTED PUBLICATIONS Bermudez, R., Feng, Y., Roleda, M.Y., Tatters, A.O., Hutchins, D.A., Larsen, T., Boyd, P.W., Hurd, C.L., Riebesell, U., Winder, M. 2015. Long-Term Conditioning to Elevated pCO2 and Warming Influences the Fatty and Amino Acid Composition of the Diatom Cylindrotheca fusiformis. PLoS ONE, 10 (5): e0123945. doi: 10.1371/journal.pone.0123945 Tatters, A.O., Flewelling, L.J., Fu, F., Granholm, A.A, Hutchins, D.A. 2013. High CO2 Promotes the Production of Paralytic Shellfish Poisoning Toxins by Alexandrium catenella from Southern California waters. 30: 37-43. doi: 10.1016/j.hal.2013.08.007 Tatters, A.O., Roleda, M.R., Schnetzer, A.., Fu, F., Hurd, C.L., Boyd, P.W., Caron, D.A., Lie, A.A.Y., Hoffmann, L.J., Hutchins, D.A. 2013. Short- and Long-Term Conditioning of a

25

Temperate Marine Diatom Community to Acidification and Warming. Phil. Trans. Royal Soc. B. vol. 368, no. 1627. doi: 10.1098/rstb.2012.0437 Tatters, A.O., Schnetzer, A., Fu, F., Lie, A.Y.A., Caron, D.A., Hutchins, D.A. 2013. Short- versus Long-Term Responses to Changing CO2 in a Coastal Dinoflagellate Bloom: Implications for Interspecific Competitive Interactions and Community Structure. Evolution. 67(7) 1879-1891. doi: 10.1111/evo.12029 Fu, F., Tatters, A.O., Hutchins, D.A. 2012. Global change and the future of harmful algal blooms in the ocean. Mar. Ecol. Prog. Ser. 470:207-233 Tatters, A.O., Van Wagoner, R.M., Tomas, C.R., Wright, J.L.C. 2012. Regulation of spiroimine neurotoxins and hemolytic activity in laboratory cultures of the dinoflagellate Alexandrium peruvianum (Balech & Mendiola) Balech & Tangen Harmful Algae. 19:160-168 Tomas, C.R., Van Wagoner, R.M., Tatters, A.O., White, K.D., Hall, S., Wright, J.L.C. 2012. Alexandrium peruvianum (Balech and Mendiola) Balech and Tangen a new toxic species for coastal North Carolina. Harmful Algae. 17:54-63 Tatters, A.O., Fu, F., Hutchins, D.A. 2012. High CO2 and Silicate Limitation Synergistically Increase the Toxicity of Pseudo-nitzschia fraudulenta. PLoS ONE. 7(2):e32116. doi: 10.1371/journal.pone.0032116 Van Wagoner, R.M., Deeds, J.R., Tatters, A.O., Place, A.R., Tomas, C.R., Wright, J.L.C. 2010. Structure and Relative Potency of Several Karlotoxins from Karlodinium veneficum. Journal of Natural Products. 73(8) 1360-1365 Tatters, A.O., Muhlstein, H.I., Tomas, C.R. 2010. The hemolytic activity of Karenia selliformis and two clones of K. brevis throughout a growth cycle. J. Appl. Phycol. 22:435-442 Tomas, C.R., Peterson, J., Tatters, A.O. 2007. Harmful Algal Species from Wilson Bay, New River, North Carolina: Composition, Nutrient Bioassay, and HPLC Pigment Analysis. Water Resources. Research Institute Project 50337. Report 369

26

BRIEF CURRICULUM VITA (Webb) Name: Eric A. Webb Address Dept. of Biological Sciences, University of Southern California 3616 Trousdale Parkway, Los Angeles, CA 90089 Phone (work) 213-740-7954 (home) 774-836-6778 Email eawebb@usc.edu EDUCATION 1994 B.Sc., The Ohio State University, Microbiology 1999 Ph.D., The University of Wisconsin-Madison, Bacteriology 1999-2001 Postdoctoral, The Woods Hole Oceanographic Institution (WHOI) POSITIONS HELD

2001- 2005 Assistant Scientist, Biology Department WHOI 2005-2006 Associate Scientist without tenure 2006-2011 Assistant Professor, USC, Biology Depart., MEB Section 2011-2015 Associate Professor with Tenure, USC, Biology Depart., MEB SELECTED PUBLICATIONS (WOS August 2014 h-index = 20)

Sohm, J.A., N. Ahlgren, Z. Thomson, C. Williams, J. W. Moffett, M. A. Saito, E. A. Webb, and G. Rocap. Synechococcus Diversity And Distribution in the Tropical and Subtropical Oceans. –in press at ISMEJ N.G. Walworth, U. Pfreundt, W.C. Nelson, T. Mincer, J. F. Heidelberg, F. Fu, J.B. Waterbury, T. Glavina del Rio, L. Goodwin, N. Kyrpides, M. Land, T. Woyke, D.A. Hutchins, W.R. Hess, and E.A. Webb. 2015 Trichodesmium genome maintains abundant, widespread noncoding DNA in situ, despite oligotrophic lifestyle. PNAS 112:4251–4256. Momper LM, Reese BK, Carvalho G, Lee P, and Webb EA. (2015). A novel cohabitation between two diazotrophic cyanobacteria in the oligotrophic ocean. ISME J 9:882–893. Fu FX, Yu E, Garcia NS, Gale J, Luo Y, Webb EA, Hutchins DA. 2014. Differing responses of marine N2 fixers to warming and consequences for future diazotroph community structure. Aquatic Microbial Ecol 72:33–46. S.A. Sañudo-Wilhelmy, L Gómez-Consarnau, C. Suffridge, and E.A. Webb. 2014. The Role of B Vitamins in Marine Biogeochemistry. Annu. Rev. Mar. Sci. 2014. Vol. 6: 339-367 doi: 10.1146/annurev-marine-120710-100912 Hutchins DA, Fu F-X, Webb EA, Walworth N, Tagliabue A. 2013. Taxon-specific response of marine nitrogen fixers to elevated carbon dioxide concentrations. Nature Geosci 6:790–795.

27

Chappell, P.D., J.W. Moffett, A.H. Hynes, and E.A. Webb. 2012 Molecular evidence of iron limitation and availability for the global diazotroph Trichodesmium ISME J 1-12 doi:10.1038/ismej.2012.13 Hynes, A.M., E.A. Webb, S.C. Doney, and J.B. Waterbury. 2012. Comparison of cultured Trichodesmium (Cyanophyceae) with species characterized from the field. J Phyc 48: 196–210. doi: 10.1111/j.1529-8817.2011.01096.x Sohm, J. A., J. A. Hilton, A. E. Noble, J. P. Zehr, M. A. Saito, and E. A. Webb. 2011. Nitrogen fixation in the South Atlantic Gyre and the Benguela Upwelling System. Geophys Res Lett 38: Chappell, P.D. and E.A. Webb. 2010. A molecular assessment of the iron stress response in the two phylogenetic clades of Trichodesmium Environ Microbiol 12:13-27 Rivers, A.R., R. W. Jakuba, and E.A. Webb. 2009. Iron stress genes in marine Synechococcus and the development of a flow cytometric iron stress assay. Environ. Microbiol 11:382 - 396 Van Mooy, B. A., Fredricks, H. F., Pedler, B. E., Dyhrman, S. T., Karl, D. M., Koblizek, M., Lomas, M. W., Mincer, T. J., Moore, L. R., Moutin, T., Rappe, M. S., and E.A. Webb. 2009. Phytoplankton in the ocean use non-phosphorus lipids in response to phosphorus scarcity. Nature, 458(7234), 69-72. Webb E.A., I.M. Ehrenreich, S. Brown, F.W. Valois, and J.B. Waterbury. 2009. Phenotypic and Genotypic Characterization of Multiple Strains of the Diazotrophic Cyanobacterium, Crocosphaera watsonii, isolated from the Open Ocean. Environ Microbiol 11: 338-348. Webb, E. A., R. W. Jakuba, J. W. Moffett, and S. T. Dyhrman. 2007. Molecular assessment of phosphorus and iron physiology in Trichodesmium populations from the western Central and western South Atlantic. Limnol. Oceanogr. 52:2221-2232. (Impact factor 3.545, citations 21) Dyhrman, S.T., P. D. Chappell, S. T. Haley, J. W. Moffett, E. D. Orchard, J. B. Waterbury, and E. A. Webb. 2006. Phosphonate utilization by the globally important marine diazotroph Trichodesmium. Nature. 439:68-71 Ehrenreich, I.M., J.B. Waterbury, and E.A. Webb. 2005. The Distribution and Diversity of Natural Product Genes in Marine and Freshwater Cyanobacterial Cultures and Genomes Appl. Environ. Microbiol. 71:7401-7413 Webb, E. A., Moffett, J. W., and J. B. Waterbury. 2001. Iron Stress in Open Ocean Cyanobacteria (Synechococcus, Trichodesmium, and Crocosphaera): Identification of the IdiA protein. Appl. Environ. Microbiol. 67:5444-5452

32

SUPPORTING DOCUMENTATION Letter of support: Dr. Meredith Howard, Southern California Coastal Water Research Project, Costa Mesa, CA

33

35

SUMMARY PROPOSAL FORM PROJECT TITLE: DOCUMENTING MULTIPLE PHYCOTOXINS IN COASTAL

ECOSYSTEMS OF THE CALIFORNIA COAST OBJECTIVE: The overarching objectives of this research project are to build awareness of the presence of undocumented phycotoxins in estuaries and coastal regions adjacent to freshwater discharge along the coast of the Southern California Bight, and to provide insight into the causative species for these toxins through isolation and culture of toxin-producing species. The longer-term goal is to contribute to the establishment of guidelines for monitoring potentially toxic species and their harmful products in estuarine environments throughout the region. METHODOLOGY: A spatial and temporal survey to obtain baseline information on the presence of potentially harmful cyanobacteria and algae, and their phycotoxins, will be conducted at numerous sites along the southern California coastline. We will obtain water and grab samples and employ passive toxin sampling methodology to provide a temporal aspect to the analysis. Algae and cyanobacteria will be examined via microscopy, and toxins will be assessed by HPLC and/or ELISA. Species of interest will be isolated and cultured, and studied experimentally in order to provide further physiological and genetic characterization. RATIONALE: The widespread occurrence of marine harmful algal blooms and their toxins (in particular domoic acid and saxitoxins) in coastal waters of California has been documented during the last 15 years. In contrast to these ‘showcase’ marine phycotoxins, there is a paucity of research on many other algal and cyanobacterial toxins that occur in our coastal environment. During fall 2014, ad-hoc sampling of estuarine and coastal interface waters along the coast of southern California revealed the consistent and simultaneous presence of several toxin-producing species of algae and cyanobacteria, and/or multiple toxins. The potential human and environmental health risks posed by acute or chronic exposure to mixtures of these previously undocumented phycotoxins is unknown. We propose a combination of field and laboratory studies to characterize the extent and distribution of these toxins, to identify the causative species, and assess their environmental tolerances. We hypothesize that freshwater habitats of urbanized and developed land stimulate the growth of diverse and potentially toxic cyanobacterial/algal assemblages, creating ‘hot spots’ of complex matrices of toxins in estuaries and along coastlines. DATA SHARING: All sequence data obtained in the study will be deposited in public databases. Cultures of toxic cyanobacteria and algae will be made publicly available. Scientific data resulting from the study will be shared through publication in the primary literature, presentation at scientific meetings, and through interactions with various state agency charged with water quality management.

University of Southern California Sea Grant Proposal 2015

PROJECT TITLE: WHAT FACTORS EXPLAIN THE HIGH RATES OF FISH

PRODUCTION ASSOCIATED WITH OIL PLATFORMS OFF THE COAST OF

CALIFORNIA?

PRINCIPAL INVESTIGATORS

Jeremy Claisse, Assistant Professor, Biological Sciences Department, Cal Poly Pomona (starting

Fall 2015); Associate Director, Vantuna Research Group, Los Angeles, CA

Daniel Pondella, Associate Professor of Biology, Occidental College; Director, Vantuna

Research Group, Los Angeles, CA

FUNDING REQUESTED

2016-2017 $29,847 Federal/State $26,806 Match

2017-2018 $30,653 Federal/State $27,673 Match

STATEMENT OF THE PROBLEM

In the Southern California Bight (SCB), rocky reef habitats are a primary limited resource

(Stephens et al. 2006; Pondella et al. 2011) and are of critical importance to both commercial and

recreational fisheries (Love 2006). In 2012, some of this valuable habitat was closed to fishing

with the implementation of the Marine Life Protection Act (California MLPA Initiative 2009),

further exasperating the limited nature of this resource. Rocky reefs adjacent to Los Angeles, the

largest urban area on the west coast of the United States, are directly affected by anthropogenic

impacts associated with urban development and human population increase. These include an

extensive and diverse set of stressors (e.g., sedimentation, urban runoff, pollution, harmful algal

blooms), in addition to both recreational and commercial fishing, that combine to contribute to

the decline of productive rocky reef habitats along this important stretch of coastline (Stull et al.

1987; Dojiri et al. 2003; Schiff 2003; Love 2006; Pondella 2009; Foster and Schiel 2010; Sikich

and James 2010; Erisman et al. 2011). The physical habitat structure and composition of the hard

substrate has a strong influence on the fish standing stock and community assemblage regardless

if the origin of the reef was man-made or natural (Patton et al. 1985; Ambrose and Swarbrick

1989; Reed et al. 2006; Claisse et al. 2014).

A variety of man-made structures that exist throughout the region also provide marine hard

substrate habitat. Harbor breakwaters provide complex, high-relief nearshore habitats for many

reef-associated fishes (Pondella and Stephens Jr 1994; Pondella et al. 2002; Froeschke et al.

2005; Froeschke and Pondella 2007). Several shipwrecks in the region provide habitat for

multiple life stages of rockfishes (Love et al. 2012). Oil and gas platforms (hereafter

“platforms”) are home to diverse biological communities, supporting both food sources and

complex physical habitat for fishes, typically in soft-bottom areas that would otherwise be void

of such associated fauna (Love et al. 1999; Love et al. 2000; Love et al. 2003; Martin and Lowe

2010; Claisse et al. 2014). Man-made reefs have also been used commonly throughout the SCB

in an attempt to mitigate anthropogenic environmental impacts and restore availability of

productive fishing habitat (CDFW 2001; Pondella et al. 2006; Reed et al. 2006; Goodsell and

Page 1

Chapman 2009). Studies of individual man-made reefs in southern California have demonstrated

that they are productive habitats that can in fact have greater fish standing stock, density, species

richness, recruitment and production relative to nearby natural reefs (DeMartini et al. 1994;

Johnson et al. 1994; Bond et al. 1999; Pondella et al. 2002; Reed et al. 2006; Tetreault and

Ambrose 2007; Claisse et al. 2014; Granneman and Steele 2014).

Understanding what factors influence the productivity of these man-made structures will directly

inform man-made reef design, policy and management. These activities include creating new

man-made rocky reefs as tools for fisheries management and habitat restoration (Granneman and

Steele 2014), developing policy for existing platforms, and the deployment of emerging (e.g.,

wind, marine hydrokinetic) renewable energy technologies (Nelson et al. 2008; Macreadie et al.

2011). In a recent study, we developed a model to estimate the secondary fish production rates

for 16 of the platforms off the coast of southern California (Figure 1) and found that these are

among the most productive marine fish habitats globally (Claisse et al. 2014). These high rates of

fish production ultimately result from high levels of larval and pelagic juvenile settlement and

subsequent growth of primarily rockfishes (genus Sebastes) (Figure 2) to the substantial amount

of complex hardscape habitat created by the platform structure distributed throughout the water

column (Figure 3). Further, fish productivity varied substantially across platforms (range 104.7–

886.8 g/m2/y; Figure 4), providing a unique opportunity to study what drives fish production on

reef habitats. Even though platforms off the coast of California were not designed to be high

production artificial reefs, they can provide insight into what drives high rates of fish production

for both natural and artificial habitats (Claisse et al. 2014). Because human activities are

Figure 1. The 16 platforms (filled

circles) used in the study were

surveyed for at least 5 (up to 15)

years between 1995 and 2011.

Page 2

Figure 2. Juvenile Bocaccio, Sebastes paucispinis,

observed in high densities around the base of

Platform Gilda. Photo credit: Donna Schroeder.

threatening fish populations on natural reefs

globally (Hoegh-Guldberg and Bruno 2010;

Mora et al. 2011), understanding the

biological productivity of man-made

structures is even more critical in terms of

conservation of marine resources.

In the near future, California’s ocean

managers face the unavoidable issue of

whether any of part the platform structures

off our coastline will remain in the water and

continue to function as reef fish habitat once

they become uneconomical to operate (as

part of the process known as

decommissioning). In addition, greater than

7,500 platforms around the world (Parente et

al. 2006) will need to be decommissioned in

the coming decades (Macreadie et al. 2011).

Further, with the rapid global expansion of

renewable energy structures in the marine

environment, both the design and policy

related to their construction and deployment

need additional scientific guidance (Nelson et

al. 2008; Langhamer 2012; Reubens et al.

2014). Design modifications that may

increase fish production should be an

important consideration during the

development process of offshore renewable

energy structures to maximize the potential

conservation and fishery benefit from their

deployment. With the passage of AB 2503

The California Marine Resources Legacy Act

in 2010, the State of California will allow

consideration of the partial removal of

decommissioned offshore platforms as an

alternative to complete removal if specified

criteria are met. One of these is a finding that

conversion to a man-made reef would

provide a “net benefit” to the environment as

compared to removal of the facility. The

determination of what constitutes a “net

benefit” is still under consideration, and

therefore there is a critical need to understand

the biological productivity of these structures

(Holbrook et al. 2000; Helvey 2002; Love et

al. 2003; Schroeder and Love 2004; Bull et

Figure 3. The platform structure consists of outer

vertical pilings and horizontal crossbeams (i.e., the

platform jacket) and the vertical oil and gas

conductors in the center. Note this is a general display

diagram and the designs of these structures can vary

substantially from platform to platform.

Page 3

Figure 4. Mean annual

fish production (SE

error bars) on platforms

off the coast of

California. Platforms

are ordered from south

to north Figure 1.

al. 2008; Bernstein et al. 2010; Martin and Lowe 2010; Macreadie et al. 2011; Langhamer 2012;

Fowler et al. 2014b). Fowler et al. (2014b) evaluated one of the platforms off the coast of

California (Platform Grace) as a case study of their proposed “multi-criteria decision approach”

to determine a preferred decommissioning option. During this process “production of exploitable

biomass” and “provision of reef habitat” were ranked by expert opinion as the most important

criteria in the decision for this platform. Further, they emphasize that the platform

decommissioning process is complicated and the fate of each platform should be evaluated

individually (Fowler et al. 2014a; Fowler et al. 2014b). Therefore, it is critical to understand

what makes some platforms more productive than others so that science based decisions can be

made.

INVESTIGATORY QUESTION

1. Do characteristics of a platform’s structure and its local oceanographic environment

influence the associated fish production rates?

2. How do differences in the fish assemblages on platforms (e.g., relative species

abundance, size structure, trophic categories) relate to rates of production?

MOTIVATION

With the high likelihood that the Pacific may be the first region where platforms in deeper water

are going to be decommissioned (Schroeder and Love 2004), the process in California has an

opportunity to serve as a model for decommissioning elsewhere. Although there are thousands of

platforms in the Gulf of Mexico and they are the dominant habitat type in many areas, ecological

impact assessment of these structures has been relatively limited (e.g., Stanley and Wilson 1990;

Gallaway et al. 2009; Ajemian et al. 2015) compared to those in California. This is likely due to

less controversy associated with the process in the Gulf of Mexico region, resulting in a reduced

societal need for the associated scientific information (Schroeder and Love 2004). Meanwhile,

there has been a large quantity of biological information collected about the platforms in

California (e.g., Love et al. 1999; Love et al. 2003; Schroeder and Love 2004; Love et al. 2006;

Page 4

Love et al. 2012). Therefore, it is critical that we take advantage of the available data to learn as

much as possible about these man-made reef habitats.

Our estimates of fish production on California platforms are based on visual belt-transect surveys

along the platform structure conducted by researchers in a manned research submersible where

fish density and size structure is recorded (Claisse et al. 2014). The production model converts

these data to estimates of secondary fish production per unit area of platform structure (g/m2/yr).

These production densities are then multiplied by the structural surface area (m2) to yield overall

annual rates of production for each platform (g/yr). The platforms off California are fixed to the

seafloor (as opposed to floating

platforms) with vertical pilings that

extend to the bottom (Figure 3) and

thus platforms located in deeper water

have a larger structural surface area

(Figure 5a). Since the California

platforms are located across a large

range of seafloor depths, their

submerged structural surface area

varies substantially from around

15,000 m2

to over 100,000 m2. Given

these large surface area differences,

we had originally expected that

production rates would largely be a

function of platform size, but this was

not to be the case. Production was

highly variable across platforms

(Figure 4), and there was no

significant linear relationship between

platform surface area and fish biomass

(Figure 5b; R2 = 0.09; p-value =

0.141), nor with annual fish

production (Figure 5c; R2 = 0.19; p-

value = 0.053) (Claisse et al. in

review). Platform Gail for example,

has the largest submerged surface

area in our study (106,427 m2), but

was on the lower end in terms of fish

production (Figure 4). This

unexplained variation thus creates an

opportunity to examine how

differences in structural and

environmental characteristics make

one platform more productive than

another (Claisse et al. 2014; Ajemian

et al. 2015).

Figure 5. (a) The relationship between seafloor depth and

platform submerged surface area, and the relationships

between platform submerged surface area and (b) Log10

complete platform standing stock biomass (SSB) or (c)

Log10 complete platform Total Production. Depth was

significantly related to platform surface area (R2 = 0.93; p-

value < 0.001). There was no significant linear relationship

between platform surface area and complete platform

Log10 SSB (R2 = 0.09; p-value = 0.141), nor between

platform surface area and complete platform Log10 Total

Production (R2 = 0.19; p-value = 0.053).

Page 5

Previous studies have investigated how aspects of physical reef structure and local environmental

conditions relate to various characteristics of the associated fish populations or communities.

Ajemian et al. (2015) examined how very general differences in man-made reef structure types

(e.g., standing platforms, toppled platforms, shipwrecks) relate to fish diversity metrics, but

largely found that that there was no trend in diversity as long as the structure extended at least 20

m off the bottom. An earlier study of platforms in the Gulf of Mexico looked for relationships

between fish abundance and multiple platform structural variables (e.g., number of cross

members, number of legs, volume of water enclosed). They found some weak relationships

suggesting more complex structures were positively correlated with abundances of some species,

but their primary conclusion was that the highest reef-fish abundances occurred at intermediate

depth platforms (i.e., 70-100 m) near relatively large platforms (i.e., mean volume enclosed

150,000-250,000 m2). Additional studies in California and the Gulf of Mexico have also shown a

relationship between seafloor depth and the abundance of fishes associated with platforms

(Stanley and Wilson 1990; Love et al. 2003; Wilson et al. 2006; Ajemian et al. 2015). These

studies provide background on possible factors that may explain fish production on the

California Platform, but none had the sheer volume of data we now have available (133

individual platform surveys over 15 year period, with each of the 16 platforms being surveyed

for at least 5 years).

The SCB is located in the southern portion of the California Current Ecosystem, one of the most

productive regions in the world. Importantly, the SCB is situated directly south of Pt.

Conception, where the cooler, equator-ward flowing California Current meets the relatively

warmer, poleward flowing Southern California Countercurrent. The confluence of these two

oceanographic currents marks the interface between two biogeographic provinces, each with

distinct biota and ecosystems: the Oregonian province to the north (and extending to parts of the

Channel Islands) and the San Diegan (or Californian) province to the south (Hubbs 1960; Horn

and Allen 1978; Murray and Littler 1981; Pondella et al. 2005). Love et al. (2003) described

related biogeographic patterns in platform fish species composition (relative abundance) across

part of this region. They showed a cool-temperate assemblage associated with the western Santa

Barbara Channel platforms around Point Conception, and a warm-temperate assemblage in the

eastern Santa Barbara Channel platforms. These patterns were most conspicuous in the

assemblages of fish associated with the more shallow portions of the platform structure, while

the assemblages living deeper down the platforms were more similar. Spatial differences in fish

assemblages have also been described across platforms located elsewhere in the world

(Friedlander et al. 2014; Ajemian et al. 2015). However, fish assemblage characteristics

associated with high fish production rates have yet to be examined. A better understanding of

these relationships across platforms in the SCB will provide an additional context from which to

interpret results from the platform structural and environmental characteristics analysis. Further,

this work will be a novel line of research that can inform how biogeographic differences in fish

assemblages may relate to fish production rates on natural rocky reefs and kelp forests across this

region.

Page 6

GOALS AND OBJECTIVES

Goals

1. Model the influence of platform structure and local oceanographic environment on rates

of fish production.

2. Determine fish assemblage characteristics associated with high fish production rates.

3. Interpret results in terms of making recommendations for design characteristics and

placement of man-made reef structures in southern California to maximize productivity

of fish populations.

2016-2017 Objectives

Gather and compile structural platform variables through literature review and

consultation with industry and agency experts.

Gather and compile spatially-explicit environmental and oceanographic variables for

each platform through literature review and consultation with academic and agency

experts.

Complete analyses of relationships between fish assemblage characteristics and

production rates.

Graduate student researcher training.

2017-2018 Objectives

Complete modeling of influence of platform structure and local oceanographic

environment on fish production rates.

Graduate student researcher training.

Manuscript preparation and communication of results.

METHODS

Secondary Fish Production Estimates

Secondary (i.e., heterotrophic or animal) production is the sum of new biomass from growth for

all individuals in a given area during a unit of time (Ivlev 1966; Chapman 1968). It is a main

pathway of energy flow through an ecosystem as it makes energy available to consumers,

including humans (Waters 1977; Benke 2010). Some of the original motivations for

understanding biological productivity stem from the need to estimate the annual biomass of

fishes that can be taken from a body of water (Ivlev 1966). Estimates of secondary fish

production on platforms will be obtained using a model we have previously developed and

published (for a detailed description of the model see Claisse et al. 2014). Annual secondary

production of individual focal species and for the observed fish community as a whole will be

calculated based on density and size structure data of fishes from visual survey data.

The densities and size structure of fishes on platforms were obtained from annual visual surveys

conducted during daylight hours in the fall between September and November using the manned

Delta research submersible from 1995 through 2009 and the Dual Deepworker from 2010

through 2011. A researcher aboard identified, counted and estimated the total length (TL; to the

nearest 5 cm) of all fishes along 2 m wide belt transects. These data are available for download

here: www.lovelab.id.ucsb.edu/platform_databse.html. Since different subsets of platforms were

surveyed each year, we will use data from the 16 platforms (Figure 1) that had been surveyed for

Page 7

at least 5 years, many of which have been surveyed for 10 to 15 years. This provides annual

densities (fish/m2) at each platform for each 5 cm size class in each taxon. Transient, highly

mobile species (e.g., Jack Mackerel, Trachurus symmetricus, Pacific Sardine, Sardinops sagax)

are excluded from the data set. These species are unlikely to reside at the platforms for very long,

let alone for the 1 year time interval over which production is calculated.

Our model defines Total Production of the fish community as the sum of two components. The

first being “Somatic Production,” which is the difference between the observed biomass during

surveys and the biomass predicted one year later for all species observed. The size- and species-

specific one year increase in fish length is predicted using the Fabens version of the von

Bertalanffy growth function (Haddon 2011), a standard method for modeling fish growth rates.

Observed fish lengths are converted to biomass using species-specific weight-at-length and

(when necessary) length-length conversion relationships from the literature (see Table S3 in

Claisse et al. 2014). The production from fishes that do not survive the one-year time interval are

not included in the production estimate. Annual survivorship rates are incorporated in the model

using the size- and species-specific mortality function described in reference (Gislason et al.

2010). The second component of Total Production is “Recruitment Production” which estimates

production from the growth of post larval and pelagic juvenile fishes that settled or immigrated

and survived during the one year time interval (following Kamimura et al. 2011).

Platform Structural and Environmental Characteristics

An initial major objective is to compile a database of quantitative and categorical characteristics

for each platform that may explain variability in fish production rates. Platform structural and

environmental variables will be determined through literature review and consultation with

agency (e.g., U.S. Bureau of Ocean Energy Management), industry, and academic experts. These

will include characteristics that may potentially enhance fish recruitment, growth and/or survival;

life history components, which ultimately are directly related to rates of production. Spatially-

explicit estimates of local environmental and oceanographic characteristics for each platform

will be compiled from remote sensing data sources and other oceanographic modeling products.

We have developed a preliminary list of potential variables to be compiled based in an initial

literature review performed during proposal development (MBC 1987; Stanley and Wilson 1990;

Love et al. 2003; Strelcheck et al. 2005; Love and York 2006; Wilson et al. 2006; Caselle et al.

2010; Langhamer 2012; Love et al. 2012; Friedlander et al. 2014; Granneman and Steele 2014;

Ajemian et al. 2015):

Sea floor depth

Submerged structural surface area

Water volume enclosed within structure

Structure age

Number of vertical pilings

Number of horizontal crossbeams

Platform base footprint area

Distance to nearest platform

Distance to nearest large natural rocky reef

Distance to coastline

Seafloor substrate type (including biogenic reef habitat created by falling bivalve shells)

Mean sea surface temperature (MODIS remote sensing derived, http://spg.ucsd.edu/Satellite_Data/)

Page 8

Mean sea surface chlorophyll-a (MODIS remote sensing derived, http://spg.ucsd.edu/Satellite_Data/)

Spatial upwelling indices (e.g., Ekman transport index based on wind velocities,

http://rda.ucar.edu/)

Preliminary discussions with experts have revealed additional more nuanced structural

characteristics which may explain production differences. For example, platform Eureka has the

highest Total Production (Figure 4). While this is one of the larger platforms in our proposed

study, with the 2nd

highest submerged surface area (103,268 m2), it also has crossbeams that are

formed of flattened shelves and large three-dimensional sleeves, creating a very large expanse of

complex habitat. By comparison, other California platforms are composed of rounded and

cylindrical cross beams which form a simpler habitat (Milton Love, pers. comm.). We will

develop protocols for quantifying or categorizing these types of characteristics as additional

potential explanatory variables.

Data Analysis

To determine what set of platform structural and environmental factors best explain the

variability in secondary fish production rates we will use a general linear modeling approach

using Akaike’s Information Criterion (AIC) based model selection (Burnham and Anderson

2002). This will involve developing a set of alternative candidate models using combinations of

the previously described explanatory variables based on preliminary analysis (e.g., evidence of

co-linearity) and plausibility via literature review and expert opinion. The response variables for

these analyses will be platform-specific mean production rates (averaged across annual

replicates). The focus here is on spatial, rather than temporal (year-to-year) variability because

the desired outcome is insight into what drives production over the long-term on both natural and

man-made reefs, with results being applied to the design and placement of man-made reefs that

are likely to remain in place for decades. While high interannual variability in rockfish

recruitment is well documented (Wilson et al. 2008; Love et al. 2012), the high rates of fish

production on these platforms ultimately result from both high levels of larval/juvenile

settlement (Recruitment Production) (Figure 6) and their subsequent growth (Somatic

Production). If a strong year class persists (e.g., Love et al. 2006), it will make the most

substantial contribution to the Somatic Production component over the subsequent years, when a

given species reaches intermediate lengths. Platforms that more consistently have higher rates of

recruitment and survival will tend to have higher production over the long-term. Therefore,

explanatory variables will be long-term means of environmental variables and static structural

characteristics. Long-term data sets are extremely important to estimate production, an idea that

has often been mentioned in the context of estimating the productive potential of artificial

habitats (Grossman et al. 1997; Pitcher and Seaman Jr 2000; Langhamer 2012; Reubens et al.

2014), and that is one of the great benefits of the California platform survey data available with

many sites having 10-15 years of data.

Page 9

Figure 6. Young-of-the-year Bocaccio, Sebastes paucispinis, observed in high densities in the midwater

platform habitats of Platform Gilda. Photo credit: Scott Gietler.

Multivariate analysis approaches will be used to determine what fish assemblage characteristics

are associated with high fish production rates. A series of analyses will be run using different

response variables within a multivariate assemblage matrix. While there are inherent

biogeographic differences in the fish communities across the SCB (Love et al. 2003; Pondella et

al. 2005), productive platforms occur in each part of the region (Figure 1, 4). We thus want to

investigate whether (1) high production is driven by different cold- or warm-water associated

fishes across the region, or (2) if the same suite of species is characteristic of highly productive

platforms regardless of where they occur and it is other species (with lower productivity) that

define the previously described (abundance related) biogeographic differences. We will also look

at additional assemblage characteristics beyond the standard density of each species at each site.

These will include the taxa-independent size structure (i.e., density of individuals per size-class),

and density of fishes in distinct trophic groups (e.g., planktivorous, piscivores, herbivores, and

invertivores) (e.g., Friedlander et al. 2014). Fish size is clearly related to individual annual

production rates (Claisse et al. 2014). If there are dominate trophic categories, then this could be

particularly informative in terms of what benefit the platform structure may be providing to the

associated fishes. For each analysis, a similarity matrix will be constructed using square-root

transformed density and the Bray-Curtis similarity coefficient. We will use a relatively weak

transformation (square-root as compared to 4th

root or log transformations) because our focus is

on density differences in these metrics rather than just presence or absence (which is emphasized

with stronger transformations). Two-dimensional, non-metric multidimensional scaling (nMDS)

will be used to examine patterns among communities at platforms using the ‘metaMDS’ function

Page 10

in the ‘vegan’ package (Oksanen et al. 2013) in R (R Core Team 2013). This will be followed by

testing for significant differences amongst platforms with high, medium and low production

using the ‘adonis’ PERMANOVA function and testing for homogeneity of multivariate

dispersions with the ‘betadisper’ function, both functions from the ‘vegan’ package (Oksanen et

al. 2013). Characteristic species, size classes and tropic groups can then identified using

similarity percentage breakdown analyses (SIMPER) (Clarke 1993). Understanding the patterns

in assemblage characteristics that differentiate production across platforms will provide much

needed context for interpreting the results of the univariate analyses relating production rates to

structural and environmental characteristics.

RELATED RESEARCH

We have performed multiple related studies that investigate the influence of habitat quality on

fish biomass and production. For a previously funded (2012-2014) USC Sea Grant study (“The

ecosystem impacts of kelp forest habitat restoration, including important fishery species”) we

evaluated potential effects of kelp forest habitat restoration (i.e., targeted urchin removals) by

comparing differences among urchin barren sites, kelp forest sites and sites adjacent to urchin

barrens. Using a comprehensive monitoring protocol (e.g., fishes, invertebrates, algae, benthic

cover and habitat characteristics) we found significant community level differences among

urchin barrens and kelp forests for fishes, invertebrates, kelps and benthic cover. In some cases

these reflected negative impacts of urchin barrens on important fishery species (e.g., lobster and

Kelp Bass) which extended beyond the urchin barrens into adjacent kelp forest habitat. The lack

of macroalgal food resources in barrens also resulted in reduced gonad production in the

commercially fished red urchin (S. franciscanus), which are taken for their gonads that are eaten

as “uni” sushi. We produced a model demonstrating that the restoration of an urchin barren to a

kelp forest could potentially yield a 900% increase in red urchin gonad biomass available to the

fishery per unit area restored (Claisse et al. 2013). The results of this research have provided

additional support for the potential outcomes of large scale habitat restoration which is now

being performed (started in July 2013) along the Palos Verdes Peninsula. When taking an

ecosystem-based approach to marine resource management, managers may be able to implement

a combination of management tools in order to mitigate the socioeconomic impacts of

implementing any one in isolation, while providing greater overall ecological benefits. Kelp

restoration has the potential to play a valuable role as one of many integrated tools in an

ecosystem-based management approach.

In collaboration with Milton Love’s lab at UCSB, and with Bureau of Ocean Energy

Management (BOEM) funding (Agreement Number M12AC00003 FY 2012 - “Biological

Productivity of Fish Associated with Offshore Oil and Gas Structures on the Pacific OCS”), we

developed a model of fish production using previously collected density and size structure data

of fishes residing on offshore platforms (e.g., Claisse et al. 2014). This involved writing R code

(R Core Team 2013) to integrate the Love Lab’s database of over 15 years of visual surveys of

fish populations on platforms. This project demonstrated that the secondary production of fishes

on these platform habitats is the highest of any marine habitat that has been studied, about an

order of magnitude higher than fish communities from other marine ecosystems. Additionally,

we found high variability in fish production rates among platforms creating an opportunity to

explore what drives these differences. Further, the most likely explanatory variable, platform size

Page 11

(or structural surface area) was not significantly related to differences in production rates across

platforms.

We recently were notified that we have been awarded a grant from the Saltonstall-Kennedy (SK)

NOAA-NMFS Program for a complementary project to the one proposed here, looking at the

current and potential contribution of man-made reef habitats to fisheries resources and protected

species recovery in southern California. This project takes a broader look at the overall

contribution of man-made reefs in the southern California region focusing on nearshore rocky

reef structures, and will provide a complementary background to the proposed project, which

will take a fine scale look at the fish production on the platforms where we have a more

extensive amount of data. The SK project will be accomplished by mapping and quantifying the

current extent of all natural and man-made nearshore reef habitats and the associated fishery

resources (organismal biomass) on shallow reefs throughout the SCB. It will also include a piece

on predictive species distribution mapping to identify areas within the SCB where man-made

habitat could host important fishery or protected species and the greatest diversity of organisms.

NOAA’s Montrose Settlements Restoration Program (MSRP) was established to restore injured

resources and lost services resulting from the discharge of DDT and PCBs into southern

California ocean waters. The Portuguese Bend landslide began in the late 1950’s, releasing large

amounts of sediments to the ocean between Whites Point and Abalone Cove and covering a large

section of rocky reef habitat. Despite this source of sedimentation, productive rocky reef and

kelp forest habitat extended well offshore and downshore towards Whites Point as recently as the

late 1980’s. In the early 1990’s there were patches of buried reef adjacent to Portuguese Bend

but this burial did not extend to the southeast. On June 2, 1999, a massive landslide occurred

involving 17 acres near the Trump National Golf Course. This landslide is likely to be a major

contributor to the large area of buried reef that is now observe in this region. Recent mapping has

shown a significant amount of buried reef in this area shallower than 20 m. In 2010 and 2011, we

surveyed the entire area (Palos Verdes Point to Whites Point), conducting extensive biological

and sediment surveys. These surveys identified roughly 250 acres of impacted (buried) reef

habitat for which restoration was feasible. As a result, the MSRP has included a project entitled

“Subtidal Reef Restoration at Bunker Point Palos Verdes” in their Phase 2 Restoration Plan. We

are currently collaborating with NOAA and MSRP to restore 60 acres of rocky reef habitat on

the Palos Verdes Shelf. This will be one of the largest subtidal restorations projects ever

completed in Southern California, and will provide crucial insights into how to move this reefing

technology forward. This involves the development of high relief man-made rocky reef modules

to increase local fish production and mitigate the effects of sedimentation. Results of the

proposed project will provide additional scientific information to draw from to optimize the reef

design.

BUDGET-RELATED INFORMATION

A. Budget Explanation/Detailed Justification

The following justification corresponds to each line in the actual budget (see budget spreadsheet

section below for dollar values):

Page 12

A.1.a. Claisse (Cal Poly Pomona) will contribute 3 months of effort per year (2 months Sea

Grants Funds, 1 month Cal Poly Pomona Matching) working on all aspects of the project

including mentoring and training of the requested graduate trainee.

Pondella (Occidental College) will contribute 1 month of effort per year (Occidental College

Matching) working on model development, results interpretation, and written deliverables.

B. Fringe benefits are calculated for Claisse at 13% (requested summer salary) and at 39.8%

(annual year matching), and for Pondella at 19.8% (yr 1) and 20.2% (yr 2) (annual year

matching).

E. We request $2,000 per year for Claisse and/or the graduate trainee to present research results

at a domestic scientific conference, including conference fees, airfare, hotel and per diem based

on Cal Poly Pomona travel guidelines.

Cal Poly Pomona’s IC rate is 45% and Occidental College’s IC rate is 41%.

B. Matching Funds

$26,806 in year 1 (90%) and $27,673 in year 2 (90%) will be provided in matching funds. This

includes $31,144 that will be provided from Occidental College to cover 2 months of salary,

fringe benefits and uncollected IDC for Pondella’s contribution to the project with model

development, results interpretation, and written deliverables. This also includes $23,335 that will

be provided from Cal Poly Pomona to cover an additional 2 months of salary and fringe benefits

for Claisse’s contribution to all aspects of the project.

ANTICIPATED BENEFITS

Understanding which structural characteristics and local environmental conditions are associated

with increased fish productivity will provide insight into what drives high rates of production for

both natural and man-made reef habitats in the SCB. Results will apply to USC Sea Grant

Themes “Healthy Coastal Ecosystems” and “Safe and Sustainable Seafood”, and the WCGA

Action Plan concentration on ocean energy. This will aid in the design and policy related to the

deployment of new man-made structures in the marine environment and in determining the

potential biological impacts of platform decommissioning options. More focused research on

what determines the productivity of individual platforms will help ensure that specified criteria

can be properly evaluated during the decommissioning process associated with Bill AB 2503

(the California Marine Resources Legacy Act). More broadly, results will support state and

federal agency evaluation of projects that will restore or create additional fishing opportunities,

either directly through creation of new man-made rocky fishing reefs or indirectly through

construction of habitable structures used for energy generation, or other infrastructure projects.

Project funding will also support the training of one Cal Poly Pomona graduate student per year

in database management, modeling, and statistics. They will also receive practical networking

experience interacting agency and industry experts while taking the lead on the effort to gather

and compile structural platform variables to be used in the analysis. The student will be

encouraged to develop a master’s thesis which overlaps with and expands on these projects

Page 13

goals, be directly involved in outreach efforts, and present research results at appropriate venues

(e.g. annual meetings of the Western Society of Naturalists, the Southern California Academy of

Sciences Annual Meetings).

Additionally the results of this project will have specific direct benefits for multiple

organizations:

The U.S. Bureau of Ocean Energy Management (BOEM) has responsibilities associated with

environmental impacts of offshore platforms and new offshore renewable energy programs. Our

results will be critical to their evaluation of the fisheries value of these structures, informing

policy related to the decommissioning of existing platforms and implementation of emerging

(e.g., wind, marine hydrokinetic) energy technologies. Evaluating the characteristics of

individual platform structures on fish productivity will represent important considerations during

the decommissioning process associated with Bill AB 2503 The California Marine Resources

Legacy Act (see attached letter of support).

The proposed project is well aligned with (and supported by) the goals of the United Anglers and

The Sportfishing Conservancy, major recreational fisher organizations dedicated to the

enhancement of fishery resources through management, conservation, and education in order to

maximize angling opportunities and pass the sport of fishing on to future generations. Given the

habitat area that has been lost with the recent expansion of MPAs throughout the state, they feel

there is “a pressing need for more research on the value of man-made habitat” to explore the

potential of these active management approaches to conserve resources and create new and/or

improved fishing opportunities with a variety of habitat restoration projects. Creating more

informed stakeholders will facilitate their constructive involvement in this process, and help to

better calibrate their expectations (see attached letters of support).

The Southern California Coastal Water Research Project’s (http://www.sccwrp.org) is a public

agency, whose mission is to provide unbiased science to the environmental policy decision

makers of the region so they can better steward our natural resources. Their member agencies

include the largest water quality regulated agencies, including wastewater and stormwater

dischargers, and their regulatory counterparts, such as the State of California, the US

Environmental Protection Agency, and the California Ocean Protection Council. This research is

of particular interest to their member agencies, including the Ocean Protection Council, who

make policy and management decisions related to decommissioning options for the platforms off

our coastline, the design and deployment of offshore renewable energy generation structures, and

the building of man-made rocky reef habitat as a fishery restoration tool (see attached letter of

support).

The Ocean Science Trust is a 501(c)3 public benefit corporation that exists by California statute

to support the state’s challenging ocean resource management and policy decisions with sound

science provided by transparent processes. The proposed research fits within a larger effort to

understand how to optimize the fishery and conservation benefits of man-made structures off our

coastline and thus sits at the interface of science, marine resource management, economics and

thoughtful policy – all priorities for California (see attached letter of support).

Page 14

One of the most prominent aspects of The Bay Foundation’s (TBF) mission is to restore Santa

Monica Bay and its adjacent waters to benefit nearshore recreational and commercial fisheries

which contribute millions of dollars to the local coastal economies and support working

waterfronts. The results of this proposal will aid in their ability to inform the implementation and

design of man-made reef construction to benefit fisheries, filling critical gaps in their current

knowledge (see attached letter of support).

The AltaSea project www.altasea.org is a collaboration between science, business, and education

to generate innovative solutions to the global challenges of sustainability. They are currently

developing a 28-acre campus in the Port of Los Angeles, located at the epicenter of the urban

ocean in southern California. The proposed project is directly aligned with their goal to develop

science-based solutions to enhance our marine ecosystems while developing renewable energy

resources for our region (see attached letter of support).

The California Artificial Reef Enhancement Program (CARE) is a non-profit organization

focused on promoting awareness and understanding of platforms as habitats for marine life. They

have helped organize public outreach events including the 2012 Rigs to Reefs conference in

Huntington Beach hosted by Orange County Coastkeeper (see attached letter of support).

COMMUNICATION OF RESULTS

Results will be communicated promptly through formal and informal channels to address

ongoing management efforts. Ongoing collaboration with scientists and stakeholders at the

NOAA Restoration Center and the NMFS Southwest Regional Office Protected Resources

Division, the Sanitation Districts of Los Angeles County, The Bay Foundation (TBF), and

recreational fishers from United Anglers of Southern California offer multiple such

opportunities. Project reports will also be distributed to The Bay Foundation (TBF) board

members. The membership of the TBF governing board includes numerous local, state and

federal agencies and elected officials. Other opportunities to share information include technical

meetings with members of the NOAA Restoration Center, Montrose Settlements Restoration

Program, the Southern California Coastal Water Research Project (SCCWRP), the Southern

California Marine Institute (SCMI) and the AltaSea development project. Dr. Pondella is the

Director of SCMI which is currently in the processes of redeveloping its marine lab as part of the

AltaSea project (http://www.altasea.org/about.html). AltaSea is a collaboration between

research, education, industry and community entities to create a 28-acre campus in the Port of

Los Angeles to collaborate on innovative solutions in an urban ocean.

We will make presentations of results to audiences of interested stakeholders and citizens in

southern California that we already have existing relationships with (e.g., United Anglers of

Southern California, Reef Check California). The California Artificial Reef Enhancement

(CARE) Program and the Orange County Coastkeepers are also planning on co-sponsoring a

one-day Rigs-to-Reefs Conference. They plan to bring together representatives from multiple

management agencies (e.g., Fish and Wildlife Commission, State Lands Commission, California

Coastal Commission, Ocean Protection Council, Pacific Fisheries Management Council)

providing an ideal venue to communicate research results. Public presentations will focus on the

contribution of existing man-made reefs to the recreational and commercial fishing resources in

Page 15

the region and likely impacts associated with implementation of new man-made reefs in their

many forms (e.g., rocky reefs, structures associated with energy generation).

We also expect to publish our findings widely in the scientific research and management

literature, and present results at regional and national scientific conferences (e.g., Association for

the Sciences of Limnology & Oceanography, American Society of Ichthyologists and

Herpetologists, Ecological Society of America). The Cal Poly Pomona graduate student working

on the project will be directly involved in outreach efforts, and present research results at

appropriate venues (e.g. annual meetings of the Western Society of Naturalists, the Southern

California Academy of Sciences Annual Meetings). Media will be contacted to encourage press

coverage of the project results. USC Sea Grant support for the project will be acknowledged in

all published manuscripts and public presentations of project results.

REFERENCES

Ajemian MJ, Wetz JJ, Shipley-Lozano B, Shively JD, Stunz GW (2015) An Analysis of

Artificial Reef Fish Community Structure along the Northwestern Gulf of Mexico Shelf:

Potential Impacts of "Rigs-to-Reefs" Programs. PLoS One 10: e0126354 doi

10.1371/journal.pone.0126354

Ambrose RF, Swarbrick SL (1989) Comparison of Fish Assemblages on Artificial and Natural

Reefs off the Coast of Southern California. Bull Mar Sci 44: 718-733

Benke AC (2010) Secondary production as part of bioenergetic theory—contributions from

freshwater benthic science. River Res Appl 26: 36-44 doi 10.1002/rra.1290

Bernstein B, Bressler A, Cantle P, Henrion M, John D, Kruse S, Pondella D, Scholz A, Setnicka

T, Swamy S (2010) Evaluating alternatives for decommissioning California's offshore oil

and gas platforms. California Ocean Science Trust, Oakland, CA. Available from:

http://www.calost.org/reports/Decommissioning_Report_Full.pdf

Bond AB, Stephens JS, Pondella DJ, Allen JM, Helvey M (1999) A Method for Estimating

Marine Habitat Values Based on Fish Guilds, with Comparisons Between Sites in the

Southern California Bight. Bull Mar Sci 64: 219-242

Bull A, Love MS, Schroeder DM (2008) Artificial reefs as fishery conservation tools:

Contrasting the roles of offshore structures between the Gulf of Mexico and the Southern

California Bight. Am Fish Soc Symp 49: 899-915

Burnham KP, Anderson DR (2002) Model selection and multimodel inference, a practical

information-theoretic approach. Springer Science + Business Media, LLC, New York,

New York, USA

California MLPA Initiative (2009) Regional Profile of the MLPA South Coast Study Region

(Point Conception to the California-Mexico Border). California Marine Life Protection

Act Initiative, Sacramento, California. http://www.dfg.ca.gov/mlpa

Page 16

Caselle JE, Kinlan BP, Warner RR (2010) Temporal and spatial scales of influence on nearshore

fish settlement in the Southern California Bight. Bull Mar Sci 86: 355-385

CDFW (2001) A guide to the artificial reefs of southern California. State of California, The

Resources Agency, Department of Fish and Wildlife, USA. (The original 1989 guide by

R.D. Lewis and K.K. McKee, updated in 2001 by D. Bedford)

http://www.dfg.ca.gov/marine/artificialreefs.asp

Chapman DW (1968) Production. In: Ricker WE (ed) Methods for assessment of fish production

in fresh waters. Blackwell Scientific Publications, Oxford, pp 182-196

Claisse JT, Pondella DJ, Love M, Zahn LA, Williams CM, Bull AS (in review) Impacts from

partial removal of decommissioned oil and gas platforms on fish biomass and production

on the remaining platform structure and surrounding shell mounds

Claisse JT, Pondella DJ, Love M, Zahn LA, Williams CM, Williams JP, Bull AS (2014) Oil

platforms off California are among the most productive marine fish habitats globally.

Proceedings of the National Academy of Sciences 111: 15462-15467 doi

10.1073/pnas.1411477111

Claisse JT, Williams JP, Ford T, Pondella DJ, Meux B, Protopapadakis L (2013) Kelp forest

habitat restoration has the potential to increase sea urchin gonad biomass. Ecosphere 4:

art38 doi 10.1890/ES12-00408.1

Clarke KR (1993) Non-parametric multivariate analyses of changes in community structure.

Aust J Ecol 18: 117-143 doi 10.1111/j.1442-9993.1993.tb00438.x

DeMartini EE, Barnett AM, Johnson TD, Ambrose RF (1994) Growth and Production Estimates

for Biomass-Dominant Fishes on a Southern California Artificial Reef. Bull Mar Sci 55:

484-500

Dojiri M, Yamaguchi M, Weisberg SB, Lee HJ (2003) Changing anthropogenic influence on the

Santa Monica Bay watershed. Mar Environ Res 56: 1-14 doi 10.1016/s0141-

1136(03)00003-5

Erisman BE, Allen LG, Claisse JT, Pondella DJ, Miller EF, Murray JH, Walters C (2011) The

illusion of plenty: hyperstability masks collapses in two recreational fisheries that target

fish spawning aggregations. Can J Fish Aquat Sci 68: 1705-1716 doi 10.1139/f2011-090

Foster MS, Schiel DR (2010) Loss of predators and the collapse of southern California kelp

forests (?): Alternatives, explanations and generalizations. J Exp Mar Biol Ecol 393: 59-

70 doi 10.1016/j.jembe.2010.07.002

Fowler AM, Macreadie PI, Booth DJ (2014a) Should we “reef” obsolete oil platforms?

Proceedings of the National Academy of Sciences doi 10.1073/pnas.1422274112

Page 17

Fowler AM, Macreadie PI, Jones DOB, Booth DJ (2014b) A multi-criteria decision approach to

decommissioning of offshore oil and gas infrastructure. Ocean Coast Manage 87: 20-29

doi 10.1016/j.ocecoaman.2013.10.019

Friedlander AM, Ballesteros E, Fay M, Sala E (2014) Marine communities on oil platforms in

Gabon, west Africa: high biodiversity oases in a low biodiversity environment. PLoS One

9: e103709 doi 10.1371/journal.pone.0103709

Froeschke JT, Allen LG, Pondella DJ (2005) The Reef Fish Assemblage of the Outer Los

Angeles Federal Breakwater, 2002–2003. Bull South Calif Acad Sci 104: 63-74 doi

10.3160/0038-3872(2005)104[63:TRFAOT]2.0.CO;2

Froeschke JT, Pondella DJ (2007) Long-term Monitoring of Fishes on an Artificial Fishing Reef:

A Final Report to the Port of Los Angeles. 46 p.

Gallaway BJ, Szedlmayer ST, Gazey WJ (2009) A Life History Review for Red Snapper in the

Gulf of Mexico with an Evaluation of the Importance of Offshore Petroleum Platforms

and Other Artificial Reefs. Reviews in Fisheries Science 17: 48-67 doi

10.1080/10641260802160717

Gislason H, Daan N, Rice JC, Pope JG (2010) Size, growth, temperature and the natural

mortality of marine fish. Fish Fish 11: 149-158 doi 10.1111/j.1467-2979.2009.00350.x

Goodsell PJ, Chapman MG (2009) Rehabilitation of Habitat and the Value of Artificial Reefs.

In: Wahl M (ed) Marine Hard Bottom Communities. Springer Berlin Heidelberg, pp 333-

344

Granneman JE, Steele MA (2014) Fish growth, reproduction, and tissue production on artificial

reefs relative to natural reefs. ICES J Mar Sci doi 10.1093/icesjms/fsu082

Grossman GD, Jones GP, Seaman WJ (1997) Do artificial reefs increase regional fish

production? A review of existing data. Fisheries 22: 17-23 doi 10.1577/1548-

8446(1997)022<0017:darirf>2.0.co;2

Haddon M (2011) Modeling and quantitative methods in fisheries. Second edition. Chapman &

Hall / CRC, Boca Raton, Florida, USA

Helvey M (2002) Are southern California oil and gas platforms essential fish habitat? ICES J

Mar Sci 59: S266-S271 doi 10.1006/jmsc.2002.1226

Hoegh-Guldberg O, Bruno JF (2010) The impact of climate change on the world’s marine

ecosystems. Science 328: 1523-1528 doi 10.1126/science.1189930

Holbrook SJ, Ambrose RF, Botsford L, Carr MH, Raimondi PT, Tegner MJ (2000) Ecological

issues related to decommissioning of California’s offshore production platforms. Report

to the Univiersity of California Marine Council by the select Scientific Advisory

Committee on Decommissioning.

www.coastalresearchcenter.ucsb.edu/cmi/files/decommreport.pdf: 1-41

Page 18

Horn MH, Allen LG (1978) A distributional analysis of California coastal marine fishes. Journal

of Biogeography 5: 23-42

Hubbs CL (1960) The marine vertebrates of the outer coast. Systematic Zoology 9: 134-147

Ivlev VS (1966) The biological productivity of waters. J Fish Res Board Can 23: 1727-1759

Johnson TD, Barnett AM, DeMartini EE, Craft LL, Ambrose RF, Purcell LJ (1994) Fish

production and habitat utilization on a southern California artificial reef. Bull Mar Sci 55:

709-723

Kamimura Y, Kasai A, Shoji J (2011) Production and prey source of juvenile black rockfish

Sebastes cheni in a seagrass and macroalgal bed in the Seto Inland Sea, Japan: estimation

of the economic value of a nursery. Aquat Ecol 45: 367-376 doi 10.1007/s10452-011-

9360-1

Langhamer O (2012) Artificial reef effect in relation to offshore renewable energy conversion:

state of the art. ScientificWorldJournal 2012: 1-8 doi 10.1100/2012/386713

Love MS (2006) Subsistence, commercial, and recreational fisheries. In: Allen LG, Pondella DJ,

Horn MH (eds) The ecology of marine fishes: California and adjacent waters. University

of California Press, Berkeley, California, USA, pp 567-594

Love MS, Caselle J, Snook L (1999) Fish assemblages on mussel mounds surrounding seven oil

platforms in the Santa Barbara Channel and Santa Maria Basin. Bull Mar Sci 65: 497-513

Love MS, Caselle JE, Snook L (2000) Fish assemblages around seven oil platforms in the Santa

Barbara Channel area Fish Bull 98: 96-117

Love MS, Nishimoto M, Clark S, Schroeder DM (2012) Recruitment of young-of-the-year fishes

to natural and artificial offshore structure within central and southern California waters,

2008–2010. Bull Mar Sci 88: 863-882 doi 10.5343/bms.2011.1101

Love MS, Schroeder DM, Lenarz W, MacCall A, Bull AS, Thorsteinson L (2006) Potential use

of offshore marine structures in rebuilding an overfished rockfish species, bocaccio

(Sebastes paucispinis). Fish Bull 104: 383-390

Love MS, Schroeder DM, Nishimoto MM (2003) The ecological role of oil and gas production

platforms and natural outcrops on fishes in southern and central California: a synthesis of

information. U. S. Department of the Interior, U. S. Geological Survey, Biological

Resources Division, Seattle, Washington, 98104, OCS Study MMS 2003-032.

Love MS, York A (2006) The relationship between fish assemblages and the amount of bottom

horizontal beam exposed at California oil platforms: fish habitat preferences at man-made

platforms and (by inference) at natural reefs. Fish Bull 104: 542-549

Macreadie PI, Fowler AM, Booth DJ (2011) Rigs-to-reefs: will the deep sea benefit from

artificial habitat? Front Ecol Environ: 110324084539019 doi 10.1890/100112

Page 19

Martin C, Lowe C (2010) Assemblage structure of fish at offshore petroleum platforms on the

San Pedro Shelf of southern California. Mar Coast Fish 2: 180-194 doi 10.1577/c09-

037.1

MBC (1987) Ecology of oil/gas platforms offshore California. OCS Study MMS 86-0094. U.S.

Department of the Interior, Minerals Management Service, Pacific OCS Region.: 1-92

Mora C, Aburto-Oropeza O, Ayala Bocos A, Ayotte PM, Banks S, Bauman AG, Beger M,

Bessudo S, Booth DJ, Brokovich E, Brooks A, Chabanet P, Cinner JE, Cortes J, Cruz-

Motta JJ, Cupul Magana A, Demartini EE, Edgar GJ, Feary DA, Ferse SC, Friedlander

AM, Gaston KJ, Gough C, Graham NA, Green A, Guzman H, Hardt M, Kulbicki M,

Letourneur Y, Lopez Perez A, Loreau M, Loya Y, Martinez C, Mascarenas-Osorio I,

Morove T, Nadon MO, Nakamura Y, Paredes G, Polunin NV, Pratchett MS, Reyes

Bonilla H, Rivera F, Sala E, Sandin SA, Soler G, Stuart-Smith R, Tessier E, Tittensor

DP, Tupper M, Usseglio P, Vigliola L, Wantiez L, Williams I, Wilson SK, Zapata FA

(2011) Global human footprint on the linkage between biodiversity and ecosystem

functioning in reef fishes. PLoS Biol 9: e1000606 doi 10.1371/journal.pbio.1000606

Murray SN, Littler MM (1981) Biogeographical analysis of intertidal macrophyte floras of

southern California. Journal of Biogeography 8: 339-351

Nelson PA, Behrens D, Castle J, Crawford G, Gaddam RN, Hackett SC, Largier J, Lohse DP,

Mills KL, Raimondi PT, Robart M, Sydeman WJ, Thompson SA, Woo S (2008)

Developing wave energy in coastal California: potential socio-economic and

environmental effects. California Energy Commission, PIER Energy-Related

Environmental Research Program & California Ocean Protection Council CEC-500-

2008-083

Parente V, Ferreira D, Moutinho dos Santos E, Luczynski E (2006) Offshore decommissioning

issues: Deductibility and transferability. Energ Policy 34: 1992-2001 doi

http://dx.doi.org/10.1016/j.enpol.2005.02.008

Patton ML, Grove RS, Harman RF (1985) What do natural reefs tell us about designing artificial

reefs in southern California? Bull Mar Sci 37: 279-298

Pitcher TJ, Seaman Jr W (2000) Petrarch’s Principle: how protected human-made reefs can help

the reconstruction of fisheries and marine ecosystems. Fish Fish 1: 73-81 doi

10.1046/j.1467-2979.2000.00010.x

Pondella D, II (2009) Science Based Regulation: California’s Marine Protected Areas. Urban

Coast 1: 33-36

Pondella D, Williams J, Claisse J, Schaffner R, Ritter K, Schiff K (2011) Southern California

Bight 2008 Regional Monitoring Program: Volume V. Rocky Reefs. Southern California

Coastal Water Research Project, Costa Mesa, CA. 92p.

Pondella DJ, Allen LG, Craig MT, Gintert B (2006) Evaluation of Eelgrass Mitigation and

Fishery Enhancement Structures in San Diego Bay, California. Bull Mar Sci 78: 115-131

Page 20

Pondella DJ, Gintert BE, Cobb JR, Allen LG (2005) Biogeography of the nearshore rocky-reef

fishes at the southern and Baja California islands. Journal of Biogeography 32: 187-201

Pondella DJ, II, Stephens JS, Jr, Craig MT (2002) Fish production of a temperate artificial reef

based on the density of embiotocids (Teleostei: Perciformes). ICES J Mar Sci 59: S88-93

doi 10.1006/jmsc.2002.1219

Pondella DJ, Stephens Jr JS (1994) Factors affecting the abundance of juvenile fish species on a

temperate artificial reef. Bull Mar Sci 55: 1216-1223

R Core Team (2013) R: A language and environment for statistical computing. R Foundation for

Statistical Computing. Vienna, Austria. http://www.R-project.org

Reed DC, Schroeter SC, Huang D, Anderson TW, Ambrose RF (2006) Quantitative assessment

of different artificial reef designs in mitigating losses to kelp forest fishes. Bull Mar Sci

78: 133-150

Reubens JT, Degraer S, Vincx M (2014) The ecology of benthopelagic fishes at offshore wind

farms: a synthesis of 4 years of research. Hydrobiologia 727: 121-136 doi

10.1007/s10750-013-1793-1

Schiff K (2003) Impacts of stormwater discharges on the nearshore benthic environment of Santa

Monica Bay. Mar Environ Res 56: 225-243 doi 10.1016/s0141-1136(02)00332-x

Schroeder D, Love MS (2004) Ecological and political issues surrounding decommissioning of

offshore oil facilities in the Southern California Bight. Ocean Coast Manage 47: 21-48

doi 10.1016/j.ocecoaman.2004.03.002

Sikich S, James K (2010) Averting the scourge of the seas: Local and state efforts to prevent

plastic marine pollution. Urban Coast 1: 35-39

Stanley D, Wilson C (1990) Factors affecting the abundance of selected fishes near oil and gas

platforms in the northern Gulf of Mexico. Fish Bull 89

Stephens JS, Larson RJ, Pondella DJ (2006) Rocky reefs and kelp beds. In: Allen LG, Pondella

DJ, Horn MH (eds) The ecology of marine fishes. University of California Press, Los

Angeles, CA, USA

Strelcheck AJ, Cowan JH, Shah A (2005) Influence of reef location on artificial-reef fish

assemblages in the northcentral Gulf of Mexico. Bull Mar Sci 77: 425-440

Stull JK, Dryden KA, Gregory PA (1987) A historical review of fisheries statistics and

environmental and societal influences off the Palos Verdes Peninsula, California.

CalCOFI Reports 28: 135-154

Tetreault I, Ambrose RF (2007) Temperate marine reserves enhance targeted but not untargeted

fishes in multiple no-take MPAs. Ecol Appl 17: 2251-2267

Page 21

Waters TF (1977) Secondary Production in Inland Waters. In: Macfadyen A (ed) Adv Ecol Res.

Academic Press, pp 91-164

Wilson CA, Miller MW, Allen YC, Boswell KM, Nieland DL (2006) Effects of depth, location,

and habitat type on relative abundance and species composition of fishes associated with

petroleum platforms and Sonnier Bank in the northern Gulf of Mexico. U.S. Dept. of the

Interior, Minerals Management Service, Gulf of Mexico OCS Region, New Orleans, LA.

OCS Study MMS 2006-037. 85 pp.

Wilson JR, Broitman BR, Caselle JE, Wendt DE (2008) Recruitment of coastal fishes and

oceanographic variability in central California. Est Coast Shelf Sci 79: 483-490 doi DOI:

10.1016/j.ecss.2008.05.001

WORK SCHEDULE FORM

Title: What factors explain the high rates of fish production associated with oil platforms off the

coast of California?

Activities 2016-2017 2017-2018

F M A M J J A S O N D J F M A M J J A S O N D J

Gather and compile

structural platform

variables through

literature review and

consultation with

industry and agency

experts

Gather and compile

spatially-explicit

environmental and

oceanographic

variables for each

platform through

literature review and

consultation with

academic and agency

experts

Analyses of

relationships between

fish assemblage

characteristics and

production rates

Modeling the

influence of platform

structure and local

oceanographic

environment on fish

production rates

Graduate student

researcher training

Report and

manuscript

preparation

Presentation of

results

OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: GRANT/PROJECT NO.:

DURATION (months):

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: 1 3.0 16,446 8,223a. (Co) Principal Investigator: 1 1.0 9,067

Sub Total: 2 4.0 16,446 17,290

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians:h. Other:

Total Salaries and Wages: 2 4.0 16,446 17,290

B. FRINGE BENEFITS: 2,138 5,065Total Personnel (A and B): 18,584 22,355

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT:

E. TRAVEL:1. Domestic 2,0002. International

Total Travel: 2,000 0

F. PUBLICATION AND DOCUMENTATION COSTS:

G. OTHER COSTS:1234567

Total Other Costs: 0 0

TOTAL DIRECT COST (A through G): 20,584 22,355

INDIRECT COST (Cal Poly Pomona 45% ): 0 9,263 0INDIRECT COST (41% Occidental College ): 4,452

Total Indirect Cost: 9,263 4,452

TOTAL COSTS: 29,847 26,807

Jeremy Claisse, Daniel PondellaPRINCIPAL INVESTIGATOR:

BRIEF TITLE:Factors Explaining Fish Production on Oil Platforms 02/01/2016 - 01/31/2017

OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: GRANT/PROJECT NO.:

DURATION (months):

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: 1 3.0 16,938 8,469a. (Co) Principal Investigator: 1 1.0 9,339

Sub Total: 2 4.0 16,938 17,808

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians:h. Other:

Total Salaries and Wages: 2 4.0 16,938 17,808

B. FRINGE BENEFITS: 2,202 5,261Total Personnel (A and B): 19,140 23,069

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT:

E. TRAVEL:1. Domestic 2,0002. International

Total Travel: 2,000 0

F. PUBLICATION AND DOCUMENTATION COSTS:

G. OTHER COSTS:1234567

Total Other Costs: 0 0

TOTAL DIRECT COST (A through G): 21,140 23,069

INDIRECT COST (Cal Poly Pomona 45% ): 0 9,513 0INDIRECT COST (41% Occidental College ): 4,604

Total Indirect Cost: 9,513 4,604

TOTAL COSTS: 30,653 27,673

Jeremy Claisse, Daniel Pondella

BRIEF TITLE:Factors Explaining Fish Production on Oil Platforms 02/01/2017 - 01/31/2018PRINCIPAL INVESTIGATOR:

CURRICULUM VITAE

Jeremy T. Claisse, MS, PhD

Biological Sciences Department

California State Polytechnic University, Pomona

3801 West Temple Avenue

Pomona, California 91768

Phone: 808-551-9658 Email: claisse@oxy.edu

EDUCATION

Ph.D. in Zoology, 2009, University of Hawaii at Manoa

M.S. in Zoology, 2007, University of Hawaii at Manoa

B.S. in Aquatic Biology, 2000, University of California at Santa Barbara

POSITIONS HELD

Assistant Professor, Biological Sciences Department, Cal Poly Pomona (starting Fall 2015)

Associate Director, Vantuna Research Group, 2015 to present

Adjunct Assistant Professor, Occidental College, 2009-2015

Postdoctoral Researcher, Vantuna Research Group, Occidental College, 2009-2015

Faculty Researcher, Windward Community College, Kaneohe, Hawaii, 2009

NSF Graduate Research Fellow, Hawaii Cooperative Fishery Research Unit, University of

Hawaii 2003-2008

Research Assistant, Hawaii Cooperative Fishery Research Unit, University of Hawaii, 2002-

2003

Research Technician, University of California at Santa Barbara, 1998-2000

SELECTED PUBLICATIONS

Claisse, J.T., D.J. Pondella, M. Love, L.A. Zahn, C.M. Williams, J.P. Williams and A.S. Bull

(2014) Oil platforms off California are among the most productive marine fish habitats

globally. Proceedings of the National Academy of Sciences. 111(43): 15462-15467.

Claisse, J.T., J.P. Williams, T. Ford, D.J. Pondella, B. Meux, L. Protopapadakis (2013) Kelp

forest habitat restoration has the potential to increase sea urchin gonad biomass.

Ecosphere. 4(3):art38

Howard, K.G., J.T. Claisse, K. Boyle, T.B. Clark, J.D. Parrish (2013) Home range and

movement patterns of the redlip parrotfish (Scarus rubroviolaceus) in Hawaii. Marine

Biology. 160: 1583-1595.

Williams, C.E., J.P. Williams, J.T. Claisse, D.J. Pondella, M.L. Domeier and L. Zahn (2013)

Morphometric relationships of marine fishes common to Central California and the

Southern California Bight. Bulletin, Southern California Academy of Sciences. 112: 217-

227

Claisse, J.T., D.J. Pondella, II, J.P. Williams, J. Sadd (2012) Using GIS mapping of the extent of

nearshore rocky reefs to estimate the abundance and reproductive output of important

fishery species. PLoS ONE 7(1):e30290.

Pondella, D.J., J.P. Williams, E.F. Miller, J.T. Claisse (2012) The ichthyoplankton of King

Harbor, Redondo Beach, California 1974 – 2009. CalCOFI Reports. 53: 95-106.

Williams, J.P., J.T. Claisse, D.J. Pondella, II, L. Medeiros, C.F. Valle, M.A. Shane (2012)

Patterns of life history and habitat use of an important recreational fishery species,

Spotfin Croaker and their potential fishery implications. Marine and Coastal Fisheries:

Dynamics, Management, and Ecosystem Science. 4:71-84

Claisse, J.T., T.B. Clark, B.D. Schumacher, S.A. McTee, M.E. Bushnell, C.K. Callan, C.W.

Laidley and J.D. Parrish (2011) Conventional tagging and acoustic telemetry of a small

surgeonfish, Zebrasoma flavescens, in a structurally complex coral reef environment.

Environmental Biology of Fishes. 91:185-201

Erisman, B.E., L.G Allen, J.T. Claisse, D.J. Pondella II, E.T. Miller, and J. Murray (2011) The

illusion of plenty: hyperstability masks collapses in two recreational fisheries that target

fish spawning aggregations. Canadian Journal of Fisheries and Aquatic Sciences.

68:1705-1716.

Bushnell, M.E., J.T. Claisse, and C.W. Laidley (2010). Lunar and seasonal patterns in fecundity

of an indeterminate, multiple-spawning surgeonfish, the yellow tang Zebrasoma

flavescens. Journal of Fish Biology 76:1343-1361

Williams, I.D., W.J. Walsh, J.T. Claisse, B.N. Tissot and K.A. Stamoulis (2009) Impacts of a

Hawaiian marine protected area network on the abundance and fishery sustainability of

the yellow tang, Zebrasoma flavescens. Biological Conservation. 142:1066-1073

Claisse, J.T., M. Kienzle, M.E. Bushnell, D.J. Shafer and J.D. Parrish (2009) Habitat- and sex-

specific life history patterns of yellow tang, Zebrasoma flavescens in Hawaii. Marine

Ecology Progress Series. 398:245-255

Claisse, J.T., S.A. McTee and J.D. Parrish (2009) Effects of age, size and density on natural

survival for an important coral reef fishery species, yellow tang, Zebrasoma flavescens.

Coral Reefs. 28:95-105

CURRICULUM VITAE

Daniel J. Pondella, II, MA, PhD.

Moore Laboratory of Zoology

Occidental College

1600 Campus Rd.

Los Angeles, CA 90041

Phone (work) 323-259-2955 Email: pondella@oxy.edu

EDUCATION

Ph.D. in Biology, 2001, University of California, Los Angeles

M.A. in Biology, 1992, Occidental College

A.B. in Biology and Philosophy, 1987, Occidental College

POSITIONS HELD

Associate Professor, Occidental College, Department of Biology, 2010-present

Assistant Professor, Occidental College, Department of Biology, 2005-2010

Director, Vantuna Research Group, 1996-present

Director, Southern California Marine Institute (SCMI), 2012-present

Santa Monica Bay Restoration Commission, Technical Advisory Committee, 2002-present

Master Plan Science Advisory Team for the South Coast Study Region, California Marine Life

Protection Act, 2008-2009

Southern California Marine Institute, Board of Directors, 2008-present, President 2009-present.

SELECTED PUBLICATIONS

Claisse, J.T., D.J. Pondella, M. Love, L.A. Zahn, C.M. Williams, J.P. Williams and A.S. Bull

(2014) Oil platforms off California are among the most productive marine fish habitats

globally. Proceedings of the National Academy of Sciences. 111(43): 15462-15467.

Claisse, J.T., J.P. Williams, T. Ford, D.J. Pondella, B. Meux, L. Protopapadakis (2013) Kelp

forest habitat restoration has the potential to increase sea urchin gonad biomass.

Ecosphere. 4(3):art38

Williams, C.E., J.P. Williams, J.T. Claisse, D.J. Pondella, M.L. Domeier and L. Zahn (2013)

Morphometric relationships of marine fishes common to Central California and the

Southern California Bight. Bulletin, Southern California Academy of Sciences. 112: 217-

227

Claisse, J.T., D.J. Pondella, II, J.P. Williams, J. Sadd (2012) Using GIS mapping of the extent of

nearshore rocky reefs to estimate the abundance and reproductive output of important

fishery species. PLoS ONE 7(1):e30290.

Pondella, D.J., J.P. Williams, E.F. Miller, J.T. Claisse (2012) The ichthyoplankton of King

Harbor, Redondo Beach, California 1974 – 2009. CalCOFI Reports. 53: 95-106.

Williams, J.P., J.T. Claisse, D.J. Pondella, II, L. Medeiros, C.F. Valle, M.A. Shane (2012)

Patterns of life history and habitat use of an important recreational fishery species,

Spotfin Croaker and their potential fishery implications. Marine and Coastal Fisheries:

Dynamics, Management, and Ecosystem Science. 4:71-84

Erisman, B.E., L.G Allen, J.T. Claisse, D.J. Pondella II, E.T. Miller, and J. Murray (2011) The

illusion of plenty: hyperstability masks collapses in two recreational fisheries that target

fish spawning aggregations. Canadian Journal of Fisheries and Aquatic Sciences.

68:1705-1716.

The Ecology of Marine Fishes: California and Adjacent Waters. L. G. Allen, D. J. Pondella, II

and M. H. Horn, editors. 2006. University of California Press, Los Angeles. 660 p.

Gillett, D. J., D. J. Pondella II, K. C. Schiff, J. Freiwald, J. E. Caselle, C. Shuman and S.

Weisberg. 2011. Comparing volunteer and professionally collected monitoring data

from subtidal rocky reefs in southern California. DOI: 10.1007/s10661-011-2185-5.

Hamilton, S. L., J. E. Caselle, C. A. Lantz, T. L. Egloff, E. Kondo, S. D. Newsome, K. Loke-

Smith, D. J. Pondella II, K. A. Young and C. G. Lowe. 2011. Extensive geographic and

ontogenetic variation characterizes the trophic ecology of a temperate reef fish on

southern California rocky reefs. Marine Ecology Progress Series 429: 227-244.

Pondella, D. J., II. 2009. Science based regulation: California’s marine protected areas. Urban

Coast 1(1): 33-36.

Pondella, D. J., II and L. G. Allen. 2008. The decline and recovery of four predatory fishes

from the Southern California Bight. Marine Biology 154: 307-313.

Pondella, D. J. II, J. T. Froeschke, L. S. Wetmore, E. Miller, C. F. Valle, L. Medeiros. 2008.

Demographic parameters of yellowfin croaker, Umbrina roncador, (Perciformes:

Sciaenidae) from the Southern California Bight. Pacific Science 62(4):555-568.

Allen, L. G., Pondella, D. J., II and M. A. Shane. 2007. Documenting the return of a fishery:

distribution and abundance of juvenile white seabass (Atractoscion nobilis) in the shallow

nearshore waters of the Southern California Bight, 1995-2005. Fisheries Research 88:

24-32.

Froeschke, J. T., L. G. Allen, and D. J. Pondella, II. 2006. The fish assemblages inside and

outside of a marine reserve in southern California. Bulletin of the Southern California

Academy of Sciences 105(3):128-142.

Pondella, II, D. J., L. G. Allen, M. T. Craig and B. Gintert. 2006. Evaluation of eelgrass

mitigation and fishery enhancement structures in San Diego Bay, California. Bulletin

Marine Science 78(1): 115-131.

Froeschke, J. T., L. G. Allen, and D. J. Pondella, II. 2005. The reef fish assemblage of the outer

Los Angeles Federal Breakwater, 2002-2003. Bulletin of the Southern California

Academy of Sciences 104(2):63-74.

Pondella, D. J., II, B. E. Gintert, J. R. Cobb, and L. G. Allen. 2005. Biogeography of the

nearshore rocky-reef fishes at the southern and Baja California islands. Journal of

Biogeography 32:187-201.

Pondella, D. J., II, J. S. Stephens, Jr. and M. T. Craig. 2002. Fish production of a temperate

artificial reef based upon the density of embiotocids (Teleostei: Perciformes). ICES

Journal of Marine Science 59:S88-93.

Stephens, J. S., Jr., and D. J. Pondella, II. 2002. Larval productivity of a mature artificial reef:

the ichthyoplankton of King Harbor, California, 1974-1997. ICES Journal of Marine

Science 59:S51-58.

SUMMARY PROPOSAL FORM

PROJECT TITLE: What factors explain the high rates of fish production associated with oil

platforms off the coast of California?

OBJECTIVES:

1. Model the influence of platform structure and local oceanographic environment on rates

of fish production.

2. Determine fish assemblage characteristics associated with high fish production rates.

3. Interpret results in terms of making recommendations for design characteristics and

placement of man-made reef structures in southern California to maximize productivity

of fish populations.

METHODOLOGY:

Platform structural and environmental variables will be determined through literature review and

consultation with agency (e.g., U.S. Bureau of Ocean Energy Management), industry, and

academic experts. Estimates of secondary fish production on platforms will be obtained using a

model we have previously developed with platform fish survey data that has been collected over

the past two decades. To determine what set of platform structural and environmental factors

best explain the variability in secondary fish production rates, we will use a general linear

modeling approach using Akaike’s Information Criterion (AIC) based model selection.

Multivariate analysis approaches will be used to determine what fish assemblage characteristics

(i.e., relative species abundance, taxa-independent size structure, density of fishes in distinct

trophic groups) are associated with high fish production rates. Understanding the patterns in

assemblage characteristics that differentiate production across platforms will provide much

needed context for interpreting the results of the univariate analyses relating production rates to

structural and environmental characteristics.

RATIONALE:

In a recent study, we developed a model to estimate the secondary fish production rates for oil

and gas platforms off the coast of southern California and found that these are among the most

productive marine fish habitats globally. Further, fish productivity varied substantially across

platforms, providing a unique opportunity to study what drives fish production on reef habitats.

Understanding which physical characteristics and environmental conditions are associated with

increased fish productivity will provide insight into what drives high rates of production for both

natural and man-made reef habitats. Results will apply to USC Sea Grant Themes “Healthy

Coastal Ecosystems” and “Safe and Sustainable Seafood”, and the WCGA Action Plan

concentration on ocean energy. They will aid in the design and policy related to the deployment

of new man-made structures in the marine environment (e.g., rocky reefs, renewable energy

technologies) and in determining the potential biological impacts of platform decommissioning

options.

DATA SHARING PLAN:

All data used for this project are available for download online at www.lovelab.id.ucsb.edu/platform_databse.html.

Other quantitative products will be posted there, the Vantuna Research Group website and/or on

other appropriate web portals.

200 NIETO AVENUE SUITE 207

LONG BEACH, CA 90803 (805) 895-3000

June 22, 2015 Dr. Linda Duguay, Director University of Southern California Sea Grant Program 3616 Trousdale Parkway – AHF 254 Los Angeles, CA 90089-0373 Re: Support for “What factors explain high rates of fish production associated with oil platforms off the coast of California” Dear Dr. Duguay, United Anglers has a long history of work on behalf of resource conservation and enhancement. Our support for the rigs to reefs effort off the coast of California is based on both first hand experience and a strong reliance on good science. The work of Dr. Dan Pondella and Dr. Jeremy Claisse from the Vantuna Research Group at Occidental College has been an important part of that science. Given this background I am writing a letter of support for the USC Sea Grant proposal entitled “What factors explain high rates of fish production associated with oil platforms off the coast of California?” The proposed project is an important next step in their work modeling fish production on offshore oil and gas platforms. A highlight of this effort is their recent publication in the Proceedings of the National Academy of Sciences demonstrating high fish production on the platforms off the California coast. This work fits within a larger effort to understand how to optimize the fishery and conservation benefits of manmade structures off our coastline. The products of the proposed project will provide additional resources to guide policy and management decisions related to the decommission options for the oil and gas platforms off our coastline, the design and deployment of offshore renewable energy generation structures, and the building of manmade rocky reef habitat as a fishery restoration tool. Please give this your highest consideration. Sincerely,

April Wakeman Corporate Counsel United Anglers

200 NIETO AVENUE

SUITE 207 LONG BEACH, CA 90803

(805) 895-3000

June 20, 2015 Dr. Linda Duguay, Director University of Southern California Sea Grant Program 3616 Trousdale Parkway – AHF 254 Los Angeles, CA 90089-0373 Dear Dr. Duguay, I am writing a letter of support for the USC Sea Grant proposal entitled “What factors explain high rates of fish production associated with oil platforms off the coast of California?” by Jeremy Claisse and Dan Pondella. The Sportfishing Conservancy has been engaged in “real world conservation” since our inception and working with Dr. Dan Pondella and Dr. Jeremy Claisse from the Vantuna Research Group at Occidental College for many years. The proposed project is an important next step in their work modeling fish production on offshore oil and gas platforms. A highlight of this effort is their recent publication in the Proceedings of the National Academy of Sciences demonstrating high fish production on the platforms off the California coast. This work fits within a larger effort to understand how to optimize the fishery and conservation benefits of manmade structures off our coastline. The products of the proposed project will provide additional resources to guide policy and management decisions related to the decommission options for the oil and gas platforms off our coastline, the design and deployment of offshore renewable energy generation structures, and the building of manmade rocky reef habitat as a fishery restoration tool. Please give this your highest consideration. Sincerely,

Tom Raftican President, The Sportfishing Conservancy

June 19, 2015

Dr. Linda Duguay, Director

University of Southern California Sea Grant Program

3616 Trousdale Parkway – AHF 254

Los Angeles, CA 90089-0373

Dear Dr. Duguay,

I am writing a letter of support for the USC Sea Grant proposal entitled “What factors explain high rates of

fish production associated with oil platforms off the coast of California?” by Jeremy Claisse and Dan

Pondella.

SCCWRP is a public agency, whose mission is to provide unbiased science to theenvironmental policy decision makers of the region so they can better steward our naturalresources. Our member agencies include the largest water quality regulated agencies,including wastewater and stormwater dischargers, and their regulatory counterparts, suchas the State of California, the US Environmental Protection Agency, and the CaliforniaOcean Protection Council.

SCCWRP has been working with Dr. Dan Pondella and the Vantuna Research Group at

Occidental College to help accomplish our complimentary missions for almost two

decades. Our collaborative work with the Vantuna Research Group has resulted in

several successes including measuring status and trends in region-wide nearshore rocky

reef and soft-bottom habitat communities. Some of our most recent work has culminated

in several peer-reviewed manuscripts on the impacts of fishing pressure and water quality

stress to rocky reef ecosystem integrity.

The proposed project is an important next step in the Vantuna Research Group’s work modeling fish

production on offshore oil and gas platforms. This work fits within a larger effort to understand how to

optimize the fishery and conservation benefits of manmade structures off our coastline. This topic is of

particular interest to some of our member agencies, including the Ocean Protection Council, who make

policy and management decisions related to decommissioning options for the oil and gas platforms off our

coastline, the design and deployment of offshore renewable energy generation structures, and the building

of manmade rocky reef habitat as a fishery restoration tool.

Sincerely,

Kenneth Schiff

Deputy Director

26 June, 2015 Dr. Linda Duguay, Director University of Southern California Sea Grant Program 3616 Trousdale Parkway – AHF 254 Los Angeles, CA 90089-0373

Dear Dr. Duguay,

I am pleased to write this letter in reference to the proposal titled “What factors explain high rates of fish production associated with oil platforms off the coast of California?” submitted by Jeremy Claisse and Dan Pondella.

As interim executive director of the California Ocean Science Trust and science advisor to the California Ocean Protection Council, I can speak to the value of the proposed research as it aligns with the priorities of the state of California. The Ocean Science Trust is a 501(c)3 public benefit corporation that exists by California statute to support the state’s challenging ocean resource management and policy decisions with sound science provided by transparent processes. In this role, we have partnered with Dr. Dan Pondella and Dr. Jeremy Claisse from the Vantuna Research Group at Occidental College for many years.

The proposed project is an important next step in their work modeling fish production on offshore oil and gas platforms. A highlight of this effort is their recent publication in the Proceedings of the National Academy of Sciences demonstrating high fish production on the platforms off the California coast. This work fits within a larger effort to understand how to optimize the fishery and conservation benefits of manmade structures off our coastline. The proposal thus sits at the interface of science, marine resource management, economics and thoughtful policy – all priorities for California.

The specific products of the proposed project will provide additional resources to inform policy and management decisions related to the decommission options for the oil and gas platforms off our coastline, the design and deployment of offshore renewable energy generation structures, and the building of manmade rocky reef habitat as a fishery restoration tool. I look forward to continuing to collaborate with Vantuna Research Group as they pursue this important research.

Sincerely,

Liz Whiteman Interim Executive Director

Dr. Linda Duguay, Director

University of Southern California Sea Grant Program

3616 Trousdale Parkway – AHF 254

Los Angeles, CA 90089-0373

Dear Dr. Duguay,

This letter is in support of the USC Sea Grant proposal entitled “What factors explain high rates

of fish production associated with oil platforms off the coast of California?” by Jeremy Claisse

and Dan Pondella. This work will continue a line of research aligned with one of the most

prominent aspects of The Bay Foundation’s (TBF) mission to restore Santa Monica Bay and its

adjacent waters to benefit nearshore recreational and commercial fisheries which contribute

millions of dollars to the local coastal economies and support working waterfronts. The results of

this proposal will aid in their ability to inform the implementation and design of manmade reef

construction to benefit fisheries, filling critical gaps in their current knowledge.

The Bay Foundation and the Santa Monica Bay Restoration Commission have been working

with Dr. Dan Pondella and Dr. Jeremy Claisse of the Vantuna Research Group (VRG) for almost

a decade. Dr. Pondella has led our efforts to map and understand the extant values of the rocky

reef complexes of the Santa Monica Bay. The VRG is also leading subtidal biological

monitoring efforts for the State of California to obtain a baseline assessment for the newly

formed network of marine protected areas throughout southern California.

The application of the results from their work in which they mapped existing reefs, quantified

their extent, and quantified their relative value regionally based upon standing stock biomass and

production, has allowed us to further our management goals for Santa Monica Bay and the

Southern California Bight. It has expanded our understanding of the importance and potential

role of artificial reefs, their design and construction, and the direct benefit these reefs may have

for the management and sustainability for our fisheries and their associated economies.

More recently we’ve collaborated on active resource management projects to increase production

of rocky reef systems to benefit local fisheries. The first phase of this project targets the

restoration of kelp forests on natural reefs. Dr. Claisse developed and published a model of

potential increases in sea urchin gonad production as a result of these efforts. The second phase

involves the design and implementation of more than 69 acres of artificial reefs. The products of

the proposed project will provide additional guidance to the design and deployment of these new

fish production reefs.

In addition, resiliency efforts to protect our coast and related economies will generate a new

system of coastal management and infrastructure. The application of the findings of this proposal

will aid my organization and other resource managers on construction designs that will support

local fisheries while enabling coastal protection through the placement and design of artificial

reefs. Renewable energy infrastructure in the form of offshore wind farms and wave energy and

their associated cables, moorings and armoring could be co-located and constructed with

increased fisheries production as integrated multi-benefit projects.

In summary, this proposal will help us understand existing artificial reefs are being used by our

fishers, enabling us to better understand how future projects will affect these interests and

importantly enable us to design and locate better functioning artificial reefs for recreational and

commercial fishers in the future. The benefit of this knowledge to my organization and other

resource managers in our region would be most welcome and of direct benefit in our day to day

decisions.

Thank you for your consideration, if you have any questions regarding this letter please do not

hesitate to contact me.

Sincerely,

Tom Ford, Executive Director

The Bay Foundation

Santa Monica Bay Restoration Commission

tford@santamonicabay.org

310-216-9827

June 23, 2015 Dr. Linda Duguay, Director University of Southern California Sea Grant Program 3616 Trousdale Parkway – AHF 254 Los Angeles, CA 90089-0373 Dear Dr. Duguay: On behalf of AltaSea at the Port of Los Angeles, I would like to share our enthusiastic support for the USC Sea Grant proposal entitled “What factors explain high rates of fish production associated with oil platforms off the coast of California?” by Dr. Jeremy Claisse and Dr. Dan Pondella. AltaSea’s Board of Trustees and staff have great respect for the work of Dr. Pondella and Dr. Claisse. Dr. Pondella is the Director of the Southern California Marine Institute (SCMI) which will be situated on the AltaSea campus representing the Science Hub. AltaSea’s mission is to bring together science, business and education to generate innovative solutions to the global challenges of sustainability. The work that Dr. Pondella and Dr. Claisse are performing will provide the crucial data needed to guide policy and management decisions related to the decommission options for the oil and gas platforms off our coastline. An important output of their research will be the continued demonstration that the retention of manmade reef habitat – such as decommissioned oil and gas platforms – can serve as an effective fishery restoration tool. Thank you for your consideration of this letter of support. Please contact me if you have any questions regarding my recommendation. Sincerely,

Jenny Krusoe Chief Finance and Operating Officer

1

University of Southern California Sea Grant Proposal PROJECT TITLE META-ANALYSIS OF THE USEPA’S ECOTOX DATABASE: AN EVOLUTIONARY PERSPECTIVE ON CHOOSING ORGANISMS FOR MARINE WATER QUALITY ASSESSMENT PRINCIPAL INVESTIGATOR Suzanne Edmands, Professor, Department of Biological Sciences, University of Southern California FUNDING REQUESTED 2016-2017 $48,329 Federal/State $37,397 Match 2017-2018 $49,655 Federal/State $38,371 Match STATEMENT OF THE PROBLEM

Meta-analysis of existing toxicity data for saltwater organisms could aid in optimization of methodologies for deriving marine water quality criteria. The limited number of saltwater species for which quality data are available is an acknowledged constraint for determining criteria that are protective for all marine life. The USEPA’s guidelines (Stephen et al. 1985, “the National Guidelines”) require toxicity information for a specific set of taxonomic groups, which were chosen based on groups for which the most reliable data were available at the time. The dataset may have shifted in the ensuing thirty years and it is important to assess whether the taxonomic requirements can be improved. Further, for many chemicals, particularly contaminants of emerging concern, there are still not enough data to meet the EPA’s taxonomic requirements. When data are lacking, surrogate species may be used to set criteria. For example, interspecies correlation estimation (ICE) uses data for surrogate species to predict tolerance in target species (Asfaw et al. 2003, Raimondo et al. 2007), but these estimates are less accurate at taxonomic distances above the family level (Raimondo et al. 2010) and current models are limited to acute, but not chronic, toxicity. INVESTIGATORY QUESTIONS The proposed project would assess whether existing methods for determining water quality criteria are sufficient for protecting the broad taxonomic and phylogenetic diversity of saltwater animals. Work will focus on surveying the taxonomic diversity of data for saltwater animals in the USEPA’s ECOTOX database, both at present and at the time that the National

2

Guidelines were published (1985), for at least twelve different chemical substances chosen to span different modes of action and histories of exposure. For which chemicals are there sufficient data to meet the taxonomic requirements (e.g. 8 different families)? Are existing taxonomic guidelines sufficient for protecting most species (such as 95%)? Given that the available data have changed since 1985, should the taxonomic requirements also change? For which chemicals are the taxonomic requirements most and least protective? The proposed work would also assess evolutionary patterns of chemical tolerance by plotting toxicity values onto evolutionary trees. This will allow us to test whether tolerance is more phylogenetically restricted (higher in some evolutionary branches) for some chemicals than for others. One hypothesis is that tolerance to naturally-occurring chemicals will be more basal (shared by organisms throughout the tree) while tolerance to more recently introduced synthetic chemicals will be more phylogenetically restricted. A second hypothesis is that chronic tolerance will be more phylogenetically restricted than acute tolerance, because acute exposure may induce a generalized stress response shared by most organisms, while chronic exposure may invoke a more specific, evolutionarily-restricted response. Understanding evolutionary patterns of chemical tolerance would help predict when surrogate species approaches would and would not be useful for estimating tolerance in related taxa. MOTIVATION Previous research. Research in the Edmands lab is largely focused on population and conservation genetics, often using an intertidal copepod species (Tigriopus californicus) as a model system. Our lab’s first foray into ecotoxicology was funded by USC Sea Grant (see further details in RESULTS OF PRIOR RESEARCH below). Briefly, this research focused on toxicity testing in T. californicus, and included collaboration with ecotoxicologist KMY Leung at the University of Hong Kong. This work has shown that pollution tolerance is highly dependent on the exposure history and geographic source of test specimens, and has resulted in two publications to date (Sun et al. 2014, 2015). While these copepods are not among the most pollution-sensitive organisms, they provide a highly manipulable system for testing mechanisms of pollution tolerance due to their short generation times and amenability to multi-generation breeding experiments (e.g. Raisuddin et al. 2007). Two Ph.D. students in my lab who began their dissertations with support from Sea Grant funding (Patrick Sun and Helen Foley) have done additional ecotoxicology work with T. californicus, focusing on the genetic architecture of tolerance to different contaminants, the transcriptomic effects of short- vs. long-term exposure, and the phenotypic and transcriptomic effects of single vs. concurrent stressors (manuscripts in prep.). Discussions with potential users. Our copepod work sparked my interest in the broader question of how test species are chosen for determination of marine water quality criteria. Discussions with potential users convinced me that there is a particular dearth of toxicity data for saltwater species and that an analysis of the existing data would be a time- and cost-effective means of identifying priorities for future research. I presented a very preliminary analysis of marine toxicity data at the Southern California SETAC meeting in San Pedro this past April. Feedback from this conference presentation led me to seek input from particular

3

groups, including key people at the USEPA (particularly region 9), regional water boards (Central Coast, San Diego and Los Angeles) and the UC Davis/Granite Canyon Marine Pollution Studies Lab. These discussions made me aware that potential revision of the National Guidelines is a pressing concern and that an invited experts meeting to discuss this subject is scheduled for September 2015 in Arlington, VA. This suggests it is a particularly opportune time to assess changes in the taxonomic distribution of available data since 1985, when the National Guidelines were established. Discussions with experts in the field also made me aware of the rather sophisticated estimation techniques that have been developed to deal with the problem of filling data gaps. The proposed work is intended to complement these existing techniques by using evolutionary patterns to assess conditions when extrapolating across taxonomic data gaps is most problematic. RESULTS OF PRIOR RESEARCH Results and their implications. Our previous Sea Grant research focused on mechanisms underlying intraspecific variation in pollution tolerance, using the copepod Tigriopus californicus as a model. Results of a 15-generation chronic exposure study (Sun et al. 2014) showed that changes in tolerance to one pollutant, TBTO, was consistent with evolutionary adaptation, as increased tolerance was maintained even after populations were transferred to clean conditions for multiple generations. For a second pollutant, CuSO4, changes in tolerance were consistent with physiological acclimation, as tolerance arose relatively quickly (within 3 generations, ~ 3 months) and was also lost relatively quickly (within 3 generations) when populations were transferred to clean conditions. These finding illustrate the importance of exposure history when using bioassays to measure chemical tolerance. A second study (Sun et al. 2015) focused on geographical variation in pollution tolerance among different populations in two species of Tigriopus. Significant intra- and inter-specific were found for both copper and TBTO. Despite evidence for intra-specific tolerance variation in this and other species, results of our literature survey (Sun et al. 2015) showed that the majority of articles using bioassays did not provide details on the original collection site. Biological variation resulting from population-specific tolerance, if not addressed, can be misinterpreted as experimental error and thereby erode confidence in tolerance data. Communication of results. The PI and graduate students have presented results of this research at numerous conferences including the 2011 PRIMO conference in Long Beach, the 2012 SETAC conference in Long Beach and the 2015 Southern California SETAC conference in San Pedro. The PI has also disseminated resulting publications and discussed results with key people at state and federal agencies including the USEPA (region 9) and regional water boards (Central Coast, San Diego and Los Angeles), as well as advocacy groups such as Heal the Bay. BACKGROUND & RELATED RESEARCH ECOTOX database. The USEPA’s ECOTOXicology database (ECOTOX) is a searchable resource for single chemical toxicity data for aquatic life, terrestrial plants and wildlife

4

(USEPA 2015). The resource integrate three previously independent databases (AQUIRE, PHYTOTOX and TERRETOX) and currently includes more than 400,000 test records covering 5,900 aquatic and terrestrial species and 8,400 chemicals. The data are largely derived from peer-reviewed literature and are specific to US species. Methodologies for deriving aquatic life criteria. Procedures for deriving numeric national water quality criteria for aquatic organisms have been established by the USEPA (Stephen 1985). These National Guidelines include details on data collection, required data types and methods for determining acute and chronic values. For saltwater aquatic organisms acceptable acute tests are required for at least one species of saltwater animal in at least 8 different families including “ a. two families in the phylum Chordata b. a family in a phylum other than Arthropoda or Chordata c. either the Mysidae or Penaidae family d. three other families not in the phylum Chordata (may include Mysidae or Penaidae, whichever was not used above e. any other family” Acute-chronic ratios are required for aquatic animals in at least three different families provided that “ at least one is a fish at least one is an invertebrate and at least one is an acutely sensitive saltwater species (the other two may be freshwater species)” Beyond the National Guidelines, other methodologies have also been developed. The California Department of Fish and Game developed procedures requiring fewer than eight families in some cases depending on personal judgment (e.g. Menconi & Beckman 1996). Features from the National Guidelines as well as newer methodologies were incorporated into techniques known as the UC Davis Methodology or UCDM, which includes detailed criteria for data quality and strategies for reducing the required number of taxonomic groups to as few as five families (Tenbrook et al. 2009, 2010). Methods for dealing with data gaps. The National Guidelines do not provide procedures for setting criteria in cases that do not meet the data requirements. A number of other procedures have been developed to deal with the recurrent problem of data gaps.

Species Sensitivity Distributions (SSDs). SSDs model sensitivity data for a particular chemical (typically LC/EC50 or NOEC values) for a series of species, with chemical concentration plotted on the x-axis and the number of species affected plotted on the y-axis (e.g. Posthuma et al. 2002). A distribution is then fitted to the data and can be used to estimate parameters such as the concentration predicted to affect only a small proportion of species (typically 5%, known as the fifth percentile hazard concentration or HC5). SSDs have been use to assess broad patterns such as the sensitivity of freshwater vs. saltwater species (Leung et al. 2001, Klok et al. 2012), temperate vs. tropical species (Kwok et al. 2007) and native vs. non-native species

5

(Jin et al. 2015), as well as the relative sensitivities of broad taxonomic groups (Raimondo et al. 2008).

Interspecies Correlation Estimation (ICE). ICE models use known acute toxicity of a surrogate species to estimate toxicity in taxa with little or no available data, including threatened or endangered species (Asfaw et al. 2003). The USEPA has made this method available as a Web-based program (Web-ICE) that uses an aquatic database of at least 4700 acute values for 217 species and 695 chemicals (Raimondo et al. 2007). The accuracy of predicted toxicity was found to decrease with taxonomic distance, with 91% of within-family predictions falling within 5-fold of their actual values, while only 56% of within-phylum predictions fell within the 5-fold category (Raimondo et al. 2010).

Phylogenetic methods for assessing variation in sensitivity. A different approach to assessing taxonomic variation in sensitivity is to map tolerance onto a phylogenetic tree. This phylogenetic framework can provide information on the taxonomic level at which most of the tolerance signal is present. For example, in Figure 1, there is strong phylogenetic signal within Genus A (all species have the same tolerance value), so any one of these species could represent the entire group. In Genus B there is no phylogenetic signal, so data from each species increases information on sensitivity in the genus. Note that in this hypothetical example, taxonomic groups match phylogenetic clades (branches on the tree). This is not always the case, which is a weakness of criteria derivations based on traditional taxonomic groups. Phylogenetic approaches are increasingly being used to assess evolutionary patterns of contaminant sensitivity. For example, Buchwalter et al. 2008 found strong differences in cadmium tolerance among insect families, while Carew et al. 2011 found that much of the

signal for pollution tolerance in North American chironomids is contained within genera rather than within sub-families. In amphibians, phylogenetic signal for pesticide tolerance was found at the family level (Hammond et al. 2012). Pyrethroid resistance in Hyallela azteca is a dramatic example of phylogenetic signal in clades within what is sometimes treated as a single species (Weston et al. 2013). These types of phylogenetic approaches can provide insight into appropriate taxonomic requirements for setting water quality criteria.

Species'1,'LC50'='6'

Species'2,'LC50'='6'

Species'3,'LC50'='6'

Species'4,'LC50'='6'

Species'5,'LC50'='12'

Species'6,'LC50'='1'

Species'7,'LC50'='18'

Species'8,'LC50'='5'

Genus'A9'strong'phylogeneAc'signal'

Genus'B9'no'phylogeneAc'signal'

Figure 1. Cartoon diagram of phylogenetic signal in two genera

6

Novelty of the proposed work. To my knowledge, the proposed project does not duplicate any projects funded by Sea Grant or elsewhere. This would, I believe, be the first analysis of changes in the available toxicity data since the National Guidelines were established. I believe it would also be the first study to test specific hypotheses about the magnitude of the phylogenetic signal for sensitivity to different chemicals. GOALS AND OBJECTIVES A. Overall Goals. The proposed project is a meta-analysis of existing toxicity data aimed at optimizing methodologies for protecting saltwater aquatic life. Specific goals of the project are • to strategically choose chemicals and endpoints for analysis • to survey saltwater toxicity data in the ECOTOX database, both for the current database and for the database at the time when the National Guidelines were established (1985), including analysis of taxonomic composition and generation of SSDs/HC5s • to construct a phylogenetic tree for each chemical/endpoint, map toxicity values onto each tree, evaluate phylogenetic patterns and calculate phylogenetic signals • to communicate results to state and federal regulatory agencies, as well as to the academic world through peer-reviewed publications. B. 2016-2017 and 2017-2018 Objectives

2016-2017: The first year will focus on assessing taxonomic issues inherent in deriving water quality criteria, with the aim of being able to make very specific recommendations for any revisions that might be made in methodologies for protecting saltwater aquatic life 2017-2018: The second year will focus on assessing phylogenetic patterns and testing hypotheses for why tolerance may be more phylogenetically restricted in some cases than in others.

METHODS Choice of chemical substances to be assessed. At least twelve chemicals will be chosen that span a range of different modes of action and include both naturally-occurring and synthetic agents. By including chemicals with long histories of exposure to marine organisms, as well as contaminants of emerging concern (e.g. Scott et al. 2012), we hope to assess how evolutionary patterns of tolerance may be different when lineages have co-evolved with contaminant exposure. Potential candidates include: • Ammonia- a natural excretion product that can become elevated due to agricultural runoff and the decomposition of biological waste. Toxicity is attributed to the depolarizing effect of NH4+ ions on neurons (Eddy 2005)

7

• Chlordane- an organochlorine compound used as an insecticide. Chlordane is interesting in that sensitivity appears higher in saltwater species than freshwater species, but this may be due to a high proportion of crustaceans (which appear to be particularly sensitive to insecticides) in the saltwater data (Leung et al. 2011)

• Copper- an essential trace element that becomes toxic at high concentrations due, in part, to the generation of reactive oxygen species (Letelier et al. 2005) • Fipronil- a broad spectrum insecticide in the phenylpyrazole family that acts by

disrupting GABA channels (Chandler et al. 2004, Wu et al. 2015) • Nickel- an essential element in some animal species that becomes toxic at high concentrations. Nickel is interesting in that sensitivity appears higher in freshwater species than saltwater species, possibly due to different taxonomic distributions in the two datasets (Leung et al. 2011) • Rotenone- a naturally occurring pesticide that works by interfering with the electron transport chain in mitochondria (Ling 2003) • Tributyltin oxide (TBTO)- an organotin compound used as a biocide and marine anti-fouling agent. TBTO is associated with imposex in molluscs and is toxic to most marine organisms, although the mode of action is still poorly known

Choice of endpoints to be assessed. For all chosen chemicals, saltwater toxicity data will be surveyed for the acute endpoint of median lethal concentration (LC50). While LC50 values are dubious predictors of appropriate protection levels, they constitute the most abundant source of toxicity data in terms of both the number and taxonomic diversity of records (e.g. Raimondo et al. 2010). For at least two chemicals we will also survey saltwater toxicity for a sublethal chronic endpoint such as survival, growth, reproduction or population growth rate. Chronic endpoints are certainly important for predicting contaminant effects on ecosystems, but data for chromic effects are relatively sparse. We will choose chronic endpoints after extensive assessment of the ECOTOX database to determine chemical and endpoint combinations with sufficient data. Survey of saltwater toxicity data in ECOTOX in 1985 vs. the present. For the chosen chemicals and endpoints we will survey toxicity data for saltwater animals up through 1985 (when the National Guidelines were published) and through the present day. Taxonomic composition. Taxonomic composition of the database will be quantified for comparison between time points and chemicals, and used to determine if the data meet the taxonomic requirements of the National Guidelines. For example, current LC50 data show that the 8 family requirement can be met for both copper sulfate and chlordane, but that more taxonomically diverse data are available for copper sulfate (Figure 2). Importantly, this is only an assessment of data quantity, not quality. Results will be used to address the following questions: How often are there sufficient

8

data to meet the USEPA’s taxonomic guidelines? Are there specific taxonomic holes that need to be filled, either by generating more data from existing model species or

by developing new model species? How has the database changed since 1985? Given the current composition of the dataset, should the number or types of required taxa be adjusted?

Figure 2. Taxonomic composition (proportion of species in each taxonomic category) for LC50 values in saltwater animals taken from the USEPA ECOTOX database on July 7, 2015.

SSDs and HC5s. For each chemical substance and endpoint we will generate 4 SSDs:

1) using current data and all species 2) using current data and the minimum set of 8 species from different families 3) using 1985 data and all species 4) using 1985 data and the minimum set of 8 species from different families

SSDs will be constructed following methods advocated by the UCDM (TenBrook et al. 2010). These methods follows the ANZECC and ARMCANZ (2000) procedure using a Burr Type III distribution, with the BurrliOZ program used to calculate the HC5 (5th percentile value). Results will be used to compare HC5 for the different data sets. Does the percentile cutoff differ between the full and minimum (8 family) data sets? Have the thirty years of data generated since the 1985 guidelines altered the percentile cutoffs?

Phylogenetic analyses. For each chemical substance and endpoint, a phylogenetic tree will be constructed and tolerance data will be mapped onto the tree.

Methods. For each species a toxicity dataset, DNA sequence for the mitochondrial COI gene will be obtained, if available, from data archived in GenBank, the NIH genetic sequence database (http://www.ncbi.nlm.nih.gov/genbank). COI is the gene most commonly used for ‘DNA barcoding’ (e.g. Hebert et al. 2003) and sequence data for this gene are widely available for animals (but not plants). COI data will be used to construct phylogenetic trees using the program MEGA 6 (Tamura et al. 2013). Tolerance data will be mapped onto each tree and used to assess phylogenetic

Copper&sulfate& Chlordane&

Chordates*(fish)*

Penaids*

Mysids*

Other*crustaceans*

Molluscs*

Polychaetes*

Other*inverts*

9

patterns. Data will also be used to calculate phylogenetic signal, the tendency for related taxa to share similar phenotypic features, using Blomberg’s K statistic (Blomberg et al. 2003).

Example. As a preliminary example (Figure 3), I compiled CuSO4 lethality data (96h LC50) for saltwater species in ECOTOX and generated a phylogenetic tree for the subset of species with mitochondrial COI sequence archived on GenBank. Phylogenetic signal for this particular toxicant appears to be extremely weak. One reason for such low phylogenetic signal is that CuSO4 tolerance may be particularly physiologically plastic, so that tolerance may be impacted more by short-term exposure history rather long-term evolutionary history. Our own data on T. californicus (Sun et al. 2014), as well as data for the congener T. japonicus (Kwok et al. 2009) show that copper tolerance is physiologically plastic and can increase after a single generation of exposure and decrease after being returned to benign conditions. In cases like this where phylogenetic signal is weak, tolerance in one species will be a poor predictor of tolerance in related species.

Questions to be addressed: Phylogenetic tolerance patterns will be assessed to help understand when tolerance in one species will be good proxy for tolerance in a related species. Phylogenetic signal might be expected to be strongest for contaminants that have recently been introduced into the environment (because only a subset of lineages may have evolved tolerance), for specific responses governed by things like appropriate receptors (because these receptors may be phylogenetically restricted) and for chronic rather than acute effects (because acute exposures may invoke a generalized stress response, while chronic exposure may invoke a more specialized response). In cases where phylogenetic signal is strong, surrogate species approaches become more attractive. This could include using a common species as a proxy for closely-related threatened species, using a non-native species as a proxy for a native species or using a standard test species as a proxy for a closely-related species that is not amenable to laboratory testing.

10

!!!!!!!!!!!!!!!!!!!!!!

species&are&!

species&are&!

How&can&meta/analysis&of&exis4ng&toxicity&data&improve&coastal&water&quality&regula4on?&Suzanne!Edmands,!University!of!Southern!California,!Los!Angeles!CA!90089>0371!

SoCal!SETAC,!San!Pedro!CA,!April!21!2015!

!Abstract&Marine!water!quality!regulaJons!might!benefit!from!systemaJc!review!of!exisJng!toxicity!data.!The!USEPA’s!ECOTOX!

database!is!a!repository!of!single!chemical!toxicity!data!for!both!terrestrial!and!aquaJc!species.!Here!I!focus!on!how!

the!ECOTOX!database!might!be!used!to!opJmize!the!choice!of!marine!test!organisms.!I!focus!on!four!quesJons.!First,!

which!species!are!most!sensiJve?!Second,!does!sensiJvity!to!one!contaminant!predict!sensiJvity!to!another?!Third,!

does!the!geographic!origin!of!test!specimens!maWer?!Fourth,!how!can!phylogeneJcs!be!used!to!assist!with!choosing!

appropriate!test!organisms?!The!goal!of!this!poster!is!to!solicit!community!input!on!the!best!use!of!exisJng!databases!

in!advance!of!conducJng!a!comprehensive!meta>analysis.!

Which&marine&species&are&most&sensi4ve&to&pollu4on?&Does&sensi4vity&to&one&contaminant&predict&sensi4vity&to&another?&&Preliminary&work.!SystemaJc!analysis!of!exisJng!data!for!contaminant!sensiJvity!in!marine!taxa!could!help!improve!!

the!Jme>!and!cost>efficiency!of!designing!future!bioassays!for!coastal!polluJon.!As!a!preliminary!step,!I!searched!the!

USEPA!ECOTOX!database!and!found!12!marine!species!with!96h!LC50!data!for!all!of!the!following!3!contaminants:!!

CuSO4,!CdCl

2!and!TBTO!(Table!1).!Scud!(Elasmopus)rapax)!was!the!most!sensiJve!species!for!CuSO

4!and!CdCl

2!and!was!!

the!3rd!most!sensiJve!for!TBTO.!Opossum!Shrimp!(Americamysis)bahia)!was!the!most!sensiJve!to!TBTO!but!was!3rd!in!

sensiJvity!to!CuSO4!and!7

th!in!sensiJvity!to!CdCl

2.!Overall,!there!was!no!significant!correlaJon!in!LC50!values!between!!

any!pair!of!contaminants.!!!!!!!!!!!!!!!!!!!!!!

Does&the&geographic&origin&of&test&specimens&maBer?!

How&can&phylogene4cs&be&used&to&assist&with&choosing&test&organisms?!

References&Agra!AR,!AMVM!Soares!&!C!Barata.!2011.!Life>history!consequences!of!adaptaJon!to!polluJon.!“Daphnia)longispina)clones!historically!exposed!to!copper”.!Ecotoxicology!!!!20:552>562.!

Sun!PY,!HB!Foley,!VWW!Bao,!KMY!Leung!&!S!Edmands,!submi6ed.!VariaJon!in!tolerance!to!common!marine!pollutants!!among!different!populaJons!!in!two!species!of!!

!!!the!marine!copepod!Tigriopus.!Environ.!Sci.!Pollut.!Res.!Tamura!K,!Stecher!G,!Peterson!D,!Filipski!A!&!Kumar!S,!2013.!MEGA6:!Molecular!EvoluJonary!GeneJcs!Analysis!version!6.0.!Mo.!Biol.!Evol.!30:!2725>2729.!!

&&&&&&&&&&&&&&&!

Table&1.&Median!lethal!concentraJon!(LC50,!96h,!µg/L)!in!twelve!marine!species!commonly!used!for!toxicity!!

tesJng.!Species!are!ranked!by!sensiJvity!(1=most!sensiJve).!Data!are!from!the!USEPA’s!ECOTOX!database.!

!

Species! !! !!

!!

CuSO4!!!!!!!!!!!!!!!!!!!!!!

(CAS!#7758987)! !!

CdCl2!!!!!!!!!!!!!!!!!!!!!!!!

(CAS!#10108642)! !!

TBTO!!!!!!!!!!!!!!!!!!!!!!!!!

(CAS!#56359)!

Common!name!

ScienJfic!

name! !! !!

Mean!

LC50! Rank! !!

Mean!

LC50! Rank! !!

Mean!

LC50! Rank!

Scud!Elasmopus)rapax) )) !! 77.5! 1! !!1.6! 1! !!9.4! 3!

Common!Bay!

Mussel,!!!!!!!!!!!!!!!!!!!

Blue!Mussel!

My:lus)edulis) )) !! 142.9! 2! !!1350! 4! !!29.0! 8!

Opossum!Shrimp!Americamysis)bahia) )) !! 214.0! 3! !!4067.1! 7! !!3.2! 1!

Green!Mussel! Perna)viridis) )) !! 595.0! 4! !!8400! 9! !!4.8! 2!

Santo!Domingo!

Falsemussel!

My:lopsis)sallei) )) !! 600.0! 5! !!710! 3! !!53.0! 10!

Polychaete!Worm!

Neanthes)arenaceodentata)

)) !! 600.0! 5! !!37872.7! 12! !!20.0! 6!

HarpacJcoid!

Copepod!

Tigriopus)japonicus) )) !! 1202.0! 7! !!25200! 11! !!18.0! 5!

Pacific!Oyster!Crassostrea)gigas) )) !! 1550.0! 8! !!9500! 10! !!290.0! 12!

Mummichog!Fundulus)heteroclitus) )) !! 1877.2! 9! !!7999.4! 8! !!36.1! 9!

Sheepshead!

Minnow!

Cyprinodon)variegatus) )) !! 2500.0! 10! !!2341.7! 6! !!25.6! 7!

Kuruma!Shrimp!Penaeus)japonicus) )) !! 10116.0! 11! !!1658.4! 5! !!12.1! 4!

Common!Shrimp,!

Sand!Shrimp!

Crangon)crangon) )) !! 19000.0! 12! !!655! 2! !!145.8! 11!

Future&work.!Our!future!work&will!!involve!systemaJc!analysis!of!a!broad!range!of!toxicants,!including!heavy!metals,!

pesJcides,!inorganics!and!phenols.!Species!sensiJvity!distribuJons!will!be!constructed!and!compared!for!different!

taxonomic!groups!(microalgae,!macroalgae,!polychaetes,!bivalves,!amphipods,!mysids,!echinoderms,!fish!etc.).!This!

comprehensive!assessment!of!marine!toxicity!data!will!be!used!to!address!the!following!quesJons?!Which!taxonomic!

groups!are!most!sensiJve?!Does!sensiJvity!to!one!class!of!toxicants!predict!sensiJvity!to!other!toxicants?!When!can!

invertebrate!tests!be!used!as!a!surrogate!for!vertebrate!tests?!Are!larvae!always!more!sensiJve!than!adults?!

Introduc4on.!Toxicology!studies!onen!treat!species!as!invariant,!staJc!enJJes,!ignoring!

tolerance!variaJon!caused!by!adaptaJon!or!

acclimaJon.!Our!previous!work!showed!>!2>fold!

difference!in!copper!tolerance!between!

populaJons!of!the!Jdepool!copepod!Tigriopus)californicus)collected!from!different!geographic!

locaJons!(Sun!et!al.!submiWed).!Even!more!

extreme,!!studies!on)Daphnia)longispina!show!up!to!48>fold!difference!in!copper!tolerance!

between!!strains!from!polluted!vs.!unpolluted!

sites!(Agra!et!al.!2011).!Despite!much!evidence!

for!geographic!variaJon!within!species,!!our!

literature!survey!showed!that!65%!of!bioassay!

studies!did!not!even!menJon!the!geographic!

source!of!their!test!organisms!(Figure!1).!

Future&work.!We!will!conduct!an!extensive!literature!survey!of!studies!assessing!toxicant!tolerance!among!

conspecific!marine!populaJons!from!different!geographic!locaJons.!Results!will!be!compared!to!the!total!

magnitude!of!tolerance!variaJon!found!for!each!species!in!the!ECOTOX!database.!Is!geographic!source!an!

important!component!of!variance!in!intraspecific!measurements?!If!so,!then!biological!difference!in!sensiJvity!

may!be!misconstrued!as!measurement!error,!thereby!eroding!confidence!in!the!accuracy!of!toxicity!tesJng.!!

Further,!tests!using!resistant!populaJons!may!lead!to!water!quality!criteria!with!unexpectedly!negaJve!results!on!

more!sensiJve!populaJons!of!the!same!species.!

species&are&!Figure!1.!!Survey!of!arJcles!from!2004>2014!found!on!Web!of!Science!!

using!with!the!search!term!“ecotoxicology!bioassay”!(94!arJcles,!with!an!

average!of!1.4!test!species!per!arJcle).!Percentages!are!based!on!the!!

total!number!of!studies!in!each!category,!with!study!defined!as!results!!

for!a!single!species!in!a!single!arJcle.!From!Sun!et!al.,!submiWed.!

Cynoglossus)joyneri,!80)

78!

50!

99!

70!

54!

54!

100!

80!

78!

95!

63!

66!

94!

56!

63!

52!

99!

90!

62!

100!

53!

68!

Figure!3.!Maximum!parsimony!

tree!of!66!marine!species!based!

on!mitochondrial!COI!(535!!

aligned!bases,!consistency!index!

0.1513,!tree!length!5310).!!

Tree!is!collapsed!to!include!

only!nodes!with!bootstrap!

values!>50%!(500!replicates).!

To!the!right!of!the!species!!

names!are!96h!LC50!values!!

(µg/L,!geometric!means)!for!!

CuSO4!(CAS!#7758987)!taken!!

from!the!ECOTOX!database.!!

LC50!values!are!color!coded!as!!

shown!below.!

Solea)senegalensis,!320)

Etroplus)maculatus,!1700)

Morone)saxa:lis,!1972)Rachycentron)canadum,!108)Terapon)jarbua,!6170)Liza)ramado,!2000)Liza)parsia,!17455!Liza)macrolepis,!1400)Mugil)cephalus,!3200)Cyprinodon)variegatus,!2500)

Pomatoschistus)microps,!568)Lates)calcarifer,!1530)Paralichthys)olivaceus,!3000)Sebastes)schlegelii,!2700!Pagrus)major,!84400)Sparus)aurata,!64)

Trachinotus)carolinus,!645)Oryzias)melas:gma,!7300)Oreochromis)mossambicus,!8200)Kryptolebias)marmoratus,!20818)Fundulus)heteroclitus,!11263)Diadema)an:llarum,!25)Paracentrotus)lividus,!39)

Eurythoe)complanata,!1300)Ophryotrocha)diadema,!160)Perinereis)aibuhitensis,!864)Namanereis)sp.,!550!Hediste)diversicolor,!908!Melita)plumulosa,!227!Spiralothelphusa)hydroma,)570!Diogenes)pugilator,!2864!Sphaeroma)serratum,!1980!

Idotea)bal:ca,!1200!Elasmopus)rapax,!77!Gammarus)duebeni,!893!Palaemon)elegans,!2520!Pandulus)danae,!39!

Litopenaeus)vannamei,!13251!

Penaeus)monodon,!4918!Homarus)americanus,!237!Portunus)pelagicus,!3314!Leptodius)exaratus,!460!Metapenaeus)dobsoni,!1374!Uca)annulipes,!9420!

Uca)triangularis,!8280!Morula)granulata,!370!Planaxis)sulcatus,!1010!Nassarius)fes:vus,!360!Turbo)coronatus,!3790!Artemia)salina,!380!

Helcion)concolor,!80!Cellana)radiata,!70!Nerita)albicilla,!1480!Nerita)chamaeleon,!2900!Tympanotonus)fuscatus,!18627!

Capitella)capitata,!193!

My:lopsis)sallei,!600!Mercenaria)mercenaria,!1000!Rangia)cuneata,!7694!Modiolus)auriculatus,!180!My:lus)edulis,!82!Ostrea)aupouria,!6!

Crassostrea)rhizophorae,!40000!Crassostrea)madrasensis,!88!Crassostrea)gigas,!560!

LC50!values!(µg/L)!

0>100!

101>500!

501>1000!

1001>2000!

2001>5000!

>!5000!

Preliminary&work.!By!mapping!polluJon!

sensiJvity!onto!a!phylogeneJc!tree,!we!can!

parJJon!variance!at!different!depths!of!the!

evoluJonary!tree.!Further,!we!can!measure!

"phylogeneJc!signal"!(PS).!PS!for!a!parJcular!

toxicant!may!be!weak!if!resistance!is!a!plasJc!

trait!or!if!it!evolves!rapidly.!In!such!cases,!

tolerance!in!one!species!will!be!a!poor!

predictor!of!tolerance!in!related!species.!As!a!

preliminary!example!(Fig.!2)!I!compiled!CuSO4!

lethality!data!(96h!LC50s)!for!marine!species!in!

the!ECOTOX!database!and!generated!a!

phylogeneJc!tree!using!MEGA!6!(Tamura!et!al.!

2013)!for!the!subset!of!those!species!with!

mitochondrial!COI!data!archived!in!GenBank.!

PhylogeneJc!signal!for!this!parJcular!toxicant!

appears!to!be!be!extremely!weak.!

!

Future&work.!Using!an!approach!similar!to!that!

taken!!in!Fig.!2,!we!will!measure!PS!for!a!broad!

range!of!toxicants,!including!contaminants!of!

emerging!concern!(CECs).!CECs!are!of!parJcular!

interest!here!because!resistance!to!these!

contaminants!may!have!evolved!relaJvely!

recently!and!therefore!be!present!in!only!a!

subset!of!branches.!PS!will!be!quanJfied!by!

standard!metrics!such!as!Blomberg’s!K!and!

Pagel’s!lambda,!thereby!allowing!comparison!

of!PS!for!different!contaminants.!

11

BUDGET-RELATED INFORMATION A. Budget Explanation/ Detailed Justification Personnel

One month of summer salary (1/9th academic year salary) is requested for the PI, who holds a 9-month appointment and will oversee, coordinate and participate in all aspects of the project. One Sea Grant trainee (TBD) is also requested, and the budget includes 3 months summer salary to supplement the chosen student’s 9-month traineeship (Ph.D. offer letters in USC-Dornsife now require a promise of 12 months support each year). I anticipate recruiting a Ph. D. student who will conduct a major portion of the proposed work as their thesis research, with the remainder of their Ph.D. dissertation funded by other sources. Graduate student tuition at USC is not charged to federal grants. Internal funds will be sought to support undergraduate research students. Annual increases of 3% were calculated for all salaries.

Materials and Supplies A new laptop computer (MacBook Pro) is requested for the Sea Grant trainee to use for this computationally expensive project.

Travel

In Year 1, funds are requested to allow the PI and Sea Grant trainee to attend and present at the 2016 SoCal SETAC conference to be held in San Diego, CA. In Year 2, funds are requested to allow the PI and Sea Grant trainee to attend and present at the 2017 North American SETAC conference (location TBA). B. Matching Funds Matching funds include one month of salary per year for the PI and funds for undergraduate research stipends to be requested from internal programs at USC (Women in Sciences and Engineering [WiSE], Undergraduate Research Associates Program [URAP], Rose Hills Foundation etc.). The Edmands lab has been consistently successful in obtaining internal funds to support undergraduate research (>$100K to date) and can reasonably expect to obtain these funds in the future.

12

ANTICIPATED BENEFITS The proposed work will evaluate the taxonomic distribution of toxicity data for saltwater organisms, both at the time that the National Guidelines were established (1985) and at the present time. This will be used to determine the most sensitive taxonomic groups and to assess holes in the available data. For what taxonomic groups are additional data most needed? If new saltwater model test species were to be developed, what should they be? The cost and time necessary to develop a new standardized model is well acknowledged, and the number of options is particularly limited for saltwater taxa, which are often not amenable to long-term laboratory culture. Meta-analysis of existing toxicity data is a cost-effective means of identifying the most critical need for new model test species. The work will also inform potential revisions in methodologies for deriving criteria for saltwater organisms. How often can the eight taxonomic family requirement be met? Given any change in the taxonomic distribution of toxicity data since 1985, should the number or type of required taxonomic groups be altered? This information is important for any potential revision to the National Guidelines, as well as to the California guidelines, which may be more flexible. The proposed phylogenetic analyses provide an alternative approach to dealing with data gaps, a problem that has long plagued agencies charged with protecting aquatic life. Assessing evolutionary patterns of sensitivity can provide insight into cases when taxonomic extrapolation is most and least effective. Specifically, we will test predictions that the success of surrogate species approaches will differ between long-standing and recently-introduced contaminants and between acute and chronic endpoints. This is important for optimizing approaches to using surrogate species as proxies for threatened or endangered species or for species that are not suitable for laboratory testing. The proposed project is directly relevant to groups and agencies involved in setting and using marine water quality standards, including the Southern California Coastal Water Research Project (SCCWRP), state and regional Water Boards, the USEPA and local advocacy groups such as Heal the Bay.

13

COMMUNICATION OF RESULTS Results will published in appropriate scientific journals and presented at conferences such as SETAC, which is attended by scientists, assessors, regulators and managers. The PI will also attend, via webinar, an upcoming meeting on potential revisions to the National Guidelines (http://water.epa.gov/scitech/swguidance/standards/criteria/aqlife/guidelines.cfm) and will make every effort to communicate with appropriate people at the USEPA. proposal was developed after conversations with state and federal regulators, including key people at the EPA and California water boards, as well as individuals at the UC Davis/Granite Canyon Marine Pollution Studies Lab, including Brian Anderson. While conflicts-of-interest issues prevent many state and federal regulators from writing support letters for project proposals, I will maintain communication with these agencies to ensure that the project produces results of direct use for water quality regulation.

14

REFERENCES ANZECC, ARMCANZ. 2000. Australian and New Zealand guidelines for fresh and marine water quality. Report Australian and New Zealand Environment and Conservation Council and Agriculture and Resource Management Council of Australia and New Zealand, Canberra, Australia. Asfaw A, MR Ellersieck & FL Mayer. 2003. Interspecies correlation estimations (ICE) for acute toxicity to aquatic organisms and wildlife. II. User manual and software. US Environmental Protection Agency Report No. EPA/600/R-03/106. Blomberg SP, Garland T & AR Ives. 2003. Testing for phylogenetic signal in comparative data: behavioral traits are more labile. Evolution 57:717-745. Buchwalter DB, DJ Cain, CA Martin, L Xie, SN Luoma and T Garland. 2008. Aquatic insect ecophysiological traits reveal phylogenetically based differences in dissolved cadmium susceptibility. Proc. Nat. Acad. Sci. USA 105: 8321-8326. Carew ME, AD Miller & AA Hoffmann. 2011. Phylogenetic signals and ecotoxicological responses: potential implications for aquatic monitoring. Ecotoxicology 20: 595-606. Chandler, G.T., T.L. Cary, D.C. Volz, S.S. Walse, J.L. Ferry and S.L.Klosterhaus. 2004. Fipronil effects on estuarine copepod (Amphiascus tenuiremis) development, fertility and reproduction: a rapid life cycle assay in 96-well microplate format. Environ. Toxicol. Chem. 23:117-124. Eddy FB. 2005. Ammonia in estuaries and effects on fish. J. Fish. Biol. 67:1495-1513. Hammond JI, DK Jones, PR Stephens & RA Relyea. 2012. Phylogeny meets ecotoxicology: evolutionary patterns of sensitivity to a common insecticide. Evolutionary Applications 5: 593-606. Hebert, P.D.N., A. Cywinska, S.L. Ball and J.R. DeWaard. 2003. Biological identification through DNA barcodes. Proc. R. Soc. Lond. B 270:313-321. Jin X, Z Wang, Y Wang, Y Lv, K Rao, W Jin, JP Giesy & KMY Leung. 2015. Do water quality criteria based on nonnative species provide appropriate protection for native species? Environ. Toxicol. Chem. 9999:1-6. Kwok KWH, EPM Grist & KMY Leung. 2009. Acclimation effect and fitness cost of copper resistance in the marine copepod Tigriopus japonicus. Ecotox. Env. Safety 72: 358-364. Letelier ME, AM Lepe, M Faundez, J Salazar, R Marin, P Aracena & H Speisky. 2005. Possible mechanisms underlying copper-induced damage in biological membranes leading to cellular toxicity. Chem. Bio. Interact 151:71-82.

15

Ling N. 2003. Rotenone- a review of its toxicity and use for fisheries management. Science for Conservation 211: 1-40. Klok C, P de Vries, R Jongbloed & J Tamis. 2012. Literature review on the sensitivity and exposure of marine and estuarine organisms to pesticides in comparison to corresponding fresh water species. Supporting Publications 2012:EN-357. [152 pp.]. Available online: www.efsa.europa.eu/publications Kwok KWH, KMY Leung, GSG Lui, VKH Chu, PKS Lam, D Morritt, L Maltby, TCM Brock, PJ Van den Brink, MSJ Warne & M Crane. 2007. Comparison of tropical and temperate freshwater animal species’ acite sensitivities to chemicals: implications for deriving safe extrapolation factors. Integ. Environ. Assess. Manag. 3:49-67. Kwok KWH, EPM Grist and KMY Leung. 2009. Acclimation effect and fitness cost of copper resistance in the marine copepod Tigriopus japonicus. Ecotoxicol and Env. Safety 72:358-364. Leung, K.M.Y., D. Morritt, J.R. Wheeler, P. Whitehouse, N. Sorokin, R. Toy, M. Holt and M. Crane. 2001. Can saltwater toxicity be predicted from freshwater data? Mar. Pollut. Bull. 42(11):1007-1013. Menconi M and J. Beckman 1996. Hazard assessment of the insecticide methomyl to aquatic organisms in the San Joaquin River System. Environmental Services Division. Administrative Report 96-6. Posthuma L. TP Traas, GW Suter. 2002. Species Sensitivity Distributions in Ecotoxicology. Lew Publishers, Boca Raton FL. Raimondo S, DN Vivian & MC Barron. 2007. Web-based interspecies correlation estimation (Web-ICE) for acute toxicity: User Manual Version 2.0. Raimondo S, DN Vivian, C Delos & MG Barron. 2008. Protectiveness of species sensitivity distribution hazard concentrations for acute toxicity used in endangered species risk assessment. Environ. Toxicol. Chem. 27: 2599-2607. EPA/600/R-07/071. Gulf Breeze, FL Raimondo S, CR Jackson & MG Barron. 2010. Influence of taxonomic relatedness and chemical mode of action in acute interspecies estimation models for aquatic species. Environ. Sci. Technol. 7711-7716. Raisuddin, S., K.W.H. Kwok, K.M.Y. Leung, D. Schlenk, J.-S. Lee. 2007. The copepod Tigriopus: A promising marine model organisms for ecotoxicology and environmental genomics. Aquatic Toxicol. 83:161-173. Scott GI, MH Fulton, SB Weisberg, KA Maruya & G Lauenstain. 2012. Contaminants of concern in the marine environment: the need for new monitoring and assessment strategies. J. Mar. Biol. Oceanogr. 1:1.

16

Stephen CE, DI Mount, DJ Hansen, JR Gentile, GA Chapman & WA Brungs. 1985. Guidelines for Deriving Numerical National Water Quality Criteria for the Protection of Aquatic Organisms and their Uses. PB-85-227049. US Environmental Protection Agency, National Technical Information Service, Springfield, VA Sun PY, HB Foley, L Handschumacher, A Suzuki, T Karamanukyan & S Edmands, 2014. Acclimation and adaptation to common marine pollutants in the copepod Tigriopus californicus. Chemosphere 112:465-471 Sun PY, HB Foley, VWW Bao, KMY Leung & S Edmands, 2015. Variation in tolerance to common marine pollutants among different populations in two species of the marine copepod Tigriopus. Environmental Science and Pollution Research. DOI 10.1007/s11356-015-4846-3 Tamura K, Stecher G, Peterson D, Filipski A & Kumar S, 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mo. Biol. Evol. 30: 2725-2729.

Tenbrook PL, RS Tjeerdema, P Hann & J Karkoski. 2009. Methods for deriving pesticide aquatic life criteria. Rev. Environ. Contamin. Toxicol. 199: 19-109.

Tenbrook PL, AJ Palumbo, TL Fojut, P Hann, J Karkowski & RS Tjeerdema. 2010. The University of California-Davis Methodology for Deriving Aquatic Life Pesticide Water Quality Criteria. In D.M. Whitacre (ed.), Reviews of Environmental Contamination and Toxicology 209:1-155.

U.S. Environmental Protection Agency. 2015. ECOTOX User Guide: ECOTOXicology Database System. Version 4.0. Available: http:/www.epa.gov/ecotox/

U.S. Environmental Protection Agency. 2003. Water quality guidance for the Great Lakes system. Fed. Registr. 40

Weston DP, HC Poynton, GA Wellborn, MJ Lydy, BJ Blalock, MS Sepulveda & JK Colbourne. 2013.Multiple origins of pyrethroid insecticide resistance across the species complex of a non-target aquatic crustacean, Hyalella azteca. Proc Nat. Acad. Sci. USA 110: 16532-16537. Wu J, J Lu, H Lu, YJ Lin & PC Wilson. 2015. Occurrence and ecological risks from fipronil in aquatic environments located within residential landscapes. Science of the Total Environment 518: 139-147.

1

Projected Work Schedule Project Title: META-ANALYSIS OF THE USEPA’S ECOTOX DATABASE: AN EVOLUTIONARY PERSPECTIVE ON CHOOSING ORGANISMS FOR MARINE WATER QUALITY ASSESSMENT

Activities 2016-2017 F M A M J J A S O N D J Choice of chemicals and endpoints to be assessed

X X

Survey of taxonomic composition pre- and post-1985

X X X X X

Analysis of SSDs and HC5s pre- and post-1985

X X X X X

Activities 2017-2018 F M A M J J A S O N D J Construction of phylogenetic trees

X X X X

Analysis of phylogenetic patterns and signal

X X X X

Manuscript preparation and communication of final results

X X X X X X

OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: USC Sea Grant GRANT/PROJECT NO.:

DURATION (months):February 1 2016 - January 31, 2017

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: 1 2.0 15,000 15,000b. Associates (Faculty or Staff):

Sub Total: 1 2.0 15,000 15,000

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students: 1 3.0 7,125d. Prof. School Students:e. Pre-Bachelor Student(s): 2 2.0 3,000f. Secretarial-Clerical:g. Technicians:h. Other:

Total Salaries and Wages: 4 7.0 22,125 18,000

B. FRINGE BENEFITS: 31.1% 4,665 4,665Total Personnel (A and B): 26,790 22,665

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT: 2,000

E. TRAVEL:1. Domestic 5002. International

Total Travel: 500 0

F. PUBLICATION AND DOCUMENTATION COSTS:

G. OTHER COSTS:1234567

Total Other Costs: 0 0

TOTAL DIRECT COST (A through G): 29,290 22,665

INDIRECT COST (On campus 65% ): 0 19,039 14,732INDIRECT COST (Off campus % of $ ):

Total Indirect Cost: 19,039 14,732

TOTAL COSTS: 48,329 37,397

PRINCIPAL INVESTIGATOR: Suzanne Edmands

BRIEF TITLE: Meta-analysis of the USEPA's ECOTOX database

OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: USC Sea Grant GRANT/PROJECT NO.:

DURATION (months):February 1 2017 - January 31, 2018

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator:b. Associates (Faculty or Staff):

Sub Total: 1 2.0 15,450 15,450

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students: 1 3.0 7,339d. Prof. School Students:e. Pre-Bachelor Student(s): 2 2.0 3,000f. Secretarial-Clerical:g. Technicians:h. Other:

Total Salaries and Wages: 4 7.0 22,789 18,450

B. FRINGE BENEFITS: 31.1% 4,805 4,805Total Personnel (A and B): 27,594 23,255

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT:

E. TRAVEL:1. Domestic 2,5002. International

Total Travel: 2,500 0

F. PUBLICATION AND DOCUMENTATION COSTS:

G. OTHER COSTS:1234567

Total Other Costs: 0 0

TOTAL DIRECT COST (A through G): 30,094 23,255

INDIRECT COST (On campus 65%): 65% 19,561 15,116INDIRECT COST (Off campus of $ ):

Total Indirect Cost: 19,561 15,116

TOTAL COSTS: 49,655 38,371

PRINCIPAL INVESTIGATOR: Suzanne Edmands

BRIEF TITLE: Meta-analysis of the USEPA's ECOTOX database

2

BRIEF CURRICULUM VITAE NAME Suzanne Edmands Address Department of Biological Sciences, 3616 Trousdale Parkway University of Southern California, Los Angeles, CA 90089 Phone Work: 213-740-5548; Home: 323-256-2300; Cell 626-437-1698 Email sedmands@usc.edu (lab website: https://dornsife.usc.edu/labs/edmands/) EDUCATION 1988-94 Doctoral Program (Ph.D., Biology) University of California at Santa Cruz.

Advisor: Donald C. Potts. Thesis: Genetic and evolutionary consequences of contrasting mating systems in the sea anemone genus Epiactis

1983-87 Undergraduate Program (B.A., Biology, cum laude), Carleton College, MN POSITIONS HELD 2013- Professor, Department of Biological Sciences, University of Southern California

(Associate Professor 2005-2013; Assistant Professor 1998-2005) 1996-98 NSF Postdoctoral Fellow, Department of Biology, University of Oregon.

Advisor: Michael Lynch. Research: Genetic mechanisms underlying inbreeding depression, outbreeding depression and hybrid vigor

1994-96 Postdoctoral Research Associate, Scripps Institution of Oceanography, University of California at San Diego. Advisor: Ronald Burton. Research: 1) Genetic structure of purple sea urchin populations, 2) Nuclear-mitochondrial coevolution in an intertidal copepod

SELECTED PUBLICATIONS Sun PY, HB Foley, VWW Bao, KMY Leung & S Edmands, 2015. Variation in tolerance to common marine pollutants among different populations in two species of the marine copepod Tigriopus. Environmental Science and Pollution Research. DOI 10.1007/s11356-015-4846-3 Edmands S, 2015. Blurred lines: scientific and legislative issues surrounding hybrids and conservation. Current Zoology 61(1):128-131.

3

Sun PY, HB Foley, L Handschumacher, A Suzuki, T Karamanukyan & S Edmands, 2014. Acclimation and adaptation to common marine pollutants in the copepod Tigriopus californicus. Chemosphere 112:465-471. Foley BR, CG Rose, DE Rundle, W Leong & S Edmands, 2013. Postzygotic isolation involves strong mitochondrial and sex-specific effects in Tigriopus californicus, a species lacking heteromorphic sex chromosomes. Heredity 111:391-401. Peterson DL, KB Kubow, MJ Connolly, LR Kaplan, MM Wetkowski, BC Phillips, W Leong & S Edmands, 2013. Reproductive and phylogenetic divergence of tidepool copepod populations across a narrow geographical boundary in Baja California. Journal of Biogeography 40: 1664-1675. Pritchard VL & S Edmands, 2013. The genomic trajectory of hybrid swarms: outcomes of repeated crosses between populations of Tigriopus californicus. Evolution 67:774-791. [Recommended by Faculty of 1000] Hwang AS, SL Northrup, DL Peterson, Y Kim & S Edmands, 2012. Long-term experimental hybrid swarms between nearly incompatible Tigriopus californicus populations: persistent fitness problems and assimilation by the superior population. Conservation Genetics 13:567-579. Foley BR, CG Rose, DE Rundle, W Leong, GW Moy RS Burton & S Edmands, 2011. A gene-based SNP resource and linkage map for the copepod Tigriopus californicus. BMC Genomics 12:568. Purcell CM & S Edmands, 2011. Resolving the genetic structure of striped marlin, Kajikia audax, in the Pacific Ocean through spatial and temporal sampling of adult and immature fish. Canadian Journal of Fisheries and Aquatic Sciences 68:1861-1875. Vogel AB, KA Selkoe, D Anderson & S Edmands, 2009. Development and inheritance of molecular markers in the kelp bass, Paralabrax clathratus. Fisheries Science. 75(2):525-27. Hedgecock D, PH Barber & S Edmands, 2007. Genetic approaches to measuring connectivity. Oceanography 20(3):70-79 [invited review] Edmands S, 2007. Between a rock and a hard place: Evaluating the relative risks of inbreeding and outbreeding for conservation and management. Molecular Ecology 16:463-475. [invited review] Edmands S & DC Potts. 1997. Population genetic structure in brooding sea anemones (Epiactis spp.) with contrasting reproductive modes. Marine Biology 127:485-498. Edmands S, PE Moberg & RS Burton. 1996. Allozyme and mitochondrial DNA evidence of population subdivision in the purple sea urchin Strongylocentrotus purpuratus. Marine Biology 26:443-450.

8

SUMMARY PROPOSAL FORM PROJECT TITLE: META-ANALYSIS OF THE USEPA’S ECOTOX DATABASE: AN

EVOLUTIONARY PERSPECTIVE ON CHOOSING ORGANISMS FOR MARINE WATER QUALITY ASSESSMENT

OBJECTIVES The proposed project is a meta-analysis of existing toxicity data aimed at optimizing methodologies for protecting saltwater aquatic life. One major objective is to survey saltwater toxicity data in the ECOTOX database, both before and after the National Guidelines were established (1985). This will be used to determine the most sensitive taxonomic groups, to evaluate any taxonomic holes in the data, and to assess whether changes to the taxonomic requirements of the National Guidelines are warranted. A second major object is to evaluate phylogenetic patterns of sensitivity to different chemicals. This will be used to test hypotheses for why tolerance may be more phylogenetically restricted in some cases than in others. METHODOLOGY A minimum of twelve chemical substances will be chosen to span different modes of action and histories of presence in the marine environment. For all chosen chemicals, the ECOTOX database will be surveyed for LC50 values in saltwater animals. For at least two chemicals, the database will also be surveyed for a chronic endpoint. For each chemical-endpoint combination, we will analyze data available in 1985 vs. the present, including analyses of taxonomic composition, species sensitivity distributions (SSDs) and the fifth percentile hazard concentration (HC5). For phylogenetic analyses, evolutionary trees will be constructed using archived data for the standard barcoding gene, mitochondrial COI. For each chemical-endpoint combination, toxicity data will be mapped onto the tree and used to assess phylogenetic patterns and calculate phylogenetic signal. RATIONALE Limited toxicity data for saltwater species is an acknowledged problem in deriving marine water quality criteria. Meta-analysis of existing databases can help determine the most critical taxonomic data holes and inform methodologies for deriving criteria intended to protect the wide evolutionary diversity of marine life. The proposed work uses an alternative approach, based on a phylogenetic framework, to assess the problem of taxonomic data gaps. DATA SHARING PLAN Results will be published in the scientific literature and presented at conferences such as SETAC that are attended by a mix of scientists, regulators, assessors and managers. Throughout the project, progress and results will be shared with key people at state and federal agencies such as the EPA and California Water Boards.

University of Southern California Sea Grant Proposal

PROJECT TITLE: INTEGRATING INFORMATION FROM CLIMATE SCIENTISTS AND RESOURCE MANAGERS: INFORMING PREPAREDNESS AND ADAPTATION TO EXTREME EVENT IMPACTS ON WATER QUALITY IN SOUTHERN CALIFORNIA PRINCIPAL INVESTIGATORS: Julia Ekstrom, Climate Adaptation Program Director, UC Davis Policy Institute for Energy, Environment and the Economy (PIEE)

Louise Bedsworth, Visiting Research Fellow, UC Davis PIEE OTHER KEY PERSONNEL: Mark Lubell, Professor, Department of Environmental Science and Policy, UC Davis FUNDING REQUESTED: 2016-2017 $13,950 Federal/State $13,079 Match 2017-2018 $16,163 Federal/State $13,166 Match STATEMENT OF THE PROBLEM: Extreme events associated with a changing climate already are beginning to create new challenges for resource managers, including water suppliers. In some cases, the challenge will be to address more severe or frequent occurrences of events that have previously been experienced (e.g., spikes in air or water pollution), while in others, management will need to address new problems (e.g., protection of treatment facilities from new flood risks). Science can help managers to anticipate and plan for these changes, but only if scientists have adequate understanding of what resource managers consider an extreme event, how that relates to impacts, and the type of information desired to help in managing that risk. To date, extreme events have been defined by scientists through a top-down approach, relying on observations for current extremes and climate model projections based on future scenarios for their expected changes. These abstract definitions of extreme events are based on a corresponding characterization of what is “normal” and perhaps the choice of a threshold (e.g., a percentile of a historical distribution for a given climate variable) beyond which would represent an extreme event. However, as a result of the typical one way flow from scientists to practitioners (McNie 2007), there are not necessarily direct connections between these abstract definitions and what is extreme in terms of impacts that challenge resource management (Cash and Buizer, 2005; Lemos et al. 2012; Vogel and O’Brien, 2006).

Ideally, the relationship of extreme climate conditions to extreme impacts would be informed by a bottom-up or co-production approach, with input from stakeholders and on-the-ground resource managers who are familiar with the systems being impacted, the climate conditions that pose risks to those systems, and their resilience and adaptive capacity (McNie 2007; Mastrandrea et al, 2009; 2010; Lemos et al. 2012; Kirchhoff 2013; Meadow et al. in prep; Moser and Ekstrom 2011). To ensure that the analysis of events from the climatic perspective is relevant to informing management of the associated risks in specific sectors, it is important to select specifications and thresholds that are consistent with the scale and nature of management decisions (Carbone and Dow 2005; Lemos et al. 2012). Closer interactions between resource managers and climate scientists not only can inform the scientific process as to information needs for management, but will also inform resource managers of the ability (and limitations) of currently-available climate science information to contribute to management decisions (Ferguson et al. 014). Armed with this learning, resource managers can make decisions about how to proceed under uncertainty, weighing the risks of the impacts of a given event and the tolerance for that risk. The research project that we propose aims to develop a better understanding of climate information needs for water quality management in and to work together with climate scientists to find opportunities to meet these needs. At the same time we will evaluate the types (and strengths) of relationships that exist between water managers and scientists to identify opportunities for and challenges to co-production of climate information in California to managing water quality. INVESTIGATORY QUESTION: This study will test whether the use of such a bottom-up/top-down approach can facilitate the development of more useful indicators to help local water managers prepare for the increased occurrence of extreme events under a changing climate. At the same time, the investigation will assess how closer interactions between local water supply managers and scientists can help develop priorities for robust management activities that increase preparedness and adaptive capacity for an uncertain future.

MOTIVATION: This investigation is motivated by the hypothesis that there is a mismatch between the availability and salience of indicators of extreme events under a changing climate and information desired by regional and local water quality managers to respond to those events. Recent studies have shown that while resource managers understand the risks associated with climate change, in many cases they do not feel that available information is helpful for improving preparedness (Tribbia and Moser, 2008; Maibach et al., 2008; Bedsworth, 2009; Lemos et al. 2014). Studies have suggested that an integrated approach that combines bottom-up information from resource managers with climate science data can help address this gap. Such an approach can also serve as an opportunity for both resource managers and climate scientists to build understanding about the more general ability of climate science to provide the desired information.

Page 1

GOALS AND OBJECTIVES: The overall goal of this project is to develop and test a set of indicators of extreme events under a changing climate that have relevance for preparedness and adaptation within the water quality sector in California. We will do this through an iterative process by comparing water quality managers’ understanding of the vulnerabilities of their systems and points in decision-making where climate information could be (and already is) useful. Throughout the study we will compare these needs and opportunities with what climate scientists are or can generate (in terms of extreme events and projections, as relevant to water quality). By working with resource managers and climate scientists, we will develop more relevant definitions of extreme events to guide the development of policy-relevant climate impacts data. METHODS: This proposed case study is part of a larger project funded primarily by the US Environmental Protection Agency looking across California for how to better connect the science of climate extremes projected with the needs of practitioners for climate adaptation. By investigating both what science is being produced and what practitioners need (a top-down/bottom-up combined approach), this can help provide information in a useful format that is salient to decision making for climate adaptation. The “bottom-up” portion of the methods involve surveying water managers, analyzing water management plans and other documents, and case study analysis (interviews). Surveys will be used to gather information from resource managers on past and future risks of extreme events and to identify the needs and capacity of managers to prepare for those risks. Case studies will allow a more in-depth investigation of water managers daily, seasonal, and longer term planning and management needs for safeguarding water quality.

• 2015 (Year 0): We are conducting initial key informant interviews and surveying water utilities to inform the development of case studies. These are primarily to understand practitioner needs and current practices in management of water quality. In parallel we will interview climate scientists (identified through snowball sampling) to document the suite of extreme event projections that relate to water quality threats in California and tally what thresholds they use to define extreme climate-related events.

• 2016 (Year 1): We will conduct case studies across California and working with scientists and water quality managers, one of which will be focused on Los Angeles and its regional concerns of how climate change will degrade water quality.

• 2017 (Year 2): We will test and verify relevancy of findings in Los Angeles for applying the lessons learned to other areas or management sectors in California. With these findings, we plan to develop a guidance tool for decision makers.

RELATED RESEARCH: The research project that we propose aims to integrate scientific approaches to the identification and analysis of extreme events in a changing climate with an assessment and understanding of

Page 2

challenges and opportunities for adaptation to these extreme events and their impacts as they are and will be experienced by water quality managers. Scholars (Mastrandrea et al. 2010; Moser and Ekstrom 2011, among others), government agencies (EPA 2010), and cross-organizational collaborations (Stratus Consulting and Denver Water 2015; Yates and Miller 2011; Groves et al. 2014) suggest and demonstrate the usefulness of a top-down/bottom-up model for vulnerability assessments and other actionable climate change information development. Such an approach combines information from historical climate data and climate projections with information collected from resource managers through surveys, interviews, and other on-the-ground data collection about the system. The need for such an approach is increasingly apparent from information gathered from resource managers in a range of sectors, and has been recognized in the climate and impact science communities for some time (e.g., Carter et al. 2007). In fact a study with climate scientists and large climate-progressive water utilities from around the US reports that information on extreme event impacts were “the most sought-after projections for many of the utilities,” (Vogel et al. 2015: vi). In many cases resource managers recognize the existence of climate change-related risks, but they do not feel well equipped to respond to those risks (e.g., for study of coastal mangers, see Moser and Luers, 2008 and Tribbia and Moser, 2008 and for studies of public health officers see Maibach et al., 2008 and Bedsworth, 2009). While the lack of salient, accessible and available information is not always the major impediment for practitioners trying to adapt (e.g., for coastal communities, see Hart et al. 2011), in other cases this barrier does persist (e.g., as demonstrated in Vogel et al. 2015 and based on preliminary discussions with water utilities in California). While the larger overall statewide project focuses on air and water quality management in California, the proposed case study will focus on water quality management in the Los Angeles region. Specific case studies (including which public water systems to focus on within the Los Angeles region) will be selected to maximize transferability of the findings to other states and regions, taking advantage of the geographic and climatic diversity within California. Los Angeles provides an especially appealing location for one (or more) case studies given how well the information about drinking supply systems have been recently documented (see DeShazo and McCann 2015). The region’s largest water retailer, the Los Angeles Department of Water and Power has increased local supplies and has successfully made demands for water more efficient (Hughes et al. 2013); and the region has a relatively advanced regional climate adaptation collaborative that could help support water utility needs (Los Angeles Regional Collaborative, LARC – see letter of support from Kline). At the same time, relatively little research has focused on the threats of water quality in the coastal urban areas of Los Angeles County. Which, if any, sources of supply are threatened by sea level rise and flooding (e.g., salt water intrusion into groundwater basins, water treatment plants at risk of flooding or storm surge, and others)? Does all of the supply to coastal communities come from purchased water, and if so, how is this supply vulnerable to climate change extreme events? Are local water utilities preparing for these expected impacts and how do efforts (and barriers) compare? The ongoing research and governance efforts demonstrate interest exists in the region for adaptation to climate change (as does the letter of support from Krista Kline, LARC), and therefore providing clear potential users (scientists and water utility managers) and beneficiaries (water utilities and representative organizations) of the results of the study.

Page 3

BUDGET-RELATED INFORMATION:

PERSONNEL (SALARIES AND BENEFITS)

Julia Ekstrom (PI): Ekstrom is the lead researcher and manager of the larger statewide study in which this case study is embedded. We request 12 of months of salary at 6.7% in Year 1 and 5.9% in Year 2. This is approximately six weeks per year at 50% time (140 hours) towards the Los Angeles case study, which includes connecting with other ongoing studies in the region (such as through USC and UCLA, USGS or other), conducting interviews with scientists and utility managers and water quality experts in person and over the phone, document analysis and results presentation/delivery.

Benefits: Benefits are calculated at the current composite rates. Salaries are inflated by 3% every July for cost of living increases.

TRAVEL

We requests funds to cover the flights for a total of eight 2-day trips, two in year 1 (one for graduate student and one for Ekstrom) and six in year two (three each for graduate student and Ekstrom), to Southern California for interviews and meetings with utilities and climate scientists. Flights costs were estimated as non-stop flights of $250 per round trip ticket, per current estimates from Southwest airlines (from Sacramento to Burbank airports).

MISCELLANEOUS/OTHER Office Supplies: We request $1100 in funding for publication costs for Year 2. GAEL: We request funding to cover the campus’ general liability insurance at a cost of $0.56 per $100 of salary charged to the project.

INDIRECT COST RATE

The indirect rate is 56.6% in FY 15/16, and 57% in FY 16/17 – 17/18.

A. Matching Funds

The non-federal matching funds to couple with the Los Angeles case study work is supported by in-kind advising from Professor Mark Lubell (UC Davis, Environmental Science and Policy Department) and Dr. Amber Mace (UC Davis Policy Institute). Prof. Lubell is the dissertation chair for the two graduate student assistants working on the larger statewide project and therefore will be involved in the case study design and interpretation, including interview questionnaire development that will be used for the Los Angeles case study. Dr. Mace is a Policy Fellow and co-founder of the Policy Institute. She has over 15 years of experience working at the science-policy interface and will help advise throughout this project to guide it in a direction that is policy and management relevant. Lubell is providing 3.4% time over Year 1 (equivalent to

Page 4

$5000) and 3.3% time over Year 2 (equivalent to $5000) and Mace is providing 0.6% time over Year 1 to the project, equivalent to $1000, and 0.6% time over Year 2 advising the project. ANTICIPATED BENEFITS: This project will provide several useful and relevant outcomes that will be important for a variety of communities. First, water systems selected as part of case studies in this project (to be determined based on completion of survey in Summer 2015) are expected to benefit the most directly from the results of this study. From these water systems, we will compile the types of information used to determine when water quality thresholds are reached and then relay these to climate scientists. By articulating the information needs and water quality system-specific thresholds to climate scientists – and also in our working with climate scientists, we expect to help water systems get the water quality-related information (projections, forecasts, etc.) they need and in the useable format for climate change adaptation planning. Next, the work will result in contributions to the academic scholarship on climate change adaptation. There is a growing recognition of the need to employ an approach to adaptation like the one being implemented in this work. We will produce several journal articles based on our work, aimed to inform the climate science and environmental management communities. We will also prepare presentations for relevant academic conferences, federal, state and local resource managers, policymakers, and other interested audiences. The indicators of extreme events that are produced through this research will provide valuable information to climate scientists and the resource management community. Because the indicators will be developed through an integrated process, they will reflect the information needs of resource managers, but also the inherent uncertainty of climate change predictions. The process of developing these indicators will help to inform climate scientists about how to produce information that is most useful to resource managers. And, concurrently, resource managers will learn about the limitations of the available climate science and where management under uncertainty is unavoidable. Further, this research will provide valuable real-world experience that will be broadly applicable to adaptation planning. Analysis of the survey findings will help to identify common characteristics and information needs of water quality managers and how far along they are in adapting to climate change (in terms of water quality management). Careful selection of representative case studies will help to ensure that the findings are broadly applicable in other states and regions.

COMMUNICATION OF RESULTS: Results will be transmitted in the form of publications (academic), briefings to water utilities and regional stakeholders working on climate adaptation (including at forums of the Association of California Water Utilities and LARC) as results are with more emphasis on dissemination in the final year of the project.

Page 5

REFERENCES:

Bedsworth, L. 2009. Preparing for climate change: A perspective from local health officers in California. Environmental Health Perspectives 117(4): 617-623.

Carter, T. R. et al. 2007. General Guidelines on the Use of Scenario Data for Climate Impact and Adaptation Assessment. Report of the Task Group on Data and Scenario Support for Impact and Climate Assessment (TGICA) of IPCC. http://www.ipcc-data.org/guidelines/TGICA_guidance_sdciaa_v2_final.pdf

Cash, D. W., and J. Buizer. 2005. Knowledge-Action Systems for Seasonal-to-Interannual Climate Forecasting. Washington, D.C.: National Academies Press.

Chen, W., K., Haunschild, J. Lund, and W. Fleenor. 2010. Current and long-term effects of Delta water quality on drinking water treatment costs from disinfectant byproduct formation. San Francisco Estuary and Watershed Science 8(3).

Conrad, E. (2013). Preparing for New Risks: Addressing Climate Change in California's Urban Water Management Plans. Report to the Department of Water Resources.

Cutter, S., B. Osman-Elasha, J. Campbell, S.-M. Cheong, S. McCormick, R. Pulwarty, S. Supratid, and G. Ziervogel, 2012: Managing the risks from climate extremes at the local level. In: Managing the Risks of Extreme Events and Disasters to Advance Climate Change Adaptation [Field, C.B., V. Barros, T.F. Stocker, D. Qin, D.J. Dokken, K.L. Ebi, M.D. Mastrandrea, K.J. Mach, G.-K. Plattner, S.K. Allen, M. Tignor, and P.M. Midgley (eds.)]. A Special Report of Working Groups I and II of the Intergovernmental Panel on Climate Change (IPCC). Cambridge University Press, Cambridge, UK, and New York, NY, USA, pp. 291-338

DeShazo, J.R. and Henry McCann. “Los Angeles County Community Water Systems: Atlas and Policy Guide Volume I” UCLA Luskin Center for Innovation. March 2015.

Dilling, L., and M. C. Lemos, 2011: Creating usable science: Opportunities and constraints for climate knowledge use and their implications for policy. Global Environ. Change, 21, 680–689, doi:10.1016/j.gloenvcha.2010.11.006.

Feldman, D. L., and H. Ingram, 2009: Making science useful to decision makers: Climate forecasts, water management, and knowledge networks. Wea. Climate Soc., 1, 9–21, doi:10.1175/2009WCAS1007.1.

Ferguson, D., Rice, J., and Woodhouse, C. 2014. Linking Environmental Research and Practice: Lessons from the Integration of Climate Science and Water Management in the Western United States. Tucson, AZ: Climate Assessment for the Southwest: pp19.

Frich, P., L. V. Alexander, P. Della-Marta, B. Gleason, M. Haylock, Amgk Tank, and T. Peterson. 2002. Observed coherent changes in climatic extremes during the second half of the twentieth century. Climate Research 19(3): 193-212.

Page 6

Groves et al. (2014) Developing Robust Strategies for Climate Change and Other Risks: A Water Utility Framework. http://www.waterrf.org/PublicReportLibrary/4262.pdf

Hanak, E., J. Lund, A. Dinar, B. Gray, R. Howitt, J. Mount, P. Moyle, and B. Thompson. 2011. Managing California’s Water: From Conflict to Reconciliation. San Francisco: Public Policy Institute of California.

Hart, J., P. Grifman, S. Moser, A. Abeles, M. Myers, S. Schlosser, J. Ekstrom. 2012. Rising to the Challenge: Results of the 2011 Coastal California Adaptation Needs Assessment.USCSG-TR-01-2012. (PDF)

Hughes, S., Pincetl, S. and Boone, C. 2013. Triple exposure: Regulatory, climatic, and political drivers of water management changes in the city of Los Angeles. Cities 32:51-59 (http://www.sciencedirect.com/science/article/pii/S0264275113000255)

IPCC, 2012: Managing the Risks of Extreme Events and Disasters to Advance Climate Change Adaptation. A Special Report of Working Groups I and II of the Intergovernmental Panel on Climate Change [Field, C.B., V. Barros, T.F. Stocker, D. Qin, D.J. Dokken, K.L. Ebi, M.D. Mastrandrea, K.J. Mach, G.-K. Plattner, S.K. Allen, M. Tignor, and P.M. Midgley (eds.)]. Cambridge University Press, Cambridge, UK, and New York, NY, USA, 582 pp.

Kirchhoff, C., 2013: Understanding and enhancing climate information use in water management. Climatic Change, 119, 495–509, doi:10.1007/s10584-013-0703-x. Lemos, M. C., C. Kirchhoff, J., and V. Ramprasad, 2012: Narrowing the climate information usability gap. Nature Clim. Change, 2, 789-793.

Lemos, M. C., C. Kirchhoff, J., S. E. Kalafatis, D. Scavia, and R. B. Rood, 2014: Moving climate information off the shelf: Boundary chains and the role of RISAs as adaptive organizations. Bull. Amer. Meteor. Soc., 6, 273-285.

McNie, E. C., 2007: Reconciling the supply of scientific information with user demands: An analysis of the problem and review of the literature. Environ. Sci. Policy, 10, 17–38, doi:10.1016/j.envsci.2006.10.004.

Maibach, E. W., A. Chadwick, D. McBride, M. Chuk, K. L. Ebi, and J. Balbus. 2008. Climate change and local public health in the United States: Preparedness, programs and perceptions of local public health department directors. PLOS One 3(7).

Mastrandrea, M. Tebaldi, C., and S. Schneider. 2009. Current and Future Impacts of Extreme Events in California. Sacramento: California Energy Commission.

Mastrandrea, M. Heller, T. Root, and S. Schneider. 2010. Bridging the Gap: Linking Climate-Impacts Research with Adaptation Planning and Management. Climatic Change 100: 87-101.

Meadow, A., Ferguson, D.B., Guido, Z., Horangic, A., Owen, G., and Wall, T. In prep. Moving toward the deliberate co-production of climate science knowledge.

Page 7

Moser, S. and J. Ekstrom. 2010. A framework to diagnose barriers to climate change adaptation. Proceedings of the National Academy of Science 107(51): 22026-22031.

Moser, S. and J. Ekstrom, 2011. Taking ownership of climate change: Stakeholder-intensive adaptation planning in two California communities. Journal of Environmental Studies and Sciences (JESS) 1(1).

Moser, S. and A. Luers. 2008. Managing climate risks in California: The need to engage resource managers for successful adaptation to change. Climatic Change 87(S1): 309-322.

Schneider, S.H. et al. 2007 Assessing Key Vulnerabilities and the Risk from Climate Change. In: Parry, M. et al. (eds). Climate Change 2007: Impacts, Adaptation, and Vulnerability – Contribution of Working Group II to the Intergovernmental Panel on Climate Change Fourth Assessment Report. Cambridge University Press, Cambridge, UK, pp 779-810.

Tebaldi, C. and Alexander, L.A. 2011. Weather and Climate Extremes: Observations, Modeling and Projections. In Henderson-Sellers and McGuffie (eds). Future of the World’s Climate. Elsevier.

Tribbia, J., and S. Moser. 2008. More than information: What coastal managers need to plan for climate change. Environmental Science & Policy 11(4): 315-328.

Vogel, C.H. and O’Brien, K. 2006. Who can eat Information? Examining the effectiveness of seasonal climate forecasts and regional climate-risk management strategies. Climate Research 33: 111-122.

Vogel, J. M., et al. (2015). Actionable Science in Practice: Co-Producing Climate Change Information for Water Utility Vulnerability Assessments Final Report for the Pilot Utility Modeling Applications (PUMA) Project. Water Utility Climate Alliance. Yates, D., and K. Miller. 2011. Climate Change in Water Utility Planning: Decision Analytic Approaches. Water Research Foundation and the University Corporation for Atmospheric. Research, Denver, CO.

Page 8

BRIEF CURRICULUM VITAE NAME Julia Ekstrom Address 1715 Tilia St., Ste 100, UC Davis, Davis, CA 95616 Phone (work) 530-752-0152 (home) 805-689-7449; Email jekstrom@ucdavis.edu EDUCATION 2008: PhD, Marine Science (coastal/ocean governance focus), UC Santa Barbara 2001: Bachelors of Science, Conservation and Resource Studies, UC Berkeley POSITIONS HELD Director, Climate Adaptation Program, Policy Institute for Energy, Environment and the Economy, University of California, Davis (October 2014-p.)

Steering Committee Member, Capital Region Climate Collaborative (October 2014-p.)

Science Fellow, Natural Resources Defense Council, San Francisco, CA (2012-2014)

Postdoctoral Researcher, University of California, Berkeley (2010-2012)

Postdoctoral Fellow, Lawrence Berkeley National Lab, Berkeley (2009-2010)

Hired for various contract work, including for climate change vulnerability assessments (all with Susanne Moser): City of Hermosa Beach (2014); City of Los Angeles/USC Sea Grant (May-July 2012); Local Government Commission/San Luis Obispo County and Fresno County (2009-2011).

SELECTED PUBLICATIONS

Ekstrom, J.A. and S.C. Moser. 2014. Identifying and overcoming barriers in urban climate adaptation: Case study findings from the San Francisco Bay Area, California, USA. Urban Climate 9: 54-74

Ekstrom, J. and S. Moser. 2012. Climate Change Impacts, Vulnerabilities, and Adaptation in the San Francisco Bay Area. California Energy Commission. Publication number CEC-500-2012-071

Moser, S., J. Ekstrom, G. Franco. 2012. Our Changing Climate 2012: Vulnerability & Adaptation to the Increasing Risks from Climate Change in California. A Summary Report on the Third Assessment from the California Climate Change Center. Publication number: CEC-500-2012-007.

Ekstrom, J., and S. Moser. 2012. Sea-level rise impacts and flooding risks in the context of social vulnerability: an assessment for the City of Los Angeles. Prepared for the Mayor’s Office, City of Los Angeles. (PDF)

Finzi Hart, J., P. Grifman, S. Moser, A. Abeles, M. Myers, S. Schlosser, J. Ekstrom. 2012. Rising to the Challenge: Results of the 2011 Coastal California Adaptation Needs Assessment.USCSG-TR-01-2012. Moser, S. and J. Ekstrom. 2010. A framework to diagnose barriers to climate change adaptation. Proceeding of the National Academy of Sciences (PNAS). 107(51):22026-22031.

Page 10

BRIEF CURRICULUM VITAE

NAME Louise Bedsworth Address 1715 Tilia St. Ste 100, Davis, CA 95616 Phone (work) 510.910.4445 Email: Louise.Bedsworth@opr.ca.gov EDUCATION 2002: Ph.D. Energy and Resources (use of science in decision-making), UC Berkeley. 1997: Master of Science in Environmental Engineering, UC Berkeley 1996: Bachelors of Science. Earth, Atmospheric, and Planetary Sciences, Massachusetts Institute of Technology POSITIONS HELD Visiting Research Fellow, Policy Institute for Energy, Environment and the Economy, UC Davis (2014-p.) Deputy Director. California Governor’s Office for Planning and Research. (2011-p.) Research Fellow, Public Policy Institute of California (2002-2003; 2006-2011) Analyst, Union of Concerned Scientists (2003-2006) SELECTED PUBLICATIONS Franco, Guido, Louise Bedsworth, and Amber Pairis. 2014. California’s Comprehensive Climate Change Program: The Pivotal Role of Research. EM

Bedsworth, Louise and Ellen Hanak. 2012. Climate Policy at the Local Level: Insights from California. Global Environmental Change. Bedsworth, Louise. 2012. California’s local health agencies and the state’s climate adaptation strategy. Climatic Change 111(1): 119-133. Bedsworth, Louise and Ellen Hanak. 2012. Guest Editorial: Preparing California for a Changing Climate. Climatic Change 111(1): 1-4. Bedsworth, Louise and Ellen Hanak. 2010. Adaptation to Climate Change – A Review of Challenges and Tradeoffs in Six Sectors. Journal of the American Planning Association 76(4): 477-495. Bedsworth, Louise. 2009. Climate Change and California’s Local Health Officers – A Role for Scientists. Bulletin of the American Meteorological Society: doi: 10.1175/2008BAMS2745.1.

Bedsworth, Louise. 2009. Preparing for Climate Change: A Perspective from Local Public Health Officers in California. Environmental Health Perspectives 117(4): 617-623.

Page 11

BRIEF CURRICULUM VITAE

NAME Mark Lubell Address One Shields Avenue, University of California, Davis, Davis, CA 95616 Phone (work) (530) 752-5880 Email mnlubell@ucdavis.edu EDUCATION Ph.D.(8/99) Political Science, State University of New York at Stony Brook Major: Public Policy; Minor: Political Psychology, Quantitative Methodology M. A. (12/96) in Political Science, SUNY at Stony Brook B.A. (6/93) in Political Science, University of California San Diego POSITIONS HELD Professor, July, 2010-Present. Department of Environmental Science and Policy, University of California, Davis. Director, Center for Environmental Policy and Behavior. Associate Professor, July 2006-July 2010. Department of Environmental Science and Policy, University of California, Davis. Assistant Professor. Fall 2002-July 2006. Department of Environmental Science and Policy, University of California, Davis. Assistant Professor. Fall 1999—Spring 2002. Department of Political Science, Florida State University

SELECTED PUBLICATIONS Hoffman, M., M. Lubell, and Vicken Hillis. 2014. “Linking Knowledge and Action through Mental Models of Sustainable Agriculture.” PNAS.

Lubell, M., G. Robins, and P. Wang. 2014. "Policy Coordination in an Ecology of Water Management Games." Revise and Resubmit, Ecology and Society.

Lubell, M. and J. Edelenbos. 2013. “Integrated Water Resources Management: A Comparative Laboratory for Water Governance.” International Journ. of Water Governance 1: 177–196

Niles, M., M. Lubell, and Van Ryan Haden. 2013. “Perception and Responses to Climate Policy Risks Among California Farmers.” Global Environmental Change 23(6): 1752-1760

Haden VR, Niles MT, Lubell M, Perlman J, Jackson LE. 2012. “Global and Local Concerns: What Attitudes and Beliefs Motivate Farmers to Mitigate and Adapt to Climate Change?” PLoS ONE 7(12):e52882.

Lubell, M. and L. Lippert. 2011. "Integrated Regional Water Management: A Study of Collaboration or Water Politics-As-Usual in California, USA." International Review of Administrative Sciences 77(1): 76

Page 12

SUMMARY PROPOSAL FORM

OBJECTIVES: We propose to conduct a case study in the urban Los Angeles coastal region, working with water suppliers to understand what they need to adapt to and prepare for the impacts of climate change. This case study is part of a larger project geared to make the management of water quality more resilient to climate change impacts. Over three years, this larger project’s goal is to develop a decision-support tool for water managers in California as they prepare for increasing extreme events that threaten water quality. A series of case studies, of which the Los Angeles region will be one, will be conducted throughout California with water suppliers to identify how they define extreme events (relating to water quality threats), their thresholds of risk, and what points within their decision-making that climate change information and knowledge can be useful. METHODOLOGY: The project will employ mixed methods that integrates inputs from resource managers and climate scientists. The first phase of the project (currently underway) is to survey water utilities and analyzing state government datasets about utilities to understand the heterogeneity of how weather and climatic extreme events threaten drinking water quality across California. Survey collection includes how utility managers and staff perceive the threat of climate change to water quality, how far along they are preparing for climate change and what barriers they perceive to hinder adaption progress, and where they currently get information about climate change impacts. We will conduct case studies to provide a more in-depth understanding of the needs of water utilities in managing and responding to water quality threats, especially those amplified by climate change. Case studies will involve interviews with key managers and other staff of water systems, as well as analysis of management plans and public meeting records, and follow up interviews with key informants to verify decision making processes and water management complexities. RATIONALE: Recent studies have shown that while resource managers understand the risks associated with climate change, often they do not feel that available information is helpful for improving preparedness. Studies have suggested that an integrated approach that combines bottom-up information from resource managers with climate science data can help address this gap. This project investigates this challenge (seeking to help overcome it) through a case study on water quality in the coastal LA urban region. Absent of other political, institutional and financial challenges, practitioners need understandable and useful information to make decisions based on projected changes and risks. Our larger study, of which the proposed Los Angeles (LA) case study is a part of, is motivated by the hypothesis that there is a mismatch between available indicators of extreme events under a changing climate and information desired by regional and local air and water quality managers to respond to those events. DATA SHARING PLAN: The results of our study – including the survey results and case study findings will be available as summarized datasets to follow requirements of the University of California human subject requirements. We will work with the Association of California Water Utilities and the Los Angeles Regional Collaborative for Climate Action and Sustainability (LARC – see letter of support) help disseminate any decision support tools or guidance developed. We will share results of case studies with the utilities directly who participated in interviews and meetings. And we plan to publish peer-reviewed journal articles of findings that contribute to the scholarly literature on adaptation and water management.

Page 16

Projected Work Schedule Project Title: INTEGRATING INFORMATION FROM CLIMATE SCIENTISTS AND RESOURCE MANAGERS: INFORMING PREPAREDNESS AND ADAPTATION TO EXTREME EVENT IMPACTS ON WATER QUALITY IN SOUTHERN CALIFORNIA

Activities 2016-2017 F M A M J J A S O N D J Open-ended questionnaire development

x x

Key Informant pre-case study informal interviews

LA

Conduct case studies (interviews with utility managers and climate scientists)

LA

Analyze interview and other case study material

LA LA LA

Develop indicators or other guidance for other identified needs (to-be-determined from case studies)

x x x x

Page 17

Activities 2017-2018

F M A M J J A S O N D J Develop indicators or other guidance for other identified needs (to-be-determined from case studies)

x x

Write up results of case studies

x x x x x

Test indicators or other guidance/tool developed with utility managers

x x x x

Follow-up survey of decision-making tool (what information is needed/what is available to meet needs for climate change adaptation and water quality)

x x

Analysis of final survey and write up of findings and next steps

x x x x

Page 18

OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: GRANT/PROJECT NO.:

DURATION (months):24 months

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People Amount of Effort Sea Grant Funds Matching Funds

a. Principal Investigator: 1 .8 mo 5,500b. Associates (Faculty or Staff): 2 .5 mo 6,000

Sub Total: 3 0.0% 5,500 6,000

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians:h. Other: Graduate Student Trainee 1 6 mo

Total Salaries and Wages: 4 0.0 5,500 6,000

B. FRINGE BENEFITS: various % 52.1% 2,866 2,308Total Personnel (A and B): 8,366 8,308

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT: 31 34

E. TRAVEL:1. Domestic 5002. International

Total Travel: 500 0

F. PUBLICATION AND DOCUMENTATION COSTS:

G. OTHER COSTS:1234567

Total Other Costs: 0 0

TOTAL DIRECT COST (A through G): 8,897 8,342

5,053 4,737

Total Indirect Cost: 5,053 4,737

TOTAL COSTS: 13,950 13,079

INDIRECT COST (On campus: FY 15-16 56.5%; FY 16-17 57%; FY 17-18 57%

Julia EkstromPRINCIPAL INVESTIGATOR:

UC Davis Policy InstituteBRIEF TITLE:Extreme Events, Water Quality and Drinking Water Management

OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: GRANT/PROJECT NO.:

DURATION (months):24 months

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: 1 .7 mo 5,000b. Associates (Faculty or Staff): 2 .5 mo 6,000

Sub Total: 3 0.0 5,000 6,000

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians:h. Other: Graduate Student Trainee 1 3 mo

Total Salaries and Wages: 4 0.0 5,000 6,000

B. FRINGE BENEFITS: various % 53.3% 2,667 2,352Total Personnel (A and B): 7,667 8,352

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT: 28 34

E. TRAVEL:1. Domestic 1,5002. International

Total Travel: 1,500 0

F. PUBLICATION AND DOCUMENTATION COSTS: 1,100

G. OTHER COSTS:

234567

Total Other Costs: 0 0

TOTAL DIRECT COST (A through G): 10,295 8,386

5,868 4,780

Total Indirect Cost: 5,868 4,780

TOTAL COSTS: 16,163 13,166

INDIRECT COST (On campus: FY 15-16 56.5%; FY 16-17 57%; FY 17-18 57

Louise Bedsworth, Julia EkstromPRINCIPAL INVESTIGATOR:

UC Davis Policy InstituteBRIEF TITLE:Extreme Events, Water Quality and Drinking Water Management

Los Angeles Regional Collaborative for Climate Action and Sustainability

c/o UCLA Institute of the Environment and Sustainability La Kretz Hall, Suite 300 Los Angeles, CA 90095

www.larc.environment.ucla.edu

larc@ioes.ucla.edu

!

March!13,!2015!

USC!Sea!Grant!3616!Trousdale!Parkway,!AHF!253!Los!Angeles,!CA!90089F0373!!Subject:!Support!for!helping!decisionFmakers!prepare!and!prevent!climate!change!threats!to!water!quality!in!the!coastal!Los!Angeles!urban!region!!!Dear!USC!Sea!Grant!Proposal!Selection!Committee,!

I!am!writing!to!express!strong!support!for!the!UC!Davis!proposal!“Informing!Preparedness!and!Adaptation!to!Extreme!Event!Impacts!on!Water!Quality!in!the!Los!Angeles!Region”!submitted!to!the!Sea!Grant!general!call!for!projects.!The!goal!of!this!project!is!to!supplement!a!threeFyear!research!project!already!underway!to!connect!climate!science!with!practitioner!needs!for!adapting!to!climate!change!in!the!Los!Angeles!region.!!

The!Los!Angeles!Regional!Collaborative!for!Climate!Action!and!Sustainability!(LARC)!is!dedicated!to!fostering!greater!coordination!and!cooperation!at!the!local!and!regional!levels!by!bringing!together!leadership!from!governmental!organizations,!academia,!business,!nonFgovernmental!organizations,!and!the!public!to!address!impacts!related!to!climate!change.!!Our!goal!is!to!enhance!collaboration!on!climate!mitigation!and!adaptation!in!the!Los!Angeles!region.!!

This!effort!also!dovetails!nicely!with!LARC’s!current!initiative!to!develop!a!Framework!for!Climate!Action!for!the!Los!Angeles!Region.!As!a!clearinghouse!of!climate!research,!data,!and!policy!guidance,!the!Framework!is!uniting!the!climate!work!taking!place!throughout!the!LA!region!into!one!landscape,!building!a!resource!for!local!decisionFmakers!and!practitioners,!to!help!them!mitigate!the!causes!of!climate!change!and!prepare!for!its!impacts!and,!ultimately,!creating!a!resilient!and!sustainable!LA.!!

A!significant!aspect!of!the!Framework!development!is!to!build!the!capacity!of!local!decisionFmakers!to!create!more!robust!climate!change!mitigation!and!resiliency!policy!through!the!use!of!locally!relevant!research!and!data.!!The!creation!of!the!proposed!tool!will!help!practitioners!articulate!what!information!they!need!for!adaptationFdecision!making!is!integral!to!this!effort.!

LARC!enthusiastically!supports!this!proposal.!Please!do!not!hesitate!to!contact!me!if!you!have!any!questions.!I!can!be!reached!at!kkline@ioes.ucla.edu.!!

Very!Truly!Yours,!

!

Krista!Kline!Managing!Director,!The!Los!Angeles!Regional!Collaborative!for!Climate!Action!and!Sustainability!!

Los Angeles Regional Collaborative for Climate Action and Sustainability

c/o UCLA Institute of the Environment and Sustainability La Kretz Hall, Suite 300 Los Angeles, CA 90095

www.larc.environment.ucla.edu

larc@ioes.ucla.edu

!

March!13,!2015!

USC!Sea!Grant!3616!Trousdale!Parkway,!AHF!253!Los!Angeles,!CA!90089F0373!!Subject:!Support!for!helping!decisionFmakers!prepare!and!prevent!climate!change!threats!to!water!quality!in!the!coastal!Los!Angeles!urban!region!!!Dear!USC!Sea!Grant!Proposal!Selection!Committee,!

I!am!writing!to!express!strong!support!for!the!UC!Davis!proposal!“Informing!Preparedness!and!Adaptation!to!Extreme!Event!Impacts!on!Water!Quality!in!the!Los!Angeles!Region”!submitted!to!the!Sea!Grant!general!call!for!projects.!The!goal!of!this!project!is!to!supplement!a!threeFyear!research!project!already!underway!to!connect!climate!science!with!practitioner!needs!for!adapting!to!climate!change!in!the!Los!Angeles!region.!!

The!Los!Angeles!Regional!Collaborative!for!Climate!Action!and!Sustainability!(LARC)!is!dedicated!to!fostering!greater!coordination!and!cooperation!at!the!local!and!regional!levels!by!bringing!together!leadership!from!governmental!organizations,!academia,!business,!nonFgovernmental!organizations,!and!the!public!to!address!impacts!related!to!climate!change.!!Our!goal!is!to!enhance!collaboration!on!climate!mitigation!and!adaptation!in!the!Los!Angeles!region.!!

This!effort!also!dovetails!nicely!with!LARC’s!current!initiative!to!develop!a!Framework!for!Climate!Action!for!the!Los!Angeles!Region.!As!a!clearinghouse!of!climate!research,!data,!and!policy!guidance,!the!Framework!is!uniting!the!climate!work!taking!place!throughout!the!LA!region!into!one!landscape,!building!a!resource!for!local!decisionFmakers!and!practitioners,!to!help!them!mitigate!the!causes!of!climate!change!and!prepare!for!its!impacts!and,!ultimately,!creating!a!resilient!and!sustainable!LA.!!

A!significant!aspect!of!the!Framework!development!is!to!build!the!capacity!of!local!decisionFmakers!to!create!more!robust!climate!change!mitigation!and!resiliency!policy!through!the!use!of!locally!relevant!research!and!data.!!The!creation!of!the!proposed!tool!will!help!practitioners!articulate!what!information!they!need!for!adaptationFdecision!making!is!integral!to!this!effort.!

LARC!enthusiastically!supports!this!proposal.!Please!do!not!hesitate!to!contact!me!if!you!have!any!questions.!I!can!be!reached!at!kkline@ioes.ucla.edu.!!

Very!Truly!Yours,!

!

Krista!Kline!Managing!Director,!The!Los!Angeles!Regional!Collaborative!for!Climate!Action!and!Sustainability!!

UNIVERSITY OF CALIFORNIA, DAVIS

BERKELEY ● DAVIS ● IRVINE ● LOS ANGELES ● MERCED ● RIVERSIDE ● SAN DIEGO ● SAN FRANCISCO ● SANTA BARBARA ● SANTA CRUZ

DEPARTMENT OF ENVIRONMENTAL SCIENCE AND POLICY ONE SHIELDS AVENUE

DAVIS, CALIFORNIA 95616-5270

July 5, 2015

Julia Ekstrom

Director Climate Adaptation Program

Policy Institute for Energy, Environment and the Economy

University of California, Davis

1715 Tilia St, Suite 100

Davis, CA 95618

Dear Dr. Ekstrom:

I am pleased to support your proposed research project “Integrating Information From Climate

Scientists and Resource Managers: Informing Preparedness and Adaptation to Extreme Event

Impacts on Water Quality in Southern California” and I look forward to collaborating with the

Policy Institute as the project develops. The study seeks to understand the needs of water utilities

in California as they plan for climate change and particularly focuses on the Los Angeles coastal

region selected as a case study.

As an environmental social science professor at UC Davis, I study decision-making in

environmental policy and climate change adaptation. This study’s focus on climate adaptation

and water management fits well with my interests and my graduate students. As part of your

proposed study, I am committed to providing in-kind support of $5000-worth of my time per

year to advising you and the graduate student. To help the project meet its goals, I will advise

you on the proposed project’s case study design, developing interview questions, and

interpretation of results.

Sincerely,

Mark Lubell

Professor, Department of Environmental Science and Policy

Director, Center for Environmental Policy and Behavior

University of California, Davis

UNIVERSITY OF CALIFORNIA, DAVIS

DAVIS , CALIFORNIA 95616

July 6, 2015 Julia Ekstrom Director, Climate Adaptation Program Policy Institute for Energy, Environment and the Economy University of California, Davis 1715 Tilia St, Suite 100 Davis, CA 95616 Dear Dr. Ekstrom: Please accept this letter as my commitment to support your proposed research project “Integrating Information from Climate Scientists and Resource Managers: Informing Preparedness and Adaptation to Extreme Event Impacts on Water Quality in Southern California.” Over the past three years, I co-founded and built the Policy Institute for Energy, Environment and the Economy, which seeks to help leverage science from UC Davis and other universities to make it useful for policy- and other decision makers in California. Your study helps to support this goal by conducting research that can inform scientists about what decision makers need. This is especially important for climate change adaptation because so much of the action ‘on the ground’ must be implemented by local resource managers (such as public water systems). As Policy Fellow at the UC Davis Policy Institute (and other related career roles), my expertise and interest lies in ensuring that resource management decisions are based on sound science. I am committed to advising your project by providing in-kind support of $1000-worth of my time per year to advising you and the graduate student trainee. I will work with you to strategize how, when and with whom to best communicate results and gather feedback from stakeholders (water utility managers and scientists). Together we can help make the study’s results more useful for regional climate collaboratives across California, in addition to the water utilities in the Los Angeles region. I look forward to continue working with you. Sincerely,

Amber Mace, Ph.D.

SANTA BARBARA • SANTA CRUZ

BERKELEY • DAVIS • IRVINE • LOS ANGELES • RIVERSIDE • SAN DIEGO • SAN FRANCISCO

Policy Fellow UC Davis 1715 Tilia St., Suite 100 Policy Institute for Energy, Environment and the Economy Davis, CA 95616

Giddings, S.N. USC Sea Grant 2015 1/19

1. TITLE: DRIVERS OF MORPHODYNAMIC CHANGE AND HYPOXIC EVENTS IN SOUTHERN CALIFORNIA LAGOONS

2. PRINCIPLE INVESTIGATORS Sarah N Giddings, Assistant Professor, University of California, San Diego, Scripps Institution of Oceanography

Geno Pawlak, Associate Professor, University of California, San Diego, Dept. of Mechanical and Aerospace Engineering

3. ASSOCIATE INVESTIGATORS Kristen A Davis, Assistant Professor, University of California, Irvine, Dept. of Civil and Environmental Engineering

4. FUNDING REQUESTED 2016-2017 $48,354 Federal/State $24,178 Match 2017-2018 $37,082 Federal/State $18,541 Match

5. STATEMENT OF THE PROBLEM Estuaries and wetlands provide extensive biological and ecological functions and are heavily utilized by humans. They are among the most productive ecosystems in the world, serving as key links in the food web. In addition, they provide many human services including freshwater, food, waste disposal, runoff filtration, and recreation, amongst many other economically valuable uses. However, these systems are highly sensitive to environmental changes. In California they have already been significantly impacted by human uses and continue to experience enhanced pressures from increasing development and a changing climate. More than 50 marsh estuaries and bays (all low-inflow estuaries, LIEs) line the highly urbanized Southern California coastline. These systems persist as critical regions for coastal resiliency to extreme events and ecosystem health. While it has been suggested that estuaries and coastal marshes may mitigate negative impacts of a changing climate, their response to climatic variations is not well understood [e.g., Shepard et al., 2011].

One problem of particular interest in Southern California LIEs is sediment transport and the associated morphologic changes that alter hydrodynamic and ecosystem dynamics. For example, many LIEs periodically fill in with sediment such that they are closed to tidal action. This can lead to stagnation and hypoxic conditions with significant ecosystem consequences. Thus many Southern California LIEs undergo costly mouth maintenance including dredging and jetty construction to maintain open inlets and protect infrastructure such as roads and railroads. For example, dredging costs alone in individual Southern California LIEs range from ~$100K to over $1M annually [Jenkins and Wasyl, 2006 and M. Hastings personal communication, 2014]. An improved understanding of these dynamics as well as predicting their response to future climate conditions is of great concern to LIE managers and surrounding communities and is a current area of focus for LIE managers (e.g., Board of Governors of the Southern California Wetlands Recovery Project, M. Hastings, J. Crooks, personal communication and attached letters of support). Thus we propose to address the resiliency of Southern California estuaries to both rising sea level and increased frequency of extreme water level events by investigating the detailed physical drivers of hydrodynamic-morphodynamic feedbacks and resulting ecosystem consequences.

6. INVESTIGATORY QUESTION It is not well understood how estuaries in general, and LIEs in particular, will respond to sea level rise and climate change including potential changes in morphology and consequences of those changes [e.g., Reeve and Karunarathna, 2009]. The proposed work will expand upon an ongoing 1-year USC Sea Grant project to examine questions to address coastal resiliency and sustainability in LIEs. The ongoing work is

Giddings, S.N. USC Sea Grant 2015 2/19

examining larger temporal and spatial scale processes including the relative importance of waves versus river flow, the long-term (~monthly) impact of storms on estuarine circulation, and the adaptability of natural versus engineered systems. So far, our results suggest the dominance of wave impacts on morphodynamic-hydrodynamic interactions, thus here we propose to investigate the shorter time-scale links between waves, mean currents, water level, and morphodynamic processes in more detail. The strong connections between entrance morphodynamics and hypoxia have led us to simultaneously investigate hypoxia and re-oxygenation processes associated with closures and breaching. We therefore have designed a set of experiments, informed by our ongoing work, to address the following questions:

1. What is the relative importance of waves, wave-current interactions, and mean currents in driving sediment transport in estuarine mouths? Our preliminary results suggest that larger wave events during high tides enhance up-estuary beach sand transport increasing mouth closure risk (see Figure 3 and §7.D). Our measurements also suggest that the wave frequency and direction are important to the total sediment flux. Thus we plan to investigate the interaction of waves of varying frequencies and mean currents and their impact on sediment transport and ultimately mouth morphology.

2. How does hydraulic control at an estuarine mouth regulate wave-current interactions and thus sediment transport and hypoxia on tidal and event time scales? We hypothesize that hydraulic control at the mouth/sill regulates lagoon water levels that, in turn, determine wave dissipation with strong feedback to tidal timescale sediment transport. Specifically, we hypothesize that upstream wave energy propagation increases with water level modulated by depth-limited wave breaking, similar to that observed on coral reefs. We anticipate that tidally modulated, wave-driven bed stress causes net landward sediment transport resembling beach sandbar migration.

We further hypothesize that oxygen conditions respond to this hydraulic control. Our previous measurements show that re-oxygenation can occur during a closure (e.g., Figure 3) which we hypothesize is due to vertical mixing from incoming tidal flow when the tide is high enough to spill over but not breach the sill. We anticipate both hydraulic control and stratification influence this process.

3. How will an embayment respond relative to an intertidal marsh-like system? In our ongoing project, we hypothesized that constrained LIE entrances in engineered systems will be more susceptible to closure. Here we expand further upon this hypothesis by investigating the sediment transport response of embayments versus marsh-like systems to elevated water events.

While some of these questions have been addressed qualitatively [e.g., Jacobs et al., 2010], quantitative physical process dynamics, particularly in response to extreme events have not been examined. Weaknesses in our dynamical understanding result in poor predictive capabilities and make it difficult for managers to plan for climate change, sea level rise, and extreme event impacts in coastal LIEs. This proposed work will enhance predictability for mouth processes including mouth closures, morphological changes, and the potential impacts on infrastructure and system function. These are critical areas in need of enhanced understanding as outlined by the Board of Governors of the Southern California Wetlands Recovery Project in November 2014 and emphasized in our letters of support from local managers.

7. MOTIVATION Estuaries and wetlands provide extensive biological and ecological functions and are heavily utilized by humans yet they have experienced significant degradation. Historical salt-marsh habitat loss is greater than 65% and continues at 1-2% per year [Lotze et al., 2006; Murray et al., 2011]. Due to their contributions to habitat and biodiversity, as protective barriers, and to coastal economies amongst others, numerous restoration efforts have been undertaken. Restoration goals are difficult due to lack of undisturbed reference sites [Grayson et al., 1999], and unfortunately many attempted restorations have

Giddings, S.N. USC Sea Grant 2015 3/19

been slow and incomplete [Moreno-Mateos et al., 2012]. Thus, an improved understanding of estuarine and wetland dynamics and resiliency is required to predict future changes and inform sustainable coastal development and restoration. Here we describe the project motivation first broadly by describing Southern California estuaries and then by focusing in on the morphodynamics of these systems.

A. Southern California Estuaries We focus on Southern California low inflow estuaries (LIEs), prevalent along Mediterranean climate coasts (e.g., California, Spain, South Africa, Australia). LIEs (including lagoons, marshes, wetlands and low-inflow embayments) stretch throughout much of California. Our proposed work will concentrate on Southern California given its unique regional physical forcing conditions and extent of human interaction. Figure 1 shows the location of the larger LIEs including 36 estuaries that are marsh/wetland types and 13 that are more open water bay/harbors. There are a multitude of smaller inlets not marked.

Figure 1. Overview of Southern California estuaries and conditions California-wide map shows annual average precipitation (green, cm) and offshore water temperature on 10 Sept 2010 showing the typical summer upwelling pattern (color, degrees C). The inset of Southern California marks larger LIEs including marsh/wetland type estuaries (blue star) and harbor/bay type estuaries (red square). 36 marsh estuaries and 13 bays are marked, however, many other smaller inlets are not included.

Due to a strong north/south gradient in both upstream (river flow) and downstream (oceanic) estuarine forcing conditions, Southern California LIEs represent a subclass of LIEs. Southern California LIEs receive minimal river flow correlated with intermittent precipitation events [Nezlin and DiGiacomo, 2005; Warrick et al., 2007] (as seen by the strong north/south gradient in precipitation in Figure 1). Reduced upwelling south of Point Conception (e.g., Hickey [1998] and Figure 1) leads to warmer, fresher, reduced nutrient oceanic water offshore of Southern California LIEs.

Southern California LIEs also share similar anthropogenic pressures due to significant urbanization and coastal development, with over 17 million people in coastal Southern California counties and over 20 million including inland counties [US Census Bureau 2010]. The coast is a significant revenue stream for the region including tourism, shipping, and fishing [e.g., The Port of Los Angeles 2014; Port of Long Beach 2014]. For example, tourism in San Diego and Los Angeles Counties totaled over $18 billion each

Giddings, S.N. USC Sea Grant 2015 4/19

in 2013 [Los Angeles Department of Tourism 2014; San Diego Tourism Authority 2014]. In addition Southern California LIEs are utilized for aquaculture and sites for critical infrastructure including desalination and energy generation facilities. Agua Hedionda, one of the sites for this proposed work, is home to significant infrastructure of this type.

LIEs provide multiple ecosystem services. Southern California LIEs are important rearing grounds for juvenile fish (particularly for local fisheries such as California halibut), host a variety of endangered species, and act as stopovers on the pacific flyway [Larson, 2001]. Additionally, LIEs act as buffer zones between urbanized regions and the coast. LIE marshes and wetlands act to filter contaminants from urban runoff prior to coastal discharge. They also provide coastal protection and resiliency where sea level rise can potentially be mitigated [Shepard et al., 2011]. Marshes and wetlands within LIEs play an important role in coastal ecosystem carbon storage [Murray et al., 2011]. Southern California estimates for marsh habitat destruction range from 70-90% of historical extent [Larson, 2001; Southern California Wetlands Recovery Project, 2013] thus all of these positive benefits have been reduced significantly. For example, the Ocean Health Index points to salt marsh loss as one of the main drivers negatively impacting US west coast carbon storage [Halpern et al., 2014]. Their ability to perform these valuable ecosystem services has been limited and it is unknown how they will respond to additional future changes.

B. Hydrodynamics and morphodynamics of Low Inflow Estuaries LIE hydrodynamics differ from freshwater dominated estuaries. LIEs can become hypersaline with a salinity minimum inside of the system leading to relatively small exchange and stagnant conditions [Largier et al., 1997; Largier et al., 1996; Largier, 2010]. The morphodynamics of many LIEs are particularly sensitive to wave forcing and intermittent floods making them subject to mouth closures and channel migration [e.g., Moreno et al., 2010; Zedler, 2010]. Morphodynamic changes are due to sediment transport divergence caused by the underlying hydrodynamics. Morphodynamic alterations then impact the system hydrodynamics substantially including transitions to a closed lagoon state with strong stratification, high phytoplankton biomass, and potentially low oxygen [e.g., Ortega-Cisneros et al., 2014]. Thus there is strong feedback between hydrodynamics, morphodynamics, and ecosystem function.

Of the LIEs that remain in Southern California, most have been heavily physically modified including dredging, seawall and jetty building, mouth constrictions, and other development. Southern California inlets historically migrated seasonally (southward in the winter, northward during the summer) and even in response to individual storm events [Engstrom, 2006]. Physical manipulation has negatively impacted the resiliency of these ecosystems [Jacobs et al., 2010; Shepard et al., 2011].

These systems’ response to extreme events is poorly understood [Shepard et al., 2011]. Some work has shown that extreme events have the ability to drastically modify morphology, salinity structure, productivity and vegetation [e.g., Zedler, 2010; Engstrom, 2006; Riddin and Adams, 2010; Jacobs et al., 2010]. Yet the physics underlying these processes has not been elucidated. Specifically the sediment transport mechanisms in these systems have only recently begun to be investigated (see below).

C. Extreme events in Southern California We aim to take advantage of elevated water level events (large ocean waves and increased sea level due to tides, storms and/or El Niño) to assess Southern California LIE morphodynamic event response. Extreme events provide a window into potential future conditions. Long-term California climate projections predict not only mean sea level rise, but also an increase in the frequency of extreme sea level events [Cayan et al., 2008]. Similarly, storm events, which bring large waves and setup, are expected to become larger [Das et al., 2013]. The predicted El Niño [NOAA Climate Prediction Center, 2014]. provides an enhanced opportunity to carry out this work as El Niño brings anomalously high sea level (10-20 cm) to the Southwest United States [e.g., Cayan et al., 2008; Das et al., 2013].

Giddings, S.N. USC Sea Grant 2015 5/19

Extreme water level events in California can have both immediate and long-lasting coastal consequences. Typically storms occur during the winter and spring months of December through March with some during November and April. These storms bring larger waves from offshore (see Figure 2) and wave setup. Additionally, tides experience extreme highs during December-February due to tropic-spring high tides [Flick and Cayan, 1984] increasing the chances for winter extreme water level events. High swell events from the southwest also occur in summer and fall, associated with remote tropical storms.

Figure 2. Southern California seasonal wave patterns. Monthly wave climatology compiled from the CDIP, SIO Oceanside buoy. Color indicates mean significant wave height (m) while size indicates the standard deviation of the wave height. Dots are scattered by the mean wave direction where 270° indicates waves coming from due west.

In Southern California and the southwest US, there is a strong correlation between extreme water levels and ENSO (El Niño/Southern

Oscillation) events as observed in wave records [e.g., Bromirski et al., 2003], and flooding events. For example, the 1982-83 and 1997-98 El Niños, amongst the strongest on record [Wolter and Timlin, 1998], brought substantial flooding and damage to coastal California, with the 1982-83 winter causing over $100 million worth of damage [Flick and Cayan, 1984]. Large wave events from the west which directly impact the Southern California coastline, are both more frequent and have larger significant wave heights during El Niño. If a moderate to strong El Niño occurs during winter 2015-2016, this will provide an enhanced sampling opportunity. Current NOAA predictions suggest a strong El Niño with a 90% chance of continuation into fall 2015 and an 85% chance of continuation through winter 2015-2016 [NOAA Climate Prediction Center, 2014]. Local Southern California ENSO indices and the Multivariate ENSO index also both point towards continued El Niño conditions [SCCOOS, 2014; Wolter, 2015]. Importantly, even without El Niño, we expect ample elevated water level events due to the combination of winter storms and extreme winter tides. For example, during winter 2014-2015 (ENSO neutral conditions) we captured 3 complete inlet closures in Los Peñasquitos and multiple other extreme water level events that significantly impacted sediment transport and morphology. This is typical for Los Peñasquitos and other local LIEs. Agua Hedionda is dredged deeper and thus complete closures occur less frequently (every 2 years), yet we anticipate significant sediment transport occurs during winter events.

D. Extreme event LIE response in Southern California – preliminary results An ongoing 1-year USC Sea Grant project is examining the role of extreme events (storms) on estuarine circulation and morphodynamics. Preliminary results indicate that both wave and tidal energy play major roles in driving morphodynamic alterations in small Southern California estuaries, although not always acting in concert. Large wave events occurring at the same time as relatively high tides allow infragravity waves (periods > 30 s) to propagate at least 0.75 km upstream into the estuary. These high wave events appear to transport beach sand into the lagoon in significant quantities and correlate with mouth closure (Figure 3), although the detailed physics linking the waves to the sediment transport are unclear with our current data. Closure is rapidly followed by estuarine eutrophication where stratification along with reduced flow allows for dissolved oxygen in the bottom layer to quickly become hypoxic. However, our observations indicate that extreme high tides can breach the sandbar and naturally re-open the lagoon mouth restoring tidal action and re-oxygenating the system. In addition, we observed re-oxygenation associated with intermittent overtopping at the mouth while the estuary remained closed. Thus our

Giddings, S.N. USC Sea Grant 2015 6/19

ongoing project has raised multiple questions about the detailed mechanisms by which sediment transport occurs and extreme water levels lead to either hypoxia or re-oxygenation.

Figure 3. Los Peñasquitos December 2014 closure. This 16 d time series from December 2014 shows the offshore significant wave height (Hs, m) and direction (degrees) in the top panels, turbidity in the middle panel (brown), water level (m, dark blue) and along-estuary velocity (red is into the estuary, i.e., with a flood tide), and near-bottom dissolved oxygen (mg L-1) in the lagoon in the bottom panel. The lagoon mouth closed around 12 Dec. 2014 in response to large waves (~2 m) coming from due west, i.e., directly into the lagoon. During closure, water levels remain high, flushing becomes weak and oxygen levels quickly drop to hypoxic conditions (red on bottom panel). The lagoon is re-oxygenated while closed on 16 Dec. 2014 and re-opens on 21 Dec. 2014 (not shown in this time series). Significant wave height data from Oceanside, CA from CDIP, SIO. La Jolla water level is from NOAA and lagoon water level and currents are from our instrumentation. Dissolved oxygen is from NOAA NERR SWMP.

E. Wave-current interactions & sediment transport Infragravity waves are low-frequency surface gravity wave with periods of ~30 to 300 seconds. We hypothesize that the tidally modulated infragravity energy observed during our ongoing LP study (Figure 4) plays an important role in sediment transport near the mouth. On gently sloping beaches infragravity waves are thought to be the result of non-linear wave-wave interactions between shoaling waves [Longuet-Higgins and Stewart, 1962; Herbers et al., 1995]. In the surfzone, sediment suspension has been shown to occur at infragravity timescales with important effects on the cross-shore transport of sediment [Beach and Sternberg, 1988]. Infragravity waves have been found to also be important to barrier breaching and dune erosion [Roelvink et al., 2009]. To date, very few models of wave-dominated inlets have been able to successfully model closures [Ranasinghe et al., 1999; Bertin et al., 2009] and even fewer observational studies have been conducted in inlets to understand the mechanisms of infragravity waves and wave-current interactions on sediment transport. One study conducted in Portugal observed infragravity wave propagation into a wave-dominated inlet and through modeling found that infragravity

Giddings, S.N. USC Sea Grant 2015 7/19

waves increased sand transport into the inlet up to 20% during flood tides while wave-current interactions did not allow waves to propagate into the system during the ebb tide which could contribute to inlet closure [Dodet et al., 2013; Bertin and Olabarrieta, 2015]. We propose that infragravity energy is critical in modulating sediment suspension at the swell band, such that infragravity water level variations result in increased shoreward fluxes.

Figure 4. Infragravity waves in Los Peñasquitos. This time series from December 2014 shows tidal amplitude in the lagoon (blue) and at Scripps Pier (gray) in the top panel, the spectra of the energy derived from the ADCP pressure signal in the middle panel (i.e., spectragram), and the offshore wave height at the Torrey Pines Outer Buoy in the bottom panel. In the spectragram, the darker blues indicate more energy and wave periods of 30 seconds, 1 minute, and 2 minutes are indicated with red lines in the legend. During high tides and large wave events, energy in the infragravity band is seen over 0.75 km upstream of the mouth. La Jolla water level is from NOAA. Lagoon water level and spectrogram are from our upstream ADCP deployed as part of the ongoing USC Sea Grant project. The ADCP pressure sensor was sampling at 0.5 Hz. Significant wave height data from CDIP, SIO Torrey Pines Outer Buoy.

8. GOALS AND OBJECTIVES A. Overall Goals

• Assess the impact of wave-current interactions on sediment transport and morphodynamic responses to extreme events in Southern California LIEs using in-situ and remote observations

• Compare results from two different types of LIEs (marsh vs. embayment) • Use these observations to make predictions about the response of these estuaries to future

conditions including sea level rise and elevated water level events in order to assist managers in planning dredging events and in adopting coastal resiliency programs

B. 2016-2018 Objectives Instruments measuring salinity, temperature, pressure, suspended sediment, currents, turbulence, and basic water quality parameters (i.e. dissolved oxygen, turbidity, pH) are already deployed in Southern California estuaries via the NOAA National Estuarine Research Reserve (NERR) program (salinity, temperature, oxygen, pH, water depth, turbidity) and our ongoing USC Sea Grant project (currents, turbulent stresses, waves, water depth, salinity, temperature, turbidity). We will maintain these instruments prior to and through the February 2016 project start date in order to capture the approaching El Niño and pre-storm season conditions. During the February 2016- February 2018 project period (as outlined as a timeline in the Projected Work Schedule.) we will:

• Maintain and add to our existing observations in our focus estuary while adding observations to the second comparative system

• Conduct monthly enhanced sampling, including higher spatial and temporal resolution hydrographic transects; sediment sampling; and aerial surveys

• Conduct rapid response sampling before and after large storms, including higher spatial and temporal resolution hydrographic transects; sediment sampling; concurrent wave, turbulence, dissipation, and suspended sediment measurements near the channel mouth; and aerial surveys

• Analyze the data to address wave-wave and wave-current interactions on sediment transport and hydraulic control

• Compare observations between the two systems

Giddings, S.N. USC Sea Grant 2015 8/19

• Relate observed conditions to predicted future scenarios in these systems and other LIEs, specifically focusing on applications for managers

• Present our results at conferences, through manuscript publication, and via outreach

9. METHODS We plan a 2-year project to complement and extend the measurements we started in Los Peñasquitos Lagoon during the current USC Sea Grant project. This includes maintaining a long-term mooring that measures currents throughout the water column, water surface level, salinity, temperature, and dissolved oxygen (CT-DO) at multiple depths; and two buried pressure sensors in the lagoon mouth. To test our hypotheses we plan to add short-term higher resolution current and pressure measurements collocated with optical backscatter sensors (to measure suspended sediment) and a near-field camera looking down at the water surface to further investigate sediment re-suspension at multiple locations along the estuary during times when wave propagation into the estuary is expected. Additionally, we plan to fly a drone-mounted camera coupled with high-resolution GPS elevation surveys at the lagoon mouth to quantify larger scale morphodynamic changes. These higher resolution measurements will allow us to address our hypotheses by calculating currents and wave dissipation, which together determine sediment suspension and transport, and comparing these to both in-situ and remote measurements of suspended sediment. Finally, we plan to extend our study to Agua Hedionda Lagoon with more limited observations.

While the study sites are all located in the southern extent of Southern California for logistical regions, these systems well represent the range of LIEs throughout the Southern California region. Agua Hedionda is representative of some of the more open water lagoons/bays in the region (e.g., Los Batiquitos Lagoon, Buena Vista Lagoon, Santa Clara, UCSB Lagoon, etc.) while Los Peñasquitos is representative of the smaller systems with extensive marsh habitat (e.g., San Elijo, Seal Beach Wetlands, Upper Newport Bay, etc. and to some extent the more natural systems such as Mugu Lagoon and Tijuana Estuary).

A. In-situ long-term instrumentation We will deploy 2 moorings in our focus estuary (e.g., Figure 5) to be maintained throughout the project. The downstream mooring will be a continuation of instrumentation we have deployed since December 2014 and includes an upward-looking, bottom-mounted acoustic Doppler current profiler (ADCP) sampling currents and pressure at 2 Hz and a bottom and top-mounted conductivity-temperature-depth (CTD) sensor that measures salinity, temperature, density, and water level at 10 min intervals. We will add to this mooring a bottom-mounted dissolved oxygen sensor and an optical backscatter sensor (OBS) to measure suspended sediment. The upstream mooring will include top and bottom CTD sensors. In addition to mean currents, the ADCP high frequency pressure signal will allow for quantification of infragravity waves. Additionally, during key months, we will add a bottom-mounted Acoustic Doppler Velocimeter (ADV) to measure higher frequency waves, turbulence statistics and turbulent dissipation. The ecosystem response to morphodynamic changes in terms of stratification, along channel density gradients, and dissolved oxygen will be tracked with the CT-DO sensors. Additionally, four bottom-mounted temperature sensors will be deployed along the estuary to track the propagation of incoming waves and tidal bores. These are closely spaced in order to capture anomaly propagation as well as to assess the value of future work using a Distributed Temperature Sensor (DTS) cable which is capable of 0.5 m horizontal temperature resolution, in collaboration with Kristen Davis, the associate investigator on this project. In the second estuary, 1 mooring with an ADCP and top/bottom CTDs will be deployed.

In addition, two pressure gauges sampling at 2 Hz will be buried near the Los Peñasquitos river mouth in the beach to measure waves and runup, one around Mean Sea Level, another just within the estuary mouth. A third mooring just offshore will measuring the incoming wave direction and height. These will be deployed from December 2015 through May 2016 by experienced technicians and redeployed for 2 more 6 month cycles to extend these observations over 1.5 years, building on the 5 month dataset collected during the first project.

Giddings, S.N. USC Sea Grant 2015 9/19

Finally, these instruments will be complemented by ongoing monitoring efforts and collaborations in each LIE (see Figure 5 and Figure 6). This includes CT-DO and pH sensors and a meteorological station maintained by the NERR in Los Peñasquitos and an elaborate carbon chemistry sampling package being tested in Agua Hedionda by SIO scientists Todd Martz and Kiley Yeakel. In addition to the carbon chemistry (pH, total Alkalinity, pCO2, salinity, temperature), we have agreed to help Martz and Yeakel plan and deploy instrumentation for measuring currents and waves. Thus there will be at least one other mooring in addition to the mooring deployed for this project in Agua Hedionda.

Figure 5. (left) Los Peñasquitos Lagoon and instruments Existing monitoring sites (Los Peñasquitos Lagoon Foundation, red diamonds, see support letters from Mike Hastings and Jeff Crooks), proposed long-term mooring locations (blue dots), proposed bottom-mounted temperature sensors (purple dots), proposed short-term tripod location (blue star), proposed pressure sensors (open circle), and proposed digital camera view overlain on an image from Google Earth. The white line indicates scale.

Figure 6. (right) Agua Hedionda Lagoon instrumentation Same as Figure 5 but for the second sampling site, Agua Hedionda Lagoon. Existing monitoring in the estuary is conducted by the NOAA Shellfish Water Quality Monitoring Station. Additionally, instrumentation will be in place by our collaborators Martz and Yeakel (see letter of support) to measure carbon chemistry parameters along with our additional mooring.

Giddings and Pawlak have both designed and deployed moorings of this type in many shallow water systems (including within Los Peñasquitos during the ongoing project) and will be contributing significant matching funds in terms of new and existing instruments and field equipment. These moorings will need to be recovered and re-deployed approximately every two months due to battery and memory limitations. The buried pressure sensors need to be recovered and re-deployed every 6 months. For upstream freshwater flow rates, we will use the closest available gauges (United States Geological Survey) scaled to account for ungauged watershed.

B. Remote instrumentation and imaging During our ongoing project, we have utilized an existing time-lapse camera focused over the mouth of the estuary (NERR SWMP) along with an in-house camera system deployed periodically to investigate large-scale morphodynamic changes (e.g., channel movements). The camera system, designed by

Giddings, S.N. USC Sea Grant 2015 10/19

undergraduate environmental engineering students in collaboration with the project PIs as part of a capstone engineering design course (MAE 126B), integrates orientation and location data with imagery. Using camera orientation data and known GPS points in the field of view, we can geo-rectify large scale images in order to get quantitative measures of morphologic change [Pawlowicz, 2003; Bourgault et al., 2011]. We will continue use of this instrumentation to monitor morphodynamic alterations. Additionally, we will use the camera system to conduct some closer field-of-view measurements of suspended sediment to corroborate the tripod measurements (see below).

To assess the generality of observations at the two selected sites, we will recruit an undergraduate student to carry out analysis of imagery (historical and collected as part of this proposed work) of LIE entrances in the southern California region. A significant historical imagery dataset exists for region via Google Earth (1-5 images per year, extending back to 2003 and further), and via the California Coastal Records Project (http://www.californiacoastline.org/, roughly two-year intervals). These data sets will be complemented by oblique imagery obtained biweekly during the study period at four LIE entrances near the two study sites (Buena Vista, Batiquitos, San Elijo, and San Dieguito Lagoons). The project PIs will co-advise an environmental engineering undergraduate who will carry out the imagery analysis as part of a two-quarter independent research course (MAE 199). The student will continue to participate as a research assistant over two summer months.

C. Regular transects surveys Regular high-resolution spatial and temporal sampling will be conducted approximately monthly during spring tides from a small vessel in both locations, continuing from our ongoing USC Sea Grant project. This sampling will include vertical profiles with a CTD that is cast over the side of the boat and a boat-mounted acoustic Doppler velocity profiler capturing velocity throughout the water column. When available, the CTD casts will include an OBS, and oxygen sensor. These transects will include along and cross-estuary transects every 2 hours throughout a tidal cycle. In addition we will collect water samples mid-water column to be filtered later in order to measure suspended sediment and calibrate the OBS. Additionally, in our focus estuary, we will conduct these surveys twice monthly during at least one winter month and one summer month in order to assess spring-neap tidal cycle variation. These additional surveys will be timed to occur at peak spring and peak ebb tides.

D. Extreme event surveys Both before and after storm events we will conduct high-resolution spatial and temporal sampling from a small vessel in our focus estuary. As with the regular surveys, this sampling will include CTD and ADCP surveys including along and cross-estuary transects every 2 hours throughout a tidal cycle.

In addition, in our focus estuary, we will deploy a tripod near the estuary mouth with two Acoustic Doppler Velocimeters (ADVs) programmed to capture waves, turbulence, and mean currents at two heights. These instruments will be aligned to allow for wave-turbulence decomposition. In addition to measuring waves, turbulence and mean currents, the ADVs will directly measure dissipation which we will compare to indirect estimates from two pressure sensors on either side of the ADV. Additionally, they will be connected to OBS units which when combined with in-situ sediment samples can be converted into suspended sediment concentrations. Finally, the camera will be mounted atop the tripod frame looking down at the water surface to provide a cross-reference for periods of high suspended sediment. Due to battery and memory life as well as potential for theft, this instrumentation cannot be deployed continuously. Thus, these tripods will be deployed for ~6 hours during large wave events and during calm conditions spanning the flood tide in order to capture wave-current interactions and hydraulic control effects.

The largest water level events historically occur in January-March. Thus we will deploy the additional in-situ instrumentation in Los Peñasquitos in November 2015 to capture pre-storm conditions. Additional

Giddings, S.N. USC Sea Grant 2015 11/19

deployment costs and instruments will be supported by PI startup funds and existing resources. Instruments will remain in the estuary through October 2017, being recovered and re-deployed as necessary based on battery life (approximately every other month). The additional sensors in the second system (the embayment, i.e. Agua Hedionda) will occur at the start of the project period, February 2016, during one of the rainiest expected months with significant differences between El Niño and neutral or La Niña conditions. Transects will be initiated prior to storm events based on weather and buoy reports. Transects will follow storm events by 1-2 days to ensure safe sampling conditions.

E. Data analysis The observational program described above is designed to address the questions posed in Section 6. Analysis of the observational data will be carried out to examine the associated hypotheses in a quantitative manner. The beach pressure sensors, upstream ADCP, and downstream ADVs will provide measurements of wave height and frequency while an offshore sensor will provide incoming wave direction. Using this instrumentation along with OBSs we will further quantify stresses, sediment flux, and investigate hydraulic control as explained below in more detail.

The ADVs will be synced and deployed at separate heights so that their separation is greater than the turbulent length scales. Using the assumption that variance associated with waves is much larger than that associated with turbulence, wave-turbulence decomposition will be performed to separate the effects of waves and Reynolds stresses on the bed [Shaw and Trowbridge, 2001; Trowbridge, 1998]. The wave, current, and combined bottom shear velocities and stresses and the apparent bottom roughness will be calculated [Grant and Madsen, 1979; Wiberg and Dungan Smith, 1983]. We will investigate effects of wave-current interactions on waves propagating into the lagoon during strong flood and ebb tidal flows [e.g., Olabarrieta et al., 2011; Dodet et al., 2013].

The dominant forcing for sediment transport near the inlet occurs due to a combination of bed load transport and suspended sediment transport. The bed load transport, governed by the Shield’s parameter will be calculated [Ribberink, 1998] based on shear velocities and in-situ sediment grain size distributions. OBS sensors will be deployed along with the ADVs and be calibrated with in-situ bed sediments samples [Green and Boon, 1993]. The measurements from the ADVs and OBS sensors will be used to quantify the sediment flux [Butt et al., 2004; Beach and Sternberg, 1988].

The hydraulic control parameters at the mouth sill will be analyzed [Seabergh, 2006] to understand the hydrodynamics at the constriction and its effects on sediment transport and inlet stability [Pacheco et al., 2008; Escoffier, 1940]. Based on measurements taken during the ongoing USC Sea Grant study, we will assume that when the inlet is open, the water column above the sill is vertically well mixed. We will also investigate the effects of tidal or wave bores identified during the previous study. Bores have been shown to increase turbulent mixing in the bottom layer [Koch and Chanson, 2008]. Bores may impact sediment transport [Butt and Russell, 2000] and re-oxygenation of bottom waters.

To determine larger scale morphodynamic response, we will quantitatively assess channel migration, accretion, and erosion using the digital camera data (using georectified imagery) and aerial surveys, validated by boat-based transects. We will relate these large scale morphodynamic responses to the observed hydrodynamics and use a few approaches to try to relate our observations to previous work and modeling studies [e.g., Friedrichs and Perry, 2001; Lanzoni and Seminara, 2002]. One approach we will use is a simple quantitative paradigm for assessing system responses described as dS/dt = k (S-S*) where S is a variable describing the temporal evolution of some system characteristic. S* represents the ‘stable’ condition and 1/k is the time scale for the system response. If k is constant, the relation has a solution that decays exponentially with time. This simple model for dynamic evolution is used commonly for beach morphology, for example, where the S may be a measure of the bathymetry, S* is determined from a Bruun type equilibrium profile and k is determined empirically. For the complex systems we are

Giddings, S.N. USC Sea Grant 2015 12/19

examining, this relation provides only a guiding framework, but we intend to explore the use of this paradigm in explaining estuarine response using data from the observational plan described above. We will also use guiding framework such as the Exner equations and other modeling studies as comparisons.

Comparisons with other sites using historical and new imagery (undergraduate researcher) will examine the relative morphological states for neighboring LIEs, (using channel width, for example) to establish the extent to which mouth response is coherent over time throughout the region.

10. RELATED RESEARCH There have been significant efforts in the Southern California region to investigate marsh habitat and biodiversity, efforts to address the impact of contaminants, and historical-based analysis of hydrodynamic and morphodynamic properties funded by Sea Grant and other organizations. Although some work on the event-time scale provides important qualitative context [e.g., Zedler, 2010], to our knowledge, direct observations of hydrodynamics and morphodynamics at a process level linking it to larger scales has not been done. Thus our proposed work compliments previous and ongoing work in the region. Ongoing regional monitoring (e.g., Figure 5 and Figure 6) will allow us to explore additional collaborations.

D. Jacobs et al. [2010] conducted a classification of California estuaries based on watershed, the degree of coastal exposure, and the type of formation to predict closure frequency and processes. This project was funded by USC Sea Grant and provides an important foundation upon which our work will build. Similarly, prior work by T. Longcore and colleagues focused on using historical ecology to establish baseline conditions for Southern California estuaries and geomorphic changes [Stein et al., 2010].

A currently funded USC Sea Grant project led by J. Largier and D. Gorge is investigating sediment transport using both observations and modeling around a headland, Point Dune, near Malibu. Their work has potential ties to ours, although much of their focus is on transport of particles, larvae, and sediment further offshore, but with some implications for beach transport. Beach transport processes are linked to processes within the estuaries. Similar related offshore work includes two previous USC Sea Grant studies by B. Jones and J. Fuhrman that investigated the downstream impacts of discharge and urban runoff on pathogen and contaminant transport. While they were not looking within the estuaries, but rather on the coast, their work highlights the importance of coastal impacts of these urban watersheds [Reifel et al., 2009; Warrick et al., 2007].

Extensive work has been conducted in the Southern California region investigating marsh habitat, biodiversity, function, restoration, transition, and other biological/ecosystem processes. As just a few examples, J. Zedler, L. Levin, C.R. Whitcraft, J. Crooks, amongst others have investigated processes ranging from species invasion, to marsh accretion, to habitat structure [e.g., Whitcraft and Levin, 2007; Zedler, 1996], with some of this work supported by Sea Grant. This work helps set the historical and current biological ecosystem value and function of these systems. We will continue to include measurements of suspended sediment and dissolved oxygen along with analysis of ongoing monitoring of water quality parameters within the estuary. Collaborations with additional planned projects include carbon chemistry in Agua Hedionda (T. Martz and K. Yeakel, see letter of support) and measurements of bacteria/phytoplankton community composition and gene expression in Los Peñasquitos (A. Allen and R. Diner, personal communication, 2015) amongst others. These collaborations and ongoing monitoring analysis will broaden the suite of water quality parameters and links to biological processes such as those investigated by Jones and Fuhrman.

Additionally, we are aware of complementary work either ongoing or being proposed in the region including beach studies, sea level rise response, proposed El Niño rapid response work, genetic analysis of closed versus open estuarine states, parasitism in estuaries, and others. For example, Scripps colleagues R. Guza and T. Gallien have collected ongoing records of beach accretion and erosion near the mouth of

Giddings, S.N. USC Sea Grant 2015 13/19

Los Peñasquitos Lagoon and the Tijuana Estuary which will help us connect beach sediment supply and beach processes to estuarine processes. As already mentioned, preliminary and planned work by Martz and Yeakel in Agua Hedionda will be strongly complimentary. Additionally, we have strong connections with related researchers studying San Dieguito Lagoon (including Steven Schroeter, a UCSB Ecologist, and Scripps graduate student May-Linn Paulsen conducting carbon measurements there), Mission Bay Kendall Front Reserve, and the Tijuana River Estuary.

11. BUDGET RELATED INFORMATION A. Budget Explanation/Justification

Personnel: We are requesting 0.5 months each of a Staff Research Associate and a Senior Marine Mechanician to calibrate, prepare, deploy, and recover the buried pressure sensors and offshore pressure + velocity (i.e., wave height and direction) sensor in Years 1 and 2. These personnel are highly experienced with this type of deployment. We are also requesting 2 months for an undergraduate researcher in year 2 to process and analyze the remote imagery and to help with field work.

Salary recharge rates are calculated for actual productive time only (except for non-faculty academic sick leave). The rates include components for employee benefits, provisions for applicable merit increases and range adjustments in accordance with University policy, except postdoc rates which do not include components for downtime, so those rates are calculated for all working hours. Staff overtime or remote location allowance may be required in order to meet project objectives, and separate rates are used in those cases.

Supplies, Materials, and other costs: • We plan to purchase 2 OBS 3+ sensors in Yr 1which will be integrated with the ADVs recently

purchased from Giddings’ startup funds. • We plan to purchase 4 SBE 56 temperature sensors to deploy along the estuary to capture

incoming tidal/wave bores. This will also provide preliminary tests for determining the value of a cable which can take spatially continuous temperature measurements (with collaborator K Davis).

• Battery packs for instrumentation are requested in both years. • An estimate for miscellaneous field supplies is included from a prior project of similar scale and

includes line, shackles, weights, and material to build instrument frames for both years. • A request for a cargo van vehicle rental is included to transport equipment to and from the field

sites for 6 days Yr 1 and for 4 days in Yr 2. • An estimate for boat costs including gas and maintenance based on a prior project of similar scale

is included for both years. • IT support costs are requested for computer software maintenance and consortium costs related to

the use of laboratory computers supporting hardware and software development for both years. This applies to computers being used for data analysis and instrument programming.

• Other project specific costs for both years include telephones, tolls, voice and data charges, photocopying, faxing and postage are requested. Supply and expense items, categorized as project specific, and computer and networking services are for expenses that specifically benefit this project and are reasonable and necessary for the performance of this project.

• Publication costs are requested for one manuscript in Yr 2.

Travel: Registration costs to attend the Headwaters 2 Ocean (H2O) conference in 2016 are included. Because this conference is local to San Diego, no additional travel costs are required. This is an excellent venue to disseminate information to interested government agencies, managers, scientists, and citizens. Costs to attend the Physics of Estuaries and Coastal Seas conference in 2016, held in the Netherlands, are included for year 1. This biannual conference focuses on estuarine physics and typically over 50% of the attendees are working on sediment transport. The 2016 location, while distant, is ideal for this project

Giddings, S.N. USC Sea Grant 2015 14/19

because researchers and managers in the Netherlands currently lead the world in understanding coastal resiliency and coastal management and the conference draws experts internationally. Finally, in year 2, 2 trips to a TBD National conference are included. All conference fees include estimates of airfare, per diem, and registration fees.

B. Matching Funds Giddings and Pawlak both have 9-month faculty appointments. Giddings will apply 0.9 mo. of her salary and Pawlak will apply 1.2 mo. of his salary towards the cost sharing which covers the required 50%.

12. ANTICIPATED BENEFITS Our proposed research will significantly enhance our understanding of urban Southern California lagoon physical (hydrodynamic and morphodynamic) response to elevated water level events (tides, waves, storms, and El Niño) and the ensuing ecosystem response (dissolved oxygen). While the physical processes we are proposing to investigate are detailed and complex, our approach will yield system-level understanding that will greatly improve our ability to predict morphodynamic changes and oxygen responses in low inflow estuaries. This will provide direct benefits for LIE managers and municipalities, for example, by aiding with planning for scheduled dredging. Over longer timescales, the work will provide managers with a foundation for improved coastal resiliency, water quality, ecosystem health, and adaptation to a changing climate. Specifically, we will continue our strong collaborations with the Los Peñasquitos Foundation (see letter of support from M. Hastings), Los Batiquitos Lagoon Foundation, NOAA's Tijuana NERR (see letter of support from J. Crooks), the San Dieguito wetlands restoration team, and develop ties with stakeholders in Agua Hedionda (see letter of support from Martz and Yeakel) including the Agua Hedionda Lagoon Foundation, Carlsbad aquafarm, and desalination plant.

As Southern California estuaries are heavily developed, these studies will help coastal managers plan for complex interactions between the built and natural environment. Specifically, we have chosen two estuaries that have direct local stakeholder interest and that are representative of the two main types of estuaries found in Southern California: open, embayment lagoons and lagoons with extensive marshland. Los Peñasquitos is bordered by the city of Del Mar and San Diego neighborhoods of La Jolla and Carmel Valley. It is also home of the Los Peñasquitos Lagoon Foundation and further upstream the Los Peñasquitos Canyon Preserve, and bordered to the south by the Torrey Pines State Natural Reserve. The Los Peñasquitos Lagoon Foundation is a non-profit organization managed in partnership with California State Parks. Mike Hastings, Executive Director of the Los Peñasquitos Lagoon Foundation and Dr. Jeff Crooks, Research Coordinator for the Tijuana River NERR, have both been instrumental in supporting our ongoing and proposed work (see attached letters of support). Our work will directly impact Hastings’ and Crooks’ management goals and long-term planning providing them with desired additional information regarding estuary function, flushing, and opening/closure mechanisms.

Agua Hedionda is a highly modified and highly utilized LIE located within the urban city of Carlsbad. It contains the Agua Hedionda Lagoon Foundation and Discovery Center; the Magdalena Ecke Family YMCA Aquatic Park, a summer camp; the Hubbs-Sea World Fish Hatchery, a hatchery for the endangered white-sea bass; Carlsbad Aquaculture, a mussel and oyster aquaculture facility; a power plant; a soon to be on-line desaliniation plant; and extensive recreational use. Ongoing management efforts are required in the lagoon to maintain this functionality including approximately bi-annual dredging. Additionally, significant research efforts have been focused on trying to plan for the desalination facility and the resulting brine discharge. The Agua Hedionda Lagoon Foundation runs the Agua Hedionda Lagoon Discovery Center (http://lagoon.aguahedionda.org/ agua-hedionda-lagoon-discovery-center) and we are working with Yeakel to make connections with this group. Yeakel has also connected with managers at the NOAA fishery as well as the power plant. Finally, we plan to learn from Dr. Scott Jenkins and his extensive work in the lagoon.

Giddings, S.N. USC Sea Grant 2015 15/19

Broadly, our scientific results will benefit managers at LIEs throughout Southern California as we will work to connect our results in these individual systems to more general types of LIEs. In addition to the scientific applications to management, all collaborators will be involved in outreach that furthers the project benefits. Both the Tijuana River NERR and Agua Hedionda Lagoon Foundation have visitor centers aimed at outreach to the general public. Project PIs will hold presentations and run mini-workshops at these centers and beyond to reach out to local communities. The PIs success in this has already been established during the first few months of the current USC Sea Grant project collaborating with the Tijuana NERR to host a booth at the Science EXPO day and participating in the Expanding Your Horizons conferences. Giddings is also a new member of the Technical Advisory Committee to the city of Del Mar on a sea level rise planning effort and she regularly attends Tijuana Estuary bi-national planning meetings. In addition, we will host a project website aimed at broad dissemination and free data access. Finally, this project will provide continued training in field methodology and hydrodynamic calculations for a Sea Grant Trainee (Madeleine Harvey, currently supported by the existing one year USC Sea Grant) and an undergraduate environmental engineering student.

13. COMMUNICATION OF RESULTS As mentioned above, we plan to continue our direct communication with managers at the Los Peñasquitos Lagoon Foundation and Tijuana River NERR. This not only includes M. Hastings and J. Crooks, but we are also in regular communication with Darren Smith from California Fish and Wildlife and Rangers Hardenbrook and Winterton from Torrey Pines State Park who have been supportive in providing access and permits for our currently USC Sea Grant funded study. We hope to establish similar relationships with managers at the Agua Hedionda Lagoon Foundation as well as partner stakeholders there (NOAA, the power plant and the desalination plant). This will include quarterly meetings and ongoing conversations as to how we can incorporate our results into management. During our first year of USC Sea Grant funding, we have also maintained significant communication with other local lagoon managers including those at San Dieguito and Los Batequitos lagoons; relationships that we will continue to grow. As highlighted in the support letters from M. Hastings and J. Crooks, our work will directly impact their ability to assess estuary mouth state, closure risks, and resulting ecosystem consequences for the lagoon.

Also as mentioned above, we plan to work with the local communities surrounding these estuaries. We have previously used the Tijuana River NERR Visitor Center to interact with local communities and students at outreach events aimed to introduce students to estuarine dynamics and environmental stewardship. We plan to expand our outreach activities to include volunteer activities at the Agua Hedionda Lagoon Discovery Center who work with YMCA and Boy and Girl Scout programs. Brochures and signs will be installed to explain to onlookers the ongoing work.

Importantly, these systems are similar to systems prevalent throughout Southern California. Thus to reach the broader Southern California audience, we hope to participate in USC Sea Grant workshops such as the workshops on sea level rise and coastal habitat conservation offered previously. Additionally, we plan to attend the Headwaters 2 Ocean (H2O) annual meeting which is aimed at addressing a wide spectrum of coastal issues drawing a diverse audience including researchers, engineers, managers, scientists, architects, urban planners, and representatives from local, regional, state, federal and non-profit agencies. This meeting provides an excellent venue to communicate results broadly. Using connections from this meeting and other networking, we hope to establish relationships with managers of estuaries throughout Southern California to discuss how our results pertain to their systems with the hopes of facilitating future collaborations and improving comparative studies and categorization.

Finally, we will publish at least one scholarly journal article resulting from this research for dissemination to the scientific community and attend two other conferences that are focused on estuarine dynamics and include sessions on sediment transport, hydrodynamics, and estuarine management.

Giddings, S.N. USC Sea Grant 2015 16/19

14. REFERENCES Beach, R. A., and R. W. Sternberg (1988) "Suspended sediment transport in the surf zone: Response to

cross-shore infragravity motion." Marine Geology, 80(1–2), 61-79.

Bertin, X., A. B. Fortunato, and A. Oliveira (2009) "A modeling-based analysis of processes driving wave-dominated inlets." Continental Shelf Research, 29(5-6), 819-834.

Bertin, X., and M. Olabarrieta (2015) An Infragravity Wave-Dominated Inlet? Proceedings of the Coastal Sediments Conference 2015, San Diego, CA.

Board of Governors of the Southern California Wetlands Recovery Project 2013 and 2014 reports available at http://scwrp.org/governing-board/.

Bourgault, D., D. C. Janes, and P. S. Galbraith (2011) "Observations of a Large-Amplitude Internal Wave Train and Its Reflection off a Steep Slope." Journal of Physical Oceanography, 41(3), 586-600. doi: 10.1175/2010JPO4464.1; 05.

Bromirski, P. D., R. E. Flick, and D. R. Cayan (2003) "Storminess Variability along the California Coast: 1858-2000." Journal of Climate, 16(6), 982-993. doi: 10.1175/1520-0442(2003)0162.0.CO;2; 10.

Butt, T., and P. Russell (2000) "Hydrodynamics and cross-shore sediment transport in the swash-zone of natural beaches: A review." Journal of Coastal Research, 16(2), 255-268.

Butt, T., P. Russell, J. Puleo, J. Miles, and G. Masselink (2004) "The influence of bore turbulence on sediment transport in the swash and inner surf zones." Continental Shelf Research, 24(7-8), 757-771.

Cayan, D., P. Bromirski, K. Hayhoe, M. Tyree, M. Dettinger, and R. Flick (2008) "Climate change projections of sea level extremes along the California coast." Climatic Change, 87(1), 57-73.

Das, T., E. P. Maurer, D. W. Pierce, M. D. Dettinger, and D. R. Cayan (2013) "Increases in flood magnitudes in California under warming climates." Journal of Hydrology, 501(0), 101-110.

Dodet, G., X. Bertin, N. Bruneau, A. B. Fortunato, A. Nahon, and A. Roland (2013) "Wave-current interactions in a wave-dominated tidal inlet." Journal of Geophysical Research-Oceans, 118(3), 1587-1605.

Engstrom, W. N. (2006) "Nineteenth Century Coastal Geomorphology of Southern California." Journal of Coastal Research, 22(4), 847-861.

Escoffier, F. F. (1940) "The Stability of Tidal Inlets." 8(4), 114-115.

Flick, R., and D. R. Cayan (1984) "Extreme sea levels on the coast of California." Coastal Engineering Proceedings, 1(19), 886-898.

Friedrichs, C. T., and J. E. Perry (2001) "Tidal Salt Marsh Morphodynamics: A Synthesis." Journal of Coastal Research, (Special issue NO. 27. Tidal Wetland Restoration: Physical and Ecological Processes), 7-37.

Grant, W. D., and O. S. Madsen (1979) "Combined Wave and Current Interaction with a Rough Bottom." Journal of Geophysical Research-Oceans and Atmospheres, 84(NC4), 1797-1808.

Grayson, J. E., M. G. Chapman, and A. J. Underwood (1999) "The assessment of restoration of habitat in urban wetlands." Landscape and Urban Planning, 43(4), 227-236.

Green, M. O., and J. D. Boon (1993) "The Measurement of Constituent Concentrations in Nonhomogeneous Sediment Suspensions using Optical Backscatter Sensors." Marine Geology, 110(1-2), 73-81.

Giddings, S.N. USC Sea Grant 2015 17/19

Halpern, B. S., C. Longo, C. Scarborough, D. Hardy, B. D. Best, S. C. Doney, S. K. Katona, K. L. McLeod, A. A. Rosenberg, and J. F. Samhouri (2014) "Assessing the Health of the U.S. West Coast with a Regional-Scale Application of the Ocean Health Index." PLoS ONE, 9(6), e98995.

Herbers, T., S. Elgar, and R. Guza (1995) "Generation and propagation of infragravity waves." Journal of Geophysical Research-Oceans, 100(C12), 24863-24872.

Hickey, B. M. (1998) Coastal oceanography of western North America from the tip of Baja California to Vancouver Island: Coastal segment, in The Sea, edited by A. R. Robinson and K. H. Brink, pp. 345-391, John Wiley & Sons, Inc.

Jacobs, D., E. D. Stein, and T. Longcore (2010). Classificiation of California Estuaries Based on Natural Closure Patterns: Templates for Restoration and Management, Southern California Coastal Water Research Project, report.

Jenkins, S. A., and J. Wasyl (2006). Coastal Processes Effects of Reduced Intake Flows at Agua Hedionda Lagoon, report.

Koch, C., and H. Chanson (2008) "Turbulent mixing beneath an undular bore front." Journal of Coastal Research, 24(4), 999-1007.

Lanzoni, S., and G. Seminara (2002) "Long-term evolution and morphodynamic equilibrium of tidal channels." Journal of Geophysical Research: Oceans, 107(C1), 1-1-1-13.

Largier, J. L. (2010), Low-inflow estuaries: hypersaline, inverse, and thermal scenarios, in Contemporary Issues in Estaurine Physicsedited by A. Valle-Levinson, pp. 247-272, .

Largier, J. L., C. J. Hearn, and D. B. Chadwick (1996), Density structures in low-inflow "estuaries", in Buoyancy Effects on Coastal and Estuarine Dynamicsedited by D. G. Aubrey and C. T. Friedrichs, pp. 227-241.

Largier, J. L., S. V. Smith, and J. T. Hollibaugh (1997). "Seasonally hypersaline estuaries in mediterranean-climate regions." Estuarine Coastal and Shelf Science, 45, 789-797.

Larson, E. J. (2001), Coastal Wetlands - Emergent Marshes, in California’s Living Marine Resources: A Status Reportedited by California Department of Fish and Game, pp. 483-486, .

Longuet-Higgins, M. S., and R. W. Stewart (1962) "Radiation stress and mass transport in gravity waves, with application to ‘surf beats’." Journal of Fluid Mechanics, 13(04), 481-504.

Los Angeles Department of Tourism (2014). Los Angeles Tourism by Numbers 2013 Quick Facts. Available at www.discoverlosangeles.com/tourism/research/.

Lotze, H. K., H. S. Lenihan, B. J. Bourque, R. H. Bradbury, R. G. Cooke, M. C. Kay, S. M. Kidwell, M. X. Kirby, C. H. Peterson, and J. B. C. Jackson (2006) "Depletion, Degradation, and Recovery Potential of Estuaries and Coastal Seas." Science, 312(5781), 1806-1809.

Moreno, I. M., A. Ávila, and M. Á Losada (2010) "Morphodynamics of intermittent coastal lagoons in Southern Spain: Zahara de los Atunes." Geomorphology, 121(3–4), 305-316.

Moreno-Mateos, D., M. E. Power, F. A. ComÃn, and R. Yockteng (2012) "Structural and Functional Loss in Restored Wetland Ecosystems." PLoS Biol, 10(1), e1001247.

Murray, B., L. Pendleton, W. A. Jenkins, and S. Sifleet (2011) Green Payments for Blue Carbon: Economic Incentives for Protecting Threatened Coastal Habitats.

Nezlin, N. P., and P. M. DiGiacomo (2005) "Satellite ocean color observations of stormwater runoff plumes along the San Pedro Shelf (southern California) during 1997-2003." Continental Shelf Research, 25(14), 1692-1711.

Giddings, S.N. USC Sea Grant 2015 18/19

NOAA Climate Prediction Center, 2 July 2015. El Niño/Southern Oscillation Diagnostic Discussion, available at http://www.cpc.ncep.noaa.gov/products/analysis_monitoring/ enso_advisory/ensodisc.html.

Olabarrieta, M., J. C. Warner, and N. Kumar (2011) "Wave-current interaction in Willapa Bay." Journal of Geophysical Research: Oceans, 116(C12), - C12014.

Ortega-Cisneros, K., U. M. Scharler, and A. K. Whitfield (2014) "Inlet mouth phase influences density, variability and standing stocks of plankton assemblages in temporarily open/closed estuaries." Estuarine, Coastal and Shelf Science, 136(0), 139-148.

Pacheco, A., A. Vila-Concejo, Ó Ferreira, and J. A. Dias (2008) "Assessment of tidal inlet evolution and stability using sediment budget computations and hydraulic parameter analysis." Marine Geology, 247(1–2), 104-127.

Pawlowicz, R. (2003) "Quantitative visualization of geophysical flows using low-cost oblique digital time-lapse imaging." Oceanic Engineering, IEEE Journal of, 28(4), 699-710.

Port of Long Beach (2014). Statistics available at www.polb.com/economic/economics.asp.

The Port of Los Angeles (2014). Statistics available at www.portoflosangeles.org/finance/ economic_impact.asp.

Ranasinghe, R., C. Pattiaratchi, and G. Masselink (1999) "A morphodynamic model to simulate the seasonal closure of tidal inlets." Coastal Engineering, 37(1), 1-36.

Reeve, D. E., and H. Karunarathna (2009) "On the prediction of long-term morphodynamic response of estuarine systems to sea level rise and human interference." Continental Shelf Research, 29(7), 938-950.

Reifel, K. M., S. C. Johnson, P. M. DiGiacomo, M. J. Mengel, N. P. Nezlin, J. A. Warrick, and B. H. Jones (2009) "Impacts of stormwater runoff in the Southern California Bight: Relationships among plume constituents." Continental Shelf Research, 29(15), 1821-1835.

Ribberink, J. (1998) "Bed-load transport for steady flows and unsteady oscillatory flows." Coastal Engineering, 34(1-2), 59-82.

Riddin, T., and J. B. Adams (2010) "The effect of a storm surge event on the macrophytes of a temporarily open/closed estuary, South Africa." Estuarine, Coastal and Shelf Science, 89(1), 119-123.

Roelvink, D., A. Reniers, A. van Dongeren, J. v. T. de Vries, R. McCall, and J. Lescinski (2009) "Modelling storm impacts on beaches, dunes and barrier islands." Coastal Engineering, 56(11-12), 1133-1152.

San Diego Tourism Authority (2014). San Diego County 2014 Visitor Industry General Facts. Available at www.sandiego.org/industry-research.aspx.

SCCOOS (Southern California Coastal Ocean Observing System), 2 July 2015. El Niño, available at http://www.sccoos.org/data/elnino/.

Seabergh, W. C. (2006), Hydrodynamics of tidal Inlets, in Coastal Engineering Manual 1110-2-1100edited by Anonymous , pp. Ch. II-6, US Army Corps of Engineers.

Shaw, W., and J. Trowbridge (2001) "The direct estimation of near-bottom turbulent fluxes in the presence of energetic wave motions." Journal of Atmospheric and Oceanic Technology, 18(9), 1540-1557.

Shepard, C. C., C. M. Crain, and M. W. Beck (2011) "The Protective Role of Coastal Marshes: A Systematic Review and Meta-analysis." PLoS ONE, 6(11), e27374.

Giddings, S.N. USC Sea Grant 2015 19/19

Southern California Wetlands Recovery Project (2013), Chapter II: Southern California Wetlands , in WRP Regional Strategy.

Stein, E., S. Dark, T. Longcore, R. Grossinger, N. Hall, and M. Beland (2010) "Historical Ecology as a Tool for Assessing Landscape Change and Informing Wetland Restoration Priorities." Wetlands, 30(3), 589-601.

Trowbridge, J. H. (1998) "On a technique for measurement of turbulent shear stress in the presence of surface waves." Journal of Atmospheric and Oceanic Technology, 15(1), 290-298.

US Census Bureau (2010). Data available at www.census.gov/2010census/. Warrick, J. A., P. M. DiGiacomo, S. B. Weisberg, N. P. Nezlin, M. Mengel, B. H. Jones, J. C. Ohlmann,

L. Washburn, E. J. Terrill, and K. L. Farnsworth (2007) "River plume patterns and dynamics within the Southern California Bight." Continental Shelf Research, 27(19), 2427-2448.

Whitcraft, C. R., and L. A. Levin (2007) "Regulation of benthic algal and animal communities by salt marsh plants: impact of shading." Ecology, 88(4), 904-917. doi: 10.1890/05-2074; 06.

Wiberg, P., and J. Dungan Smith (1983) "A comparison of field data and theoretical models for wave-current interactions at the bed on the continental shelf." Continental Shelf Research, 2(2–3), 147-162.

Wolter, K., 5 July 2015, Multivariate ENSO index, available at http://www.esrl.noaa.gov/psd/enso/mei/. Wolter, K., and M. S. Timlin (1998) "Measuring the strength of ENSO events: How does 1997/98 rank?"

Weather, 53(9), 315-324.

Zedler, J. B. (1996) Tidal wetland restoration: a scientific perspective and southern California focus., California Sea Grant College System, University of California.

Zedler, J. B. (2010) "How frequent storms affect wetland vegetation: a preview of climate-change impacts." Frontiers in Ecology and the Environment, 8(10), 540-547. doi: 10.1890/090109; 15.

Giddings, S.N. USC Sea Grant 2015 Work Schedule

PROJECTED WORK SCHEDULE Project Title: Drivers of Morphodynamic Change and Hypoxic Events in Southern California Lagoons

As described in the methods, in-situ instrumentation will begin prior to the February 2016 start of this grant in order to capture the beginning of the storm season, and as part of the currently funded 1 year USC Sea Grant project ending at the end of January 2016. Instruments, including moorings and beach pressure gauges, will be prepared and deployed early using instruments purchased through Giddings startup and Pawlak’s existing instrument pool with resources from the ongoing USC Sea Grant project.

This proposed grant will begin February 2016, Year 1, and will build substantial capacity upon what we can accomplish with our startup funds and existing instrumentation. Using this grant, we will deploy additional instrumentation as well as enhance our rapid response event sampling. This includes additional measurements during the intensive surveys as well as the ability to carry out the surveys throughout the winter season into the particularly stormy February and March months. The additional measurements will include enhanced in-situ transect surveys, remote imagery surveys, and tripod measurements. Due to battery and memory limitations, in-situ instrumentation will need to be recovered and re-deployed every two months (hashing). Analysis will occur throughout the year as new data will be coming in every two months and transect data every one month at a minimum. We will present at the H2O (Headwaters 2 Ocean) conference in late May 2016, the PECS (Physics of Estuaries and Coastal Seas) conference in August 2016, and likely the CERF (Coastal and Estuarine Research Federation) conference in November 2017. The student trainee will take her qualifying exam to become a PhD candidate in June 2016. We will begin manuscript preparation and extension to other estuaries starting during spring/early summer of 2016.

project(yearobjective month N D J F M A M J J A S O N D J F M A M J J A S O N D J

in+situ/observations/* 1 1 1 1 1 1 1 2 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1in+situ/obs,/bay+like/estuaryhigh/resolution/pressure/sensorsintensive/event/surveysdata/analysisextension/to/other/estuariesmanuscript/preparation/&/presentation C Q C C

*/solid/indicates/in+situ/measurements/while/hashing/indicates/instrument/deployment/recovery/and/turnarounds1/indicates/montly/transect/sampling,/2/indicates/2/surveys/to/capture/spring/neap/variationC/indicates/a/conferenceQ/indicates/the/student's/qualifying/exam/while/hashing/indicates/preparation/for/the/exam

analysis

Year(1Year(0 Year(2

OMB Control No. 0648-0362Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: UCSD Scripos Institution of Oceanography GRANT/PROJECT NO.:

DURATION (months):February 1, 2016 - January 31, 2017

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior Personnel No. of PeopleAmount of Effort Sea Grant Funds Matching Funds

a. Principal Investigator: Sarah Giddings 1 0.5 3,505 (Co) Principal Investigator: Eugene Pawlak 1 0.7 9,450b. Associates (Faculty or Staff):

Sub Total: 2 1.2 0 12,955

2. Other Personnela. Professionals:b. Research Associates: 2 1.0 9,772c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians:h. Other:

Total Salaries and Wages: 4 2.2 9,772 12,955

B. FRINGE BENEFITS: *see below* 0 2,644Total Personnel (A and B): 9,772 15,598

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT: 17,116

E. TRAVEL:1. Domestic 3502. International 3,798

Total Travel: 4,148 0

F. PUBLICATION AND DOCUMENTATION COSTS:

G. OTHER COSTS:1 Project Specific 160234567

Total Other Costs: 160 0

TOTAL DIRECT COST (A through G): 31,196 15,598

INDIRECT COST (On campus 55% ): 13.33333333 17,158 8,579INDIRECT COST (Off campus % of $ ):

Total Indirect Cost: 17,158 8,579

TOTAL COSTS: 48,354 24,178

* UCSD SIO: Salary recharge rates are calculated for actual productive time only (except for non-faculty academic sick leave). The rates include components for employee benefits, provisions for applicable merit increases and range adjustments in accordance with University policy, except postdoc rates which do not include components for downtime, so those rates are calculated for all working hours. Staff overtime or remote location allowance may be required in order to meet project objectives, and separate rates are used in those cases.

PRINCIPAL INVESTIGATOR: Sarah Giddings

UCSD #2016-0029BRIEF TITLE: DRIVERS OF MORPHODYNAMIC CHANGE AND HYPOXIC EVENTS IN SOUTHERN CALIFORNIA LAGOONS

OMB Control No. 0648-0362Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: UCSD Scripos Institution of Oceanography GRANT/PROJECT NO.:

DURATION (months):February 1, 2017 - January 31, 2018

12 months 2 Yr.A. SALARIES AND WAGES: man-months

1. Senior Personnel No. of PeopleAmount of Effort Sea Grant Funds Matching Funds

a. Principal Investigator: Sarah Giddings 1 0.4 3,083 (Co) Principal Investigator: Eugene Pawlak 1 0.5 6,750b. Associates (Faculty or Staff):

Sub Total: 2 0.9 0 9,833

2. Other Personnela. Professionals:b. Research Associates: 2 1.0 10,114c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s): 1 2.0 4,846f. Secretarial-Clerical:g. Technicians:h. Other:

Total Salaries and Wages: 5 3.9 14,960 9,833

B. FRINGE BENEFITS: *see below* 0 2,129Total Personnel (A and B): 14,960 11,962

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT: 4,504

E. TRAVEL:1. Domestic 3,3002. International

Total Travel: 3,300 0

F. PUBLICATION AND DOCUMENTATION COSTS: 1,000

G. OTHER COSTS:1 Project Specific Supplies 160234567

Total Other Costs: 160 0

TOTAL DIRECT COST (A through G): 23,924 11,962

INDIRECT COST (On campus 55%): 65% 13,158 6,579INDIRECT COST (Off campus of $ ):

Total Indirect Cost: 13,158 6,579

TOTAL COSTS: 37,082 18,541

* UCSD SIO: Salary recharge rates are calculated for actual productive time only (except for non-faculty academic sick leave). The rates include components for employee benefits, provisions for applicable merit increases and range adjustments in accordance with University policy, except postdoc rates which do not include components for downtime, so those rates are calculated for all working hours. Staff overtime or remote location allowance may be required in order to meet project objectives, and separate rates are used in those cases.

PRINCIPAL INVESTIGATOR: Sarah Giddings

UCSD #2016-0029BRIEF TITLE: DRIVERS OF MORPHODYNAMIC CHANGE AND HYPOXIC EVENTS IN SOUTHERN CALIFORNIA LAGOONS

Giddings, S.N. USC Sea Grant 2015 SN Giddings CV

BRIEF CURRICULM VITAE – SN GIDDINGS NAME: Sarah N. Giddings, Assistant Professor, UCSD, Scripps Institution of Oceanography

Address: 9500 Gilman Drive #0206, La Jolla, CA 92093-0206

Phone: (work) 858-534-5103 Email: sarahgid@ucsd.edu

EDUCATION Ph.D. Civil and Environmental Engineering, Stanford University, Dec. 2010 M.S. Civil and Environmental Engineering, Stanford University, June 2005 B.S. Civil and Environmental Engineering, University of California, Berkeley, Dec. 2003 POSITIONS HELD Assistant Professor, University of California, San Diego, Scripps Institution of Oceanography, (1/14-current) NSF Ocean Sciences Postdoctoral Research Fellow, University of Washington (1/13 – 12/13) Postdoctoral Research advisor Dr. Parker MacCready, University of Washington (1/11 - 12/12) Engineering Intern: Stetson Engineers Inc. water resources consulting engineers (1/04 - 8/04) Research Assistant for Dr. Mark Stacey, Civil and Environmental Engineering, U.C. Berkeley (6/03-12/03) Intern: Alameda County Water District Operations Department, (1/02 – 8/02) Research Assistant for Dr. Robert Harley, Civil and Environmental Engineering, U.C. Berkeley (6/01-6/02) SELECTED PUBLICATIONS Siedlecki, S. A., N. S. Banas, K. A. Davis, S. N. Giddings, B. M. Hickey, P. MacCready, T. P. Connolly,

and S. Geier (2015), Seasonal and interannual Oxygen variability on the Washington and Oregon continental shelves. Journal of Geophysical Research, Oceans. 120 (2): 618-633, doi: 10.1002/2014JC010254.

Giddings, S.N., P. MacCready, B.M. Hickey, N.S. Banas, K.A. Davis, S.A. Siedlecki, V.L. Trainer, R.M. Kudela, N.A. Pelland, and T.P. Connolly (2014), "Hindcasts of potential harmful algal bloom transport pathways on the Pacific Northwest coast." J. Geophys. Res., 119(4), doi: 10.1002/2013JC009622.

Giddings, S.N., S.G. Monismith, D.A. Fong, and M.T. Stacey (2014), “Using depth-normalized coordinates to examine mass transport residual circulation in estuaries with large tidal amplitude relative to the mean depth.” J. Phys. Oceanogr., 44, 128-148. doi: 10.1175/JPO-D-12-0201.1.

Giddings, S.N., D.A. Fong, S.G. Monismith, C.C. Chickadel, K.A. Edwards, W.J. Plant, B. Wang, O.B. Fringer, A.R. Horner-Devine, and A.T. Jessup (2012), “Frontogenesis and frontal progression of a trapping-generated estuarine convergence front and its influence on mixing and stratification,” Estuaries and Coasts, doi: 10.1007/s12237-011-9453-z.

Wang, B, S.N. Giddings, O.B. Fringer, E.S. Gross, D.A. Fong, and S.G. Monismith (2011), “Modeling and understanding turbulent mixing in a macrotidal salt wedge estuary." J. Geophys. Res., 116, C02036, doi: 10.1029/2010JC006135.

Giddings, S.N., D.A. Fong, and S.G. Monismith (2011), "Role of straining and advection in the intratidal evolution of stratification, vertical mixing, and longitudinal dispersion of a shallow, macrotidal, salt wedge estuary." J. Geophys. Res., 116, doi: 10.1029/2010JC006482.

Giddings, S.N. USC Sea Grant 2015 SN Giddings CV

Wang, B, O.B. Fringer, S.N. Giddings, and D.A. Fong (2009), "High-resolution simulations of a macrotidal estuary using SUNTANS." Ocean Modelling, 26(1-2), 60-85.

Plant, W.J., R. Branch, G. Chatham, C.C. Chickadel, K. Hayes, B. Hayworth, A. Horner-Devine, A. Jessup, D.A. Fong, O.B. Fringer, S.N. Giddings, S.G. Monismith, and B. Wang (2009), “Remotely sensed river surface features compared with modeling and in-situ measurements,” J. Geophys. Res., 114, C11002, doi: 10.1029/2009JC005440.

Harley, R.A, L.C. Marr, J.K. Lehner and S.N. Giddings (2005), “Changes in Motor Vehicle Emissions on Diurnal to Decadal Time Scales and Effects on Atmospheric Composition,” Environmental Science & Technology, 39(14), 5356-5362.

PROFESSIONAL ACCOMPLISHMENTS • NSF Ocean Sciences Postdoctoral Research Fellowship, Jan 2013 • Conference Chair Eastern Pacific Ocean Conference (EPOC) Co-chair, 2012 • UW Postdoctoral Association research symposium award for best talk, 2011 • Outstanding contribution to manuscript review, Coastal and Estuarine Research Federation, 2011 • Society of Women Engineers Teaching Excellence Award, 2010 • Physics of Estuaries and Coastal Seas Conference award for best oral presentation, 2008 • Achievement Rewards for College Scientists Foundation Fellowship 2008-2009 • National Science Foundation Graduate Research Fellowship 2004-2007 • Stanford Graduate Fellowship, NSF-Wells Family Fellow, 2004 • Invited talks: Gordon Research Conference on Coastal Ocean Modeling, 10 June 2015;  Mechanical

Engineering Fluids Seminar, UCSD, 13 October 2014;  John and Mary Louise Riley Seminar Series at UC Davis Bodega Marine Laboratory, 13 August 2014;  Stanford University Fluid Mechanics, 1 April 2014; “Ignite” talk, CERF meeting, 4 Nov 2013; discussion lead, Workshop on River Plume Mixing, 3 Oct 2013; UCLA Department of Atmospheric and Oceanic Sciences, 20 Feb. 2013; San Francisco State University Geosciences Department, 5 Feb. 2013; Scripps Institution of Oceanography, 23 Jan. 2013; Cal Poly San Luis Obispo Physics Department, 29 Jan. 2013; Friday Harbor Labs, 22 Jun. 2012; Virginia Institute of Marine Sciences, 23 Apr. 2012; University of Florida, 16 Mar. 2012; Coastal & Hydraulics Laboratory, 13 July 2009.

SYNERGISTIC ACTIVITIES Teaching: I have taught several graduate level classes and one undergraduate class Educational Outreach: I am engaged in numerous educational outreach programs throughout the year, three that exemplify outreach to young and underrepresented students include: Volunteer for Science EXPO (with the Tijuana NERR), March 2015 Volunteer for Avanzamos, UCSD (targeted towards young Latinas), March 2014 Volunteer for Ocean Inquiry Project (lower socioeconomic students), April 2011 – current Expanding your Horizons Conference (women in science), March 2006 and 2007 Collaborations, Workshop participation, reviews: I have collaborated with a variety of scientists on interdisciplinary research including chemists and biologists. In addition I have participated in a variety of workshops on interdisciplinary topics and reviewed over 15 manuscripts and 6 proposals. Student Advising: I currently advise 2 PhD students, sit on 2 additional PhD Committees, and have advised 2 undergraduate researchers

Giddings, S.N. USC Sea Grant 2015 G Pawlak CV

BRIEF CURRICULM VITAE – G PAWLAK NAME: Geno Pawlak, Professor, UCSD, Department of Mechanical and Aerospace Engineering

Address: 9500 Gilman Drive #0411, La Jolla, CA 92093-0411

Phone: (work) 858-534-2343 Email: pawlak@ucsd.edu EDUCATION University of Minnesota, Aerospace Engineering and Mechanics, B.S.E., 1991 University of California, San Diego, Mechanical Engineering, M.S.E., 1994 University of California, San Diego, Mechanical Engineering, Ph.D, 1997 POSITIONS HELD 2015-Present Professor, Mech. and Aerosp. Engineering, University of California, San Diego; 2012-2015 Assoc. Professor, Mech. and Aerosp. Engineering, University of California, San Diego; 2007-2012 Assoc. Professor, Ocean and Resources Engineering, University of Hawaii; Cooperating Graduate Faculty, Dept. of Oceanography (2002-2012) Ocean and Resources Engineering Graduate Program Chair (2010-2012) 2001-2007 Assistant Professor, Dept. of Ocean and Resources Engineering, University of Hawaii. 1998-2001 Postdoctoral Research Associate, School of Oceanography, University of Washington. 1997-1998 Postdoctoral Research Associate, Scripps Institution of Oceanography, University of

California, San Diego. 1992-1997 Graduate Research Assistant, Scripps Institution of Oceanography, University of

California, San Diego.

SELECTED PUBLICATIONS L. Molina, G. Pawlak, S.G. Monismith, and M.A. Merrifield, "Cross-shore Thermal Exchange on a

Tropical Fore-reef", of Geophysical Research, doi:10.1002/2013JC009621, 2014 J. P. Fram, G. Pawlak, F.J. Sansone, B.T. Glazer and A.K. Hannides, “Miniature Thermistor Chain for

Determining Surficial Sediment Porewater Advection”, Limnology and Oceanography Methods, 12:155-165, 2014

Y. Yamazaki, K.F. Cheung, G. Pawlak, T. Lay, “Surges along the Honolulu Coast from the 2011 Tohoku Tsunami”, Geophysical Research Letters, 39, 9, doi:10.1029/2012GL051624, 2012.

J.R. Wells, J. P. Fram and G. Pawlak, “Solar warming of the seafloor on a fringing reef”, J. Marine Research, 70, 4, 641-660, 2012.

M. Canals and G. Pawlak, "Three-dimensional vortex dynamics in oscillatory flow separation", Journal of Fluid Mechanics, 674, pg 408, doi:10.1017/S0022112011000012, 2011.

S. Jaramillo and G. Pawlak, “AUV-based bed-roughness mapping over a tropical reef”, Coral Reefs, doi:10.1007/s00338-011-0731-9, 2011

J. Sevadjian, M.A.McManus, G. Pawlak, “Effects of physical structure and processes on thin zooplankton layers in Mamala Bay, Hawai’i.”, Marine Ecology Progress Series, 409: 95-106, 2010.

M. S. Tomlinson, E. H. De Carlo, M. A. McManus, G. Pawlak, G. F. Steward, F. J. Sansone, O. D. Nigro, C. E. Ostrander, R.E. Timmerman, J. Patterson, S. Jaramillo*, “Monitoring the Effects of Storms on Coastal Water Quality with the Hawai‘i Ocean Observing System (HiOOS)”, Oceanography, June 2011.

J.D. Bricker, S. Munger, C. Pequignet, J.R. Wells, G. Pawlak, K. F. Cheung, "ADCP observations of edge waves off Oahu in the wake of the November 2006 Kuril Islands tsunami", Geophys. Res. Lett., 34, L23617, doi:10.1029/2007GL032015, Dec. 2007.

Giddings, S.N. USC Sea Grant 2015 G Pawlak CV

J. M. Becker, Y. L. Firing, J. Aucan, R. Holman, M. Merrifield and G. Pawlak, “Video-based Observations of Nearshore Sand Ripples and Ripple Migration”, Journal of Geophysical Research, 112, C01007, doi:10.1029/2005JC003451, 2007.

SYNERGISTIC ACTIVITIES - Serve as faculty advisor for UCSD Global Teams in Engineering Service (TIES) program. TIES is a humanitarian engineering program that assembles teams of undergraduates to work with non-profits in San Diego and in developing countries around the world. - Participated in UH Faculty Ambassadors Program: This program takes UH faculty members to local schools with the purpose of giving high school students a personal view of the university academic. The project aims to increase interest in higher education in general. - Referee for JFM, J. Fluid Eng., L&O, JPO, JCR, JGR, DSR, J. Wat., Port, Coast. Ocean Eng., Ocean Eng., among others. - Session Convener/Chair, 2010 AGU Ocean Sciences Meeting; Session Chair AGU Fall Meeting; Organizing Committee, 2012 APS Division of Fluid Dynamics Meeting ADVISING Current students: Andre Amador (PhD), Isabel Arzeno (PhD), Ajinkya Desai (MS) Completed degrees: Vasco Nunes (MS), Abdulla Mohamed (MS), Melinda Swanson (MS), Lauren Tuthill (MS), Miguel Canals (PhD), Marion Bandet-Chavanne (PhD), Kumar Rajagopalan (PhD) Postdoctoral Researchers (current): Payam Aghsaee Postdoctoral Researchers (previous): Jeremy Bricker, Jon Fram, Andrew Hebert, Judith Wells, Sergio Jaramillo, Audric Collignon Total Graduate Students advised: 10 Total Postdoctoral Researchers advised: 7

1

CURRICULUM VITAE – KRISTEN DAVIS July 2015

Address: Henry Samueli School of Engineering Civil and Environmental Engineering

University of California, Irvine Irvine, CA 92697

Phone: (949) 824-4498 (office) E-mail: davis@uci.edu Education University of Florida, Environmental Engineering Sciences, B.S., 2000 Stanford University, Civil and Environmental Engineering, M.S., 2004 Stanford University, Civil and Environmental Engineering, Ph.D., 2009 Professional History 2012-Present Asst. Professor, Civil and Environmental Engineering & Earth System Science,

University of California, Irvine 2010-2012 Research Associate, Applied Physics Laboratory, University of Washington 2009-2010 Postdoctoral Scholar, Departments of Physical Oceanography and Biology, Woods Hole

Oceanographic Institution Selected Publications DeCarlo, Thomas M., Kristopher B. Karnauskas, Kristen A. Davis, and George TF Wong. (2015)

Climate modulates internal wave activity in the Northern South China Sea. Geophysical Research Letters.

Siedlecki, Samantha A., Neil S. Banas, Kristen A. Davis, Sarah Giddings, Barbara M. Hickey, Parker MacCready, Thomas Connolly, Sue Geier. (2015) Seasonal and interannual oxygen variability on the Washington and Oregon continental shelves. Journal of Geophysical Research: Oceans.

Rippy, Megan, Robert Stein, Brett Sanders, Kristen Davis, Karen McLaughlin, John Skinner, John Kappeler, and Stanley Grant. (2014) Small Drains, Big Problems: The Impact of Dry Weather Runoff on Shoreline Water Quality at Enclosed Beaches. Environmental science & technology 48.24: 14168-14177.

Davis, Kristen A., Neil S. Banas, Sarah Giddings, Samantha A. Siedlecki, Parker MacCready, Evelyn J. Lessard, Raphael M. Kudela, Barbara M. Hickey. (2014) Estuary-enhanced upwelling of marine nutrients fuels coastal productivity in the US Pacific Northwest. Journal of Geophysical Resesarch: Oceans 119(12): 8778-8799.

Giddings, Sarah N., Parker MacCready, Barbara Hickey, Neil Banas, Kristen A. Davis, Samantha Siedlecki, Vera Trainer, Raphael Kudela, Noel Pelland, and Thomas Connolly (2014), Hindcasts of potential harmful algal bloom transport on the Pacific Northwest coast., J. Geophys. Res., doi:10.1002/2013JC009622.

Davis, Kristen A. and Stephen G. Monismith. (2011) The modification of bottom boundary layer turbulence and mixing by internal waves shoaling on a barrier reef. Journal of Physical Oceanography, 41(11), 2223-2241.

Davis, Kristen A., Steven J. Lentz, Jesús P. Pineda, J. Tom Farrar, Victoria R. Starczak, and James H. Churchill. (2011) Observations of the thermal environment on Red Sea platform reefs: A heat budget analysis. Coral Reefs, 30, 25-36.

Monismith, Stephen G., Kristen A. Davis, Gregory G. Shellenbarger, James L. Hench, Nicholas J. Nidzieko, Alyson E. Santoro, Matthew A. Reidenbach, Johanna H. Rosman, Roi Holtzman, Christopher S. Martens, Niels L. Lindquist, Melissa W. Southwell, and Amatzia Genin, (2010) Flow effects on benthic grazing on phytoplankton by a Caribbean reef. Limnology and Oceanography, 55, 1881-1892.

2

Pineda, Jesús, Victoria Starczak, Ann Tarrant, Jonathan Blythe, Kristen Davis, Tom Farrar, Michael Berumen, and José da Silva. (2013) Two spatial scales in a bleaching event: Corals from the mildest and most extreme environments escape mortality. Limnology and Oceanography, 58(5), 1531-1545.

Davis, Kristen A., James J. Leichter, James L. Hench, Stephen G. Monismith. (2008) Effects of western boundary current dynamics on the internal wave field of the Southeast Florida shelf. Journal of Geophysical Research, 113, C09010.

Paytan, Adina, Gregory G. Shellenbarger, Joseph H. Street, Megan E. Gonneea, Kristen A. Davis, Megan B. Young, and Willard S. Moore. (2006) Submarine groundwater discharge: An important source of new nutrients to coral reef ecosystems. Limnology and Oceanography, 51(1), 343-348.

Boehm, Alexandria B., Adina Paytan, Gregory G. Shellenbarger, and Kristen A. Davis. (2006) Composition and flux of groundwater from a California beach aquifer: Implications for nutrient supply to the surf zone. Continental Shelf Research, 26, 269-282.

Boehm, Alexandria B., Daniel G. Lluch-Cota, Kristen A. Davis, Clint D. Winant, and Stephen G. Monismith. (2004) Covariation of coastal water temperature and microbial pollution at interannual to tidal periods. Geophysical Research Letters, 31, L06309, doi:10.1029/2003GL019122.

Synergistic Activities • Technical Reviewer for scientific manuscripts and proposals in Marine Ecological Progress Series,

Ocean Dynamics, Journal of Physical Oceanography, Limnology and Oceanography, Progress in Oceanography, Geophysical Research Letters, Estuaries and Coasts, Estuarine, Coastal and Shelf Science, PLoS One, California Sea Grant, National Oceanic and Atmospheric Administration, and the National Science Foundation.

• Acting primary research advisor to three undergraduate students participating in the California Alliance for Minority Participation (CAMP) program at UC, Irvine to support underrepresented students in the science, technology, engineering, and math fields.

• Co-chair of Eastern Pacific Ocean Conference, 2015; Conference Session Organizer for Ocean Sciences Meeting 2012, Eastern Pacific Ocean Conference Meeting, 2011.

• Community Outreach: Organized an interactive science program for elementary and middle school girls through the Sally Ride Program and served as a “Science Superstar” for Project Scientist for a STEM summer camp for girls ages 5-12 years old.

Graduate Advisor S.G. Monismith, Civil and Environmental Engineering, Stanford Univ., Stanford, CA

Postdoctoral Advisors S.J. Lentz, Dept. of Physical Oceanography, Woods Hole Oceanographic Institution, Woods Hole, MA Pineda, J., Dept. of Biology, Woods Hole Oceanographic Institution, Woods Hole, MA Banas, N., Applied Physics Laboratory, University of Washington, Seattle, WA Advising Current students: Aryan Safaie, Emma Reid, Shukai Cai Total Graduate Students advised: 5

Giddings, S.N. USC Sea Grant 2015 Summary Proposal

SUMMARY PROPOSAL FORM

Project No. (For office use)_________ PROJECT TITLE: Drivers of Morphodynamic Change and Hypoxic Events in Southern California Lagoons

OBJECTIVES: Our project objectives are to:

• Assess the impact of wave-current interactions on sediment transport and the morphodynamic responses to extreme events in Southern California LIEs using in-situ and remote observations

• Compare results from two different types of LIEs (marsh vs. embayment) • Use these observations to make predictions about the response of these estuaries to future

conditions including sea level rise and elevated water level events in order to assist managers in planning dredging events and in adopting coastal resiliency programs

We plan to approach these broad objectives by asking the following research questions: 1. What is the relative importance of waves, wave-current interactions, and mean currents in driving

sediment transport in estuarine mouths?

2. How does hydraulic control at an estuarine mouth regulate wave-current interactions and thus sediment transport and hypoxia (through reduced flushing) on tidal and event time scales?

3. How will an embayment respond relative to an intertidal marsh-like system?

METHODOLOGY: We plan to address our hypotheses by carrying out detailed in-situ observations in two Southern California estuaries (chosen to represent two estuary types) measuring currents, salinity, temperature, oxygen, water depth, suspended sediment, turbulent stresses, turbulent dissipation, and waves. Moorings will be placed in both study sites. Long-term moorings will be supplemented with transect surveys and short-term moorings to gain enhanced temporal and spatial resolution. We will conduct monthly hydrographic surveys (in both systems) and surveys before and after individual storm events (in our main study site), and will deploy high-resolution wave-turbulence-sediment tripods. Remote imagery measurements will complement the in-situ observations and quantify morphodynamic change. RATIONALE: Low inflow estuaries, prevalent throughout Southern California, provide extensive ecological and human benefits. The number and total area of these systems have been drastically reduced and those systems that remain are heavily modified by human development. It is unclear if these estuaries can maintain their roles as key contributors to habitat, biodiversity, carbon storage, and coastal protection. The response and resiliency of these systems to elevated water level events are particularly poorly understood. Some work has shown that extreme events have the ability to drastically modify morphology and transition vegetation structure, yet the physics underlying these processes has not been studied in detail. Thus we aim to explore in detail the coupled hydrodynamic-sediment transport mechanisms and their impact on larger scale system morphodynamics and hydrodynamics in urbanized Southern California estuaries in order to inform sustainable development and future adaptation.

DATA SHARING PLAN: We will make our data available as soon as it is uploaded and preliminary data quality control is completed. It will be made available on a project website and via email request in full accordance with the recently outlined NOAA Data Management Planning Procedural Directive.

Tijuana River National Estuarine Research Reserve “A Wetland of International Importance” International Ramsar Convention, 2005

301 Caspian Way Imperial Beach, CA 91932

Office (619) 575 3613 x.333 Fax (619) 575 6913 jcrooks@trnerr.org

3  July  2015  

Dr.  Sarah  Giddings  Scripps  Institution  of  Oceanography,  University  of  California,  San  Diego    Dear  Dr.  Giddings,    Thank  you  for  contacting  us  about  your  proposal  to  USC  Sea  Grant,  entitled  “Drivers  of  Morphodynamic  Change  and  Hypoxic  Events  in  Southern  California  Lagoons.”    The  work  you  have  done  to  date  has  already  improved  our  understanding  of  estuarine  hydrodynamics,  and  we  strongly  support  this  proposed  project.    Southern  California  lagoons  are  complex,  both  in  terms  of  their  environments  and  their  management.    A  primary  factor  shaping  these  areas  is  their  connection  to  the  ocean,  and  there  has  been  growing  interest  in  evaluating  our  approaches  to  mouth  management.    This  became  formalized  in  November,  2014,  when  he  Board  of  Governors  of  the  Southern  California  Wetlands  Recovery  Project,  a  consortium  of  14  federal  and  state  resource  agencies,  identified  the  need    “develop  guidance  on  the  management  of  intermittently  open  estuaries.”    Currently,  our  ability  to  effectively  manage  these  lagoon  mouths  is  hampered  by  an  incomplete  understanding  of  the  dynamics  of  these  systems.    Thus,  your  project  is  timely  and  much-­‐needed,  and  we  will  be  happy  to  support  your  work  in  whatever  way  we  can.    We  are  especially  pleased  that  you  will  be  able  to  leverage  our  long-­‐term  monitoring  programs  in  your  proposed  project.    We  have  extensive  water  quality  datasets  for  several  local  systems,  and  we  will  make  these  data  available  to  you.    Given  the  importance  of  this  topic,  we  would  also  like  to  highlight  your  project  and  its  results  in  our  outreach  and  education  programs  at  the  Tijuana  River  National  Estuarine  Research  Reserve.    We  have  opportunities  to  reach  broad  audiences  through  a  variety  of  means,  such  as  incorporating  project  results  into  our  K-­‐12  curriculum  (which  includes  teacher  trainings),  presenting  in  our  seminar  series  for  the  public,  and  developing  interpretive  elements  for  our  Visitor  Center.      Of  course,  your  work  will  also  substantially  inform  our  Reserve-­‐based  research  and  adaptive  management  program.    We  look  forward  to  the  opportunity  of  working  with  you  on  this  project,  and  please  let  us  know  how  we  can  be  of  assistance.        Sincerely,  

       Dr.  Jeff  Crooks  Research  Coordinator  

LOS$PEÑASQUITOS$$

LAGOON$FOUNDATION$P.O.$Box$940$Cardiff$by$the$Sea$CA,$92007$!

!July 6, 2015

USC Sea Grant 3616 Trousdale Pkwy, AHF 253 Los Angeles CA 90089-0373 Subject: USC Sea Grant Proposal – Drivers of Morphodynamic Change and Hypoxic Events

in Southern California Lagoons. To USC Sea Grant review panel, As the Executive Director of the Los Peñasquitos Lagoon Foundation (LPLF), I am writing in support of Dr. Giddings’ USC Sea Grant proposal entitled: Drivers of Morphodynamic Change and Hypoxic Events in Southern California Lagoons. Los Peñasquitos Lagoon is a dedicated Marsh Preserve located within the Torrey Pines State Natural Reserve in San Diego County. A coastal estuary, the Lagoon faces many challenges caused by encroachment of urban areas and transportation corridors that make Los Peñasquitos Lagoon a managed system. Restoring and maintaining tidal circulation using heavy equipment to excavate the inlet area is a management priority listed in the Los Peñasquitos Lagoon Enhancement Plan. Our long-term monitoring program has documented impacts caused by constricted tidal circulation and extended inlet closures that can quickly lead to hypoxia within Lagoon channels that can cause fish kills and devastate populations of aquatic invertebrates that provide the primary food source to both migratory and endemic bird populations that include several listed bird species. Loss of tidal mixing also creates a serious threat to human safety as the entire Lagoon becomes an active breeding habitat for Culex tarsalis, a mosquito known as a vector for arboviruses that can be fatal to avian, equine and human populations within a 2-mile radius from the Lagoon. These same dry weather inputs cause water levels within Los Peñasquitos Lagoon to continually rise during extended inlet closures, flooding sensitive nesting habitat for listed bird species and facilitating habitat conversion that results in net-loss of native salt marsh plant species. Since 1932, the inlet at Los Peñasquitos Lagoon has been constrained under a bridge span that was constructed along with Highway 101 and other hardened structures that impair the Lagoon’s connectivity with the ocean. In 2005 this bridge was replaced with the new design using four support columns instead of seventy-four, effectively altering the hydrodynamics and morphology of the inlet area. Restoring, enhancing and protecting Los Peñasquitos Lagoon through the long-term will require a better understanding of lagoon hydrology and the role that inlet morphology plays. LPLF is working to modify its approach to maintaining the Lagoon inlet to ensure that hypoxic events are avoided and to facilitate the success of large-scale restoration of salt marsh habitat that will occur in the near-term as a compliance

!!

2!

measure under the San Diego Basin Plan and the Los Peñasquitos Lagoon Sediment Total Maximum Daily Load. LPLF has been working closely with Dr. Giddings and her project team to improve our long-term monitoring program that was initiated in 1987. The proposed study will greatly improve our management of the inlet area and our understanding how morphodynamic change at the inlet affects Los Peñasquitos Lagoon with regard to lagoon processes, water quality and management needs. Results from this study will also compliment our efforts to assess and evaluate large-scale restoration alternatives developed in the updated the Lagoon’s enhancement plan that consider how modified hydrology may or may not support large-scale restoration efforts and vector management needs in lieu of projected sea level rise scenarios. We look forward to working with Giddings in an ongoing collaboration that will be mutually beneficial and working together on future projects as they arise. This will include conversations regarding connecting science with management not only within Los Peñasquitos Lagoon, but also forming connections with managers in similar systems throughout Southern California that include the Tijuana River National Estuarine Research Reserve. Additionally, we hope to use this opportunity to assist our ongoing efforts to enhance public knowledge of the estuary and its benefits and challenges to improve coastal stewardship efforts. We wholeheartedly support these research efforts and highly recommend Giddings’ proposal for USC Sea Grant funding as we see estuarine function as a key contributor to understanding coastal resilience in Southern California. Sincerely,

Mike Hastings Executive Director, Los Peñasquitos Lagoon Foundation

July 1, 2015 University of Southern California Sea Grant Program Los Angeles, California 90089-0373 Dear University of Southern California Sea Grant,

It is my pleasure to write a letter in support of the proposal “Drivers of morphodynamic change and hypoxic events in Southern California lagoons” being submitted to the USC Sea Grant Program by Dr. Sarah Giddings and Dr. Geno Pawlak.

My group currently maintains a real-time seawater carbonate chemistry monitoring station at Agua Hedionda Lagoon in Carlsbad, California - one of the sites proposed for PI Giddings and Pawlak’s work. Our shore station measures and streams live temperature, salinity, total dissolved inorganic carbon (TCO2), total alkalinity, and pCO2 data from the Agua Hedionda lagoon as part of NOAA’s Integrated Ocean Observing System and Ocean Acidification Programs, and in collaboration with Carlsbad Aquafarm, a local shellfish and seaweed farm. The aim of our observing systems is to provide shellfish farmers in local estuaries real-time water quality data both to assess the current impacts of ocean acidification on shellfish aquaculture productivity and to mitigate expected future acidification events.

Preliminary data from our shore station has revealed the wide range of seawater carbon chemistry conditions within the Agua Hedionda Lagoon over the span of hours to weeks. To understand the drivers of inorganic carbon dynamics, we plan to deploy chemical sensors within the lagoon to obtain in situ measurements of pH, dissolved oxygen, temperature and salinity, as well as deploy physical oceanographic instrumentation in collaboration with PI Giddings and Pawlak. Our chemical instrumentation will facilitate the proposed work investigating hypoxia within the lagoon, and correspondingly, the proposed physical oceanographic measurements will greatly complement our understanding of estuarine carbon transport processes.

In conclusion, I fully support the research proposed by PI Giddings and Pawlak. The proposed work will not only increase our understanding of storm-induced morphodynamic change and hypoxia in coastal estuaries, but also greatly aid ongoing collaborative efforts to understand the many physical and chemical oceanographic dynamics in these environments.

Sincerely,

Todd R. Martz Associate Professor Scripps Institution of Oceanography

Gillett and Burton – Molecular Identification of Ichthyoplankton

PROJECT TITLE: MOLECULAR IDENTIFICATION OF LARVAL NEKTON INHABITING THE WATERS OF THE SOUTHERN CALIFORNIA BIGHT

PRINCIPAL INVESTIGATORS:

Dr. David Gillett – Scientist, Biology Department, Southern California Coastal Water Research Project

Dr. Ronald Burton – Professor, Marine Biology, Scripps Institution of Oceanography, UC San Diego

ASSOCIATE INVESTIGATORS:

Dr. Eric Stein – Department Head, Biology Department, Southern California Costal Water Research Project

FUNDING REQUESTED

2016-2017: $57,708 Federal/State $0.00 Match $95,733 2017-2018: $50,505 Federal/State $0.00 Match $34,325

STATEMENT OF PROBLEM:

The Southern California Bight (SCB) is the quintessential urban ocean, exposed to a variety stressors at local (e.g., urban runoff, habitat loss, wastewater discharge) and regional (e.g., climate change, ocean acidification) scales. The SCB is also the home to a myriad of ecologically, economically, and culturally important organisms; ranging from benthic infauna to migratory marine mammals. Given the importance of this diverse ecosystem, a variety of programs have been developed to monitor the condition of these biological resources relative to a range of ambient stressors.

However, the tools that are presently available to assess the condition of the SCB’s resources are limited in scope. Regional water quality and natural resource managers have developed robust monitoring programs to assess benthic invertebrates (Ranasinghe et al. 2012; CSD 2014a; LACSD 2014a; OCSD 2014a), demersal fishes (Allen et al. 2011; CSD 2014b; LACSD 2014b; OCSD 2014b), and rocky reef/kelp associated fishes (Craig and Pondella 2006; Claisse et al. 2012; Pondella et al. 2012). Pelagic fishes, especially in coastal habitats, are a conspicuous gap in assessment of the condition of the SCB ecosystem.

In recognition of this gap, the regional water quality and resource management communities have expressed a desire to start monitoring pelagic fishes in concert with the demersal and rocky reef fish assemblages – looking at the nekton of the SCB holistically instead of only as disparate components. Comprehensive community analysis would provide a more complete understanding of the condition of specific areas and their ability to support a diverse nektonic community. One approach to efficiently survey the entire nekton community is to sample eggs

1

Gillett and Burton – Molecular Identification of Ichthyoplankton

and larvae (i.e. ichthyoplankton) before they segregate as juveniles to their respective habitats (e.g., hard bottom, soft sediments, or water column) (Reviewed in Auth and Brodeur 2013).

A significant obstacle to the regular monitoring of ichthyoplankton is the difficulty in identifying the individuals in a given sample. Traditional larval fish identification is done via microscopy of preserved specimens. This process requires time and a high degree of taxonomic specialization. Furthermore, the process is complicated by the lack of detailed dichotomous keys for a number species, many of which have only subtly different morphology as larvae (e.g., Sebastes spp.) (Gray et al. 2006).

Molecular taxonomic methods, such as DNA barcoding, offer a potential solution to improve the efficiency and utility of ichthyoplankton assessment by increasing the speed, accuracy, and resolution of a sample’s taxonomic composition. DNA barcoding of individual organisms has been demonstrated to provide reliable identifications for taxonomically challenging organisms like ichthyoplankton (e.g., Gleason and Burton 2012) and other taxa (e.g., Pawlowski and Holzmann 2014; Lejzerowicz et al. 2015). However, despite its utility in improving the identification of problematic species, single organism barcoding is not practical for application in a large-scale monitoring programs given the time needed to process hundreds of individuals in dozens of samples. However, with a reliable DNA reference library, metabarcoding – the extraction and sequencing of all the DNA in sample at one time – represents a promising way to create an ichthyoplankton monitoring program across the SCB based upon molecular identification of samples. Furthermore, if successfully applied to ichthyoplankton, similar metabarcoding techniques could be applied to other biological components of the ecosystem in the future.

INVESTIGATORY QUESTION:

o The primary question this work is centered around is, “Can metabarcoding techniques provide comparable (or better) data to traditional morphological methods of ichthyoplankton identification?”

o As part of this question, we will also be able to address whether metabarcoding is as sensitive to detecting rare taxa as morphological identification and if the costs and time associated with the metabarcoding are amenable to their inclusion in a regional monitoring program.

o The secondary question this work will address is “Does metabarcoding provide similar taxonomic diversity to single organism identification using traditional (Sanger-based) barcoding methods?”

MOTIVATION:

Understanding the larval ichthyoplankton population dynamics along the shelf addresses several management questions/needs. First, it is essential to understanding the potential condition of the entire adult nekton community of the SCB. Second, detailed spatial information on rocky reef associated larval communities would be valuable to managers of the recently established marine protected area network in Southern California. These data could provide insight into the

2

Gillett and Burton – Molecular Identification of Ichthyoplankton

effectiveness of the reserves and their productivity value to adult assemblages outside of the reserves. Third, larval nekton monitoring is an ideal approach for early detection of invasive taxa before a population of adults becomes established.

Molecular taxonomic methods, such as DNA barcoding, offer a potential solution to improve the efficiency and utility of ichthyoplankton assessment. Traditional specimen-by-specimen barcoding has been shown to provide valuable taxonomic details beyond those obtained in standard surveys. More recently, new methods are being developed for metabarcoding of bulk environmental samples (i.e. analysis of all barcodes present in an ambient water or sediment sample). This approach holds promise in increasing the speed and taxonomic breadth of an assessment (e.g., Gray et al. 2006; Loh et al. 2014; Hubert et al. 2015). Although already proven effective in concept, this method still requires refinement to allow it to be easily integrated into routine monitoring and assessment programs. Specifically, it needs to be evaluated in the context of routine monitoring and assessment programs and the results need to be directly compared to alternative methods such as microscopy and single-specimen barcoding.

The southern California continental shelf provides a perfect opportunity to refine metabarcoding methods for routine application. First, many species of nekton associated with the different continental shelf habitats of Southern California have been collected as adults, morphologically identified (considerably easier as adults vs. larvae), and had their mitochondrial CO1 (i.e., the DNA barcode) and 16S ribosomal genes sequenced (largely as part of a California Sea Grant project, P. Hastings and R Burton PIs, "Establishing a DNA Sequence Database for California Marine Fishes," (2004-2007). Consequently, an extensive reference library already exists that can be used to match validated species identifications to sequences generated from the sampled larvae. Second, there is existing infrastructure among the local sanitation districts (i.e., City of Los Angeles, Los Angeles County, Orange County, and the City of San Diego), the Southern California Bight Regional Survey, and CalCOFI programs to support routine sample collection. Third, there are important management questions regarding the condition of the local environment relative to discharge locations that could be addressed through application of these new methods.

Beyond providing a spatially integrated profile of the larval stages of the SCB nekton community, this work will provide an approach to improve current nekton monitoring efforts via modernization of laboratory techniques, while also likely increasing the taxonomic breadth of these surveys. Additionally, the regular use of metabarcoding techniques should shorten the time it takes to collect data, analyze samples, and provide information to key decision makers.

Improving the quality, efficiency, and geographical/ecological scope of these data will provide the underlying support for the management and monitoring of coastal nekton communities across the SCB; will support the needs of our research partners, and are consistent with the goals of the CA Sea Grant program. As highlighted in the 2014-17 Strategic Plan, our proposed work will help addresses Healthy Coastal Ecosystems Goal 2: “Ecosystem-based approaches are used to manage land, water and living resources”, specifically short term outcomes 2.2 “and 2.3. The benefits this work would fulfill the stated desire of many of the regional agencies across SCB to integrate molecular-based taxonomy into their programs and to expand the scope of their programs to include ichthyoplankton.

3

Gillett and Burton – Molecular Identification of Ichthyoplankton

GOALS AND OBJECTIVES:

A. Overall Goals: The primary goals of this research are to determine if ichthyoplankton monitoring data derived from metabarcoding methods produces comparable or better quality data to traditional morphological methods and if so, develop basic operating procedures for incorporation into monitoring programs of our management partners

B. 2015-2016 Objectives: 1 – Develop measures of ichthyoplankton community composition across the SCB using morphological identification of samples 2 – Develop similar measures of community composition, but using individually sequenced DNA barcodes (CO1 and 16S)

2016-2017 Objectives 3 – Develop measures of ichthyoplankton community composition across the SCB using bulk sequenced metabarcoding techniques (CO1 and 16S) 4 – Compare the overall taxonomic composition, sensitivity to rare dominant taxa, and effort associated with processing samples among the three methods of identification (morphological, individual barcoding, metabarcoding) 5- Develop basic operating procedures for incorporating metabarcoding methods into routine monitoring programs.

METHODS:

Sample Collection – Sample work flow for the proposed work from collection to assignment of species names/operation taxonomic unit (OTUs) is summarized in Figure 1. Ichthyoplankton samples will be collected from across the Southern California Bight by field crews from the region’s large publicly owned treatment works (POTW) (i.e., Los Angeles County Sanitation District, Orange County Sanitation District, and the City of San Diego, [see attached letters of support]). Samples will be collected with a 150-μm mesh pairovet net, using a vertical tow following CalCOFI sampling protocols (https://swfsc.noaa.gov/textblock.aspx?Division=FRD&id=1343). Samples will be collected along similar sampling grids to those used by the POTWs for their demersal fish trawl sampling (e.g., CSD 2014b; LACSD 2014b; OCSD 2014b). Upon removal from the net, samples will be labeled and placed in 95% ethanol. Samples will be drained and placed in fresh 95% ethanol within 48 hrs of collection.

Sample Identification – After preservation, samples will be processed along one of two approaches: 1.) morphological → single barcode → metabarcode or 2.) morphological →metabarcode. In an effort to benchmark results generated by metabarcoding to more traditional single organism barcoding, a subset of samples will be identified based upon morphology, then by barcoding of individual organisms, and then composited for bulk

4

Gillett and Burton – Molecular Identification of Ichthyoplankton

metabarcoding. All other samples will be identified based upon morphology and then bulk metabarcoding.

For the first identification approach, fish eggs and larvae will be sorted from detritus and zooplankton, enumerated, and identified by taxonomists at the NOAA Southwest Fisheries Science Center. Vouchers of each unique taxon will be kept for archiving purposes. Standard QA/QC procedures for the sorting, enumeration, and identification will be done following modifications to Kramer et al. (1972). From these identified samples, ~ 800 individuals will be removed for individual DNA barcoding. Standard DNA extraction and amplification protocols will be used. Tissue samples of approximately 2-3 mm3 will removed from each organism, placed in 96-well plates with lysis solution. DNA will be extracted and collected from the tissue samples by centrifugation onto glass fiber plates (Ivanova et al. 2006). Mitochondrial cytochrome oxidase subunit 1(CO1) will be targeted using forward primer COI VF1 (5’-TTCTCAACCAACCACAAAGACATTGG-3’) and the reverse primer COI VR1 (5’-TAGACTTCTGGGTGGCCAAAGAATCA-3’ (Ivanova et al. 2006; Ward et al. 2005) and 16S mitochondrial 16S ribosomal DNA using the forward primer 16Sar (5’-CGCCTGTTATCAAAAACAT-3’) and the reverse primer 16Sbr (5’-CCGGTCTGAACTCAGATCACGT-3’) yielding an amplicon of approximately 570 bp (Palumbi 1996). Taq polymerase and standard polymerase chain reaction (PCR) protocols will follow Ivanova and Grainger (2006) and Gleason and Burton (2012).

Upon successful amplification, the PCR amplicons will be sequenced bi-directionally by Sanger sequencing with a capillary DNA analyzer (e.g., Stein et al. 2014). Forward and backward sequences will be aligned and checked for appropriate size and structure (Tamura et al. 2011). Valid DNA sequences will then be assigned names based upon matches from custom DNA libraries of Southern California nekton, as well the larger public genomic databases (e.g., BOLD, GENBANK).

After the Sanger sequencing (i.e., individual barcoding), the individuals from which the tissue was collected will be composited into a new “virtual-sample” with known composition. These virtual-samples will be homogenized for metabarcoding of the bulk sample. An aliquot of each homogenized sample will be archived at -80°C . The DNA from the remainder of the sample will be extracted multiple times using commercial lysing and extraction kits (e.g., Nucleospin, Machercy-Nagel inc.). The sequential extraction s will be combined and COI and 16S DNA sequences will be targeted using a mix of universal primers (e.g., see above) and amplified using Taq polymerase and PCR.

Upon successful amplification, the DNA will be sequenced using an Illumina Mi-Seq high throughput sequencer following Kozich et al. (2013). Produced forward and reverse sequences (of approximately 200-300 bp) will be aligned and verified for size and structure, to insure purity. Valid sequences will be assigned names based upon matches from custom DNA libraries of Southern California nekton, as well the larger public genomic databases (e.g., BOLD, GENBANK).

5

Gillett and Burton – Molecular Identification of Ichthyoplankton

Figure 1. Work flow diagram summarizing our experimental design for identifying ichthyoplankton by morphological, single barcode, and metabarcoding

Sample collection

Samples to lab

Change ethanol

Clean sample of detritus and zooplankton

Morphological ID

Sanger sequencing

Composited into virtual sample

Bulk DNA extraction

Next-Gen sequencing

Morphological ID

Clean sample of detritus and zooplankton

Bulk DNA extraction

Next-Gen sequencing

OTU assignment

OTU assignment

OTU assignment Metabarcoding

Single barcode

Morphological Key to identification

approaches

6

Gillett and Burton – Molecular Identification of Ichthyoplankton

For the second identification approach, samples will undergo morphological identification as described above. Once the contents of the sample are identified, the sample will be re-constituted and homogenized for metabarcoding. DNA extraction, amplification, and sequencing will be done as described above for the virtual samples (Figure1).

Data Analysis – Similarity in taxonomic composition of each sample using the three identification methods (i.e., morphological, individual barcoding, and bulk metabarcoding) will be compared using a series of multivariate methods (e.g., nMDS, Permanova, etc). Taxa that create dissimilarity in the results among the different methods will be highlighted and further analyzed to ascertain the reason(s) for their failure to be detected by all three methods (i.e., molecular problems or morphological problems).

RELATED RESEARCH:

No current or past USC Sea Grant projects have focused on developing or advancing metabarcoding for analysis of ichthyoplankton communities. However research over the past ten years has led to dramatic advances in the application of molecular methods, such as barcoding and metabarcoding for species identification and community analysis (Jackson et al. 2014, Stein et al. 2014). The use of standardized DNA sequence markers – DNA barcodes – has become a common, standard practice in many areas of biodiversity assessment (Hajibabaei et al. 2007a, 2007b). Customized, public databases of DNA barcodes and other marker gene sequences (e.g., BOLD, GenBank) contain representative DNA barcodes for hundreds of thousands of animal, plant, fungal, and microbial taxa. Comparison of DNA barcodes recovered from unidentified specimens can be used to provide species-level identification for a wide range of organisms.

Barcoding has proven to be a useful method for providing more complete understanding of fish communities. For example, Valdez-Moreno et al. (2010) used barcoding to examine over 1390 specimens including adults, juveniles, larvae and eggs off the coast of Mexico. Barcoding results improved overall taxonomic identification, revealed major range extensions and overlooked taxa, new information about spawning locality and time. More recently, a dual marker system consisting of the mitochondrial genes cytochrome oxidase I (COI) and 16s rRNA have been used together to improve species identification from mixed samples and to enhance the ability to detect hybridization and separate closely related species (Kochzius et al. 2010). Locally, Gleason and Burton (2012) have validated the use of the dual gene approach using COI and 16s markers to identify fish that commonly occur off the California coast.

From a fisheries management perspective, there is great interest in assessing ichthyoplankton communities as a way of improving understanding of issues such as spawning locations and seasonal migration patterns and quantification of population levels or biomass of fished species (Teletchea 2009). Although DNA barcoding has been successfully used to identify pelagic fish larvae and eggs (Kawakami et al. 2010), traditional specimen-by-specimen analysis can be cumbersome, inefficient, and challenging due to inadequate taxonomic keys

7

Gillett and Burton – Molecular Identification of Ichthyoplankton

Over the past few years, metabarcoding methods have emerged that take advantage of advances in sequencing technology to rapidly identify many specimens from mixed (or bulk) environmental samples (Ji et al. 2013, Gibson et al. 2015). Laboratory testing of these methods have shown that they can provide a powerful and practical means for generating millions of DNA sequences across broad phylogenetic groups from bulk environmental samples as opposed to single specimen analysis (Hajibabaei et al. 2011; Shokralla et al. 2012; Gibson et al. 2014; Shokralla et al. 2014). Such methods are currently being applied by the Los Angeles Museum of Natural History to help survey terrestrial insects through their BioScan project (http://research.nhm.org/bioscan/about.html).

Metabarcoding has the potential to greatly expand our ability to assess ichthyoplankton communities by improving taxonomic accuracy and resolution and increasing the efficiency and rapidity of sample analysis. Many past studies have provided “proof of concept” for metabarcoding. This study would advance the science and practice by answering practical questions associated with applying metabarcoding analysis in real-world monitoring and assessment programs along the California coast.

BUDGET-RELATED INFORMATION

A. Budget Justification • Year 1 (2016-17)

o $16,513 for 0.75 months of Gillett’s time (salary, benefits, and indirect) to coordinate sample collection and exchange, facilitate two meetings among the participants, manage data, and prepare interim report.

o $10,917 for 0.3 months of Stein’s time (salary, benefits, and indirect) to assist in meeting facilitation and preparation of the interim report.

o $3,459 for 0.3 months of a SCCWRP part-time employee” time (wage, benefits, and indirect) to provide support towards sample preparation, transportation of samples, and data management.

o $2000 in expendable supplies. Purchase of denatured ethanol, sample containers, and field/lab supplies for sample collection and preservation at SCCWRP.

o $300 for travel support to transport samples among different laboratory locations and to cover travel to meetings held at SCCWRP offices in Costa Mesa, CA by project PI’s and partners.

o $720 for two meetings (catering, coffee service, etc) among technical and supervisory staff of project participants. Meetings to be held at SCCWRP offices in Costa Mesa, CA.

o $27,908 in subcontract to UC San Diego. The contract covers 3 months ($15,555 – salary) of a SIO technician’s time to process samples and sequence DNA in the Burton lab, purchase of reagents and supplies

8

Gillett and Burton – Molecular Identification of Ichthyoplankton

($2,000) for single specimen (i.e., Sanger) sequencing in Burton lab, $450 in project costs, and $9,903 in indirect costs (55% rate).

• Year 2 (2017-18) o $22,017 for 1.0 month of Gillett’s time (salary, benefits, and indirect) to

manage data, analyze results, prepare manuscripts, and facilitate a meeting among project participants.

o $7,798 for 0.25 months of Stein’s time (salary, benefits, and indirect) to assist in meeting facilitation and preparation of manuscripts

o $2,935 for 0.2 months of a SCCWRP part-time employee (wage and indirect)

o $3200 for travel support of PIs to scientific conferences to present study results and travel of project participants to project meeting held at SCCWRP offices in Costa Mesa, CA.

o $400 for one meeting (catering, coffee service, etc) among project participants and regional water quality and resource managers to communicate the results of the study and promote adoption of new techniques into the regional monitoring programs.

o $17,100 in subcontract to UC San Diego. The contract covers 2 months ($10,732 – salary and benefits), $300 in project costs, and $6,068 in indirect costs.

B. Matching Funds • Year 1 (2016-17)

o $31,377 for 1 month of Burton’s time (salary, benefits, and indirect) for coordinating sample processing at SIO and assisting with data analysis and interim report preparation

o $17,500 in ship and staff time ($3,500/day) from Orange County Sanitation District for sample collection in year 1

o $29,356 in ship and staff time, plus purchase of sampling gear from Los Angeles County Sanitation District for sample collection in year 1

o $17,500 in ship and staff time ($3,500/day) from City of San Diego for sample collection in year 1

• Year 2 (2017-18) o $34,325 for 1 month of Burton’s time (salary, benefits, and indirect) for

assisting with data analysis and report/manuscript preparation

ANTICIPATED BENEFITS

In addition to advancing the science and application of environmental metabarcoding, this project targets benefits for three end-user communities, as indicated by the attached letters of support.

The first beneficiary is the ocean discharge community, consisting primarily of the large wastewater treatment agencies (i.e. City of San Diego, Orange County Sanitation District, City

9

Gillett and Burton – Molecular Identification of Ichthyoplankton

of Los Angeles Bureau of Sanitation, and Los Angeles County Sanitation Districts). These agencies are required to demonstrate that their discharges do not adversely affect marine communities. Historically, these agencies have relied on assessment of benthic communities as the main assessment endpoint. However, as discharge practices affect the composition of their effluent (e.g. contaminants of emerging concern) and the behavior of the discharge plumes (e.g. changing density due to increase reclamation) they are being asked to consider potential effects on pelagic communities. Ichthyoplankton assessment will likely become an important part of their ability to answer emerging questions about environmental effects of their discharges. The dischargers recognized these points and they approached SCCWRP to help them develop an approach for sampling ichthyoplankton (this actually ended up being the genesis of this proposal and other similar work we are presently undertaking with our partners). The methods developed through this study would not only help institutionalize ichthyoplankton assessment, but can be applied to improve current practices for assessment of benthic infauna as well.

The second beneficiary is the Marine Monitoring Enterprise. This group is responsible for assessing the effectiveness of marine protected areas at achieving desired fisheries and environmental health goals. As discussed above, analysis of ichthyoplankton communities has the potential to provide important information about spawning, recruitment, and dispersal patterns. When paired with traditional assessments of adult fish communities, it will provide important linkages to understand relative effects of fishing pressures and ocean discharge on overall food web integrity. The methods developed through this study will provide critical tools to support these assessments.

The third beneficiary is major regional monitoring programs in the SCB (e.g. southern California Bight regional survey, Santa Monica Bay Restoration Commission), which (in part) encompasses the first two beneficiaries. These programs provide relatively unique abilities to holistically assess condition and trends of the SCB as a way of providing insight into the relative influence of natural cycles and patterns (e.g. upwelling effects, El Nino) and anthropogenic activities (e.g. fishing, discharges) on ocean health. There has been a long-standing desire to incorporate ichthyoplankton assessment into these programs (for many of the same reasons cited above). However, issues such as limitations on taxonomic capacity and accuracy, time necessary to produce results, and cost have limited the analysis of larval and egg composition. This project will directly address these issues by working with these two monitoring programs to produce operational approaches for application of metabarcoding and to test the ability to apply it in through routine assessments.

The ocean dischargers, the marine protected area community, and the regional monitoring programs have all expressed a desire to integrate molecular-based taxonomy into their programs and to expand the scope of their programs to include ichthyoplankton and have therefore expressed support for this project. SCCWRP and SCIO’s scientific reputation and relationship with the management community will facilitate incorporation of this new technology once our proposed demonstration of the concepts is completed

10

Gillett and Burton – Molecular Identification of Ichthyoplankton

COMMUNICATION OF RESULTS

The communication and outreach aspects of this project will have two target audiences: the management community and the scientific community. The technical staff of local (the POTWs) and federal (NOAA SWF) management agencies will be directly involved the project and they will be learning the new techniques for metabarcoding while helping us refine them for future application in their respective monitoring programs. Their direct involvement in the project will facilitate knowledge transfer and ultimate incorporation of the new methods into routine monitoring and assessment. We will engage with the upper level managers of these agencies – the decision makers who set their monitoring program agendas –as well as those from CalCOFI and the MPA Monitoring Enterprise, via the presentation of our final results at a meeting at SCCWRP. In addition, we will provide them copies of all reports and manuscripts produced by this work. SCCWRP has a long history of transitioning new technologies into our management partners. Based upon our history and the management community’s interest in metabarcoding technology, communication will be key to the technology transfer. We will be interacting with the wider scientific community by presenting the overall results and the comparison of morphological, individual barcoding, and metabarcoding-based identification methods at scientific conferences (e.g., CERF, ASLO) and via publication of manuscripts in peer reviewed journals.

In compliance with NOAA’s Directive on Data Management, all of the molecular data (sequences, primers used, assigned species names), as well as their accompanying spatial data, will be posted as publicly accessible and searchable in the Barcode of Life Database (BOLD) (http://www.boldsystems.org/) upon publication of project results. For analytical purposes, sample composition data measured from all three methods, sample location data (e.g., latitude, longitude, water depth), sample collection data (e.g., tow duration, sea conditions, crew identity), and any concurrently collected environmental data will managed in a relational database. Upon completion of the project and publication of the results, this database will be made available to USC Sea Grant.

REFERENCES

Allen, M.J., D. Cadien, D.W. Diehl, K. Ritter, S.L. Moore, C. Cash, D.J. Pondella II, V. RAco-Rands, C. Thomas, R. Gartman, W. Power, A.K. Latker, J. Williams, J.L. Armstrong, E Miller, and K. Schiff. 2011. Southern California Bight 2008 Regional Monitoring Program: IV. Demersal Fishes and Megabenthic Invertebrates. 152p. Southern California Coastal Water Research Program, Costa Mesa, CA.

Auth, T. D. and Brodeur, R. D. 2013. An overview of ichthyoplankton research in the northern California Current region: contributions to ecosystem assessments and management. CalCOFI Report, Vol. 54 p. 107-126.

Craig, M.T., and D.J. Pondella II. 2006. A survey of the fishes of the Cabrillo National Monument, San Diego, California. California Fish and Game, 92: 172-183.

11

Gillett and Burton – Molecular Identification of Ichthyoplankton

Claisse, J.T., D.J. Pondella II, J.P. Williams, and J. Sadd. 2012. Using GIS mapping of the extent of nearshore rocky reefs to estimate the abundance and reproductive output of important fishery species. PLoS ONE 7:e30290. doi: 0.1371/journal.pone.0030290

City of San Diego. 2014a. Chapter 5 Macrobenthic Communities. In: Point Loma Ocean Outfall Annual Receiving Waters Monitoring & Assessment Report 2013. 65-86p. City of San Diego Ocean Monitoring Program Environmental Monitoring & Technical Services Division, San Diego, CA.

City of San Diego. 2014b. Chapter 6 Demersal Fishes and Megabenthic Invertebrates. In: Point Loma Ocean Outfall Annual Receiving Waters Monitoring & Assessment Report 2013. 87-112p. City of San Diego Ocean Monitoring Program Environmental Monitoring & Technical Services Division, San Diego, CA.

Folmer, O., M. Black, W. Hoeh, R. Lutz, and R. Vrijenhoek. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3: 294-299.

Gibson J.F., E.D. Stein, D.J. Baird, C.M. Finlayson, X. Zhang, and M. Hajibabaei. 2015. Wetland Ecogenomics – The Next Generation of Wetland Biodiversity and Functional Assessment. Wetland Science and Practice, 32: 27-32

Gibson, J., Shokralla, S., Porter, T.M., et al. 2014. Simultaneous assessment of the macrobiome and microbiome in a bulk sample of tropical arthropods through DNA metasystematics. Proceedings of the National Academy of Science USA, 111: 8007-8012.

Gleason, L.U. and Burton R.S. 2012. High-throughput molecular identification of fish eggs using multiplex suspension bead arrays. Molecular Ecology Resources. 12:57-66. doi 10.1111/j.1755-0998.2011.03059.x

Gray, A. K., Kendall Jr, A. W., Wing, B. L., Carls, M. G., Heifetz, J., Li, Z., and Gharrett, A. J. 2006. Identification and first documentation of larval rockfishes in southeast Alaskan waters was possible using mitochondrial markers but not pigmentation patterns. Transactions of the American Fisheries Society, 135: 1-11.

Hajibabaei, M., Shokralla, S., Zhou, X., Singer, G.A.C. and Baird, D.J. 2011 Environmental barcoding: a next-generation sequencing approach for biomonitoring applications using river benthos. PLoS One 6:e17497

Hajibabaei, M., Singer, G.A., Clare, E.L. and Hebert, P.D.N. 2007a. Design and applicability of DNA arrays and DNA barcodes in biodiversity monitoring. BMC Biology, 5: 24.

Hajibabaei, M., Singer, G.A.C., Hebert, P.D.N. and Hickey, D.A. 2007b. DNA barcoding: how it complements taxonomy, molecular phylogenetics and population genetics. Trends in Genetics, 23: 167-172.

Hubert, N., Espiau, B., Meyer, C., and Planes, S. 2015. Identifying the ichthyoplankton of a coral reef using DNA barcodes. Molecular Ecology Resources, 15: 57-67.

12

Gillett and Burton – Molecular Identification of Ichthyoplankton

Ivanova, N.V., J.R. Dewaard, and P.N. Hebert. 2006. An inexpensive, automation-friendly protocol for recovering high-quality DNA. Molecular Ecology Notes, 6: 998-1002.

Ivanova, N., and C. Grainger. 2006. Protocols CO1 Amplification. CCDB Protocols. 3p. http://ccdb.ca/resources.php

Jackson, J.K, J.M. Battle, B.P. White, E.M. Pilgrim, E.D. Stein, P.E. Miller, and B.W. Sweeney. 2014. Cryptic biodiversity in streams - a comparison of macroinvertebrate communities based on morphological and DNA barcode identifications. Freshwater Science. 33(1):312–324. DOI: 10.1086/675225

Ji, Y., Ashton, L., Pedley, S.M., Edwards, D.P. et al. 2013. Reliable, verifiable and efficient monitoring of biodiversity via metabarcoding. Ecology Letters. doi: 10.1111/ele.12162

Kawakami, T., Aoyama, J., Tsukamoto, K. 2010. Morphology of pelagic fish eggs identified using mitochondrial DNA and their distribution in waters west of the Mariana Islands. Environmental Biology of Fishes, 87: 221-235

Kochzius, M, Seidel C, Antoniou A, Botla SK, Campo D, et al. 2010. Identifying Fishes through DNA Barcodes and Microarrays. PLoS ONE, 5: e12620. doi: 10.1371/journal.pone.0012620

Kozich, J. J., S.L. Westcott, N.T. Baxter, S.K. Highlander, and P.D. Schloss. 2013. Development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform. Applied and environmental microbiology, 79: 5112-5120.

Kramer, D. M. J. Kalin, E. G. Stevens, J. R. Thrailkill, and J. R. Zweifel. 1972. Collecting and processing data on fish eggs and larvae in the California Current region. NOAA Tech. Rep. NMFS CIRC-370. 38p.

Lejzerowicz, F., I. Voltski, and J. Pawlowski. 2015. Foraminifera of the Kuril-Kamchatka Trench area: the prospects of molecular study. Deep Sea Research Part II, 111: 19-25.

Loh, W. K. W., Bond, P., Ashton, K. J., Roberts, D. T., and Tibbetts, I. R. 2014. DNA barcoding of freshwater fishes and the development of a quantitative qPCR assay for the species‐specific detection and quantification of fish larvae from plankton samples. Journal of Fish Biology, 85: 307-328.

Los Angeles County Sanitation Districts. 2014a. Chapter 5 Benthic Infauna. In: Joint Water Pollution Control Plant biennial receiving water monitoring report 2012-2013. 12p. Los Angeles County Sanitation Districts, Ocean Monitoring and Research Group, Technical Services Department, Whittier, CA.

Los Angeles County Sanitation Districts. 2014b. Chapter 6 Invertebrate and Fish Trawls. In: Joint Water Pollution Control Plant biennial receiving water monitoring report 2012-2013. 27p. Los Angeles County Sanitation Districts, Ocean Monitoring and Research Group, Technical Services Department, Whittier, CA.

13

Gillett and Burton – Molecular Identification of Ichthyoplankton

Orange County Sanitation District. 2014a. Chapter 5 Macrobenthic invertebrate communities. In: Ocean Monitoring Annual Report Year 2012-2013. 38p. Orange County Sanitation District Marine Monitoring, Fountain Valley, CA.

Orange County Sanitation District. 2014b. Chapter 6 Trawl Communities and Organism Health. In: Ocean Monitoring Annual Report Year 2012-2013. 36p. Orange County Sanitation District Marine Monitoring, Fountain Valley, CA.

Pawlowski, J., and M. Holzmann. 2014. A plea for DNA barcoding of foraminifera. Journal of Foraminiferal Research, 44: 62-67.

Pondella, D., J. Williams, J. Claisse, R. Schaffner, K. Ritter, and K. Schiff. 2012. Southern California Bight 2008 Regional Monitoring Program: V. Rocky Reefs. 113p. Southern California Coastal Water Research Program, Costa Mesa, CA.

Ranasinghe, J.A., K.C. Schiff, C.A. Brantley, L.L. Lovell, D.B. Cadien, T.K. Mikel, R.G. Velarde, S. Holt, S.C. Johnson. 2012. Southern California Bight 2008 Regional Monitoring Program: VI. Benthic Macrofauna. 89p. Southern California Coastal Water Research Program, Costa Mesa, CA.

Shokralla, S., Gibson, J.F., Nikbakht, H., Janzen, D.H., Hallwachs, W. and Hajibabaei, M. 2014. Next-generation DNA barcoding: using next-generation sequencing to enhance and accelerate DNA barcode capture from single specimens. Molecular Ecology Resources, 14: 892-901.

Shokralla, S., Spall, J.L., Gibson, J.F. and Hajibabaei, M. 2012. Next-generation sequencing technologies for environmental DNA research. Molecular Ecology, 21: 1794-1805.

Stein, E.D., B.P. White, R.D. Mazor, J.K. Jackson, J.M. Battle, P.E. Miller, E.M. Pilgrim, B.W. Sweeney. 2014. Does DNA Barcoding Improve Performance of Traditional Stream Bioassessment Metrics? Freshwater Science. 33(1):302–311. DOI: 10.1086/674782

Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei and S. Kumar. 2011; MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biological Evolution, 28: 2731-2739.

Teletchea, F. 2009. Molecular identification methods of fish species: reassessment and possible applications. Reviews in Fish Biology and Fisheries 19(3):265-293. doi 10.1007/s11160-009-9107-4

Valdez-Moreno, M., Vásquez-Yeomans, L., Elías-Gutiérrez, M., Ivanova, N. V., and Hebert, P. D. N. 2010. Using DNA barcodes to connect adults and early life stages of marine fishes from the Yucatan Peninsula, Mexico: potential in fisheries management. Marine and Freshwater Research, 61: 655–671

14

Gillett and Burton – Molecular Identification of Ichthyoplankton

Ward, R.D., T.S. Zemlak, B.H.Innes, P.R. Last, and P.D.N. Hebert. 2005. DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences, 360: 1847-1857.

15

Gillett and Burton – Molecular Identification of Ichthyoplankton

WORK SCHEDULE

Task Feb '16 Mar '16 Apr '16 May '16 Jun '16 Jul '16 Aug '16 Sep '16 Oct '16 Nov '16 Dec '16 Jan '17Organizational meeting Sampling SOP creation/refinementSample collectionMorphological ID of samplesIndividual specimen (Sanger) sequencingInterim Report

Feb '17 Mar '17 Apr '17 May '17 Jun '17 Jul '17 Aug '17 Sep '17 Oct '17 Nov '17 Dec '17 Jan '18Bulk sample (Nex Gen) sequencingAnalysis of resultsPreperation of final report and manuscriptsPresentation of results to management groups

Year 1

Year 2

16

Gillett and Burton – Molecular Identification of Ichthyoplankton

OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: David J. Gillett GRANT/PROJECT NO.:

DURATION (months): 24

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: 1 0.75 4,935b. Associates (Faculty or Staff): 1 0.30 3,572

Sub Total: 2 1.05 8,507 0

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians:h. Other: 1 0.30 881

Total Salaries and Wages: 3 1.35 9,388 0

B. FRINGE BENEFITS: 52.6% 4,938 0Total Personnel (A and B): 14,325 0

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT: 2,000

E. TRAVEL:1. Domestic 3002. International

Total Travel: 300 0

F. PUBLICATION AND DOCUMENTATION COSTS:

G. OTHER COSTS:1 Meeting support 7202 UCSD subcontractor 27,908 31,3773 Orange County Sanitation District 17,5004 Los Angeles County Sanitation District 29,3565 City of San Diego 17,50067

Total Other Costs: 28,628 95,733

TOTAL DIRECT COST (A through G): 45,253 95,733

INDIRECT COST (86.94% on wages/benefits only): 2385.66667 12,454 0INDIRECT COST (Off campus % of $ ):

Total Indirect Cost: 12,454 0

TOTAL COSTS: 57,708 95,733

Year One

PRINCIPAL INVESTIGATOR: David J. Gillett

BRIEF TITLE: Molecular Identification of Ichthyoplankton

17

Gillett and Burton – Molecular Identification of Ichthyoplankton

OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: David J. Gillett GRANT/PROJECT NO.:

DURATION (months): 24

12 months 2 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: 1 0.25 6,778b. Associates (Faculty or Staff): 1 1.00 3,066

Sub Total: 2 1.25 9,844 0

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians:h. Other: 1 0.20 604

Total Salaries and Wages: 3 1.45 10,448 0

B. FRINGE BENEFITS: 52.6% 5,496 0Total Personnel (A and B): 15,944 0

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT:

E. TRAVEL:1. Domestic 3,2002. International

Total Travel: 3,200 0

F. PUBLICATION AND DOCUMENTATION COSTS:

G. OTHER COSTS:1 Meeting support 4002 UCSD subcontractor 17,100 34,32534567

Total Other Costs: 17,500 34,325

TOTAL DIRECT COST (A through G): 36,644 34,325

INDIRECT COST (86.94% on wages/benefits only): 1458.33333 13,861 0INDIRECT COST (Off campus % of $ ):

Total Indirect Cost: 13,861 0

TOTAL COSTS: 50,505 34,325

Year Two

BRIEF TITLE: Molecular Identification of Ichthyoplankton

PRINCIPAL INVESTIGATOR: David J. Gillett

18

Gillett and Burton – Molecular Identification of Ichthyoplankton

Curriculum Vitae

David James Gillett Ecologist Phone: (714) 755-3249 Southern California Coastal Water Research Project Fax: (714) 755-3229 Costa Mesa, California, 92626 Email: davidg@sccwrp.org

EDUCATION:

Ph.D., Marine Science, The College of William and Mary, Williamsburg, VA - 2010 M.S., Marine Biology, University of Charleston, Charleston, SC - 2003 B.S., Cum Laude, Marine Science, Eckerd College, St. Petersburg, FL - 1997

AREAS OF EXPERTISE:

Dr. Gillett is an ecologist who specializes in studying the influence of anthropogenic disturbances and habitat quality on the community structure and ecosystem functioning of marine, estuarine and freshwater benthic communities. His research has focused primarily on ecosystem-scale field studies and experiments, but also incorporates biogeochemical and toxicological information into ecological field data to better understand biotic structure-function relationships. Dr. Gillett is leading the efforts to develop a causal assessment/stressor ID framework for California’s freshwater and coastal habitats in order to better understand and characterize the sources of impacts to biotic resources in these systems. He is also involved with the development of habitat assessment tools using both traditional monitoring information and newly emerging, genetic/molecular-based information.

PROFESSIONAL EXPERIENCE:

Scientist, Southern California Coastal Water Research Project. Costa Mesa, CA. 2010-Present Graduate Research Fellow, Chesapeake Bay National Estuarine Research Reserve of Virginia. Gloucester Point, VA. 2006-2008 Graduate Fellow, Virginia Institute of Marine Science. Gloucester Point, VA. 2003-2006; 2008-2010 Research Assistant, South Carolina Department of Natural Resources. Charleston, SC. 1999-2003 Teaching Assistant, College of Charleston. Charleston, SC. 1998-1999

HONORS AND AWARDS:

National Estuarine Research Reserve Graduate Research Fellowship (2006-2008) Program Chair, Atlantic Estuarine Research Society (2006-2007) Best Student Poster Presentation, Atlantic Estuarine Research Society Spring Conference (2006)

19

Gillett and Burton – Molecular Identification of Ichthyoplankton

Outstanding Student Presentation, Estuarine Research Federation Conference (2005) Outstanding Graduate Student Award, University of Charleston (Spring 2003) Virginia Institute of Marine Science Graduate Fellowship (2003-2005)

PROFESSIONAL SOCIETIES:

Association for the Sciences of Limnology and Oceanography California Estuarine Research Society Coastal and Estuarine Research Federation Society of Environmental Chemistry and Toxicology Southern California Association of Marine Taxonomists

PUBLICATIONS:

Ode, P.R., A.C. Rehn, R.D. Mazor, K.C. Schiff, E.D. Stein, J.T. May, L.R. Brown, D.B. Herbst, D. Gillett, K. Lunde, and C.P. Hawkins. In press. Evaluating the adequacy of a reference site pool for the ecological assessment of streams in environmentally complex regions. Freshwater Science.

Mazor, R.D., A.C. Rehn, P.R. Ode, M. Engeln, K. Schiff, E. Stein, D. Gillett, D. Herbst, and C.P. Hawkins. In press. Bioassessment in complex environments: designing an index for consistent meaning in different settings. Freshwater Science.

Gillett, D.J., S.B. Weisberg, T. Grayson, A. Hamilton, V. Hansen, E.W. Leppo, M.C. Pelletier, A. Borja, D. Cadien, D. Dauer, R. Diaz, M. Dutch, J.L. Hyland, M. Kellog, P.F. Larsen, J.S. Levinton, R. Llansó, L.L. Lovell, P.A. Montagna, D. Pasko, C.A. Phillips, C. Rakocinski, J.A. Ranasinghe, D.M. Sanger, H. Teixeira, R.F., Van Dolah, R.G. Velarde, and K.I. Welch. 2015. Effect of ecological group classification schemes on performance of the AMBI benthic index in US coastal waters. Ecological Indicators 50:99-107.

Gillett, D.J., K.C. Schiff, D.J. Pondella II, J. Freiwald, J.E. Casselle, C. Shuman, and S.B. Weisberg. 2012. Comparing volunteer and professionally collected monitoring data from the rocky subtidal reefs of southern California, USA. Environmental Monitoring and Assessment 184:3239-3257.

Gillett, D.J. and L.C. Schaffner. 2009. Benthos of the York River. Journal of Coastal Research SI57:80-98. Gillett, D.J., A.F. Holland, and D.M. Sanger. 2007. On the ecology of oligochaetes: Variation in community composition and environmental characteristics of two South Carolina tidal creeks at monthly scales. Estuaries and Coasts 30:238-252. Gillett, D.J., A.F. Holland, and D.M. Sanger. 2005. Secondary production of a dominant oligochaete (Monopylephorus rubroniveus) in the tidal creeks of South Carolina and its relation to ecosystem characteristics. Limnology and Oceanography 50:566-577.

20

Gillett and Burton – Molecular Identification of Ichthyoplankton

CURRICULUM VITAE Ronald S. Burton Work Address: Marine Biology Research Division 0202 Scripps Institution of Oceanography University of California, San Diego La Jolla, CA 92093-0202 Phone: 858 822 5784 Fax: 858 534 7313 Email: rburton@ucsd.edu Education: Degrees: Stanford University B.S. Biological Sciences, 1976 (1972-1976) M.S. Biological Sciences, 1976 Stanford University Ph.D. Biological Sciences, 1981 (1977-1981) Current Position: Professor of Marine Biology, Scripps Institution of Oceanography (SIO), 1995-present. Head, Biology Section, SIO/UCSD, 2015-present Professional Experience: Director, Marine Biology Research Division, SIO, UCSD, 2000-2012. Head, Biology Section, SIO, UCSD, 2004-2012. Associate Professor, Marine Biology Research Division, SIO, UCSD 1992-1995. Associate Professor of Biology, University of Houston, 1987-1992. Assistant Professor of Biology, University of Pennsylvania, 1981-1987. Professional Societies: AAAS, ASLO, Society for the Study of Evolution Honors and Awards: 1976 Phi Beta Kappa, B.S. Degree with Departmental Distinction, Stanford University. 1990 Outstanding Educator (Teaching Award), University of Houston. 2003 Presidential Lecture Series, Florida International University. 2005 Vice Presidential Symposium, American Society of Naturalists. 2007. Mentor Recognition Award, UCSD 2011 Plenary Speaker: Ocean Acidification Principal Investigators’ Meeting, Woods Hole. 2012 University of British Columbia, Zoology Annual Symposium, Student Invited Speaker. 2013 Distinguished Speaker: Smithsonian Tropical Research Institute, Panama. 2013 Elected Fellow: American Association for the Advancement of Science (AAAS) Professional Activities and Outreach: • Advisory Panel: White Abalone (endangered species) Recovery Team, National Marine Fisheries Service, 2002- 2008. • Associate Editor: EVOLUTION (1999- 2001), J. Exp. Mar. Biol. Ecol. (1995-2005). • Editorial Advisor: Marine Ecology - Progress Series (1991- present). • NSF Panel Member, nine panels in five different programs (1989-2015). • Scientific advisor/partner with the Ocean Discovery Institute of San Diego since 2007. • I developed a hands-on molecular biology exercise that is now delivered by ODI staff to over 500 fifth-grade students in underserved San Diego schools each year. • Public lecture at the Birch Aquarium at Scripps, March 2007. Shown on university TV throughout the country (on demand at http://www.uctv.tv/ with over 150,000 views) Selected Publications (of 100 total publications): Burton, R. S. and B.-N. Lee 1994. Nuclear and mitochondrial gene geneologies and allozyme

22

Gillett and Burton – Molecular Identification of Ichthyoplankton

polymorphism across a major phylogeographic break in the copepod Tigriopus californicus. Proc. Nat. Acad. Sci. USA. 91:5197-5201. Burton, R.S. 1998. Intraspecific phylogeography across the Point Conception biogeographic boundary. Evolution 52:734-745. Hellberg, M.E., Burton, R.S., Neigel, J.E., Palumbi, S.R. 2002. Genetic assessment of connectivity among marine populations. Bull. Mar. Sci. 70(1) Suppl:273-290. Flowers, J.M., S.C. Schroeter, and R.S. Burton. 2002. The recruitment sweepstakes has many winners: genetic evidence from purple sea urchins. Evolution 56:1445-1453. Gruenthal, K.M. and R.S. Burton. 2005. Genetic diversity and species identification in the endangered white abalone (Haliotis sorenseni). Conservation Genetics 6:929-939. Ellison, C.K. and R.S. Burton. 2008. Interpopulation hybrid breakdown maps to the mitochondrial genome. Evolution 62:631-638. doi:10.1111/j.1558-5646.2007.00305.x Burton, R. S. 2009. Molecular markers, natural history and conservation of marine animals. BioScience 59:831-840. Barreto, F. S., G.W. Moy and R.S. Burton. 2011. Interpopulation patterns of divergence and selection across the transcriptome of the copepod Tigriopus californicus. Molecular Ecology 20:560-572. Gleason, L.U. and R.S. Burton. 2012. High-throughput molecular identification of fish eggs using multiplex suspension bead arrays. Molecular Ecology Resources 12: 57–66. Burton, R. S. and F.S. Barreto 2012. A disproportionate role for mtDNA in Dobzhansky- Muller incompatibilities? Molecular Ecology 21: 4942–4957. Schoville S.D., F.S. Barreto, G.W. Moy, A. Wolff and R.S. Burton 2012. Investigating the molecular basis of local adaptation to thermal stress: population differences in gene expression across the transcriptome of the copepod Tigriopus californicus. BMC Evolutionary Biology 2012, 12:170 Barreto, F.S., and R.S. Burton. 2013. Evidence for compensatory evolution of ribosomal proteins in response to rapid divergence of mitochondrial rRNA. Molecular Biology and Evolution 30:310-314. DOI: 10.1093/molbev/mss228 Barreto, F. S., and R.S. Burton. 2013. Elevated oxidative damage is correlated with reduced fitness in interpopulation hybrids of a marine copepod. Proceedings of the Royal Society B 280: 20131521. http://dx.doi.org/10.1098/rspb.2013.1521 Fisch, K.M., J. A. Ivy, R. S. Burton and B. May 2013. Evaluating the performance of captive breeding techniques for conservation hatcheries: A case study of the delta smelt captive breeding program. Journal of Heredity 104: 92-104. Burton, R.S., R. J. Pereira and F. S. Barreto. 2013. Cytonuclear genomic interactions and hybrid breakdown. Ann. Rev. Ecol. Evol. Syst. 44:281-302. DOI: 10.1146/annurevecolsys- 110512-135758 Pereira, R.J., F. S. Barreto and R.S. Burton. 2014. Ecological novelty by hybridization: experimental evidence for increased thermal tolerance by transgressive segregation in Tigriopus californicus Evolution 68:204-215. doi:10.1111/evo.12254. Barreto, F.S., R.J. Pereira, and R.S. Burton 2015. Hybrid dysfunction and physiological compensation in gene expression. Molecular Biology and Evolution 32: 613- 622 doi:10.1093/molbev/msu321. Barreto, F.S., S.D. Schoville and R.S. Burton 2015. Reverse genetics in the tidepool: Knockdown of target gene expression via RNA interference in the copepod Tigriopus californicus. Molecular Ecology Resources 15: 868–879

23

Gillett and Burton – Molecular Identification of Ichthyoplankton

Eric D. Stein Principal Scientist Phone: (714) 755-3233 Southern California Coastal Water Research Project Fax: (714) 755-3299 Costa Mesa, California, 92626 Email: erics@sccwrp.org PROFESSIONAL PREPARATION: D.Env. Environmental Science and Engineering, University of California, Los Angeles, 1995 M.Ed. Science Education, University of California, Los Angeles, 1988 B.S. Biology, University of California, Los Angeles, 1987 PROFESSSIONAL EXPERIENCE: 2002 – Present Principal Scientist - Southern California Coastal Water Research Project 1998 – 2002 Adjunct Associate Professor - California State University, Los Angeles, Department of Geography and Urban Analysis 1998 – 2002 Principal Ecologist, Associate Principal - PCR Services Corporation 1993 – 1998 Biologist, Senior Project Manager - U.S Army Corps of Engineers, Los Angeles District SELECTED RELATED PEER-REVIEWED PUBLICATIONS: Stein, E.D., M.C. Martinez, S. Stiles, P.E. Miller, and E.V. Zakharov. 2014. Is DNA Barcoding Actually Cheaper

and Faster Than Traditional Morphological Methods: Results from a Survey of Freshwater Bioassessment Efforts in the United States? PLoS ONE. 9(4): e95525. doi:10.1371/journal.pone.0095525

Mazor, R.D., E.D. Stein, P.R, Ode, and K Schiff. 2014. Integrating intermittent streams into watershed assessments: Applicability of an index of biotic integrity. Freshwater Science. DOI: 10.1086/675683

Stein, E.D., B.P. White, R.D. Mazor, J.K. Jackson, J.M. Battle, P.E. Miller, E.M. Pilgrim, B.W. Sweeney. 2014. Does DNA Barcoding Improve Performance of Traditional Stream Bioassessment Metrics? Freshwater Science. 33(1):302–311. DOI: 10.1086/674782

Jackson, J.K, J.M. Battle, B.P. White, E.M. Pilgrim, E.D. Stein, P.E. Miller, and B.W. Sweeney. 2014. Cryptic biodiversity in streams - a comparison of macroinvertebrate communities based on morphological and DNA barcode identifications. Freshwater Science. 33(1):312–324. DOI: 10.1086/675225.

White, B.P., E.M. Pilgrim, L.M. Boykin, E.D. Stein, R.D. Mazor. 2014. Comparison of four species-delimitation methods applied to a DNA barcode data set of insect larvae for use in routine bioassessment. Freshwater Science. 33(1):338–348. DOI: 10.1086/674982

Lackey, L.G., and E.D. Stein. 2014. Selecting the optimum plot size for a California design-based stream and wetland mapping program. Environmental Monitoring and Assessment. 186:2599–2608. DOI 10.1007/s10661-013-3563-y

Fetscher, A.E., R. Stancheva, J.P. Kociolek, R.G. Sheath, E.D. Stein, R.D. Mazor, P.R. Ode, and L.B. Busse. 2014. Development and comparison of stream indices of biotic integrity using diatoms vs. non-diatom algae vs. a combination. Journal of Applied Phycology. 26(1):433-450. DOI 10.1007/s10811-013-0088-2

Stein, E.D. 2013. Using Regional Stormwater Monitoring Programs to Provide Reference Data for Wetland Mitigation Performance Evaluation. National Wetlands Newsletter. 35(4):13-14

Stein, E.D., M.R. Cover, A.E. Fetscher, C. O’Reilly, R. Guardado, and C.W. Solek. 2013. Reach-scale geomorphic and biological effects of localized stream bank armoring. Journal of the American Water Resources Association. 49(4):780-792. DOI: 10.1111/jawr.12035

Lackey, L.G. and E.D. Stein. 2013. Evaluation of design-based sampling options for monitoring stream and wetland extent and distribution in California. Wetlands. 33:717–725. DOI 10.1007/s13157-013-0429-6

Stein, E.D., J.S. Brown, T.S. Hogue, M.P. Burke, and A. Kinoshita. 2012. Storm water contaminant loading following southern California wildfires. Environmental Toxicology and Chemistry. 31(11):2625-2638.

Hawley, R.J., B.P. Bledsoe, E.D. Stein, and B.E. Haines. 2012. Channel Evolution Model of Response to Urbanization in Southern California. Journal of the American Water Resources Association 48(4):722—744. 2

25

Gillett and Burton – Molecular Identification of Ichthyoplankton

Bledsoe, B.P., E.D. Stein, R.J. Hawley, and D.B. Booth. 2012. Framework and tool for rapid assessment of stream susceptibility to hydromodification. Journal of the American Water Resources Association 48(4):788-808.

Solek, C.W., M.A. Sutula, E.D. Stein, C. Roberts, R. Clark, K. O’Connor, and K.J. Ritter. 2012. Determining the Health of California’s Coastal Salt Marshes Using Rapid Assessment. Wetland Science and Practice 29(1):8-28

Dark, S., E.D. Stein, D. Bram, and J. Osuna. 2012. Historical Ecology as a Living Resource for Informing Urban Wetland Restoration. Urban Coast. 3(1):54-60.

Solek, C.W., E.D. Stein, and M.A. Sutula. 2011. Demonstration of an Integrated Watershed Assessment Using a Three-tiered Assessment Framework. Wetlands Ecology and Management. 19(5):459-474

Stein, E.D. and D.B. Cadien. 2009. Ecosystem Response to Regulatory and Management Actions: the Southern California Experience in Long-term Monitoring. Marine Pollution Bulletin 59:91-100.

Lyon, G.S. and E.D. Stein. 2009. How Effective Has the Clean Water Act Been at Reducing Pollutant Mass Emissions to the Southern California Bight over the Past 35 Years? Environmental Monitoring and Assessment 154(1):413-426.

Stein, E.D. and V.K. Yoon. 2008. Dry Weather Flow Contribution of Metals, Nutrients, and Solids from Natural Catchments. Water Air and Soil Pollution 190:183-195.

Ackerman, D. and E.D. Stein. 2008. Evaluating the Effectiveness of Best Management Practices Using Dynamic Modeling. Journal of Environmental Engineering 134(8):628-639.

Stein, E.D. and B. Bernstein. 2008. Integrating Probabilistic and Targeted Compliance Monitoring for Comprehensive Watershed Assessment. Environmental Monitoring and Assessment 144:117-129.

SYNERGISTIC ACTIVITIES: - Associate Editor, Wetlands: Journal of the Society of Wetland Scientists (2009-Present) - Southern California Wetlands Recovery Program Science Advisory Panel (1999-Present) - Santa Monica Bay Restoration Commission Technical Advisory Committee (2013-present) - USEPA, Environmental Law Institute (ELI), Nature Conservancy (TNC) - watershed approach (2012 – present). - California Wetland Monitoring Workgroup, Co-chair (2008 – present) - California Healthy Streams Partnership (2011 – present) - USDA-NRCS National Easement Assessment Project – technical team (2011-present) - U.S. Army Corps of Engineers Workgroup: Quantifying Significance of Aquatic Ecosystems (2010) - NOAA Water Quality Synthesis & Assessment (SAM) Technical Advisory Committee (2006-2009) - Society of Wetland Scientists, Western Chapter President (2006-2010) - Society of Wetland Scientists, Wetland Concerns Committee (2006- present) - National Wetlands Awards, Selection Committee (2007, 2008, 2012) - California State Stream and Wetland Protection Policy Science Advisory Team (2009 – present) - US Army Corps of Engineers – National Workgroup on Arid Stream Assessment (2007) - NOAA National Estuary Eutrophication Workgroup, S. Pacific Coast Coordinator (2007) - California State Stream and Wetland Protection Policy Science Advisory Team (2009-present) RECENT COLLABORATORS: B. Bledsoe (Colorado State University), Erik Pilgrim (USEPA), Mehrdad Hajibabaei (University of Ontario), D.

Booth (UCSB), D. Carlisle (USGS), R. Ambrose (UCLA), G.M. Kondolf (UCB), M. Cover (CSU Stanislaus), B. Jones (USC), T. Longcore (USC), S. Dark (CSU Northridge), T. Hogue (UCLA), J. Warrick (USGS), J.H. Dorsey (Loyola Marymount University)

THESIS ADVISORY & POSTGRADUATE-SCHOLAR SPONSOR: S. Lopez (UCLA), L. Lackey (UCLA), L. Fong (UCLA), M. Schliebe (CSULB), B. White (CSU Fullerton), I. Irvine

(UC Irvine), S. Eberhart (Colorado State University), B. Hawley (Colorado State University), B. Haines (Colorado State University), V. Yoon (UCLA), S. Lee (UCLA), D. Cummings (CSULA), L. Morales (CSULA)

26

Gillett and Burton – Molecular Identification of Ichthyoplankton

SUMMARY PROPOSAL FORM

PROJECT TITLE: Molecular Identification of Larval Nekton Inhabiting the Waters of the Southern California Bight

OBJECTIVE: The primary goals of this research are to determine if ichthyoplankton monitoring data derived from metabarcoding methods produces comparable or better quality data to traditional morphological methods. If so, we will help develop basic operating procedures for incorporation of these molecular methods into monitoring programs of the water quality and resource management community across the Southern California Bight.

METHODOLOGY: Ichthyoplankton samples will be collected from across the Southern California Bight by field crews from the region’s large publicly owned treatment works (POTW) (i.e., Los Angeles County Sanitation District, Orange County Sanitation District, and the City of San Diego). Samples will be labeled and placed in 95% ethanol. From ethanol preserved specimens, fish eggs and larvae will be sorted from detritus and zooplankton, enumerated, and identified by taxonomists at the NOAA Southwest Fisheries Science Center. After morphological identification, individual samples will be homogenized and the DNA will be extracted using standard protocols. CO1 and 16S DNA will be sequenced from the bulk extraction using Illumina Mi-Seq high throughput sequencer (i.e., metabarcoding). Produced forward and reverse sequences (of approximately 200-300 bp) will be aligned and verified for size and structure, to insure purity. Valid sequences will be assigned names based upon matches from custom DNA libraries of Southern California nekton, as well the larger public genomic databases (e.g., BOLD, GENBANK).

Additionally, ~ 800 individuals will be removed from a subset of samples for individual DNA barcoding. Standard DNA extraction and amplification protocols will be used and PCR amplicons will be sequenced bi-directionally by Sanger sequencing with a capillary DNA analyzer. Valid DNA sequences will then be assigned names based upon matches from custom DNA libraries of Southern California nekton, as well the larger public genomic databases (e.g., BOLD, GENBANK). Taxonomic assignments from the morphological, Sanger sequenced DNA, and metabarcoded DNA will be compared for taxonomic composition and similarity.

RATIONALE:

Understanding the larval ichthyoplankton population dynamics along the shelf addresses several management questions/needs including general adult population structure, larval production/success of marine protected areas, and early detection of invasive taxa before a population of adults becomes established. A significant obstacle to the regular monitoring of ichthyoplankton is the difficulty in identifying the individuals in a given sample. Traditional larval fish identification done via microscopy of preserved specimens requires time and a high degree of taxonomic specialization. Molecular taxonomic methods, such as DNA barcoding, offer a potential solution to improve the efficiency and utility of ichthyoplankton assessment. However, despite its utility in improving the identification of problematic taxa, single organism

32

Gillett and Burton – Molecular Identification of Ichthyoplankton

barcoding is not practical for application in a large-scale monitoring programs given the time needed to process hundreds of individuals in dozens of samples. However, with a reliable DNA reference library, metabarcoding – the extraction and sequencing of all the DNA in sample at one time – represents a promising way to create an ichthyoplankton monitoring program across the region based upon molecular identification of samples.

33

UNITED STATES DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration NATIONAL MARINE FISHERIES SERVICE Sout hw est Fisher ies Science Cent er 8604 La Jo lla Shores Dr ive La Jo lla, CA 92037-1508

July 9, 2015 Ms. Ruth Dudas, Contract and Grants Coordinator USC Sea Grant 3616 Trousdale Pkwy, AHF 253 Los Angeles, CA 90089-0373 RE: Letter of Support for “Molecular Identification of Larval Nekton Inhabiting the Waters of the Southern California Bight” Project Dear Ms. Ruth Dudas: I am pleased to provide this letter supporting the Southern California Coastal Water Research Project’s (SCCWRP) grant application for “Molecular Identification of Larval Nekton Inhabiting the Waters of the Southern California Bight”. The work proposed in this grant would develop a new approach and application to sample processing that will allow us to increase the geographic scope and utility of an ecologically important component of the coastal ocean ecosystem across the Southern California Bight (SCB). Monitoring of larval fishes from nekton samples in California over the past 70 years has provided valuable information regarding the responses of fish populations and communities to perturbation. However, identification of larvae based on morphological characteristics requires extensive expertise and thus limits the capacity of many programs to conduct this sampling. Although advances in molecular technology to identify nekton have been made in many individual laboratories worldwide, these new techniques have yet to be adopted by the broader management community in the United States. We are excited to work with SCCWRP to refine tools and sampling protocols that will facilitate the integration of emerging technologies in next-generation DNA sequencing and taxonomic identification into existing field programs. Beyond our conceptual support for this project, we intend to provide in-kind support towards this project via partial support of a post-doctoral investigator focusing on the bioinformatics and sequencing aspects of this work, a laboratory technician focusing the processing/sorting of samples, and taxonomic expertise in the identification of the sorted larvae. Thank you for your consideration and I appreciate your favorable consideration of SCCWRP’s application to fund this project. Sincerely, Andrew Thompson Ph.D., Research Fisheries Biologist, Ichthyoplankton Ecology

OMB Control No. 0648-0362

Expiration Date 1/31/2018 SEA GRANT BUDGET FORM 90-4

GRANTEE: The Regents of the University of California GRANT/PROJECT NO.:

BRIEF TITLE: MOLECULAR IDENTIFICATION OF LARVAL NEKTON INHABITING DURATION (months): 12 2/1/2016 - 1/31/2017

PRINCIPAL INVESTIGATOR: Burton 12 months 1 Yr.

A. SALARIES AND WAGES: man-m

1. Senior Personnel No. of People Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: 1 1.0 0 20,243 b. Associates (Faculty or Staff):

Sub Total: 1 1.0 0 20,243

2. Other Personnel

a. Professionals:

b. Research Associates:

c. Res. Asst./Grad Students:

d. Prof. School Students:

e. Pre-Bachelor Student(s):

f. Secretarial-Clerical:

g. Technicians: 1 3.0 15,555 0 h. Other:

Total Salaries and Wages: 2 4.0 15,555 20,243

B. FRINGE BENEFITS: 0.0% 0 0 Total Personnel (A and B): 15,555 20,243

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT: 2,000

E. TRAVEL:

1. Domestic

2. International

Total Travel: 0 0

F. PUBLICATION AND DOCUMENTATION COSTS:

G. OTHER COSTS:

Project specific costs 450

2

3

4

5

6

7

Total Other Costs: 450 0

TOTAL DIRECT COST (A through G): 18,005 20,243

INDIRECT COST (On campus 55% ): 37.5 9,903 11,134 Total Indirect Cost: 9,903 11,134

TOTAL COSTS: 27,908 31,377 OMB Control No. 0648-0362

Expiration Date 1/31/2018 SEA GRANT BUDGET FORM 90-4

GRANTEE: The Regents of the University of California GRANT/PROJECT NO.:

BRIEF TITLE: MOLECULAR IDENTIFICATION OF LARVAL NEKTON INHABITING DURATION (months): 12 2/1/2017 - 1/31/2018

PRINCIPAL INVESTIGATOR: Burton 12 months 1 Yr.

A. SALARIES AND WAGES: man-m

1. Senior Personnel No. of People Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: 1 1.0 0 22,145 b. Associates (Faculty or Staff):

Sub Total: 1 1.0 0 22,145

2. Other Personnel

a. Professionals:

b. Research Associates:

c. Res. Asst./Grad Students:

d. Prof. School Students:

e. Pre-Bachelor Student(s):

f. Secretarial-Clerical:

g. Technicians: 1 2.0 10,732 0 h. Other:

Total Salaries and Wages: 2 3.0 10,732 22,145

B. FRINGE BENEFITS: 0% 0 0 Total Personnel (A and B): 10,732 22,145

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT:

E. TRAVEL:

1. Domestic

2. International

Total Travel: 0 0

F. PUBLICATION AND DOCUMENTATION COSTS:

G. OTHER COSTS:

Project specific costs 300

2

3

4

5

6

7

Total Other Costs: 300 0

TOTAL DIRECT COST (A through G): 11,032 22,145

INDIRECT COST (On campus 55%): 65% 6,068 12,180 Total Indirect Cost: 6,068 12,180

TOTAL COSTS: 17,100 34,325 Scripps PI Burton will provide 1.0 month of effort each year serving as matching funds for the project. Funds requested from USC Sea Grant are for 5 months of technician time (SRA I, 3 months in year 1 and 2 months in year 2). Salary recharge rates are calculated for actual productive time only (except for nonfaculty academic sick leave). The rates include components for employee benefits, provisions for applicable merit increases and range adjustments in accordance with University policy, except postdoc rates which do not include components for downtime, so those rates are calculated for all working hours. Staff overtime or remote location allowance may be required in order to meet project objectives, and separate rates are used in those cases.

Supplies are budgeted at $2,000 in year 1 based on Burton lab experience in obtaining ~800 sequences. Project specific costs that include research telephones, tolls, voice and data communication charges, photocopying, faxing and postage are requested. Supply and expense items, categorized as project specific, and computer and networking services are for expenses that specifically benefit this project and are reasonable and necessary for the performance of this project.

1

l. TITLE OF PROJECT

DISTINGUISHING EXPOSURE FROM EFFECT IN MULTIPLE-STRESSOR SCENARIOS:

EFFECTS OF OCEAN ACIDIFICATION AND METAL-TOXICITY ON MUSSEL LARVAL

DEVELOPMENT

2. PRINCIPAL INVESTIGATOR(S)

Andrew Gracey, Associate Professor of Marine Biology, USC.

3. ASSOCIATE INVESTIGATOR(S)

4. FUNDING REQUESTED

2016-2017 $45,314 Federal/State $22,680 Match

2017-2018 $52,214 Federal/State $26,154 Match

5. STATEMENT OF THE PROBLEM

The regulations governing heavy metal contamination in Southern California’s coastal ocean

must be considered in the context of a changing global ocean. Increased dissolved CO2 levels are

predicted to decrease ocean pH to 7.7 by 2100 as well as significantly lower calcium carbonate

saturation constants, especially in the California Current system. There is growing evidence that

ocean acidification (OA) will have an overall deleterious effect on the health of many organisms.

Furthermore, it is expected that OA will increase toxicity of certain metal contaminants, such as

copper, by reducing the complexation capacity of coastal waters and increasing free metal

concentrations (1). Therefore, understanding the effects of OA on water quality issues remains a

largely unexplored but looming question. This is a particular challenge in urban oceans because

multiple environmental and chemical parameters will vary temporally and spatially due to the

proximity of large sources of urban pollutants. This means that water quality testing approaches

that will be implemented this century will have to be nuanced and capable of analyzing multiple

stressor scenarios in order to predict the impact that contaminants will have on coastal urban

ecosystems.

6. INVESTIGATORY QUESTION

Global climate change will present inhabitants of impacted coastal environments with the

additional stress of OA. This raises the question, will OA exacerbate the deleterious effects of

contaminants on the health of organisms?

We hypothesize that:

multiple-stressor exposures comprising OA and a heavy metal will be more deleterious to

the organism than exposure to either stressor alone

more deleterious exposures will be manifested as increases in abnormal embryo

development and mortality, and concomitant differences in gene expression

molecular biomarkers of contaminant exposure versus effect will be associated with

phenotypic differences among larvae

7. MOTIVATION

Importance of Studying Ocean Acidification Impacts on Metal Bioavailability and Toxicity

2

Global change is progressing at an unprecedented rate, and affecting all global ecosystems.

Ocean acidification in particular is expected to affect marine and estuarine habitats in numerous

ways, most of them negative. Ocean acidification, which is characterized by a shift in carbonate

equilibrium resulting in more bicarbonate, lower calcium carbonate saturation constants, and

lower pH will change ocean chemistry, as well as organismal physiology. Increased dissolved

CO2 levels are predicted to decrease ocean pH to 7.7 by 2100, and lower calcium carbonate

saturation constants significantly as well. The California Current system is expected to

experience particularly strong acidification, as this is already an area where strong upwelling

brings acidified deep water to the surface (2).

The impacts of ocean acidification must also be considered in the context of concurrent changes,

such as rising temperature, higher levels of UV, and increased stratification of the water column

(3). Meanwhile, extant pressures on marine ecosystems, such as chemical pollution and nutrient

loading, will remain and potentially interact with novel factors as well. Thus it will be important

to understand how numerous environmental variables in the ocean affect each other, and leaves

the potential for many unknown interactions. The physiological response of organisms to these

simultaneous changes has been an imperative question for several years now (4-6), and will

ultimately determine biogeographic range shifts, changes in genetic composition of populations,

and alterations in ecosystem function.

Metals, especially iron, copper, cadmium, and zinc are important in coastal ecosystems both

because they serve as micronutrients for all forms of life (with exception of Cd), and because at

higher doses they can become acutely toxic. Our knowledge of metal cycles (bioavailability and

speciation) in marine ecosystems is based on our understanding of extant chemical and physical

ocean parameters, but as these factors change under ocean acidification, many models of metal

biotic and abiotic interactions will have to change as well. Predicted effects of ocean

acidification on metal supply and bioavailability are outlined in recent reviews (1, 7), yet there is

little conclusive proof that numerous predictions will play out as expected. This topic is still

drastically understudied, and more direct studies exposing organisms to realistic future-ocean

scenarios are necessary, especially considering the vital roles that metals play in numerous

biogeochemical cycles.

While a lack of metal micronutrients could pose problems for marine organisms, an excess of

toxins could likewise have significant effects on keystone organisms and marine ecosystems.

The regulations that currently exist for metal contamination, as well as regulations that will be

developed in coming years, must be considered in the context of a changing global ocean (8).

The effects of ocean acidification on metal toxicity is a relatively new field of study, and only

limited research exists on the interactive effects of these two stressors on organismal survival,

reproduction, and physiology.

Several studies have begun to consider the effects of combined metal stress and ocean

acidification on marine invertebrates. Polychaete larvae exposed to both copper and reduced pH

exhibited lower survival than those in either treatment alone (9). In a study by (10), copepods

were exposed to increasing levels of copper under pH regimes representing current and future

ocean conditions. While elevated copper in the presence of CO2 resulted in faster growth of

copepods, it also resulted in lower fecundity, with an ultimately detrimental effect. Another study

3

on benthic isopods found that metal-contaminated sediments have different effects on survival

and DNA damage under acidified and normal pH conditions (8). Only one study has considered

the combined effects of metals and ocean acidification in adult mussels. When exposed to metals

under normal and reduced ocean pH conditions, mussels exhibited altered survival rates (lower,

in most cases), increased immune response, and much higher uptake rates of all metals (11). It is

clear that the combination of ocean acidification and metal exposure results in altered toxicity

patterns, indicating that current contaminant criteria will not apply under different ocean

chemistry conditions. Thus, in areas like southern California where toxic metals are highly

regulated, a detailed investigation of potential toxicity changes is warranted to prove the need for

updating water quality regulations in the coming decades.

Metal Contamination in Southern California

Metal pollution of marine environments has been identified as a persistent problem in urban

areas of southern California. Recommended limits on metal contamination are set by the EPA for

effluent and receiving waters, but the concentrations of several metals still occasionally exceed

limits in some areas along the coast (12). Three metals that still pose a problem in southern

California include copper, cadmium, and zinc (13, 14). Copper and zinc are both micronutrients

required at low concentrations, while cadmium is not necessary for biological function, yet they

are all toxins at concentrations that can occur in coastal waters. Additionally, they all can be

present as divalent cations that are easily absorbed and accumulated by bivalves.

The major sources of metals in this area are storm-water runoff, privately owned treatment works

(POTW) discharge, and anti-fouling paints on the hulls of boats. POTW effluent has been

reduced in overall toxicity over the past 35 years, yet it still contributes 41 and 52% of total

copper and cadmium loads, respectively, to coastal waters. Alternatively, storm-water runoff has

been increasing in volume and toxicity, and contributes a large fraction of cadmium and copper,

as well as most of the zinc, that pollute coastal waters (15). This problem is exacerbated by the

local climate because contaminants accumulate during long dry spells but are then flushed into

coastal waters during the first severe rainfall events. In turn these rain events cause local surges

in the levels of toxic metals and organic contaminants that can temporarily exceed EPA and State

criteria (16-18)

The toxic forms of cadmium, copper, and zinc all form strong complexes with organic ligands,

and thus exist in coastal waters primarily in a complexed, particle-associated form. However,

ocean acidification has the potential to alter the proportion of ligated and free forms of these

metals. The decrease in pH associated with ocean acidification is expected to increase

protonation of negative sites on the organic ligands, thus blocking potential binding locations for

these cations ((1); Hutchins, pers. comm.). This would result in fewer metal ions bound to the

ligands, and more free, toxic (Cd+2, Zn+2, Cu+2) ions in the water. The ability to predict and

anticipate potential changes in toxicity will be important for updating saltwater contaminant

criteria in a timely manner. The results of this research can be used by regulators to pre-empt the

effects of ocean acidification on organisms’ metal tolerance, and thus adjust contaminant limits

accordingly.

Rationale for Mytilus Embryo-Larval Development Toxicity Testing Model

4

The genus Mytilus was reported to be the most sensitive genus to copper toxicity in an EPA

survey of genus mean acute values (19). As a result, Mytilus larvae are among the most

important test organisms used in marine metal toxicity assessment in the United States and the

criteria for many priority pollutants, such as Cu, are based on Mytilus larvae EC50 data (see

(20)and refs. therein). In the standard US EPA embryo-larval development test, Mytilus larvae

are incubated in a given water sample for 48 hr and then data on larval mortality and abnormal

development are collected (Fig. 1).

Figure 1. Toxicity of Cu2+ to Mytilus californianus larvae reared for 48 hr in Catalina Island seawater with

increasing concentrations of copper. (A) The proportion of embryos exhibiting abnormal development and the rate

of larval mortality were both elevated significantly at and above 6 g/L Cu2+ (* indicates p<0.01). The data are

presented as the mean standard deviation (n=5) of the proportion of larvae exhibiting abnormal development or

larval mortality relative to control cultures to which Cu was not added. (B) Images of larvae exhibiting normal

versus abnormal development in US EPA toxicity test at 48 hrs.

Mytilus larvae are a particularly appropriate study system in the context of ocean acidification,

because acidification is expected to have an especially large effect on calcifying marine

invertebrates. Indeed, mussels have been the subjects of several key ocean acidification

experiments. Some of the primary effects that have been observed include: developmental

abnormalities ultimately resulting in death, delayed larval development (21), reduced immunity

(22), reduced tissue mass, thinner shells (23) and alteration of shell structural integrity (24),

weaker byssal threads (25), and in oyster larvae increased metabolic costs (26). Some of these

effects may also increase time that the larvae spend in the plankton resulting in greater predation

and lowered settlement rates (23). Shell integrity is of special concern for Mytilus because their

shells are partially composed of the calcium carbonate crystal form aragonite (27). Of aragonite

and calcite, the two crystal forms of calcium carbonate, aragonite has a lower saturation constant,

and is thus expected to dissolve at a higher pH than calcite. Therefore it is likely that Mytilus will

Cu2+ (g/L)

Pro

po

rtio

n o

f em

bry

os

wit

h n

orm

al

dev

elo

pm

ent

0

0.2

0.4

0.6

0.8

1

1.2

0

0.2

0.4

0.6

0.8

1

1.2

0 5 10 15 20 25

Pro

po

rtio

n o

f em

bry

os

that

su

ffer

m

ort

alit

y re

lati

ve t

o c

on

tro

l cu

ltu

res

Development

Mortality

*

* ** *

*

B

A

Normal Abnormal

5

have to increase shell maintenance sooner than other calcifying marine organisms that precipitate

solely calcite.

Toxicity testing in the 21st century

Recent advances in ecotoxicology have called for the inclusion of molecular data in assessing the

response of test organisms to contaminants (28, 29). The rationale for the inclusion of molecular

data in establishing testing toxicity criteria is that changes in cell state are invariably linked to

changes in gene expression (30), and for this reason gene expression profiling is showing

increasing promise in the context of environmental monitoring (31). Integration of classic

measurements of toxicity, gross morphological and mortality effects, and molecular responses,

provides a rich source of data yielding crucial insights into the effects of contaminants at

concentrations that are below those that give rise to the visible changes in survival and

development. This more comprehensive approach is necessary because the actual mechanisms of

toxicity are poorly understood at low concentrations and in the context of multiple stressor

scenarios. Indeed, the EPA has called for the development of “Adverse Outcome Pathway”

perspective on toxicity (28), which seeks to provide a more mechanistic representation of

toxicological events which lead to an adverse outcome (32, 33). Incorporation of molecular data

is an important step towards achieving this goal because it provides a more nuanced overview of

how toxicants exert their effects at the cellular level, and helps to inform the interpretation of

observed shifts in survival and adverse health effects under different exposure scenarios.

One of the promises of molecular approaches is that they will identify biomarkers such as gene

transcripts or proteins, which can be used to monitor the presence of a chemical in the body,

biological responses, or adverse health effects (29). Biomarkers are often grouped into

biomarkers of exposure versus those of effect, with biomarkers of exposure serving as a measure

of the amount of toxicant that the organism has been exposed to, whereas biomarkers of effect

serve as indicators of a change in biological function in response to toxicant exposure (34).

Molecular biomarkers of exposure are normally going to be surrogates, representing a

physiological response to the toxicant, but providing little to no information regarding the effects

on the health of the organism. In contrast, biomarkers of effect indicate physiological changes

that are linked to the adverse health effects of the toxicant. One of the challenges of developing

molecular biomarkers is distinguishing between responses linked to simple exposure versus

those that are linked to the deleterious effects of the exposure and adverse outcomes to the

organism’s health (28). A report by the National Research Council (NRC) of the U.S. National

Academy of Sciences (35) envisions the delineation of ‘‘toxicity pathways’’ defined as ‘‘cellular

response pathways that, when sufficiently perturbed in an intact animal, are expected to result in

adverse health effects’’ as a goal in the future of toxicology. Delineation of these pathways is

important because they differentiate between adaptive responses that are activated upon exposure

to low levels of a contaminant and which serve to defend the physiology of the organism, from

stress responses that indicate that defense measures have been overwhelmed and damage has

occurred (36). Characterization of these cell stress response pathways is important because these

pathways are extensively networked and their activation can lead to programmed cell death and

developmental consequences, thus linking their activation to adverse consequences (36, 37).

8. GOALS AND OBJECTIVES

6

Our overarching research goal is to use mussel embryo-larvae as a model to test the hypothesis

that OA will affect metal toxicity. To achieve this goal we will undertake an integrative analysis

of toxicity by simultaneously monitoring mortality, developmental abnormality, and global

changes in gene expression.

Objective 1) To determine the interactions of metals and elevated pCO2 in mussel embryo-larval

toxicity assays

The combined effects of ocean acidification and metal contaminants have the potential to act

additively, synergistically, or antagonistically on the physiology and health of marine organisms.

We will use mussel embryo-larval toxicity assays to study the effect of increasing metal

concentrations under current and future CO2 concentrations and seawater pH. Specifically, we

will test the effects of copper, cadmium, and zinc, all still pollutants of concern in southern

California (see sources listed above).

Objective 2) To complement the toxicity assay results with molecular data

In line with the EPA’s call to develop more mechanistic rather than end-point assessments of

toxicity, we will complement the standard mussel embryo-larval toxicity assay with gene

expression data. This approach will identify genes and pathways which exhibit a concentration-

response to metal/OA exposure and which can be correlated with US EPA-approved markers of

larval toxicity. This phenotype-to-molecular relationship will provide a scaffold upon which we

can investigate the molecular signatures and mechanisms responsible for differences in toxicity

under changing conditions of OA.

Objective 3) To dissect the molecular signatures associated with the normal versus abnormal

developmental phenotypes that arise in toxicity assays

One metric of toxicity in embryo-larval toxicity assays is the proportion of normal and abnormal

larvae in a given sample (Fig. 1B). Abnormal development occurs naturally but an increase in

the incidence of abnormal larvae is considered to be a marker of the adverse effects of chemical

exposure. All the larvae in the assay have received the same level of exposure but only the

abnormal individuals are exhibiting morphological evidence of adverse effect, thus these

phenotypically distinct larvae may yield biomarkers that can help to differentiate exposure from

effect. In this objective we will leverage the fact that a given assay will contain these

phenotypically distinct larvae to develop a novel stratified sub-sampling technique that will

identify the molecular signatures belonging to larvae that are exhibiting toxicant-induced

abnormal development from those that develop normally. This sub-sampling approach has the

potential to untangle the complex interactions that occur when multiple variables are employed

in water quality testing protocols, and to dissect the transcriptional contribution of the normal

and abnormal larvae to the bulk molecular data collected in objective 2. These data will also

serve to corroborate transcriptional patterns observed in the concentration-response results.

9. METHODS

Preparation of mussel embryos

M. californianus broodstock will be collected from jetties in northern Santa Monica Bay, and

held in pristine water (collected from mid San Pedro Channel, https://dornsife.usc.edu/spot/) at

the Wrigley Marine Science Center on Catalina Island for 4 weeks. Spawning will be induced

using standard protocols that employ a mild thermal shock. Spawning male and female mussels

7

(judged by type of gametes released) will be placed into separate containers. Once spawning is

complete, good quality eggs will be inoculated with sperm at a density of ~5 sperm/egg. When

the majority of eggs are fertilized, evidenced by the production of a polar body, embryo density

will be determined and embryos will be stocked at a density of 10 embryos/ml into 1 L vessels

containing the experimental seawater samples.

In our proposed program of work we will use larvae of the California mussel, Mytilus

californianus, as the bioindicator organism. One of the reasons for this decision is that M.

californianus is the only remaining native mussel in southern California and is ecologically

relevant because it dominates rocky intertidal habitats on exposed coasts. The other native

mussel was a bay mussel, M. trossulus, but it has been displaced by an invasion of M.

galloprovincialis from the Mediterranean (38). While M. edulis and M. galloprovincialis are the

mussels that have been most widely used in contaminant testing, their deployment presents

challenges because they are almost impossible to distinguish morphologically and can hybridize

with one another. Recent reports indicate that incorrect identification of bay mussel species can

confound efforts to standardize regulatory criteria and have called for data collected in M.

californianus to be added to toxicity databases (39). Moreover, as an open water species, M.

californianus may be particularly sensitive to Cu and therefore an appropriate species for the

development of criteria.

Experimental water sample preparation

The experimental treatments will be set up in a factorial cross that tests control and elevated CO2

against increasing concentrations of heavy metals. Mussel embryo-larval cultures will be

incubated at two CO2 concentrations, reflecting current (400 ppm) and future (year 2100

prediction - 800 ppm) conditions in the ocean. For each CO2 concentration, six metal

concentrations (3-20 ppb Cu, 3-30 ppb Cd, 100-250 ppb Zn) will be tested, in addition to a set of

heavy metal-free controls. Each metal by CO2 concentration combination will be assayed across

3 replicate containers, resulting in 21 containers assayed under current pCO2 (ie. 3 metal-free

control replicates, and 3 replicates for each of the 6 metal concentrations), and a similar 21

containers assayed under conditions of elevated pCO2.

The acidification and confirmation of carbonate chemistry will be conducted under the guidance

of the Hutchin’s lab at USC. pH and dissolved inorganic carbon (DIC) will be measured at the

beginning and end of the experiment (T = 0 hrs and T = 48 hrs). Samples for pH will be

collected in 50 mL conical tubes, and samples for DIC will be collected in 25 mL borosilicate

glass vials. The samples used for pH readings will be stored at -20C for later metal chemistry

analysis.

Analysis of metals in the preserved samples will be assayed using the ICP-mass spectrometer in

the laboratory of Prof. James Moffett (USC), using their established methods (40). Prior to the

initiation of the experiments, the starting water samples will be titrated by anodic stripping

voltammetry (ASV) to assess the complexation capacity (41, 42). This will serve to verify that

the sample is not anomalous due to inadvertent contamination by organics.

Mussel embryo-larval toxicity assays

8

Mussel embryo-larval toxicity assays will be performed according to standard EPA protocols

(43). The cultures will be incubated for 48 hrs and then harvested by filtration through a 20 m

sieve, followed by resuspension of the larvae in a known volume of seawater (typically 50 ml).

Then 5x 1 ml sub-samples of the larval suspension will be removed, centrifuged, resuspended in

60% EtOH, and stored for later microscopic analysis of counts for mortality and frequency of

abnormally developing larvae. The count and larval abnormality data will be analyzed by

ANOVA to compare survival and development under normal versus elevated CO2 conditions

across increasing metal exposure regimes. The remaining larval suspension will be centrifuged,

resuspended in RNAlater, and stored at 4C for future molecular analysis. About 50% of the

RNAlater preserved sample will be used for bulk analysis of gene expression and the remainder

used for the picking of normal and abnormal pools of larvae.

RNA sequencing of combined metal and OA stressor experiments

Poly A+ RNA will be isolated from a fraction of the RNAlater-preserved samples that was

equivalent to 500ml of each replicate experimental culture (this has proved to be sufficient larval

material for library construction, Fig. 3). Each experiment will yield 42 samples (2 CO2

concentrations x 7 metal concentrations x 3 replicates). The RNA samples will be fragmented,

reverse-transcribed into cDNA and converted into bar-coded Illumina DNA libraries (44) using

an optimized in-house protocol that is used extensively by the Gracey laboratory. Our standard

RNASeq protocol is to index-barcode each library and to sequence pools of 8-12 libraries per

lane of the Illumina flow cell which yields ~25-16 million reads per library. The 42 libraries per

metal experiment will be pooled and sequenced at the USC Epigenome Facility as single-end 50

bp reads across 5 lanes on the Illumina HiSeq 2000 platform, yielding ~21 million reads per

sample.

The reads will be mapped to our existing M. californianus reference transcriptome using Bowtie

(45) and read-counts per sample calculated using RSEM (46). Differentially expressed genes will

be identified using DESeq (47) employing the reads counts from the 3 replicate cultures as the

biological replicates. The Sigmoidal Dose Response Search (SDRS) grid-based algorithm (48)

will be used to identify a subset of the differentially expressed transcripts whose expression is

correlated with increasing metal exposure over some range of concentrations, as well as the

minimum concentration of metal required to induce differential expression. Other correlations

between gene expression and metal or CO2 concentration, or mortality and developmental

abnormality, will be explored using a variety of emerging data mining procedures such as the

MINE algorithm (49).

Stratified sub-sampling of normal versus abnormal larvae

For each metal assayed under current and elevated CO2 conditions, we will select the metal

concentration that yielded =>40% incidence of abnormal development in both CO2 conditions

(this will ensure that an adequate number of abnormal larvae are represented in the samples from

which larvae will be picked). From each of the replicate samples, we will pick 100 larvae

exhibiting either normal or abnormal development. The larvae will be picked manually using a

microscope, a 20 l micropipette, and an aspirator tube assembly (~60 larvae can be picked per

hour). Corresponding sets of normal and abnormal embryos will also be picked from metal-free

control samples. This will yield a total of 24 samples (3 normal and 3 abnormal larval replicates

x 4 conditions (control/current CO2, control/OA, metal/current CO2, metal/OA)).

9

Total RNA will be isolated from the picked samples and converted into bar-coded Illumina DNA

libraries using a template-switching cDNA synthesis protocol that was developed for single-cell

RNA sequencing (50), with the inclusion of index-barcodes during the final PCR amplification

step. The 24 libraries arising from each experiment collected from each spawn will be pooled

and sequenced as single-end 50 bp Illumina reads across 2 lanes (yielding ~17 million reads per

library). The reads will be mapped and DESeq statistical analysis will be used to identify genes

that differentiate normal versus abnormal larvae as candidate biomarkers of toxic effect and not

just exposure.

Special attention will be placed on genes and pathways that are implicated in the cell stress

response as these may be biomarkers of the deleterious toxic effects of exposure, cellular

damage, and the onset of pathology (37). There will be several ways to interpret these data.

Under one scenario, one could argue that the abnormal larvae will express more markers of stress

because they are exhibiting gross phenotypic evidence of the deleterious effects of the toxicant

exposure, ie. abnormal amorphous development. On the other hand, one can argue that the larvae

that are exhibiting normal development will be the pool which will be expressing cell stress

markers because they have successfully mounted a stress response and are resisting the

deleterious effects of the exposure. Examples of such interpretations have recently been reported

in studies of the response of mature and larval corals to heat stress (51, 52). Thus focus will be

placed on identifying genes and pathways which may serve to differentiate the stress response

from those associated with substantial cellular damage.

Data integration

The statistical outputs of the SDRS algorithm analysis will provide a framework upon which

shifts in the concentration-response kinetics of individual genes can be related to the actual

toxicity of heavy metals under current and OA scenarios as reported by the embryo-larval

toxicity assay. Our prediction is that the transcriptional concentration-response curves reflect

metal toxicity, and that OA will shift these concentration-response curves to the left - that is to

say that concentration of metal that induces a transcriptional response will be lowered. Thus,

genes with concentration-response curves that shift to the left may reveal genes and pathways

that are more sensitive to the metal contaminant under future OA scenarios, and clues as to the

nature of the synergistic effects that occur between heavy metals and OA.

The provision of lists of candidate biomarkers of effect provides a layer of information across

which the concentration-response results can be interpreted. For example, characterization of the

minimum metal concentration at which biomarkers of effect are differentially expressed would

provide insights into the concentration at which the deleterious effects of exposure are first felt

by the organism. The table below depicts some interpretations that can be derived from the

comparison of expression in normal versus abnormal larvae, with asterisks indicating the relative

expression of genes across the samples.

10

Cu free Control Normal

Cu free Control

Abnormal

Cu + Control Normal

Cu + Control

Abnormal

Cu + OA

Normal

Cu + OA

Abnormal Interpretation

* *** * *** * *** Genes associated with

natural abnormal development

* * * *** * *** Genes associated with toxicity-linked abnormal

development

* * *** *** *** *** Genes associated with Cu

exposure

* * * * *** *** Genes associated with OA

exposure

Collaboration at USC

We will collaborate on this project with two other scientists at USC. Prof. David Hutchins is an

ocean chemist with expertise in ocean acidification (53). He has experience designing and

advising multiple experiments in which accurate preparation and measurement of pH and other

carbonate chemistry parameters are integral (5, 6, 54, 55). Please see the attached letter of

support for more detail. Our other long-term collaborator, and co-advisor of the nominated

trainee, Prof. James Moffett, will assist in the analysis of metal concentrations in the treatment

water samples. Research space will be provided by the Wrigley Marine Science Center on

Catalina Island.

10. RELATED RESEARCH

Toxicity responses of adult mussels

We investigated the molecular changes associated with exposure of adult M. californianus to

heavy metals in a USC SeaGrant project titled ‘Contaminant stressor response in Mytilus using

genomics: mussel monitoring for the new millennium’. Toxicity assays in other disciplines such

as drug discovery rely heavily on the study of concentration-response curves to characterize the

activities of a particular compound on the biology of the test organism. Concentration-response

approaches are invaluable because they can define the level of the compound required to produce

a response, as well as the levels associated with the half-maximal and maximal responses. We

adopted a similar approach to Cu toxicity testing, working on the hypothesis that increasing Cu

exposure will be associated with increasing levels of cytotoxicity which in turn would give rise

to ever more complex transcriptional responses.

11

Figure 2. Transcriptional profiling of the concentration response of adult M. californianus to copper.

Heatmaps of 572 induced (A) and 323 repressed (B) genes that exhibited a statistically significant sigmoidal

transcriptional response. Each row corresponds to a single gene and each column corresponds to a particular

concentration of copper. The average expression of each gene at each concentration is represented by a color, with

yellow or blue indicating that the gene is up-regulated or down-regulated relative to the expression observed in

control mussels. The genes are ranked and grouped according to their observed expression half maximal induction

value, with more responsive transcripts located at the top of each heatmap. Selected genes whose expression may be

pertinent to the response to copper are indicated next to each grouping. (C) Example of the transcriptional dose

response profile of Zinc transporter ZIP12 indicating the lowest dose of copper that induced the expression of this

transcript (Low), and the dose that induced the half-maximal induction of the transcript (HalfMax). The data are

presented as the median expression standard deviation of the transcript from microarray data collected from 3

replicate mussels at each concentration. (D) Example profiles of other transcripts that exhibited sigmoidal

concentration-response profiles. (E) Histogram of induced and repressed transcripts showing the frequency of

minimum and HalfMax Cu concentrations at 5 g/L intervals.

Copper (g/L)

0 20 40 60 80 100 120

-2.5

-2.0

-1.5

-1.0

-0.5

0.0

0.5

1.0

0 20 40 60 80 100 120

-1

0

1

2

3

4

5

0 20 40 60 80 100 120

-1

0

1

2

3

4

HalfMax

20-29

30-39

40-49

50-59

60-69

70-79

80-89

1-19

20-29

40-49

30-39

50-59

60-69

70-79

80-89

0 3 6 9 15

30

60

90

120

A

B

>2

Relative expression

<0.5 1

Transcription intermediary factor α

Transcription intermediary factor β

Apoptosis inducing factor 3

Programmed cell death protein 4

Transcription intermediary factor 1-β

Centriolin

Caspase 7

Adenosine deaminase

Adenylate kinase 5

Adenylosuccinate synthetase isozyme 2

Nicotinamidephosphoribosyltransferase

Transcription intermediary factor 1-α

G1/S-specific cyclin-D2

Centrosome associated protein CEP25

Centrosomal protein of 135KDa

Caspase 3

Myc proto-onco gene

Pim-1 proto-onco gene

DNAJ homolog C12

Baculoviral IAP repeat-containing protein 2

Baculoviral IAP repeat-containing protein 3

Inositol-3-phosphate synthase

DNA damage-regulated autophagy modulator protein 2

Growth arrest and DNA damage-inducible protein GADD45

Thioredoxin reductase

Cell division control protein 42 homolog

Cyclic AMP-responsive element-binding protein 1

Cell division cycle protein 123 homolog

Zinc transporter ZIP12

Heat shock factor protein 1

Glutaredoxin-1

T-complex protein 1 subunit alpha

Glutathione S-transferase Mu 4

Growth arrest and DNA damage-inducible protein GADD45

T-complex protein 1 subunit delta

T-complex protein 1 subunit eta

Ferric-chelate reductase 1

Sequestosome-1

Stress-induced-phosphoprotein 1

Peroxiredoxin-1

Hsp70-binding protein 1

Glutamate--cysteine ligase catalytic subunit

10 kDa heat shock protein, mitochondrial

T-complex protein 1 subunit beta

Cyclic AMP-dependent transcription factor ATF-3

Glutathione S-transferase omega-1

Alpha-crystallin A chain

Alpha-crystallin B chain

Glutathione S-transferase A2

Glutamate--cysteine ligase regulatory subunit

Tubulin beta-2B chain

Tubulin beta-2C chain

Tubulin alpha-3C/D chain

D

Hsp70B2

Low=37 g/L

HalfMax=79 g/L

Sequestosome 1

Low=43 g/L

HalfMax=116 g/L

C

0 20 40 60 80 100 120

-0.5

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

Zinc transporter ZIP12

Low=19 g/L

HalfMax=63 g/L

Copper (g/L)

Rela

tive

mR

NA

exp

ressio

n (

log

2)

0 20 40 60 80 100 120

-1.2

-1.0

-0.8

-0.6

-0.4

-0.2

0.0

0.2

0.4

0.6G1/S-specific cyclin-D2

Low=15 g/L

HalfMax=29 g/L

Adenylosuccinate

synthetase 2

Low=31 g/L

HalfMax=69 g/L

E

Rela

tive

mR

NA

exp

ressio

n (

log

2)

Copper (g/L)

Peroxisome proliferator-activated receptor alpha

T-complex protein 1 subunit epsilon

T-complex protein 1 subunit theta

S-adenosylmethionine synthase 1

Peroxisomal acyl-coenzyme A oxidase 1

Multidrug resistance protein 1

cAMP-responsive element-binding protein-like 2

Heat shock-related 70kDa protein 2

90-99

0

20

40

60

80

100

120

Tra

nscri

pt fr

eq

ue

ncy

0

10

20

30

40

50

60

70

Bin center (g/L Cu)

2.5

7.5

12.5

17.5

22.5

27.5

32.5

37.5

42.5

47.5

52.5

57.5

62.5

67.5

72.5

77.5

82.5

87.5

92.5

Low dose

HalfMax

Induced

Repressed

12

Adult mussels were exposed for 24 hrs to increasing concentration of Cu in 2L containers. To

ensure that Cu concentrations were not depleted during the experiment, the water was replaced

every 4 hrs with fresh seawater adjusted to the appropriate Cu concentration. After 24 hrs total

RNA from gill tissue was isolated from 3 mussels incubated at each dose, converted to amplified

RNA, and hybridized to M. californianus cDNA microarrays. ANOVA identified 1,012 genes

that show a show statistically significant difference in expression between doses (p<0.01, FDR

corrected). In total, 413 genes were down-regulated in response to copper and 599 were up-

regulated. Transcripts that exhibited a concentration-response relationship were identified with

the SDRS algorithm (48), revealing that 95% (572/599) of the induced transcripts, and 78%

(323/413) of the repressed transcripts, exhibited an expression profile that fitted a sigmoidal

concentration-response curve to copper. Ranking the transcripts according to the effective

concentration of copper that elicited a half-maximal induction of the transcript serves to

highlight the range of responses of individual transcripts to copper (Figs. 2A & 2B). Inspection

of the concentration-response profiles of individual genes further illustrates the sigmoidal nature

of the transcriptional response to copper (Figs. 2C & 2D). An important conclusion that can be

drawn from these data is that exposure to Cu induces proportional changes in the transcriptome,

and that the abundance of specific transcripts is a function of the concentration of Cu.

Of particular relevance to toxicity testing, the SDRS algorithm reports the minimum Cu

concentration that induced a transcriptional response for each gene. A plot of the frequency

distribution of the minimum Cu concentration for both induced and repressed transcripts (Fig.

2E) showed that transcript repression tends to occur at lower concentrations of copper than

transcript induction. For example, the mode for the minimum concentration of copper required to

reduce transcript levels occurred at 12.5 g/L, whereas the mode for induced transcripts occurred

at 22.5 g/L. The list of Cu-induced transcripts included many genes associated with the

oxidative stress response such as Thioredoxin reductase 3, Peroxiredoxin, Glutaredoxin, and 3

isoforms of Glutathione S-transferase, consistent with the known deleterious effects of copper on

mitochondrial function (56, 57). We observed evidence of increasing proteotoxic stress as dose is

increased with T-complex protein chaperones induced at 22 g/L, Heat shock protein 70

isoforms induced at 35 g/L, and Sequestosome 1 induction at 41 g/L. Detection of hierarchical

series of stress responses provides compelling insights into toxicity and damage thresholds.

Toxicity responses of embryo-larval mussels

It should be noted that adult mussels are far more tolerant to copper than their larvae and that the

EPA Cu testing criteria is based upon toxicity to larvae (43). Therefore, Megan Hall, the

graduate student who is the nominated trainee for this proposal, has conducted a series of Cu

toxicity assays reproducing conditions of the standard EPA embryo-larval development assay.

Larvae were exposed to increasing concentrations of Cu and at the end of the 48 hr exposure

period, larval survival and development were quantified. Survival and normal development

declined at similar Cu concentrations to those in assays by EPA testing facilities (Fig. 1).

Increases in amorphous, deformed larvae, which characterize an “abnormally developed” animal,

are easily detected via visual microscopic analysis. This experiment was conducted in triplicate,

with a different pair of parents contributing the larvae to each trial.

Megan also collected additional samples of larvae from these experiments for gene expression

analysis. Samples from the first two trials were processed for barcoded RNAseq analysis and

13

were sequenced across two lanes of an Illumina HiSeq 2000 instrument. Analysis of read count

expression data revealed that gene expression profiles were closely correlated to Cu exposure

(Fig. 3A), with some genes induced or repressed at low concentrations (~2-3.1 g/L), and others

induced or repressed at higher concentrations (~10-25 g/L). The majority of genes showed

similar patterns of differential expression across the two trials (Fig. 3B). Megan is currently

writing a thesis chapter and an accompanying manuscript that compares and contrasts the

concentration-response kinetics of the adult and embryo-larval molecular response to Cu

exposure.

Figure 3. Transcriptional profiling of the concentration response of larval M. californianus to copper. (A)

Example of a heat map of copper-responsive genes collected under US EPA embryo-larval toxicity assay conditions.

Increasing intensity of yellow or blue color indicates transcripts whose abundance increased or decreased

respectively in response to Cu exposure. Columns represent increasing Cu concentrations (g/L), and each row

represents a different gene.. B) Examples of consistent gene expression profiles between two replicate trials of the

assay. Solid lines represent the first trial, and dashed lines represent the second trial, and represent data collected

from independent spawns.

Mussel embryo-larval toxicity assays under OA

This proposal is a natural progression of a 1 year student thesis project, “Predicting the Effects of

Copper Toxicity and Ocean Acidification on Marine Invertebrates”, funded by CA SeaGrant

(02/01/15-01/31/16), which will effectively prime the activities in the project proposed here. This

project is funding a pilot transcriptional profile of a standard mussel embryo-larval toxicity assay

of copper under elevated CO2 concentrations, followed by corroboration in ‘real-world’ samples,

achieved by running toxicity assays on Marina Del Rey Harbor water samples under acidified

conditions. It will also investigate the utility of extended toxicity assays for providing long-term

insights into the effects of copper and OA on larval health.

Histone Deacetylase Zinc Finger; C2H2-type

Sequestosome Glycoside hydrolase

HSP 70 Proteasome

0 2 3.1 4 6 8 10 15 20 25

-2

0

2

4

6

8

10

0 5 10 15 20

Fold

Cha

nge

in g

ene

expr

essi

on (L

og 2

)

-1

-0.5

0

0.5

1

1.5

2

2.5

3

0 5 10 15 20

Cu +2 (μg/L)-2

0

2

4

6

8

10

12

14

0 5 10 15 20

Fold

Cha

nge

in g

ene

expr

essi

on (L

og 2

)

Cu +2 (μg/L)

-5

-4

-3

-2

-1

0

1

0 5 10 15 20

-2

0

2

4

6

8

10

0 5 10 15 20

Fold

Ch

an

ge

in g

en

e

expr

essi

on (L

og 2

)A B

-4

-3

-2

-1

0

1

0 5 10 15 20

14

11. BUDGET RELATED INFORMATION

A. Budget Explanation/Justification.

SALARIES:

As project leader, the PI will be heavily involved in the day-to-day operation of this project.

Gracey will spend 1.4 and 1.6 months of effort on this project in years 1 and 2, and requests 0.25

months of summer salary support per year from USC SeaGrant. One Sea Grant Research Trainee

is requested for the 2 year duration of this project to work exclusively on all aspects of this

project, which will contribute towards her doctoral dissertation. The trainee proposed is Megan

Hall, a 4th year graduate student in the Gracey lab, to be the student associated with this project.

She has generated all of the supporting larval toxicity data for this proposal.

EXPENDABLE SUPPLIES AND EQUIPMENT:

RNA sequencing

Using our optimized protocols, each RNA sample costs about $50 to process through to a

quality-checked and titrated Illumina sequencing library. RNA sequencing will be performed at

the USC Epigenome Center Data Production Facility at an institutional discount rate of $1,300

per lane of 50 bp of single-end reads. With accurate titration we consistently obtain >200 million

reads per lane. For each metal we will sequence 42 libraries from the concentration-response/OA

experiment and 24 samples of normal/abnormal picked larvae, across 7 Illumina lanes. Therefore

the cost for expression analysis per metal is ($1,300 x 7) + ($50 x 66) = $12,400, x 3 metals =

$37,200

Bottled gases

We request $500 per year to cover the cost of compressed gases and other expendable supplies

for ICP-MS analysis, and the defined CO2 gas mixtures for larva-embryo toxicity assay.

Laboratory supplies

Funds of $1,000 per year are requested for laboratory supplies and chemicals necessary to

undertake the molecular biology and toxicity testing components of this project (plastic

consumables @ $500, gases, chemicals & reagents @ $250, oligonucleotides and qRT-PCR

reagents @ $250)

TRAVEL:

Funds of $500 per year are requested to cover the costs of the collection of water samples,

mussel broodstock, and local outreach activities. Funds of $3,000 in year 2 are requested towards

travel, accommodation, and registration for Gracey and the Sea Grant Trainee to attend one

Northern American Society of Environmental Toxicology and Chemistry (SETAC) meeting. The

trainee will present a poster and Gracey will communicate our results in an oral presentation.

PUBLICATION COSTS AND DATA DISTRIBUTION:

We request $2,000 to cover page charges associated with publishing our research in high quality

scientific journals in both years of the project. We request $1,000 to cover the cost to hosting

1Terabyte of data at the USC Digital Repository.

B. Matching Funds.

Gracey will spend 1.15 and 1.35 months of effort on this project in each academic year supported

on his academic salary and this will be contributed by USC as cost sharing. This constitutes

$22,680 and $26,154 in years 1 and 2 respectively.

12. ANTICIPATED BENEFITS

The proposed research will be timely and important for addressing several key issues facing

coastal ecosystems of California. Ocean acidification is expected to have notable effects on

15

contaminant speciation and bioavailability, so it will likely influence the concentration of metals

that trigger toxic responses. This information will be vital to policy-makers, scientists, and the

general public. From a biological perspective, it is invaluable to gain insight into the

physiological and ecological effects of ocean acidification and contaminant metals in marine

ecosystems. Data will contribute to the growing body of research on biological responses to

multiple stressors, and inform future studies that attempt to investigate other issues concerning

metal toxicity and ocean acidification. Most importantly, policy-makers will be able to set limits

for metal pollution that protect sensitive members of local marine ecosystems under dynamic

ocean conditions. Regulators must set contaminant limits that account for other important aspects

of water chemistry. According to the results of our study, and needed investigations into other

contaminants of concern, regulatory limits can be adjusted appropriately and in a timely fashion

to meet the challenges that a changing global ocean presents.

The research described here focuses on contaminants and sites in southern California, but the

approach could be applied to any receiving waters and any contaminant nationwide. The

proposed work strives to more accurately assess coastal water quality, and will thus result in an

improved ability to manage contaminant levels effectively. Reconsidering water quality criteria

is especially important in a changing global ocean, where we must measure and define toxicity

when there are numerous dynamic parameters at play. In order to ultimately predict how multiple

stressors may interact, we need to understand the fundamental effects of stressors by interpreting

their effects on specific biochemical pathways. By examining toxicity in the presence of multiple

stressors, and analyzing the fundamental physiological changes that occur, this research will

facilitate this understanding.

The benefit of incorporating gene expression measurements—a relatively new technology—into

standard toxicity testing could be remarkable. This technology has the potential to make water

quality toxicity testing faster, cheaper, and more reliable, as the laborious process of identifying

morphological abnormalities and counting larvae would be unnecessary, and individual

subjectivity in counts would be more or less eliminated. We have already entered discussions

with other non-academic research groups and environmental consulting agencies in the southern

California area that are interested in incorporating transcriptional profiling into their toxicity

testing. We intend to continue these talks and branch out to other parties, such as regional water

quality control boards, who may benefit from using this kind of tool. Ultimately, transcriptional

profiling could allow us to retrieve a specific gene expression profile, and be able to determine

which contaminants (or combination of contaminants) an organism has been exposed to, and

how severe that exposure has been. This kind of tool would provide substantial power for rapidly

identifying toxins in coastal ecosystems, and thus quickly disseminating warnings for fisheries,

shellfish farmers, and the general public.

Locally, we will work closely with researchers at the Southern California Coastal Water

Research Project (SCCWRP) – see attached letter of support. They play a pivotal role in advising

water quality management issues in southern California and are heavily involved in the ongoing

discussions regarding the future cleanup of copper from Marina del Rey Harbor. We will share

our findings with them and will assist in the molecular characterization of our identified

biomarkers in their collected Marina del Rey harbor water samples.

16

13. COMMUNICATION OF RESULTS

We will present our findings at both the local and national Society of Environmental Toxicology

and Chemistry (SETAC) meetings. These are important forums at which academic as well as

environmental and governmental agencies are represented. To reach the broader public in LA,

we propose to participate in the Aquarium of the Pacific’s “Urban Ocean Festival”, as a venue

for informing the public of some of the unanticipated challenges which climate change poses to

impacted coastal ecosystems. We will work with Dave Bader of the aquarium to devise an

appropriate educational output of our results. We will also explore a similar effort at the

California Science Center that is located adjacent to USC.

The trainee will also pursue a range of outreach initiatives. First, she will organize a mini

seminar series with the Long Beach Marina Boat Owners Association and the Del Rey yacht

club to discuss the costs and benefits of switching to copper-free non-toxic antifouling paints.

She will also use this as an opportunity to poll boaters on how they view the copper problem in

Marina del Rey and other California harbors, and try to develop cost-effective solutions with

them. She will also collaborate with a citizen science group associated with LA Makerspace that

she has worked with previously. With this group she will organize a quarterly (every 3 months)

toxicology workshop, and bring citizen scientists to the field to experience a day in the life of a

marine toxicologist. They will collect water samples, and even spawn mussels to go through the

assay set-up. This exercise will also be documented by video recording on Periscope, a live

streaming app for smartphones and computers. This will allow any viewers following her on

Twitter and Facebook to access the link, and get to witness the citizen science activities in action.

14. REFERENCES

1. Millero FJ, Woosley R, Ditrolio B, & Waters J (2009) Effect of ocean acidification on the

speciation of metals in seawater. Oceanography 22(4):72-85.

2. Gruber N, et al. (2012) Rapid progression of ocean acidification in the California Current

System. Science 337(6091):220-223.

3. Capone DG & Hutchins DA (2013) Microbial biogeochemistry of coastal upwelling

regimes in a changing ocean. Nat Geosci 6(9):711-717.

4. Boyd PW, Strzepek R, Fu F, & Hutchins DA (2010) Environmental control of open-

ocean phytoplankton groups: Now and in the future. Limnol. Oceanogr. 55(3):1353-1376.

5. Gao K, Helbling EW, Häder DP, & Hutchins DA (2012) Responses of marine primary

producers to interactions between ocean acidification, solar radiation, and warming. Mar

Ecol Prog Ser 470:167-189.

6. Gao K, et al. (2012) Rising CO2 and increased light exposure synergistically reduce

marine primary productivity. Nature Clim Change 2(7):519-523.

7. Hoffmann LJ, Breitbarth E, Boyd PW, & Hunter KA (2012) Influence of ocean warming

and acidification on trace metal biogeochemistry. Mar Ecol Prog Ser 470:191-205.

8. Roberts DA, et al. (2013) Ocean acidification increases the toxicity of contaminated

sediments. Global Change Biol 19(2):340-351.

9. Lewis C, Clemow K, & Holt WV (2012) Metal contamination increases the sensitivity of

larvae but not gametes to ocean acidification in the polychaete Pomatoceros lamarckii

(Quatrefages). Mar Biol 160(8):2089-2101.

17

10. Fitzer SC, Caldwell GS, Clare AS, Upstill-Goddard RC, & Bentley MG (2013) Response

of copepods to elevated pCO2 and environmental copper as co-stressors--a

multigenerational study. PLoS One 8(8):e71257-e71257.

11. Han Z, Wu DD, Wu J, Lv C, & Liu Y (2014) Effects of ocean acidification on toxicity of

heavy metals in the bivalve Mytilus edulis L. Synth React Inorg M 44(133-139).

12. SCCWRP (2014)

http://www.sccwrp.org/ResearchAreas/Stormwater/CharacterizationOfDry-

WeatherMetalsAndBacteria.aspx.

13. Smail EA, Webb EA, Franks RP, Bruland KW, & Sanudo-Wilhelmy SA (2012) Status of

metal contamination in surface waters of the coastal ocean off Los Angeles, California

since the implementation of the Clean Water Act. Environ Sci Technol 46(8):4304-4311.

14. Melwani AR, et al. (2013) Mussel Watch monitoring in California: Long-term trends in

coastal contaminants and recommendations for future monitoring. in SFEI Contribution

#685 (Surface Water Ambient Monitoring Program, Richmond, California).

15. Lyon GS & Stein ED (2009) How effective has the Clean Water Act been at reducing

pollutant mass emission to the Southern California Bight over the last 35 years. Environ

Monit Assess 154:413-426.

16. McPherson TN, et al. (2005) Trace metal pollutant load in urban runoff from a Southern

California watershed. J Env Eng:1073-1080.

17. Schiff K, Bay, S., Diehl, D. (2003) Stormwater toxicity in Chollas Creek and San Diego

Bay, California. Environmental Monitoring and Assessment 81:119-132.

18. Schiff K, Brown, J., Diehl, D., Greenstein, D. (2007) Extent and magnitude of copper

contamination in marinas of the San Diego region, California. USA Marine Pollution

Bulletin 54:322-328.

19. USEPA (2003) Notice of availability of draft aquatic life criteria document for copper

and request for scientific views (Fed. Regist., Washington D.C., USA), (Agency USEP).

20. Rivera-Duarte I, Rose, G., Chadwick, B., Padilla, L., Zirino, A. (2005) Copper Toxicity

to Larval Stages of Three Marine Invertebrates and Copper Complexation Capacity in

San Diego Bay, California. Environ. Sci. Technol 39:1542-1546.

21. Kurihara H, Asai T, Kato S, & Ishimatsu a (2008) Effects of elevated pCO on early

development in the mussel Mytilus galloprovincialis. Aquatic Biol 4(January):225-233.

22. Bibby R, Widdicombe S, Parry H, Spicer J, & Pipe R (2008) Effects of ocean

acidification on the immune response of the blue mussel Mytilus edulis. Aquatic Biol

2(April):67-74.

23. Gaylord B, et al. (2011) Functional impacts of ocean acidification in an ecologically

critical foundation species. J Exp Biol 214(Pt 15):2586-2594.

24. Fitzer SC, Phoenix VR, Cusack M, & Kamenos NA (2014) Ocean acidification impacts

mussel control on biomineralisation. Scientific reports 4:6218.

25. O'Donnell MJ, George MN, & Carrington E (2013) Mussel byssus attachment weakened

by ocean acidification. Nat Clim Change 3:587-590.

26. Pan TC, Applebaum SL, & Manahan DT (2015) Experimental ocean acidification alters

the allocation of metabolic energy. Proc Natl Acad Sci U S A 112(15):4696-4701.

27. Dodd JR (1964) Environmentally controlled variation in the shell structure of a

Pelecypod species. J Paleo 38(6):1065-1071.

28. US-EPA (2007) Toxicity Testing in the 21st Century: A Vision and a Strategy.

18

29. Snell TW, Brogdon SE, & Morgan MB (2003) Gene expression profiling in

ecotoxicology. Ecotoxicology 12(6):475-483.

30. Brown PO & Botstein D (1999) Exploring the new world of the genome with DNA

microarrays. Nat Genet 21:33-37.

31. Heckmann LH, et al. (2008) Systems biology meets stress ecology: linking molecular and

organismal stress responses in Daphnia magna. Genome Biol 9(2):R40.

32. Vinken M (2013) The adverse outcome pathway concept: a pragmatic tool in toxicology.

Toxicology 312:158-165.

33. Villeneuve DL, et al. (2014) Adverse outcome pathway (AOP) development I: strategies

and principles. Toxicol Sci 142(2):312-320.

34. Forbes VE, Palmqvist A, & Bach L (2006) The use and misuse of biomarkers in

ecotoxicology. Environ Toxicol Chem 25(1):272-280.

35. National Research Council (U.S.). Committee on Toxicity Testing and Assessment of

Environmental Agents. (2007) Toxicity testing in the 21st century : a vision and a

strategy (National Academies Press, Washington, DC) pp xvii, 196 p.

36. Simmons SO, Fan CY, & Ramabhadran R (2009) Cellular stress response pathway

system as a sentinel ensemble in toxicological screening. Toxicol Sci 111(2):202-225.

37. Kultz D (2005) Molecular and evolutionary basis of the cellular stress response. Annu

Rev Physiol 67:225-257.

38. Hilbish TJ, et al. (2000) Origin of the antitropical distribution pattern in the marine

mussels (Mytilus spp.): Routes and timing of transequatorial migration. Mar Biol 136:69-

77.

39. Arnold WR, Cotsifas JS, Smith DS, Le Page S, & Gruenthal KM (2009) A comparison of

the copper sensitivity of two economically important saltwater mussel species and a

review of previously reported copper toxicity data for mussels: important implications for

determining future ambient copper saltwater criteria in the USA. Environ Toxicol

24(6):618-628.

40. Jacquot JE, Kondo Y, Knapp AN, & Moffett JW (2013) The speciation of copper across

active gradients in nitrogen-cycle processes in the eastern tropical South Pacific. Limnol.

Oceanogr. 58(4):1387-1394.

41. Andrade S, Moffett JW, & Correa J (2006) Distribution of dissolved species and

suspended particulate copper in an intertidal ecosystem affected by copper mine tailings

in Northern Chile. Mar Chem 101(3-4):203-212.

42. Hurst M & Bruland KW (2005) The use of Nafion-coated thin mercury film electrodes

for the determination of the dissolved copper speciation in estuarine water. Analytica

Chimica Acta 546:68-78.

43. US-EPA (1995) Short-term methods for estimating the chronic toxicity of effluents and

receiving waters to west coast marine and estuarine organisms pp EPA/600/R-695/136.

44. Mortazavi A, Williams BA, McCue K, Schaeffer L, & Wold B (2008) Mapping and

quantifying mammalian transcriptomes by RNA-Seq. Nat Methods 5(7):621-628.

45. Langmead B (2010) Aligning short sequencing reads with Bowtie. Curr Protoc

Bioinformatics Chapter 11:Unit 11 17.

46. Li B, Ruotti V, Stewart RM, Thomson JA, & Dewey CN (2010) RNA-Seq gene

expression estimation with read mapping uncertainty. Bioinformatics 26(4):493-500.

47. Anders S & Huber W (2010) Differential expression analysis for sequence count data.

Genome Biol 11(10):R106.

19

48. Ji RR, et al. (2009) Transcriptional profiling of the dose response: a more powerful

approach for characterizing drug activities. PLoS Comput Biol 5(9):e1000512.

49. Reshef DN, et al. (2011) Detecting novel associations in large data sets. Science

334(6062):1518-1524.

50. Trombetta JJ, et al. (2014) Preparation of Single-Cell RNA-Seq Libraries for Next

Generation Sequencing. Current protocols in molecular biology / edited by Frederick M.

Ausubel ... [et al.] 107:4 22 21-24 22 17.

51. Barshis DJ, et al. (2013) Genomic basis for coral resilience to climate change. Proc Natl

Acad Sci U S A 110(4):1387-1392.

52. Dixon GB, et al. (2015) CORAL REEFS. Genomic determinants of coral heat tolerance

across latitudes. Science 348(6242):1460-1462.

53. Hutchins DA, Mulholland MR, & Fu F (2009) Nutrient Cycles and Marine Microbes in a

CO2-Enriched Ocean. Oceanography 22(4):128-145.

54. Beman JM, et al. (2011) Global declines in oceanic nitrification rates as a consequence of

ocean acidification. Proc Natl Acad Sci U S A 108(1):208-213.

55. Tatters AO, Fu F, & Hutchins DA (2012) High CO2 and silicate limitation synergistically

increase the toxicity of Pseudo-nitzschia fraudulenta. PLoS One 7(2):e32116-e32116.

56. Ozcelik D, Ozaras R, Gurel Z, Uzun H, & Aydin S (2003) Copper-mediated oxidative

stress in rat liver. Biol Trace Elem Res 96(1-3):209-215.

57. Vulpe CD & Packman S (1995) Cellular copper transport. Annu Rev Nutr 15:293-322.

PROJECTED WORK SCHEDULE Project Title: DISTINGUISHING EXPOSURE FROM EFFECT IN MULTIPLE-STRESSOR SCENARIOS: EFFECTS OF OCEAN ACIDIFICATION AND METAL-TOXICITY ON MUSSEL LARVAL DEVELOPMENT

Activities 2016-2017 F M A M J J A S O N D J

Metal 1 Embryo-larval toxicity assay

X X X

Metal 1 Gene expression analysis

X X X

Metal 1 Normal versus abnormal larvae analysis

X X X

Metal 2 Embryo-larval toxicity assay

X X X

Metal 2 Gene expression analysis

X X

Metal 2 Normal versus abnormal larvae analysis

Data analysis and integration and writeup

X X X

Page 1

Activities 2017-2018 F M A M J J A S O N D J

Metal 2 Gene expression analysis

X

Metal 2 Normal versis abnormal larvae analysis

X X X

Metal 3 Embryo-larval toxicity assay

X X X

Metal 3 Gene expression analysis

X X X

Metal 3 Normal versus abnormal larvae analysis

X X

Data analysis and integration and writeup

X X X x x x x x x

OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: USC SeaGrant GRANT/PROJECT NO.:

DURATION (months 2402/01/2016 - 01/31/2017

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: 1 1.4 3,736 17,300b. Associates (Faculty or Staff):

Sub Total: 1 1.4 3,736 17,300

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians:h. Other:

Total Salaries and Wages: 1 1.4 3,736 17,300

B. FRINGE BENEFITS: 31.1% 1,162 5,380Total Personnel (A and B): 4,898 22,680

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT: 20,100

E. TRAVEL:1. Domestic 5002. International

Total Travel: 500 0

F. PUBLICATION AND DOCUMENTATION COSTS: 2,000

G. OTHER COSTS:1234567

Total Other Costs: 0 0

TOTAL DIRECT COST (A through G): 27,498 22,680

INDIRECT COST (On campus 65% ): 2291.4913 17,816 0INDIRECT COST (Off campus % of $ ):

Total Indirect Cost: 17,816 0

TOTAL COSTS: 45,314 22,680

PRINCIPAL INVESTIGATOR: Andrew Gracey

BRIEF TITLE: OCEAN ACIDIFICATION AND METAL TOXICITY IN MUSSEL

OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: USC SeaGrant GRANT/PROJECT NO.:

DURATION (months 2402/01/2017 - 01/31/2018

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: 1 1.6 3,848 19,950b. Associates (Faculty or Staff):

Sub Total: 1 1.6 3,848 19,950

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians:h. Other:

Total Salaries and Wages: 1 1.6 3,848 19,950

B. FRINGE BENEFITS: 31% 1,197 6,204Total Personnel (A and B): 5,045 26,154

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT: 20,100

E. TRAVEL:1. Domestic 3,5002. International

Total Travel: 3,500 0

F. PUBLICATION AND DOCUMENTATION COSTS: 2,000

G. OTHER COSTS:1 Data storage 1,000234567

Total Other Costs: 1,000 0

TOTAL DIRECT COST (A through G): 31,645 26,154

INDIRECT COST (On campus 65%): 65% 20,569 0INDIRECT COST (Off campus of $ ):

Total Indirect Cost: 20,569 0

TOTAL COSTS: 52,214 26,154

PRINCIPAL INVESTIGATOR: Andrew Gracey

BRIEF TITLE: OCEAN ACIDIFICATION AND METAL TOXICITY IN MUSSEL

BRIEF CURRICULUM VITAE

NAME Andrew Y. Gracey

ADDRESS Marine Environmental Biology, University of Southern California, 3616

Trousdale Parkway #107, Los Angeles, CA 90089

PHONE (work) 213-740 2288 (cell) 408-425 9397 EMAIL gracey@usc.edu

EDUCATION

University of Liverpool, UK: B.Sc. with Honors in Marine Biology—1991

University of Liverpool, UK: Ph.D. in Comparative & Molecular Physiology—1996

International Institute of Genetics & Biophysics, Naples, Italy: Postdoctoral study—1995-1996

Stanford University: Postdoctoral study: physiology—1997-2000

University of Liverpool: Postdoctoral study: physiology—2000-2002

POSITIONS HELD

Stanford University: Research Associate professor: physiology—2002-July 2005

University of Southern California: Assistant professor, Biological Sciences—Aug 2005-Apr

2012

University of Southern California: Associate professor, Biological Sciences—Apr 2012-present

SELECTED PUBLICATIONS

1. Tiku, P.E., Gracey, A.Y., Macartney, A.I., Beynon, R.B. and Cossins, A.R. (1996) Cold-

inducible expression of desaturase by transcriptional and post-translational mechanisms.

Science, 271: 815-818.

2. Gracey, A.Y., Troll, J. and Somero, G.N. (2001) Hypoxia-induced expression profiling

in the euryoxic fish Gillichthys mirabilis. Proc. Natl. Acad. Sci. USA, 94: 1993-1998.

3. Gracey, A.Y. and Cossins, A.R. (2003) Application of microarray technology in

environmental and comparative physiology. Annu. Rev. Physiol., 65: 231-59.

4. Gracey, A.Y., Fraser, E. J., Li, W., Fang, Y., Taylor, R. R., Rogers, J., Brass, A. and

Cossins, A. R. (2004) Coping with cold: An integrative, multitissue analysis of the

transcriptome of a poikilothermic vertebrate. Proc. Natl. Acad. Sci. USA, 101: 16970-

16975.

5. Williams, D., Epperson, L., Li, W., Hughes, M., Taylor, R. R., Rogers, J., Martin, S.,

Cossins, A. R. and Gracey, A.Y. (2005) Seasonally hibernating phenotype assessed

through transcript screening. Physiol. Genomics, 24: 13-22.

6. Fraser, E. J., Vieira de Mello, L. Ward, D., Rees, H., Williams, D., Fang, Y., Brass, A.,

Gracey, A.Y. and Cossins, A.R. (2006) Hypoxia-inducible myoglobin expression in non-

muscle tissues. Proc. Natl. Acad. Sci. USA, 103: 2977-2981.

7. Murray, P., Hayward, S.A., Govan, G.G., Gracey, A.Y. and Cossins, A.R. (2007) An

explicit test of the phospholipid saturation hypothesis of acquired cold tolerance in

Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA, 104: 5489-5494.

8. Gracey, A.Y., Chaney, M. L., Boomhower, J., Tyburczy, W., Connor, K. and Somero, G.

N. (2008) Rhythms of gene expression in a fluctuating intertidal environment. Current

Biol., 18, 1501-1507.

9. Chaney, M. L. and Gracey, A.Y. (2011) Mass mortality in Pacific oysters is associated

with a specific gene expression signature. Mol. Ecol., 20, 2942-2954.

10. Gracey, A.Y., Lee, B., Higashi, R. and Fan, T (2011) Hypoxia-induced mobilization of

triglycerides in the euryoxic goby, Gillichthys mirabilis. J. Exp. Biol., 214, 3005-3012.

11. Connor, K.M. and Gracey, A.Y. (2011) Circadian cycles are the dominant transcriptional

rhythm in the intertidal mussel Mytilus californianus. Proc. Natl. Acad. Sci. USA, 108,

16110-16115.

12. Connor, K. M. and Gracey, A.Y. (2012) High resolution analysis of metabolic cycles in

the intertidal mussel Mytilus californianus. Am. J. Phys-Reg. I. 302(1), R103-11.

13. Nydam, M.L., Netuschil, N., Sanders, E., Langenbacher, A., Lewis, D.D., Taketa, D.A.,

Marimuthu, A., Gracey, A.Y. and De Tomaso, A.W. (2013) The candidate

histocompatibility locus of a basal chordate encodes two highly polymorphic proteins.

PLoS One, 8 (6):e65980.

14. Mandic, M., Ramon, M.L., Gracey, A.Y. and Richards, J.G. (2014) Divergent

transcriptional patterns are related to differences in hypoxia tolerance between the

intertidal and the subtidal sculpins. Mol. Ecol., 24, 6091-103.

15. Rodriguez, D., Sanders, E.N., Farell, K., Langenbacher, A.D., Taketa, D.A., Hopper,

M.R., Kennedy, M., Gracey, A.Y. and De Tomaso, A.W. (2014) Analysis of the basal

chordate Botryllus schlosseri reveals a set of genes associated with fertility. BMC

Genomics, 15(1):1183. [Epub ahead of print]

SUMMARY PROPOSAL FORM PROJECT TITLE: DISTINGUISHING EXPOSURE FROM EFFECT IN MULTIPLE-STRESSOR SCENARIOS: EFFECTS OF OCEAN ACIDIFICATION AND METAL-TOXICITY ON MUSSEL LARVAL DEVELOPMENT OBJECTIVE: Our overarching research goal is to use mussels as a model to test the hypothesis that ocean acidification (OA) will affect metal toxicity. Mussels are model organisms in the fields of both environmental toxicity and OA research. Copper criteria are determined by embryo-larval toxicity testing of the genus Mytilus, and as calcifying marine invertebrates mussels have become a key model for predicting the effects of OA. A long-standing problem in environmental toxicology has been to distinguish biomarkers of exposure from those of effect, which has led the EPA to call for the development of “Adverse Outcome Pathway” markers of toxicity. To address this challenge, we will combine classic embryo-larval testing protocols with a novel stratified sub-sampling technique that can distinguish biomarkers of exposure from those that are markers of adverse effect. This stratified sampling approach has the potential to untangle the complex interactions that occur when multiple variables are employed in water quality testing protocols. METHODOLOGY: Mussel embryo-larval toxicity assays will be performed according to standard EPA protocols (US EPA 1995). Reference water samples will be prepared with a range of environmentally relevant metal doses, and the effects of increasing metal contaminants will be tested at present day CO2 concentrations (400ppm), and predicted future concentrations (800ppm). Seawater pH and carbonate chemistry assays will be conducted in collaboration with the Hutchins lab at USC. Mortality and the proportion of abnormally developing embryos under each set of conditions will be quantified after 48 hr. Biomarkers will be developed using a stratified sub-sampling regime that leverages the fact that all the embryos in the vessel received the same contaminant exposure but only a sub-population will exhibit an adverse morphological outcome. Thus, for each treatment we will select 100 embryos that exhibit either normal or abnormal development, with abnormal development being a visual marker of the adverse effects of the particular conditions. Next-generation RNA sequencing will be used to identify transcripts that distinguish contaminant exposure from those linked to the onset of adversely effects. RATIONALE: The regulations governing copper and other metal contamination in Southern California’s coastal ocean must be considered in the context of a changing global ocean. Increased dissolved CO2 levels are predicted to decrease ocean pH to 7.7

by 2100 as well as significantly lower calcium carbonate saturation constants, especially in the California Current system. It is expected that OA will increase copper toxicity by reducing the complexation capacity of coastal waters and increasing free copper (Cu+2) concentrations. Understanding the effects of OA on water quality issues remains a

largely unexplored but looming question. This is a particular challenge in urban oceans because multiple environmental and chemical parameters will vary temporally and spatially due the proximity of large sources of urban pollutants. This means that water quality testing approaches that will be implemented this century will have to be nuanced and capable of analyzing multiple stressor scenarios in order to predict the impact that contaminants will have on coastal urban ecosystems. DATA SHARING PLAN: We will make all data visible and accessible to the wider academic community, government agencies, and public as both raw data (to encourage independent review), and as summarized findings in formats appropriate for academic users and in formats that will be understandable by the general public and educators. These data will be hosted by the USC Digital Repository which will ensure efficient access to these large datasets. Next generation sequences will be deposited in the public Short Read Archive hosted by the NCBI.

July 3, 2015

Dr. Andrew Gracey

Marine Environmental Biology

University of Southern California

3616 Trousdale Parkway #107

Los Angeles, CA 90089

Re: Letter of Support for proposed project on metal toxicity and ocean acidification

Dear Dr. Gracey,

The Southern California Coastal Water Research Project (SCCWRP) strongly supports your

proposed research project on metal toxicity and ocean acidification. The proposed research

addresses two important issues related to the assessment and management of water quality in

coastal urban areas: development of improved tools for assessing contamination impacts, and

adapting management programs to the impacts of climate change (e.g., ocean acidification).

This research will have nationwide applicability and value, as these are issues of concern for

many organizations.

SCCWRP is a public research institute focusing on the coastal ecosystems of Southern

California, from watersheds to the ocean. A primary focus of our activities is to improve the

ability of water quality managers to assess and protect water quality, through the incorporation of

state of the art research and technology in monitoring and policy. As the head of SCCWRP's

toxicology department, I am conducting several research projects focused on metal toxicity and

the development of genomic tools to improve environmental monitoring.

The goal of this proposal, to understand the potential impacts of ocean acidification on metal

toxicity, is highly relevant to SCCWRP’s mission and the concerns of our governing

Commission, which includes the key coastal water quality management agencies in southern

California. I am currently conducting research on copper toxicity in Marina del Rey Harbor that

includes testing with the same type of organism proposed in your project (mussel embryos). Our

research will use traditional toxicity test methods to investigate the influence of variations in

harbor water quality characteristics on copper toxicity. Your proposed research project is

complementary to our research and provides an excellent opportunity for collaboration and

expanding the application of our research.

SCCWRP would like to collaborate with you on your ocean acidification/metal toxicity research.

We will be conducting harbor water sampling, toxicity testing, and chemical analyses during

2015/2016 and can provide you with samples and data from our analyses. Collaboration will

increase the relevance of your work to ongoing regulatory studies in Marina del Rey Harbor,

facilitate communication of your results to water quality managers, and enable SCCWRP to

extend our research findings to future scenarios influenced by ocean acidification.

Please contact me if you would like to further develop a collaboration on our projects.

Sincerely,

Steven Bay, Principal Scientist

Toxicology Department

steveb@sccwrp.org

!

!

Biological Sciences Marine and Environmental Biology

Professor David A. Hutchins

!

University of Southern California 3616 Trousdale Parkway, Los Angeles, California 90089-0371 • Tel: 213 821-5779 • Fax: 213 740 8123

! ! ! ! ! ! ! ! 7/1/15!Dear!Andy!and!Megan:!!I!am!happy!to!support!your!pending!California!Sea!Grant!proposal!entitled!“Distinguishing exposure from effect in multiple-stressor scenarios: effects of ocean acidification and metal-toxicity on mussel larval development”.!!The!results!of!your!proposed!work!will!provide!important!and!novel!insights!into!the!how!future!ocean!acidification!could!affect!ecologically!and!economically!important!species!of!bivalves.!!Accumulation!of!toxic!copper!in!mussels!is!a!long!standing!problem!in!many!areas!along!the!California!coast!that!have!been!contaminated!by!copperLbased!antiLfouling!paint,!and!ocean!acidification!has!the!potentially!to!greatly!increase!these!already!problematic!toxicity!effects.! !I’ll!be!happy!to!support!your!project!by!helping!to!oversee!the!ocean!acidification!aspects!of!your!experiments.!!!My!laboratory!is!well!set!up!to!manipulate!and!analyze!the!seawater!carbonate!buffer!system,!as!ocean!acidification!has!been!a!longLstanding!area!of!research!in!our!group!supported!by!both!Sea!Grant!and!NSF!awards.!!I!can!also!provide!you!with!advice!and!oversight!of!your!experimental!designs,!in!order!to!make!sure!they!meet!the!highest!standards!for!global!change!manipulative!studies.!!I!am!very!enthusiastic!about!having!the!chance!to!collaborate!with!you!on!this!work!that!will!significantly!advance!our!knowledge!of!the!impacts!of!a!changing!coastal!ocean!on!key!species!of!commercially!important!shellfish.!!!

Best!of!luck!with!your!proposal,!

David A. Hutchins David!A!Hutchins!Professor!and!Section!Head!Marine!Environmental!Biology!University!of!Southern!California!3616!Trousdale!Parkway!Los!Angeles,!CA!90089!phone!213!740!5616,!email!dahutch@usc.edu!

1      

PROJECT TITLE: ECOSYSTEM SERVICE-BASED STRATEGIES FOR OPTIMIZING NATURAL TREATMENT OF STORMWATER IN SOUTHERN CALIFORNIA

PRINCIPAL INVESTIGATORS: Lisa A. Levin, Professor, Scripps Institution of Oceanography

ASSOCIATE INVESTIGATORS: Richard T. Carson, Professor, University of California San Diego

FUNDING REQUESTED:

2016-2017 Federal/State $64,027 Match $32,014 2017-2018 Federal/State $63,621 Match $31,811

STATEMENT OF THE PROBLEM:

Coastal development and urbanization modify water flows and contaminant loads in stormwater runoff that ultimately leads to degraded surface and ground water quality (Novotny & Olem 1994). As stormwater travels through urban settings, it accumulates contaminants that deteriorate the health and function of ponds, streams, wetlands, and the coastal ocean. Stormwater runoff is one of the leading sources of nonpoint source water pollution in the U.S. (Lopes & Bender 1998; Gaffield et al. 2003; U.S. EPA 2004). In southern California, these issues are known as the urban stream syndrome. They are superimposed on water shortages and droughts which heighten the importance of water retention and groundwater recharge (Meyer et al. 2005). Current approaches to improving water quality and enhancing water supply, such as water treatment plants and pipelines to transport water, are expensive in terms of both capital and energy. More efficient approaches are needed to assess, monitor, and manage impacts on our urban ocean.

Natural treatment systems (NTS) are man-made systems designed to infiltrate, filter, and harvest stormwater runoff from impervious surfaces and are now required for new development in some southern California cities. NTS include harvesting technologies (green roofs, rainwater tanks, wetlands and ponds; Figure 1A), infiltration systems (trenches, permeable pavement, engineered streams; Figure 1B), and hybrids (rain gardens, biofilters, bioswales; Figure 1C) (Askarizadeh et al., in press). It is increasingly important to evaluate the effectiveness of different technologies in different contexts. Such evaluations should include provided services that are the primary intent (water quality improvement, water supply enhancement, flood protection) as well as co-derived services such as wildlife habitat support, carbon sequestration, biodiversity support, and recreational opportunity.

2      

Figure 1. Examples of natural treatment systems on Elmer Avenue, Los Angeles that perform (A) harvesting – rain tank, (B) infiltration – permeable pavement, and (C) hybrid – biofilter.

INVESTIGATORY QUESTION:

The proposed project builds and expands on the NTS concepts being addressed for biofilters in our current one-year USC Sea Grant project (Cleaning urban stormwater on its way to the ocean: ecosystem services from natural treatment systems). The four questions we plan to address are: (1) What is the relative efficiency of different NTS categories with respect to water services including [i] water infiltration, [ii] contaminant removal, [iii] water storage, and [iv] downstream/coastal impacts of land-based activities in the ocean? (2) What are the market and non-market ecosystem services associated with each NTS category that provide environmental and socioeconomic benefits? (3) What are the economic values of NTS ecosystem services and how can those values be used for ocean and coastal resource decision-making? And (4) What are the costs and benefits of NTS relative to those of non-natural systems?

We will also test the hypothesis that NTS categories do not differ with respect to the provision of water services and associated ecosystem services. We will also consider the context-dependence

3      

of the services, i.e., how issues such as size of the NTS, surrounding land use, proximity and connectivity to the ocean, and other attributes affect ecosystem service provision.

Figure 2. We seek to understand the relationships between NTS category, water services, and associated ecosystem services.

MOTIVATION:

There is urgent need for low energy, multi-disciplinary, and multi-benefit approaches to sustaining adequate water resources. Climate change is predicted to increase the frequency and intensity of southern California droughts, magnifying the California water crisis and allowing contaminants to accumulate (Mann & Gleick 2015). Further, these contaminants can enter ponds, streams, wetlands, and the coastal ocean where they can cause waterborne illnesses and poison marine life (Dwight et al. 2004; Bay et al. 2003).

Current approaches for improving water quality and enhancing water supply are energy and capital intensive. NTS are low-energy alternatives that are designed to use natural processes to remove contaminants (e.g., trace metals, organic compounds, and pathogens) and enhance infiltration to groundwater. They not only provide the above mentioned water services, but they are also associated with the provision of a suite of other ecosystem services. These services create value for society and should be accounted for when making urban planning and regulation decisions. A substantial portion of southern California’s water demand might be met by identifying locations that would benefit the most from a specific category of NTS and employing a diverse array of capture and treatment systems across the urban landscape.

NTS are becoming more widespread in southern California. They are constructed in Los Angeles, Orange, and San Diego counties by individual developers, universities, municipalities, transportation authorities, and water districts. The city of Los Angeles requires NTS construction for new development that involves more than 500 square-feet of impervious area (Los Angeles Municipal Code). However, presently there has been little quantification of the effectiveness of NTS and whether different context influences the effectiveness of different NTS and additional services they provide (Aguirre 2015).

4      

These additional services potentially include increased habitat heterogeneity, connectivity, and food web support. In addition, NTS can sequester carbon, provide wildlife habitat and pollination services, and moderate flooding and erosion. These services are rarely included in decisions regarding urban planning, despite the benefits they provide.

This proposal will focus on determining the efficiency of different NTS categories and the associated services they provide. Understanding the rate and value of these processes will identify which employed system will reap the most benefits under different contexts, resulting in a useful urban planning, development, and regulation tool.

GOALS AND OBJECTIVES:

The long-term goal of this project is to develop a framework to incorporate the full value of NTS into decision-making of urban planners, developers, and regulators by developing tools to optimize the processes that improve water quality, enhance water supply, and provide important ecosystem services. Specific objectives of this proposal include:

(1) Develop a template for quantifying water infiltration, contaminant removal, and water storage services of NTS in Los Angeles. We will evaluate categories of Los Angeles NTS (Table 1) and choose representative NTS for each for application of the template.

(2) Identify the market and non-market ecosystem services each NTS category provides and estimate potential rates of functions and processes based on existing data and the literature.

(3) Estimate the value of services provided by each NTS category using economic tools.

(4) Conduct cost-benefit analysis of each NTS category to compare to non-natural alternatives that treat stormwater in transit to the coastal ocean.

METHODS:

Objective 1: The identification of Los Angeles NTS will involve seeking and compiling existing information from our current USC Sea Grant award; federal, state, and local governments (Los Angeles Department of Public Works, Los Angeles Watershed Protection Program); water authorities and sanitation districts (Metropolitan Water District, California Regional Water Quality Control Board, Los Angeles Waterworks); construction, developer, and environmental firms; non-profit organizations (Heal the Bay, Council for Watershed Health); and other agencies and stakeholders.

Each NTS identified will be grouped into one of eight categories (see Table 1). Representative NTS from each category will be chosen for further examination. Characteristics of each NTS such as age, size, media type, flora, surrounding land use, proximity and connectivity to the ocean will be recorded.

5      

Category Examples

Vegetative Systems Biofilters, bioswales, vegetative filter strips, constructed wetlands

Infiltration/Retention/Detention Infiltration trenches/basins, cisterns, wet/dry retention ponds

Pavement Asphalt porous pavement, structural soil

Catch Basins Boarding screens, Coarse screens, catch basin filters

Vortex/Hydrodynamic Hydrodynamic systems, downstream defender, continuous deflective separation

Clarifiers Generic clarifiers, clarifiers with rain diversion, oil/water separator

Media Filtration Sand/organic beds, organic filters

End-of-Pipe Diversion to sewer, disinfection, water reclamation

Table 1. A chart of natural treatment system categories and examples from the Reference Guide for Stormwater Best Management (L.A. Stormwater Management Division 2000).

Urbanization and development create impermeable surfaces that reduce infiltration, and wash stormwater runoff and its contaminants into a host of water channels, such as ponds, streams, wetlands, and the coastal ocean (Gobel et al. 2007). The template for quantification of water services will be developed by adapting current techniques (Bean et al. 2007).

Water Infiltration

Water infiltration is dependent on three factors: the maximum rate of water entry through the surface, the rate of water movement through the unsaturated zone, and the rate of drainage from the unsaturated into the saturated zone (Pitt et al. 2008). A saturation zone is a continuously submerged, anoxic zone designed to enhance contaminant removal, specifically nitrogen (Kim et al. 2003). Vegetative systems have been shown to remove contaminants more effectively when a saturation zone is present, and saturation zones can help retain this function during periods of drought (Blecken et al. 2009a; Blecken et al. 2009b; Zhang et al. 2011). However, southern California NTS are generally designed to drain within 72 hours because they can pose health

6      

0

200

400

600

800

1000

1200

1400

Event  1  -­‐11/21/2011            

Rainfall  =  0.34  in.

Event  2  -­‐2/16/2011              

Rainfall  =  0.30  in.

Event  3  -­‐2/26/2011              

Rainfall  =  0.88  in.

Event  4  -­‐4/11/2012              

Rainfall  =  0.17  in.

Event  5  -­‐3/1/2014              

Rainfall  =  2.36  in.

Event  6  -­‐4/2/2014              

Rainfall  =  0.17  in.

TSS  (m

g/L)

Influent

Effluent

concerns as a source of bacteria and mosquitoes (K. Galloway, Kimley-Horn, personal communication; Alm et al. 2003). The rate of water infiltration, therefore, is not only integral to reducing stormwater runoff, but can also be an early indicator of other NTS functions.

Water infiltration will be measured with a single-ring infiltrometer since previous work has shown that there is no significant difference in results between a single- and double-ring infiltrometer (Burgy & Luthin 1956; Verbist et al. 2010). The infiltrometer will be filled with a specified volume of water and water depth will be recorded at given time intervals until the water is depleted, similar to Bean et al. (2007). Three repetitions will be conducted at each NTS and infiltration rates will be calculated.

Contaminant Removal

One of the primary roles of NTS is to remove contaminants, such as trace metals and organic compounds, from stormwater runoff before they reach other bodies of water. NTS have been shown to be effective at reducing contaminant loads through filtration, adsorption, and biological treatment (Davis et al. 2008). This improvement in water quality is an important service to society as it reduces the risk of illness to recreational water users and prevents degradation of our coastal ecosystems (Hatt et al. 2008, Bratieres et al. 2008, Gaffield et al. 2003, Li et al. 2012).

Due to budget constraints, we will rely on existing data to estimate the rate of contaminant removal of chosen NTS. One biofilter on the Scripps Institution of Oceanography campus is monitored for inflow

0

100

200

300

400

500

600

Event  2  -­‐ 2/16/2011              Rainfall  =  0.30  in.

Event  3  -­‐ 2/26/2011              Rainfall  =  0.88  in.

Event  4  -­‐ 4/11/2012              Rainfall  =  0.17  in.

Event  5  -­‐ 3/1/2014              Rainfall  =  2.36  in.

Event  6  -­‐ 4/2/2014              Rainfall  =  0.17  in.

Total  Zn  (ug/L)

Influent

Effluent

A  

 

7      

and outflow concentrations of trace metals, suspended solids, and fecal coliform (see Figure 4). Data from other monitoring plans (the Los Angeles River Watershed Monitoring Program, Southern California Stormwater Monitoring Coalition, the Low Impact Development Center, and the Regional Water Quality Control Board) will be compiled and used to estimate the contaminant removal potential of the chosen NTS. These data will be used in combination with recorded NTS characteristics and existing studies that show relative contaminant removal efficiency of different

parameters (e.g., age, plant species, filter media) to estimate values for the NTS in question.

Water Storage

Enhancing water storage capacity has become an increasingly important objective in places such as California that are subject to frequent and severe droughts (Mann & Gleick 2015). Increased stormwater runoff from impervious surfaces renders watersheds more vulnerable to droughts (Houng et al. 2009). One of the ways that NTS work is by introducing permeable surfaces for water to infiltrate and replenish the watershed (Bouwer 2005).

While identifying Los Angeles NTS, we will also compile information on the design and construction of each NTS as available. We will use the dimensions of the NTS to calculate their water storage capacity. There are two volumes to consider: the surface volume contained in the NTS before it infiltrates and the volume contained in the voids of the permeable surface. The amount of water held in the voids of the permeable surface is generally calculated by multiplying the volume of the permeable layer by a constant, e.g., gravel assumes 40% voids (K. Galloway, Kimley-Horn, personal communication).

We will use these relative rates to evaluate the context-dependence of service provision. We will use regression and principal component analyses to determine which NTS characteristics (e.g., age, size, design) are significant determinants of which water services. Similar analyses will also be done in regard to ecosystem services identified in Objective 2 below.

1

10

100

1000

10000

100000

1000000

Event  1  -­‐11/21/2011            

Rainfall  =  0.34  in.

Event  2  -­‐ 2/16/2011              Rainfall  =  0.30  in.

Event  3  -­‐ 2/26/2011              Rainfall  =  0.88  in.

Event  4  -­‐ 4/11/2012              Rainfall  =  0.17  in.

Total  Colifo

rm  (M

PN/100

mL)

Influent

Effluent

C  Figure 3. Measurements of influent and effluent from a biofilter on the Scripps Institution of Oceanography campus, adjacent to the beach (shown in Figure 4). Values are depicted for (A) total zinc, (B) suspended solids, and (C) total coliform during six rain events through 2014. Data and figures provided by Kimberly O’Connell, University of California San Diego.

 

 

8      

Objective 2: Although NTS are generally employed to perform specific roles, e.g., harvesting stormwater runoff in transit to the ocean, they can also function as ecosystems with associated services that have value to society. Objective 1 will quantify the water services that are the primary roles of NTS, in addition to the existing data on inflow and outflow monitoring. However, NTS have the potential to provide a number of co-benefits.

Ecosystem services are defined as the benefits that society derives from ecosystem functions (Daily & Erlich 1992; Millennium Assessment 2005). They are often grouped into four categories: provisioning, regulating, cultural, and supporting (Millennium Assessment 2005). Provisioning services generate products that are obtained directly from the ecosystem. Regulating services are the benefits from the regulation of ecosystem processes. Cultural services are the non-material benefits. Supporting services are necessary for the provision of all other services.

We will compile a list of potential ecosystem services provided by each NTS category and their rates using information from recorded NTS characteristics, our current USC Sea Grant project, existing data, and the literature. The literature contains information about the relative efficiency of different vegetation types and plant species for nutrient removal (Payne et al. 2014), metal removal (Yang et al. 2014), pathogen removal (Li et al. 2012), and water retention and evapotranspiration (Susca et al. 2011). Other ecosystem services may include flood and erosion control, carbon sequestration, habitat support, pollination services, biodiversity support, and aesthetic value.

UC San Diego and Scripps Institution of Oceanography have constructed NTS that can serve as pilot systems to develop a methodology for the identification, quantification, and valuation of ecosystem services that can be applied to Los Angeles NTS (see Figures 4-6).

9      

Figure 4. A map of best management practices (BMPs), which include all NTS, on the main UC San Diego campus illustrating the different types of NTS available for observation.

10      

Figure 5. A map of BMPs on the Scripps Institution of Oceanography campus, also available for pilot studies.

B  

11      

Figure 6. Biofilters on the Scripps Institution of Oceanography campus. Data in Figure 3 are shown for the SIO biofilter on the left side of the middle image.

Under our current USC Sea Grant award, we are characterizing and quantifying the soil biota of biofilters on Elmer Avenue with the intent of understanding their potential role in water services. Elmer Avenue is a green street that captures water from 60 acres and treats it with under street infiltration galleries, bioswales, permeable walkways and driveways, rain gardens, rain barrels, and drought tolerant landscaping (Council for Watershed Health).We will also use this data and information to identify potential ecosystem services and estimate their rates of function.

Objective 3: Given the limited amount of time and budget, we will rely on existing valuation estimates to assign preliminary economic values on the services identified in Objective 1 and Objective 2. Benefit transfer methods “transfer” estimates from one context or location to another. Several criteria need to be met to employ these methods: similar biophysical conditions, similar scale of environmental change, similar socioeconomic characteristics, similar frame/setting, and the primary study must have been done to a satisfactory standard. Primary studies will be chosen based on these criteria.

There are many published studies that estimate the value of water quality improvements (Bateman et al. 2006, Barton 2002, Choe et al. 1996, Carson & Mitchell 1993, Desvousges 1987). In the case of water quality improvement, we can supplement our estimates with alternative costs, i.e. the value of water quality improvements from an NTS should be at least equal to the least costly equivalent alternative to an NTS.

The non-market valuation literature also contains many primary studies on the value of flood control (Mitsch & Gosselink 2000), carbon sequestration (Creedy & Wurzbacher 2001; Stavins 1999), constructed habitat (Chapman & Underwood 2011), and biodiversity (Amigues et al. 2002; Garrod & Willis 1997; Splash & Hanley 1995; Barbier et al. 1995).

There are several methods to transfer estimates from primary studies: unadjusted, simple adjusted, benefit function, and slope coefficients (Barton 2002). Information regarding Los Angeles and primary study demographics and socioeconomic conditions will be collected and used for the above methods. Simple adjusted transfers are adjusted to income. Benefit function transfers use regression coefficients of significant explanatory variables (e.g., population size, mean income, unemployment rates) from the primary study and apply them to the context in question.

Flood control valuation estimates can also be supplemented by analyzing information on flood risk assessment and insurance (Hsu et al. 2011; Speyrer & Ragas 1991) through an avoidance cost lens. A reduction of flood risk insurance an individual pays is equal to the value of an NTS that reduces the equivalent flood risk. Carbon sequestration can also be valued using market prices of carbon (U.S. EPA 2013).

Benefit transfer methods have limitations with a major concern regarding the accuracy of the primary study. Other limitations include the requirement of a primary study, context-dependent estimates and their transferability, and inherent uniqueness of a study site. The use of these

12      

methods to valuate NTS ecosystem services may also identify where original valuation estimates are most needed.

Objective 4: Permitting, construction, maintenance, and other relevant costs will be recorded for each representative NTS. We will apply standard government discount rates to costs and estimated benefit elements to calculate their net present value. These values will be compared to non-natural alternatives that include non-biological NTS.

RELATED RESEARCH:

Our current USC Sea Grant award just began and focuses on biofilters in Los Angeles with pilot studies at UC San Diego. Research will determine the location of existing biofilters, identify those linked to the ocean, observe different configurations and construction designs, examine their influence on plant and animal ecology, and evaluate ecosystem services provided. This related research provides the seeds for the current project, which will include biofilters in addition to other natural treatment systems and low impact development modes. Several other USC Sea Grant projects address upstream contamination (e.g., The role of small upstream reservoirs in trapping organic carbon, nutrients, and metals in the San Francisco Bay area [Rademacher & Faul]; developing a dialog/decision-support tool for climate-smart restoration and adaptive strategies in coastal wetlands of southern California [Stein & Ambrose]) but none address the best management practices that are the focus here.

A recent NSF PIRE award has funded an interdisciplinary group of southern California scientists from UC Irvine, UC Los Angeles, and UC San Diego, and Australian researchers from Monash University and the University of Melbourne, to train U.S. students to work internationally in the field of water sustainability. The project, focused on research in Australia, is examining new technology for treating runoff and grey water; identifying benefits and risks associated with low energy option (LEO) adoption relative to public health, energy consumption, and GHG production/emission; examining regulatory, economic, and social innovations to promote LEO adoption; and determining if LEOs improve stream hydrology and ecosystem health through case studies. Our participation in this program (which is nearing its end) has helped develop a network of water researchers and regulators that will (a) provide valuable expertise and insight, (b) be able to apply advances we make on ecosystem services in a variety of contexts, and (c) provide outreach and education opportunities to undergraduate and graduate students (including underserved students) that will extend the reach of our proposed research. Specifically we hope to introduce the ecosystem services framework into lecture presentations made for the UC Irvine UPP (Undergraduate Pire Program) students who spend six intensive weeks learning about water issues in southern California and Australia.

RESEARCH QUALIFICATIONS: PI Levin’s current research has focused on the ecology of biofilters (Grant et al. 2012; Levin & Mehring 2015; Askarizadeh et al., in press; Mehring & Levin, in review), with an emphasis on the role of soil invertebrates in providing water services. This proposal presents an expansion into new types of natural treatment systems with a focus on ecosystem services. While the field of ecosystem services is advancing rapidly and has been applied to systems such as coral reefs, built ecosystems such as NTS have largely been bypassed.

13      

Associate Investigator Carson has done extensive work on the economic benefits of ecosystems and their services. PhD student, Jennifer Le, has a background in both ecology and economics and will bring rigorous quantitative analytical skills to this project. Le has several years of research experience in the natural and social sciences, incorporating tools and theory as an innovative thinker and researcher.

BUDGET-RELATED INFORMATION:

Salary

Support is requested for 0.5 mo/y of support for L. Levin who will oversee the project, promote interactions with stakeholders, and advise PhD graduate student Jennifer Le and SRA II Jennifer Gonzalez. L.Levin will also contribute approximately 0.54 months of effort each year of the project in the form of matching. Trainee support is requested for Jennifer Le whose PhD research focuses on ecosystem services of natural and built ecosystems. J. Le, who has undergraduate degrees in economics and ecology, will conduct assessment of NTS ecosystem structure, function and services, estimate service values and conduct cost-benefit analyses. We request 2.8 mo of support in year 1 and 2.5 mo in year 2 for Jennifer Gonzalez who will assist with literature compilations, data gathering from city and regional agencies, mapping, field visits and on-site measurements of infiltration, biota, site configuration and context assessments. R. Carson will contribute economics expertise in the form of matching support (0.25/mo per year). He will advise J. Le on NTS cost-benefit analyses, and assessment of ecosystem services. We anticipate engaging one or more students from the SIO Masters of Advanced studies, SIO SURF and SIO 199 research students in this research as well.

Salary recharge rates are calculated for actual productive time only (except for non faculty academic sick leave). The rates include components for employee benefits, provisions for applicable merit increases and range adjustments in accordance with

University policy, except postdoc rates which do not include components for downtime, so those rates are calculated for all working hours. Staff overtime or remote location allowance may be required in order to meet project objectives, and separate rates are used in those cases.

Supplies

Research supply funds are requested to cover costs of laboratory supplies, field supplies (infiltration ring), and field guides.

IOD computer support costs are requested and are for computer software maintenance and consortium costs related to the use of laboratory computers supporting hardware and software development. These costs are allocated based on direct effort reported by staff in support of the proposed project.

14      

Project specific costs are requested and include research telephones, tolls, voice and data communication charges, photocopying, faxing and postage. Supply and expense items, categorized as project specific, and computer and networking services are for expenses that specifically benefit this project and are reasonable and necessary for the performance of this project.

Equipment: No equipment is requested.

Travel. Funds are requested for four 3-day trips to Los Angeles each year (from San Diego) to meet with relevant watershed managers/regulators and to visit NTS study sites. Trips will be made by Levin, Gonzalez and Le.

ANTICIPATED BENEFITS:

This project will develop tools and a framework for the identification, quantification, valuation, and assessment of NTS ecosystem services, which may potentially be adapted to other systems in need of an environmental decision-making framework. Currently, there is very limited attention to ecological characteristics and processes that drive the provision of socially beneficial services. The underlying function and structure of these services are important to understand to improve NTS design, increase regional resiliency to drought, and protect environmental and human health in an economically and socially effective manner. This project will produce information regarding NTS categories provides what water and associated ecosystem services, how individual services are affected by specific conditions, and what economic values each NTS category and each service. The resulting tools and framework will inform urban planners, developers, and regulators for efficient NTS design and land use.

Beneficiaries include the City of Los Angeles Bureau of Sanitation (Wing Tam), the Los Angeles Department of Water and Power, the Port of Los Angeles, and the California Regional Water Quality Control Board. These local government agencies will benefit with a tool for urban planners, developers, and regulators that can identify where NTS are needed and what category would be most effective. Other beneficiaries include other government agencies (the Southern California Stormwater Monitoring Coalition, California Coastal Commission, the State Water Resources Control Board, the California Department of Water Resources), industry (e.g., Kimley-Horn, Geosyntec, Rick Engineering), and non-profit organizations (Heal the Bay, the Council for Watershed Health [Mike Antos], Treepeople [Edith de Guzman]).

COMMUNICATION OF RESULTS: The Southern California Coastal Water Research Project (SCCWRP) will help us communicate findings to their 14 member agencies (including the State Water Board, the Southern California Regional Boards, city and county municipal wastewater treatment plants, and regional flood control agencies (see letter from S. Weisberg). We envision doing this through distribution of printed materials, joining relevant meetings and public seminars in the SCWWRP series. We plan to work with and communicate results to the UC San Diego Campus Storm Water Management Program to evaluate the effectiveness of on-campus NTS (see letter from K.

15      

O’Connell). This group has been pro-active in implementing a range of NTS (Figure 4). Initial meetings have shown tremendous interest in using UCSD NTS for research that tests and increases their effectiveness. The proposed work will provide opportunity for collaboration between varied disciplines and departments such as economics, urban planning, and engineering. This project will provide education opportunities via courses and student research. We plan to engage of masters students through the Masters of Advanced Studies at Scripps Institution of Oceanography via capstone projects and will engage underserved undergraduates through the SIO SURF program (funded by NSF), Faculty Mentor programs, and SIO 199 research for class credit. Research findings will be included SIO courses taught or co-taught by Levin (including Wetlands Ecology Conservation and Management, Benthic Ecology, and others). Information generated by this project will be included on the Center for Marine Biodiversity and Conservation Water webpage that will be created during our current USC Sea Grant award to discuss water issues, sustainability, and resiliency. The results of this project will be made freely available online, in terms of both access and content, to the general public. REFERENCES:

Aguirre P. 2015. Biofilters in San Diego County: a descriptive analysis of their stormwater management implications, the water regime’s role, and the way forward. Scripps Institution of Oceanography, Masters of Advanced Studies Capstone.

Alm EW, J Burke, A Spain.

2003. Fecal indicator bacteria are abundant in wet sand at freshwater beaches. Water Research, 37:3978-3982.

Amigues JP, C Boulatoff, B Desaigues, C Gautheir, and JE Keith. 2002. The benefits and costs of riparian analysis habitat preservation: a willingness to accept/willingness to pay contingent valuation approach. Ecological Economics, 43:17-31.

Askarizardeh A, MA Rippy, TD Fletcher, A AgahKouchak, BF Sanders, D Feldman, S Jiang, and SB Grant. In press. Journal of Environmental Science and Technology.

Barbier EB and BA Aylward. 1996. Capturing the pharmaceutical value of biodiversity in a developing country. Environmental and Resource Economics. 8:157-181.

Barton DN. 2002. The transferability of benefit transfer: contingent valuation of water quality improvements in Costa Rica. Ecological Economics. 42: 147-164.

Bateman IJ, MA Cole, S Georgious, DJ Hadley. 2006. Comparing contingent valuation and contingent ranking: a case study considering the benefits of urban river water quality improvements. Journal of Environmental Management. 79:221-231.

Bay S, BH Jones, K Schiff, L Washburn. 2003. Water quality impacts of stormwater discharges to Santa Monica Bay. Marine Environmental Research, 56:205-223.

16      

Bean EZ, WF hunt, and DA Bidelspach. 2007. Field survey of permeable pavement surface infiltration rates. Journal of Irrigation and Drainage Engineering. 133(3):249-255.

Blecken GT, Y Zinger, A Deletic, TD Fletcher, M Viklander. 2009a. Impact of a submerged zone and a carbon source on heavy metal removal in stormwater biofilters. Ecological Engineering, 35:769-778.

Blecken GT, Y Zinger, A Deletic, TD Fletcher, M Viklander. 2009b. Influence on intermittent wetting and drying conditions on heavy metal removal by stormwater biofilters. Water Research, 43:4590-4598.

Bouwer H. 2002. Artificial recharge of groundwater: hydrogeology and engineering. Hydrology Journal. 10:121-142.

Bratieres K, TD Fletcher, A Deletic, Y Zinger. 2008. Nutrient and sediment removal by stormwater biofilters: a large-scale design optimization study. Water Research, 42:3930-3940.

Burgy RH and JN Luthin. 1956. A test of the single- and double-ring types of infiltrometers. Transactions, American Geophysical Union. 37(2).

Carson RT and RC Mitchell. 1993. The value of clean water: the public’s willingness to pay for boatable, fishable, and swimmable quality water. Water Resources Research. 29(7):2442-2454.

Choe K, D Whittington, DT Lauria. 1996. The economic benefits of surface water quality improvements in developing countries: a case study of Davao, Philippines. Land Economics. 72(4):519-537.

Council for Watershed Health. Elmer Avenue Retrofit. Accessed 27 June 2015. http://watershedhealth.org/programsandprojects/was.aspx?search=elmer

Creedy J and AD Wurzbacher. 2001. The economic value of a forested catchment with timber, water and carbon sequestration benefits. Ecological Economics. 38:71-83.

Desvousges WH, VK Smith, A Fisher. 1987. Option price estimates for water quality improvements: a contingent valuation study for the Monongahela River. Journal of Environmental Economics and Management. 14:248-267.

Dwight RH, DB Baker, JC Semenza, BH Olson. 2004. Health effects associated with recreational coastal water use: urban versus rural California. American Journal of Public Health, 94(4):565-567.

Daily GC and PR Ehrlich. 1992. Population, sustainability, and Earth's carrying capacity. Bioscience. 42:761-771.

Gaffield SJ, RL Goo, LA Richards, RJ Jackson. 2003. Public health effects of inadequately managed stormwater runoff. American Journal of Public Health, 93(9):1527-1533.

Garrod GD and KG Willis. 1997. The non-use benefits of enhancing forest biodiversity: a contingent ranking study. Ecological Economics. 21:45-61.

17      

Gobel P, C Dierkes, and WG Coldewey. 2006. Storm water runoff concentration matrix for urban areas. Journal of Contaminant Hydrology. 91:26-42.

Grant SB, JD Saphores, DL Feldman, AJ Hamilton, TD Fletcher, P Cook, M Stewardson, BF Sanders, LA Levin. RF Ambrose, A Deletic, R Brown, SC Jiang, D Rosso, WJ Cooper, and I Marusic. 2012. Low-energy options for making water. Wastewater Science. 337:681-686.

Hatt BE, TD Fletcher, A Deletic. 2008. Hydraulic and pollutant removal performance of fine media stormwater filtration systems. Environmental Science and Technology, 42:2535-2541.

Hsu WK, PC Huang, CC Chang, CW Chen, DM Hung, and WL Chiang. 2011. An integrated flood risk assessment model for property insurance industry in Taiwan. Natural Hazards. 58:1295-1309.

Huong L, LJ Sharkey, WF Hunt, and AP Davis. 2009. Mitigation of impervious surface hydrology using bioretention in North Carolina and Maryland. Journal of Hydrologic Engineering. 14(4):407-415.

Kim HL, EA Seagren, AP Davis. 2003. Engineered bioretention for removal of nitrate from stormwater runoff. Water Environmental Research, 75(4):355-367.

Levin LA and AS Mehring. 2015. Optimization of bioretention systems through application of ecological theory. WIREs Water.

Li YL, A Deletic, L Alcazar, K Bratieres, TD Fletcher, DT McCarthy. 2012. Removal of Clostridium perfringens, Escherichia coli and F-RNA coliphages by stormwater biofilters. Ecological Engineering, 49:137-145.

Lopes TJ and DA Bender. 1998. Nonpoint sources of volatile organic compounds in urban areas – relative importance of land surfaces and air. Environmental Pollution, 101:221-230.

Los Angeles Municipal Code § 64.70.01.

Los Angeles Municipal Code § 64.70.05.

Los Angeles Municipal Code § 64.72.

Los Angeles Stormwater Management Division. 2000. Reference Guide for Stormwater Best Management Practices.

Mann ME and PH Gleick. 2015. Climate change and California drought in the 21st century. Proceedings of the National Academy of Sciences, 112(13):3858-3859.

Mehring A and LA Levin. Can animals improve the efficiency of water-sensitive urban design? Submitted to Bioscience.

Meyer JL, MJ Paul, WK Taulbee. 2005. Stream ecosystem function in urbanizing landscapes. Journal of the North American Benthological Society, 24(3):602-612.

18      

Millennium Assessment. 2005. Ecosystems and human well-being synthesis: a report of the Millennium Ecosystem Assessment.

Mitsch WJ and JG Gosselink. 2000. The value of wetlands: importance of scale and landscape setting. Ecological Economics. 35:25-33.

Novotny V and H Olem. 1994. Water Quality: Prevention, Identification, and Management of Diffuse Pollution. Van Nostrand Reinhold, New York.

Payne EGI, TD Fletcher, PLM Cook, A Deletic, and BE Hatt. 2014. Processes and rivers of nitrogen removal in stormwater biofiltration. Critical Reviews in Environmental Science and Technology. 44(7):796-846.

Pitt R, SE Chen, SE Clark, J Swenson, CK Ong. 2008. Compaction’s impacts on urban storm-water infiltration. Journal of Irrigation and Drainage Engineering. 134(5):652-658.

Rademacher L and K Faul. 2012. The role of small upstream reservoirs in trapping organic carbon, nutrients, and metals in the San Francisco Bay area. USC Sea Grant funded project.

Spash CL and N Hanley. 1995. Preferences, information, and biodiversity preservation. Ecological Economics. 12:191-208.

Speyrer JF and WR Ragas. 1991. Housing prices and flood risk: an examination using spline regression. Juornal of Real Estate Finance and Economics. 4:395-407.

Stavins RN. 1999. The costs of carbon sequestration: a revealed-preference approach. The American Economic Review. 89(4):994-1009.

Stein E and R Ambrose. 2015. Developing a dialog/decision-support tool for climate-smart restoration and adaptive strategies in coastal wetlands of southern California. USC Sea Grant funded project.

Susca T, SR Gaffin, and GR Dell’Osso. 2011. Positive effects of vegetation: urban heat island and green roofs. Environmental Pollution. 159:2119-2126.

United States Environmental Protection Agency. National Water Quality Inventory: Report to Congress (2004).

United States Environmental Protection Agency. 2013. The Social Cost of Carbon. Accessed 27 June 2015. http://www.epa.gov/climatechange/EPAactivities/economics/scc.html

Verbist K, S Torfsa, WM Cornelisa, R Oyarzunc, G Sotob, and D Gabrielsa. 2010. Comparison of single- and double-ring infiltrometer methods on stony soils. Soil Science Society of America. 9(2):462-475.

Yang X, Y Mei, J He, R Jiang, Y Li and J Li. 2014. Comprehensive assessment for removing multiple pollutants by plants in bioretention systems. Chinese Science Bulletin. 59:1446–1453.

19      

Zhang Z, Z Rengel, T Liahati, T Antoniette, K Meney. 2011. Influence of plant species and submerged zone with carbon addition on nutrient removal in stormwater biofilter. Ecological Engineering, 37:1833-1841.

Projected Work Schedule

PROJECT TITLE: Ecosystem service-based strategies for optimizing natural treatment of stormwater in southern California

Activities 2016-2017 F M A M J J A S O N D J Objective 1 a. NTS identification b. NTS characterization c. Infiltration d. Contaminant removal e. Water storage

X X

X X

X X X X

X X X X X

X X X

X X X

X X X

X

Objective 2 a. Literature review b. Data conversions

X

X

X

X

X

X X

X

X

Activities 2017-2018 Objective 3 a. Literature review b. Benefit transfer

X

X

X

X X

X X

X

Objective 4 a. Data compiling b. Cost-benefit analysis

X

X

X X

X X

X

Report, publication, and presentations

X X X

OMB Control No. 0648-0362Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: UCSD Scripps Inst of Oceanography GRANT/PROJECT NO.:

DURATION (months):February 1, 2016 - January 31, 2017

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior Personnel No. of PeopleAmount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: Lisa Levin, UCSD SIO 1 0.5 14,183 10,021b. Associates (Faculty or Staff): Richard Carson, UCSD Economics 1 0.3 0 6,849

Sub Total: 2 0.8 14,183 16,870

2. Other Personnela. Professionals:b. Research Associates: Jennifer Gonzalez, UCSD SIO 1 2.8 21,731c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians:h. Other:

Total Salaries and Wages: 3 3.6 35,914 16,870

B. FRINGE BENEFITS: See Below** 3,727Total Personnel (A and B): See Below** 35,914 20,597

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT: 1,866

E. TRAVEL:1. Domestic 3,0002. International

Total Travel: 3,000 0

F. PUBLICATION AND DOCUMENTATION COSTS:

G. OTHER COSTS:1 Research supplies and shipping 5282 IOD Computer Support Costs3 Project Specific 564567

Total Other Costs: 528 56

TOTAL DIRECT COST (A through G): 41,308 20,653

INDIRECT COST (On campus 55% ): 44 22,719 11,359INDIRECT COST (Off campus % of $ ):

Total Indirect Cost: 22,719 11,359

TOTAL COSTS: 64,027 32,013

** UCSD SIO:Salary recharge rates are calculated for actual productive time only (except for non-faculty academic sick leave). The rates include components for employee benefits, provisions for applicable merit increases and range adjustments in accordance with University policy, except postdoc rates which do not include components for downtime, so those rates are calculated for all working hours. Staff overtime or remote location allowance may be required in order to meet project objectives, and separate rates are used in those cases.

PRINCIPAL INVESTIGATOR: Lisa Levin

UCSD #2016-0025BRIEF TITLE: Ecosystem Service-Based Strategies For Optimizing Natural TreatmentOf Stormwater In Southern California

OMB Control No. 0648-0362Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: UCSD Scripps Inst of Oceanography GRANT/PROJECT NO.:

DURATION (months):February 1, 2017 - January 31, 2018

12 months 2 Yr.A. SALARIES AND WAGES: man-months

1. Senior Personnel No. of PeopleAmount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: Lisa Levin, UCSD SIO 1 0.5 14,466 9,912b. Associates (Faculty or Staff): Richard Carson, UCSD Economics 1 0.3 0 6,849

Sub Total: 2 0.8 14,466 16,761

2. Other Personnela. Professionals:b. Research Associates: Jennifer Gonzalez, UCSD SIO 1 2.5 20,083c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians:h. Other:

Total Salaries and Wages: 3 3.3 34,549 16,761

B. FRINGE BENEFITS: See Below** 3,706Total Personnel (A and B): See Below** 34,549 20,467

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT: 3,017

E. TRAVEL:1. Domestic 3,0002. International

Total Travel: 3,000 0

F. PUBLICATION AND DOCUMENTATION COSTS:

G. OTHER COSTS:1 Project Specific Costs 48023 554567

Total Other Costs: 480 55

TOTAL DIRECT COST (A through G): 41,046 20,522

INDIRECT COST (On campus 55%): 65% 22,575 11,287INDIRECT COST (Off campus of $ ):

Total Indirect Cost: 22,575 11,287

TOTAL COSTS: 63,621 31,809

** UCSD SIO:Salary recharge rates are calculated for actual productive time only (except for non-faculty academic sick leave). The rates include components for employee benefits, provisions for applicable merit increases and range adjustments in accordance with University policy, except postdoc rates which do not include components for downtime, so those rates are calculated for all working hours. Staff overtime or remote location allowance may be required in order to meet project objectives, and separate rates are used in those cases.

PRINCIPAL INVESTIGATOR: Lisa Levin

UCSD #2016-0025BRIEF TITLE: Ecosystem Service-Based Strategies For Optimizing Natural TreatmentOf Stormwater In Southern California

BRIEF CURRICULUM VITAE NAME ___________Lisa A. Levin___________________________ Address ___9500 Gilman Drive, MC 0218, La Jolla, CA 92093-0218 Phone (work) 858_-_534-3579 _____ _ Email llevin@ucsd.edu EDUCATION Postdoctoral Scholar, Woods Hole Oceanographic Instittution 1982-1983 PhD., Oceanography, Scripps Institution of Oceanography, UC San Diego, CA, 1982 B.A., Biology, Radcliffe College, Harvard University 1975 (Summa cum Laude) POSITIONS HELD 2011- Present Distinguished Professor, Oliver Chair, Director, Center for Marine Biodiversity and

Conservation, Scripps Institution of Oceanography, UCSD, La Jolla 1995 - 2011 Professor, Scripps Institution of Oceanography, UC San Diego, La Jolla 1992 - 1995 Associate Professor, Scripps Institution of Oceanography, UCSD,La Jolla 1989 - 1992 Associate Professor, Dept. of Marine, Earth and Atmospheric Sciences, North Carolina State University, Raleigh 1983 - 1989 Assistant Professor, Dept. of Marine, Earth and Atmospheric Sciences, North Carolina State University, Raleigh SELECTED PUBLICATIONS LAST 8 YEARS Levin, Lisa A. and Andrew. S. Mehring. Optimization of bioretention systems through application of

ecological theory. Wiley Interdisciplinary Reviews Water 2: 259-270. (2015) doi: 10.1002/wat2.1072. Levin, Lisa A. Kon-Kee Liu, Kay-Christian Emeis, Denise L. Breitburg, James Cloern, Curtis Deutsch,

Michele Giani, Anne Goffart, Eileen E. Hofmann, Zouhair Lachkar, and 10 others. Comparative biogeochemistry-ecosystem-human interactions on dynamic continental margins. J. Marine Systems. In press (2014).

Mengerink, K.J., C.L. Van Dover, J. Ardron, M. Baker, E. Escobar-Briones, K. Gjerde, J. A. Koslow, E. Ramirez-Llodra, A. Lara-Lopez, D. Squires, T. Sutton, A.K. Sweetman, L.A. Levin A Call for Deep-Ocean Stewardship. Science 344: 696-698. (2014)

Nordstroem, M., C. Currin, T. Talley and C. W.hitcraft, and L. Levin. Benthic food-web succession in a developing salt marsh. Mar. Ecol. Progr. Series. 500: 3-55 (2014)

Frieder, C.A., Gonzalez, J.P., Bockmon, E.B., Navarro, M.N., Lisa A. Levin. Evaluating ocean acidification consequences under natural oxygen and periodicity regimes: Mussel development on upwelling margins. Global Change Biology 20: 754-764. (2014)

Mora C, Wei C-L, Rollo A, Amaro T, Baco AR, et al. Biotic and human vulnerability to projected changes in ocean biogeochemistry over the 21st Century. PLoS Biol 11(10): e1001682. doi:10.1371/journal.pbio.1001682 (2013)

Sperling, E.A., Frieder, C.A., Raman, A.V., Girguis, P.R., Levin, L.A. and Knoll, A.H. Oxygen, ecology and the Cambrian radiation of animals. Proceedings of the National Academy of Sciences. doi:10.1073/pnas.1312778110. (2013)

Neira, C., Levin, L.A., Mendoza, G., Zirino, A. Alteration of benthic communities associated with copper contamination linked to boat moorings. Marine Ecology 36: 46-66 (2013)

Henry S. Carson, Paola C. López-Duarte, Geoff S. Cook, F. Joel Fodrie, Bonnie J. Becker, Claudio DiBacco, and Lisa A. Levin.. Temporal, spatial, and interspecific variation in geochemical tags within fish otoliths, bivalve larval shells, and crustacean larvae. Marine Ecology Progress Series 473:133-148. (2013)

Grant, S.B., J.D. Saphores, D.L. Feldman, A.J. Hamilton, T. Fletchers, P. Cook, M. Stewardson, B.F. Sanders, L.A. Levin, R.F. Ambrose, A. Deletic, R. Brown, S.C. Jiang, D. Rosso, W.J. Cooper, and I. Marusic. Low-energy options for making water from wastewater. Science 337:681-686. (2012)

López-Duarte*, P.C., Carson, H.S., Cook, G.S., Fodrie, F. J., Becker, B.J., DiBacco, C. and Levin, L.A. What Controls Connectivity? An Empirical, Multi-species Approach. Integrative and Comparative Biology doi: 10.1093/icb/ics104 (2012)

Levin, L.A. and M. Sibuet. Understanding Continental Margin Biodiversity: A New Imperative. Ann. Rev. Mar. Sci. doi: 10.1146/annurev-marine-120709-142714 (2012)

Levin, L.A. and Crooks, J. Functional consequences of species invasion. Treatise on Estuarine and Coastal Science Vol 7 chapter 4. (2012)

Currin, C.A., L.A. Levin, T.S. Talley, R. Michener, D. Talley. The role of cyanobacteria in southern California salt marsh food webs. Marine Ecology 32: 346-363 (2011)

Neira, C., Mendoza, G. Levin, L.A., Zirino, A. Delgadilloo-Hinojosa, F., Porrachia, M. Deheyn, D. Macrobenthic community response to copper in Shelter Island Yacht Basin, San Diego Bay, California. Marine Pollution Bulletin. 62: 701–717 (2011)

Carson, H.S., G. Cook, M. Paola López-Duarte and Lisa A. Levin. Evaluating the importance of demographic connectivity in a marine metapopulation Ecology 92: 1972-84. (2011)

Moseman, S.M., K.Armaiz-Nolla and L.A. Levin. Wetland response to sedimentation and nitrogen loading: diversification and functional decline of nitrogen fixing microbes. Ecological Applications. doi: 10.1890/08-1881 (2010)

Carson, H.S., Lopez-Duarte, M.P., Wang, D. and Levin, L.A. Time series reveals how reproductive timing alters coastal connectivity. Current Biology 20: 1926-1931. (2010)

Levin, L.A. and Dayton, P.K. Ecological theory and continental margins: where shallow meets deep. Trends in Ecology and Evolution 24: 606-617 (2009)

Middelburg, J. and Levin, L.A. Coastal hypoxia and sediment biogeochemistry. Biogeosciences 6, 1273-1293. (2009)

Grosholz, E.D. Levin, L.A., Tyler C. and Neira, C. Changes in community structure and ecosystem function following Spartina alterniflora invasion of Pacific estuaries Chapter IN: Human Impacts on Salt Marshes: a Global Perspective. B. Silliman, E. Grosholz, M. Bertness (editors). Pp 23-40. (2009)

Levin, L.A. W. Ekau, A. Gooday, F. Jorrisen, J. Middelburg, C. Neira, N. Rabalais, S.W.A. Naqvi, J. Zhang. Effects of natural and human-induced hypoxia on coastal benthos. Biogeosciences 6, 2063-2098 (2009)

Neira, C., Delgadillo-Hinojosa, F., Zirino, A. Mendoza, G., Levin, L.A., Porrachia, M., Deheyn, Fine spatial distribution of copper in relation to recreational boating in a California shallow-water basin. Chemistry and Ecology 25:417 — 433 (2009)

Whitcraft, C.R., L.A. Levin, D. Talley and J.A. Crooks. Utilization of invasive tamarisk by salt marsh consumers. Oecologia 158: 259-272. (2008)

Moseman, S., Zhang, R., Qian, P.Y. and Levin, L.A. Diversity and functional responses of nitrogen-fixing microbes to three wetland invasions. Biological Invasions. 11: 225-239. (2008)

Whitcraft C.R. and Levin, L.A. Light-mediated regulation of the sediment ecosystem by salt marsh plants. Ecology 88: 904-917 (2007)

Neira C., Levin, L.A., Edwin D. Grosholz & Guillermo Mendoza. Invader plant succession structures macroinvertebrate communities through soil modification. Biological Invasions. 9: 975-993. (2007)

In review:

Askarizadeh, A., Rippy, M., Fletcher, T., Feldman, D., Peng, J. , Bowler, P., Mehring, Winfrey, B., Jiang, Sanders, B., Levin. L.A., Taylor, S. Grant, S. A. From rain tanks to catchments: Use of low-impact development to prevent and cure the urban stream syndrome. Environmental Science and Technology

Mehring, A. and L.A. Levin Potential roles of soil fauna in improving the efficiency of rain gardens used as natural stormwater treatment systems. J. of Applied Ecology.

BRIEF CURRICULUM VITAE NAME ___________Richard T. Carson___________________________ Address ___9500 Gilman Dr. MC 0508, University of Californis – SD, La Jolla CA 92093 Phone (work) 858_-534-3383 ______ Email rcarson@ucsd.edu A. PROFESSIONAL PREPARATION

UC Berkeley: Ph.D., Department of Agricultural and Resource Economics, 1985. M.A., Department of Statistics, 1985. George Washington University: M.A., School of Public and International Affairs, 1979. Mississippi State University: B.A. French/Political Science, 1977. B. APPOINTMENT (Current)

UCSD: Professor, Department of Economics [at UCSD since 1985]

C. Five Relevant Recent Publications

Carson, R.T., J.J. Louviere, J.M. Rose and J. Swait (2015), “Frontiers in Modelling Discrete Choice Experiments: A Benefit-Transfer Perspective,” in R. Johnston, J. Rolfe, R. Rosenberger, and R. Brouwer, eds., Benefit Transfer of Environmental and Resource Values: A Handbook for Researchers and Practitioners (Springer).

Vincent, J.R., R.T. Carson, J.R. Deshazo, Kurt A. Schwabe Ismariah Ahma, Chong Siew Kook, Chang Y. Tan and M.D. Potts (2014), “Tropical Countries May Be Willing to Pay More to Protect Their Forests,” Proceedings of National Academy of Sciences, 11(28), 10113-10118. .

Carson, R.T. and K. Novan (2013), “The Private and Social Economics of Bulk Electricity Storage,” Journal of Environmental Economics and Management, 66(3), 404-423.

Carson, R.T., W.M. Hanemann and T.C. Wegge (2009), “A Nested Logit Model of Recreational Fishing Demand in Alaska,” Marine Resource Economics, 24(2), 101-129.

Carson, R.T., M. Damon, L.T. Johnson, and J.A. Gonzalez (2009), “Conceptual Issues in Designing a Policy to Phase Out metal-based Antifouling Paints on Recreational Boats in San Diego Bay,” Journal of Environmental Management, 90(8), 2460-2468.

D. Five Earlier Significant Publications

Auffhammer, M. and R.T. Carson (2008), “Forecasting the Path of China’s CO2 Emissions: Using Province Level Information,” Journal of Environmental Economics and Management, 55, 229-247.

Fernandez, L. and R.T. Carson (eds.) (2002), Both Sides of the Border: Transboundary Environmental Management Issues Facing Mexico & the U.S. (Boston: Springer).

Carson, R.T., R.C. Mitchell, W.M. Hanemann, R.J. Kopp, S. Presser, and P.A. Ruud (2003), "Contingent Valuation and Lost Passive Use: Damages from the Exxon Valdez Oil Spill," Environmental and Resource Economics, 25, 257-286.

Carson, R.T. and R.C. Mitchell, (1993), "The Value of Clean Water: The Public's Willingness to Pay for Boatable, Fishable, and Swimmable Quality Water," Water Resources Research, 29, 2445-2454.

Mitchell, R.C. and R.T. Carson (1989), Using Surveys to Value Public Goods: The Contingent Valuation Method (Johns Hopkins University Press).

E. SYNERGISTIC ACTIVITIES 1. Consultant to several government agencies and research organizations including: Alaska Department of Law, Australian Resource Assessment Commission, California Water Resources Control Board, Electric Power Research Institute, Environment Canada, Interamerican Development Bank, NOAA, OECD, Research Triangle Institute, United Kingdom Department of Environment, Transportation, and Regions, United Nations

Development Program, U.S. DOJ, U.S. EPA, U.S. Forest Service, and World Bank. 2. Service on editorial boards: Contemporary Economic Policy, Environmental and Resource Economics, Foundations & Trends: Microeconomics (co-editor), Journal of Environment and Development and Journal of Environmental Economics and Management. 3. Association of Environmental and Resource Economists: Past President, Fellow, and Program Chair for Second World Congress. 4. National Research Council: Member of Committee on Oil Spill Research and Development and Committee to Evaluate U.S. Army Corp of Engineers Planning Procedures. 5. UCSD: Chair, Economics Department; Chair, Advisory Committee on Sustainability; Faculty Chair of the Social Science Computer Facility; Senior Fellow, San Diego Supercomputer Center; Research Director for International Environmental Policy, UC Institute on Global Conflict and Cooperation.

E.  COLLABORATIVE  RESEARCH  2010-­‐2014  (a) Coauthors/coeditors: I. Bateman (East Anglia), Jorge Araña (U. Las Palmas de Gran Canaria) , G. Atkinson (LSE), K. Boyle (VPI), L. Burgess (UTS), T. Cenesizoglu (HEC), M. Conaway (Alabama), M. Czajkowski (Warsaw), B. Day (East Anglia), J.R. DeShazo (UCLA), D. Dupont (Brock), C. Eckert (UTS), B. Frischknecht (UTS), T. Flynn (UTS), J. Graff-Zivin (UCSD), T. Groves (UCSD), D. Hensher (Sydney), A. Holbrook (Illinois), T. Islam (Guelph), Y. Jeon (UCSD), B. Kanninen (BK Econometrics); P. Koundouri (Athens S. Econ.& Bus.), J. Krosnick (Stanford), A. Krupnick (RFF), John List (Chicago), J. Louviere (UniSA), A. Marley (McGill), P. Metcalf (LSE), R. Meyer (Penn), R. Mitchell (Clark), S. Morimoto (Kyoto), S. Mourato (LSE), C. Nauges (Toulouse), S. Navrud (Norwegian U. Life Sciences), P. Nunes (FEEM), R. Parker (Boeing), S. Presser (Maryland), R. Paterson (IEC), D. Philens (UTS), M. Potts (Berkeley), S. Polasky (Minnesota), J. Rose (UniSA), R. Scarpa (Waikato), K. Schwabe (UC Riverside), W. Schlenker (Columbia), K. Smith (Arizona State), J. Strand (World Bank), D. Street (UTS), J. Swait (UniSA), S. Thorpe (UTS), J. Vincent (Duke), E. Wei (UniSA), J. Wooldridge (Michigan State). (b) GRADUATE COMMITTEE [UCB]: W.M. Hanemann (Chair), Peter Berck, Leo Breiman. (c) GRADUATE STUDENTS[29] (major advisor, these are not included in E[a]): Paola Agostini (World Bank), Anna Alberini (Maryland), Nelson Altamirano (Tsukuba), Max Auffhammer (Berkeley), Maria Damon (NYU), Sam Dastrup (NYU), Susana Ferreira (Georgia), Nicholas Flores (Colorado), Jeff Grogger (Chicago), Andreas Heinen (Universidad Madrid, Carlos III), John Horowitz (Maryland), Jacob LaRiverie (Tennessee), Francis Lim (Australian National University), Anthony Liu (Resources for the Future), Kathy Kiel (Holy Cross), Donald McCubbins (Abt Associates), Jason Murray (South Carolina), Kevin Nolan (UC Davis), Jeffrey O’Hara (Chicago Climate Exchange), Ciaran Phibbs (Stanford), Tess Scharleman (U.S. Treasury), Tamara Sheldon (South Carolina), Chris Steiner (Penn State) Nada Wasi (Michigan), Steve Waters (Research Triangle Institute), Jarrod Welch (Compass-Lexcon), Megan Werner (Florida), Anthony Westerling (UC Merced). Postdoc: Theresa Munoz (UNED Madrid).

PROJECT TITLE: ECOSYSTEM SERVICE-BASED STRATEGIES FOR OPTIMIZING NATURAL TREATMENT OF STORMWATER IN SOUTHERN CALIFORNIA

OBJECTIVES: The long-term goal of this project is to develop a framework to incorporate the full value of natural treatment systems (NTS) into decision-making of urban planners, developers, and regulators. This will be achieved by developing tools to optimize the processes that improve water quality, enhance water supply, and provide important ecosystem services. Specific objectives of this proposal are to:

(1) Develop a template for quantifying water infiltration, contaminant removal, and water storage services of NTS in Los Angeles. We will evaluate categories of Los Angeles NTS and choose representative NTS for each for application of the template, using UC San Diego NTS as training sites. (2) Identify the market and non-market ecosystem services each NTS category provides and estimate potential rates of functions and processes based on existing data and the literature. (3) Estimate the value of services provided by each NTS category using economic tools. (4) Conduct cost-benefit analysis of each NTS category to compare to non-natural alternatives that treat stormwater in transit to the coastal ocean.

METHODOLOGY: A combination of data from our current USC Sea Grant project (Cleaning urban stormwater on its way to the ocean: ecosystem services from natural treatment systems), field work, literature reviews, and economic tools will be used to quantitatively assess water and ecosystem services provided by Los Angeles NTS.

Water infiltration rates will be measured directly while contaminant removal and water storage will be estimated using NTS attributes, e.g. age, size dimensions, design, plant species, soil invertebrates, surrounding land use, proximity and connectivity to the ocean. NTS characteristics will also be used, in combination with existing studies on relative efficiency of plant species for contaminant removal and water retention, to compile a list of ecosystem services and their potential rates of function. Other ecosystem services may include flood and erosion control, carbon sequestration, habitat support, pollination services, biodiversity support, and aesthetic value. We will use these estimated rates of provision to evaluate their context-dependence with regression and principle component analyses. UC San Diego NTS will serve as pilot studies.

We will rely on existing valuation estimates to assign preliminary economic values to identified services. Estimates from published studies will be transferred to a southern California context using benefit transfer methods, which will be supplemented by other nonmarket valuation techniques such as avoidance costs. Permitting, construction, maintenance, and other relevant costs will be recorded for each representative NTS to calculate their net present value. These values will be compared to non-natural alternatives that include non-biological NTS.

RATIONALE: There is urgent need for low energy, multi-disciplinary, and multi-benefit approaches to sustaining adequate water resources. Climate change is predicted to increase the frequency and intensity of southern California droughts, magnifying the California water crisis and allowing contaminants to accumulate. These contaminants can enter ponds, streams, wetlands, and the coastal ocean where they can cause waterborne illnesses and poison marine life.

Current approaches for improving water quality and enhancing water supply are energy and capital intensive. NTS are low-energy alternatives that are designed to use natural processes to remove contaminants (trace metals, organic compounds, and pathogens) and enhance infiltration to groundwater. They not only provide the above mentioned water services, but are also associated with a host of ecosystem services. These services create value for society and should be accounted for when making urban planning and regulation decisions. A substantial portion of southern California’s water demand could be offset by identifying locations that would benefit the most from a specific category of NTS and employing a diverse array of capture and treatment systems across the urban landscape.

This proposal will focus on determining the efficiency of different NTS categories and the associated services they provide. Understanding the rate and value of these processes will identify which employed system will reap the most benefits under different contexts, resulting in a useful urban planning, development, and regulation tool.

DATA SHARING PLAN: Information generated by this project will be included on the Center for Marine Biodiversity and Conservation Water webpage that will be created during our current USC Sea Grant award to discuss water issues, sustainability, and resiliency. The types of data generated will be concerning which categories of NTS provide which services, and under what configurations and conditions; and which NTS category would be most beneficial at certain locations. The results of this project will be made freely available online, in terms of both access and content, to the general public.

The Southern California Coastal Water Research Project (SCCWRP) will help us communicate findings to their 14 member agencies (including the State Water Board, the Southern California Regional Boards, city and county municipal wastewater treatment plants, and regional flood control agencies (see letter from S. Weisberg). We envision doing this through distribution of printed materials, joining relevant meetings and public seminars in the SCWWRP series. We plan to work with and communicate results to the UC San Diego Campus Storm Water Management Program to evaluate the effectiveness of on-campus NTS (see letter from K. O’Connell). This group has been pro-active in implementing a range of NTS (Figure 4). Initial meetings have shown tremendous interest in using UCSD NTS for research that tests and increases their effectiveness. The proposed work will provide opportunity for collaboration between varied disciplines and departments such as economics, urban planning, and engineering.

U N I V E R S I T Y O F C A L I F O R N I A

BERKELEY • DAVIS • IRVINE • LOS ANGELES • MERCED • RIVERSIDE • SAN DIEGO • SAN FRANCISCO

SANTA BARBARA • SANTA CRUZ

THE HENRY SAMUELI SCHOOL OF ENGINEERING Department of Civil and Environmental Engineering

544 Engineering Tower Irvine, CA 92697-2575

7/1/2015

RE: Sea Grant proposal entitled, “Ecosystem service-based strategies for optimizing natural treatment of stormwater in Southern California” As Director and Principal Investigator of the U.S. National Science Foundation Partnerships for International Research and Education (NSF-PIRE) project entitled “Low Energy Options for Making Water from Wastewater”, I would like to express my enthusiastic support for, and commitment to collaborate with, the Sea Grant proposal led by Professor Lisa Levin entitled, “Ecosystem service-based strategies for optimizing natural treatment of stormwater in Southern California”. First a little background. Our particular NSF-PIRE links five different universities (UCI, UCLA, UCSD/SIO, University of Melbourne, and Monash University) in two water-stressed regions of the world (southwest U.S. and southeast Australia) with unique and complementary expertise in the development and deployment of rainwater tanks, biofilters, and waste stabilization ponds for potable substitution and watershed protection. Research activities are conducted in four complementary research layers as follows. Layer 1: improve the removal of pathogens, nutrients, and micropollutants in storm water runoff by improving biofilter designs and the design of urban drainages; Layer 2: investigate the risks and benefits of distributed adoption of integrated urban water management technologies on public health, energy consumption, and greenhouse gas emissions; Layer 3: identify social, economic, and policy barriers to integrated urban water management adoption, quantify their unpriced benefits and propose economic instruments, regulations, and public education measures to foster their adoption; and Layer 4: quantify the impact of distributed adoption of integrated urban water management on urban stream hydrology, water quality, and ecology. More information about the program, including research publications, outreach activities, and press releases can be found at our website: http://water-pire.uci.edu/ The urban water challenges facing the US and Australia have a number of important parallels (e.g., many features of the “urban stream syndrome” are common to urbanized

2

areas in both countries) and distinctions (e.g., the importation of water in southern California fundamentally alters the water balance here, as compared to other areas, such as Melbourne, where most of the drinking water is sourced locally). Over the past 3.5 years we have learned much about Australia’s response to the Millennium Drought, and the various cutting edge Natural Treatment System (NTS) technologies they deployed. Indeed, their innovative use of NTS allowed Melbourne to cut its per capita consumption by over 50%--an accomplishment we would do well to reproduce in Southern California! Indeed, as our NSF project winds down over the next 1.5 years, we will be looking for opportunities to translate our findings in Australia closer to home, and Professor Levin’s proposed project precisely fits that bill. Importantly, our NSF PIRE (by design) does not support domestic focused research, and thus Professor Levin’s proposed project complements, but not duplicates, our research program in Australia. The Sea Grant results on ecosystem services also will feed exciting information into our PIRE undergraduate education program on water sustainability, with reach to students in engineering and biology. In summary, I hope it is clear from the above that my U.S. and Australian colleagues and I are very keen to see Professor Levin’s proposed project funded. Please let me know if you have any further questions or concerns. With best regards, Stanley B. Grant, PhD

Professor of Civil and Environmental Engineering Professor of Chemical Engineering and Materials Science (courtesy appointment) University of California, Irvine, USA Visiting Chair of Hydrology and Water Resources Department of Infrastructure Engineering University of Melbourne, Australia

"',========------=-~--=---~~~~=====~================~=======

UNIVERSITY OF CALIFORNIA, SAN DIEGO

BERKELEY • DAVIS • IRVINE • LOS ANGELES • MERCED • RIVERSIDE • SAN DIEGO • SAN FRANCISCO SANTA BARBARA • SANTA CRUZ

ENVIRONMENT, HEALTH AND SAFETY, 0920

June 17, 2015

9500 GILMAN DRIVE LA JOLLA, CALIFORNIA 92093-0920 PHONE (858) 534-3660 FAX (858) 534-7982

LETTER OF SUPPORT: ECOSYSTEM SERVICE-BASED STRATEGIES FOR OPTIMIZING NATURAL TREATMENT OF STORMWATER IN SOUTHERN CALIFORNIA

On behalf of the Storm Water Management Program at UC San Diego, this letter is to express support for the proposed project to evaluate the efficiency of different natural treatment systems to infiltrate, store and clean urban storm water runoff in Southern California and to evaluate their ecosystem services provided. This project supports state­wide efforts to identify innovative ways to offset potable water use in response to the ongoing drought. Storm water runoff is a highly underutilized resource that could offset demand on the State's water supply. Millions of dollars are spent each year on treatment systems to remove pollutants from urban runoff before it goes into our creeks, rivers, and oceans. This project will evaluate ways to reuse the runoff instead of having it discharge into our waterways, providing multiple ecosystem services including water quality protection, ecosystem protection, flood prevention, and drought relief.

As part of this project, staff from multiple departments at UC San Diego who are responsible for implementing the Campus Storm Water Management Program will work with the project team and provide access to existing storm water collection and treatment systems on campus for study to evaluate the effectiveness of different bioretention systems, rain gardens, and bioswale designs in removing pollutants from storm water.

The campus is very excited by this project and looks forward to collaborating with the project team .

. Sincere.Iy, O'~

~onnell Storm Water Program Manager Environment, Health and Safety Department 0: (858) 534-6018 C: (858) 583-3259

June 25, 2015

Lisa A. Levin

Scripps Institution of Oceanography

UC San Diego

9500 Gilman Drive

La Jolla, CA 92093-0218

Dear Lisa,

Please accept this letter of support for your proposal to the University of Southern California Sea

Grant Program, entitled “Ecosystem service-based strategies for optimizing natural treatment of

stormwater in southern California”. This proposal is logical extension of your present Sea Grant

work, expanding the scope of examination of ecosystem services from biofilters to include other

natural treatment systems. This area clearly deserves more attention as Southern California

continues to urbanize and increase local water retention and recycling efforts.

The Southern California Coastal Water Research Project Authority (SCCWRP) is a public

agency formed in 1969 to conduct coastal environmental research and convey scientific

understanding to Southern California’s water quality management community. Originally formed

to study the effects of wastewater discharge on the coastal ocean, SCCWRP has grown to

examine a diverse array of water quality and aquatic habitat issues, spanning coastal watersheds,

urban stormwater, wetlands, beaches, bays, and the marine shelf. Our programs examining the

effects of nutrients and contaminants from stormwater and urban runoff on people and marine

organisms in Southern California are ongoing, and your efforts clearly overlap with SCCWRP’s

goals of understanding the links between human activities, watersheds and the coastal ocean.

SCCWRP is pleased to support this proposal in several ways. First, our scientific activities form

a foundation for the management decisions of our 14 member agencies, which include the State

Water Board, the Southern California Regional Boards, City and County municipal wastewater

treatment plants, and regional flood control agencies. We are glad to serve as a bridge to link

your project’s outputs to these and other end users. We would also be delighted to have you

speak about this project and your findings at one of our monthly seminars as an additional way

of helping you reach the management community.

In closing, I enthusiastically endorse the proposed research. If I can be of further assistance,

please contact me at (714) 755-3203 or stevew@sccwrp.org.

Sincerely,

Stephen Weisberg, Ph.D.

Executive Director

University of Southern California Sea Grant Proposal Format and Required Forms

PROJECT TITLE: PHYSIOLOGICAL AND BEHAVIORAL EFFECTS OF ANGLING STRESS ON TWO IMPORTANT GAMEFISH IN SOUTHERN CALIFORNIA, KELP BASS (Paralabrax clathratus) AND BARRED SAND BASS (P. nebulifer). PRINCIPAL INVESTIGATORS: Chris Lowe, Ph.D., California State University Long Beach ASSOCIATE INVESTIGATORS: FUNDING REQUESTED: (Follow form shown below, inserting appropriate dates and figures.) It is necessary to submit a separate budget page for each year of funding requested. 2016-2017 $52,272 Federal/State $27,805 Match 2017-2018 $50,882 Federal/State $28,587 Match STATEMENT OF THE PROBLEM: Kelp bass and barred sand bass have historically supported two of the largest recreational fisheries in southern California for over 60 years, providing valuable economic, social, and ecological functions in coastal communities. However, gamefishes have been experiencing increasing fishing pressures as a result of more anglers engaging in marine recreational activities and an increasing consumption of fish (Calif. Dept. Fish & Game 2009). Fisheries managers, as well as many recreational anglers, are concerned about the sustainability of these fisheries given the escalating pressures and stock declines already observed for many popular species, such as kelp bass and barred sand bass (Erisman et al 2011; Jarvis et al 2014). Stakeholders invested in the future viability of these fisheries are keen to improve our understanding how fishing restrictions are impacting targeted fish stocks and identify ways to improve management of these populations, whether that be through changes in regulation or angler behavior.

Kelp bass and barred sand bass abundances have significantly decreased over the

last two decades, providing a compelling need for an improved understanding of the drivers behind these declines. Both kelp bass and barred sand bass have consistently ranked among the top four most landed gamefish in southern California since the closure of the commercial fishery and growth of the recreational fisheries in the mid-1950’s (Leet et al 2001). Although the commercial marine bass fishery was closed to prevent overfishing, data from commercial passenger fishing vessel (CPFV) logbooks and Marine

Page 1

Recreational Fishery Statistics Surveys (MRFSS, CRFSS) indicate that annual landings by recreational anglers in most years have far exceeded that of the best annual yields in the commercial fishery (Calif. Dept. Fish & Game 2009); thus, the recreation fishery has had a greater impact on these populations than the previous commercial fishery. A contributing factor to this problem is that, in general, recreational fisheries are much more difficult to regulate than commercial fisheries and the higher recreational landings can be attributed to both the growing number of anglers and the accessibility of kelp bass and barred sand bass, particularly while they are in their spawning aggregations from June to August (Love et al 1996; Dotson and Charter 2003; Erisman et al 2011). Because over 80% of the annual barred sand bass landings in the recreational fishery occur during their spawning season, the catch per unit effort (CPUE)) remained relatively stable until 2004; this population hyperstability likely masked concurrent stock declines from fisheries managers, who have only recently become aware of the severity of situation (Erisman et al 2011). Jarvis et al. (2014) found that annual kelp bass landings have declined 70% from 1980’s levels, and annual barred sand bass landings have declined 85% since 2001 alone. Poor larval recruitment over the last 15 years has likely exacerbated stock declines largely driven by overfishing; a Pacific Decadal Oscillation (PDO) regime shift from a warm period to a cooler period in 2000 is attributed with reduced recruitment and population growth for these subtropical species which exhibit higher recruitment during warm regime conditions (Hsieh et al 2005; Jarvis et al 2014). Therefore, it is likely the synergistic effect of fishing pressure and poor recruitment that has prevented these particular gamefish stocks from recovering based on past fisheries harvest control measures.

Mandatory catch and release is a commonly used harvest control management strategy and is the product of fishing regulations intended to mitigate angler activity on stocks; however, the full impacts of this practice have not been investigated for many individual marine species supporting valuable industry. Therefore, there is an urgent need to evaluate the effectiveness and potential impacts of these harvest control measures on targeted fisheries, particularly those species experiencing significant population declines in southern California, like the kelp bass and barred sand bass. In October 2013 fishing regulations for the basses were modified to increase the minimum size limit and reduce the daily bag limit (Calif. Dept. Fish & Game 2013), although a smaller fraction of the population can be legally removed, and sexually mature fish are protected for an additional 2-3 spawning seasons, these changes have also resulted in more total fish being caught, released, and subjected to the sublethal effects of capture and handling. There currently exists a dichotomy of opinion between the fisheries managers, whom assume that released fish survive, grow and reproduce (i.e. contribute to stock renewal), and many anglers who believe that most released fish rapidly die from physical wounds, stress, or predation (Wydoski 1977; Arlinghaus et al 2007). There is a need to determine the true fate of fish after they are released, and the effects of angling and handling on individuals that do survive, in order to evaluate the success of this management strategy for vulnerable fisheries like the kelp bass and barred sand bass.

Physiological and behavioral responses to the angling and handling stresses experienced during catch and release can negatively affect fish health, growth,

Page 2

reproduction, and, ultimately, influence stock dynamics (Wydowski et al 1977; Cooke & Schramm 2007; Donaldson et al 2008); thus it is valuable for fisheries managers to understand and account for these impacts when considering the long-term outcome of particular harvest control measures.

Stress responses have evolved as adaptations allowing fish to overcome challenges

encountered in their natural environment; however, the stresses experienced during catch and release (e.g. extreme exhaustion, air exposure, barotrauma, physical injury, etc.) are often more intense and prolonged than fish may normally endure and can result in detrimental effects on the individual (Anderson et al 1998; Mommsen et al 1999; Thorstad et al 2003; Suski et al 2004; Schreer et al 2005; White et al 2008). Physiological responses to acute stress (e.g. inhibited cardiovascular capacity, immune response, reproductive hormone circulation, and altered metabolism) can instigate behavioral modifications (e.g. reduced movement and space use) that can impair feeding (and ultimately growth), mating activity, and predator avoidance (Pickering 1981; Wendelaar Bonga 1997; Schreck et al 1997; Iwama et al 1998; Mommsen et al 1999). These decreases in growth and reproduction for individuals can have direct, and significant, impacts on the rate of stock recovery. Therefore, it is critical that the sublethal physiological and behavioral effects of angling stress are quantified to identify how angling practices and fishing regulations might be modified to better manage these species and ensure the long-term sustainability of the kelp bass and barred sand bass recreational fisheries.

INVESTIGATORY QUESTION: Q1) What are the physiological and behavioral effects of angling and handling stresses on kelp bass and barred sand bass?

a) What are the baseline (non-catch & release levels) concentrations of cortisol, glucose, and lactate? b) Do fish experience a rapid and significant elevation of these biomarkers after angling and handling? c) What are the baseline, unstressed behavioral characteristics of these fish (i.e. rate of movement, amount of area used)? d) Do fish exhibit a significant change in behavior following catch and release?

Q2) How quickly do fish recover, physiologically and behaviorally, after catch and release (return to their original baseline, unstressed states)? Q3) How does the duration of fight time and air exposure, as well as handling treatment and physical injury, effect the physiological and behavioral stress responses and rate of recovery? MOTIVATION: Given the significantly declining kelp bass and barred sand bass populations there is an urgent need to investigate the potential drivers of these population losses and ways to

Page 3

stem or reverse these trends. One potentially powerful tool is to identify specific angling and handling methods that reduce the stress fish experience during catch and release, thereby helping to mitigate the negative impacts of fishing activity on these populations. With both mandatory and voluntary catch & release, anglers are given little science-based information or have little knowledge of the best ways to handle fish that would decrease stress and ensure more rapid post-release recovery. In other fish species studied, there appears to be a threshold fight time or air exposure duration, after which the likelihood of survival and recovery are greatly reduced (Schreer et al 2005). By quantifying these threshold values for kelp bass and barred sand bass anglers can be educated on the importance of rapidly landing and releasing fish in ways to improve post-release survival and recovery. If anglers are provided with scientific data demonstrating that handling fish properly and releasing fish within the threshold period improves recovery and survival, we will likely see a greater willingness to modify their own behaviors to ensure future fishing opportunities are available and, thus, promote a more sustainable fishery. Although catch and release is a commonly used management strategy in marine and freshwater systems there is a substantial lack of direct scientific evidence supporting the efficacy of these regulations for individual marine fisheries. Although managers assume that most released fish survive, grow, and reproduce, no research has been conducted on kelp bass or barred sand bass to validate these assumptions. By assessing the physiological and behavioral stress responses of caught and released fish, as well as how quickly individuals can recover, this study will provide the much needed data to evaluate the efficacy of current harvest control measures. Quantifying impacts of recreational fishing activity on a gamefish population is often limited to the number of bagged fish reported by CPFVs, and provide little information on how the sublethal effects of catch and release may influence long-term population dynamics. Physiological and behavioral impairments, resulting from angling stress, can lead to reduced individual fish health, growth, reproduction, and, ultimately, diminished stock recovery. By examining the effects of isolated catch and release events on kelp bass and barred sand bass physiology, behavior, and recovery we can resolve the impact that a single angler may have on these gamefish and, thus, better estimate the total impact of the collective angling activity on these targeted stocks. Managers can use the information provided by this study as a metric for predicting how quickly a stock may grow or decline and for enacting appropriate regulations to ensure sustainability. GOALS AND OBJECTIVES:

A. The overall goal of this project is to improve sustainable fishing and management of the southern California kelp bass and barred sand bass populations, by 1) aiding fisheries managers in estimating the long-term effects of catch and release fishing on population growth, and 2) educating recreational anglers on specific ways to reduce the negative effects of their fishing activity and mitigate their impact on these popular gamefish stocks.

Page 4

B. The main objectives of this project for 2015-2016 are to 1) assess the sublethal physiological and behavioral effects of angling and handling stresses on individual fish, 2) quantify the rate of recovery and survival of fish post-release, and 3) identify best angling and handling practices that minimize stress during catch and release.

METHODS: Fish in this study will be collected from coastal southern California waters, including the Wheeler North Artificial Reef (WNAR) in San Onofre, CA (a popular fished artificial reef), and Big Fisherman’s Cove (a no-take marine reserve) on Santa Catalina Island, CA. Blood samples will be collected to evaluate physiological condition and acoustic telemetry will be employed to measure behavioral responses to angling and handling stresses. The protection from fishing afforded by the reserve provides some assurance that fish residing in these areas have not been recently caught and stressed, therefore, only fish sampled from a reserve will be used to quantify the baseline physiological and behavioral characteristics for kelp bass and barred sand bass. Physiological Response to Angling Stress: Physiological Baseline (Control): Baseline concentrations of cortisol, glucose and lactate will be quantified using blood samples collected from 20 individuals per species between June and August 2015 in the Catalina Island Marine Life Reserve (CIMLR). Fish will be angled using barbless hook and line and a blood sample (0.2 – 0.8 mL whole blood) will be collected in < 3-5 min of the fish being hooked. Blood will be collected by caudal vein puncture, using a 1 cc heparinized syringe (to prevent blood clotting) and centrifuged for 5 min at x10,000 rpm to isolate the plasma. Decanted plasma will be frozen in liquid nitrogen, to prevent protein degradation during transport to CSULB, where samples will be stored in a -80°C freezer until processed. After blood is collected, fish will be measured (SL cm), weighed (g), and externally tagged with a spaghetti tag (8 cm long x 1.5 mm diameter; unique serial number) through the dorsal musculature (Lowe et al 2003; Topping et al 2005, 2006). Fish will be released at the site of capture and location coordinates will be recorded. Because there is a delay between the initiation of stress and when a measurable elevation of cortisol occurs, a blood sample collected in <3 min of the fish being initially hooked will reflect the pre-angling, baseline concentration of the hormone (Mommsen et al 1999; Grutter & Pankhurst 2000; Lowe & Kelley 2004). In a previous catch & release study, California sheephead (Semicossyphus pulcher) were observed to not produce an appreciable rise in cortisol until at least 10 min after fish were hooked (Galima 2004; Lowe & Kelley 2004). Glucose also exhibits a delayed response, as glucose synthesis is stimulated by elevated cortisol levels (Mommsen et al 1999; Grutter & Pankhurst 2000). In California sheephead, elevated glucose levels were not detected until 10 min (20 min post hooking) after a rise in cortisol was observed (Galima 2004; Lowe & Kelley 2004). Because lactate production is directly correlated with swimming exertion (e.g., prolonged anaerobic muscle activity), metabolite levels measured within 3 min of hooking should represent basal levels; however, within 10 min of hooking, angling and holding, blood lactate levels should be significantly elevated (Galima 2004; Lowe & Kelley 2004).

Page 5

Therefore, rapidly blood sampling (< 3 min post hooking) individuals within the CIMLR should provide realistic baseline levels of these important stress-related biomarkers. The external tags will aid in identifying previously sampled individuals if recaptured at any point throughout the study. The CSULB Shark Lab contact information is also advertised on the tag, allowing anglers to report their catch if an individual is bagged outside the reserve. Physiological Stress Response: To quantify the endocrine stress response kelp bass and barred sand will be caught at WNAR between Sept 2015 and June 2016, and at CIMLR between June 2015 and Sept 2016. To obtain realistic measures of angling related stress, we will be collaborating with commercial passenger fishing vessels (CPFVs) and sportfishing clubs and will quantify angling, handling, and holding effects from fish caught by participating anglers. Once landed, fish will be held in an onboard bait-well with circulating seawater for 10, 15, and 20 min before a blood sample is collected; this delay is a standardized period allowing cortisol elevation and circulation to stimulate glucose production (Mommsen et al 1999; Lowe & Kelley 2004) and will allow us to identify a significant stress response and a response peak. Fish will also be measured (SL cm), weighed (g), externally tagged, and capture location will be recorded before fish are released at the site of capture.

Since all fish in this experiment will be held for the fixed amount of time (10, 15, and 20 min) post landing, it is expected that any variation in biomarker levels will be attributed to differences in angling time and handling. The length of time fish are fought on the line (i.e. Angling Time) and exposed in air (i.e. Handling Time) will be recorded for each individual and will likely vary depending on the fish, the sea conditions, and the angler’s skill and experience. Detailed notes on the handling procedure (e.g. dropped on deck, carried by gills, etc.) and the fish’s physical condition (e.g. visible injury, hook location, bleeding from gills, etc.) will be recorded. The Total Sample Time will include the Angling Time, Handling Time, the standard holding period (10, 15, 20 min), and the time until the fish is released. These stressor categories and times will allow for an assessment of the relative effects of each element in the catch and release process on cortisol, glucose and lactate concentrations, as well as identify angling practices that minimize stress on fish. Physiological Recovery: Fish recaptured at WNAR or CIMLR will be immediately blood sampled (< 3 min post hooking) if recaptured at any point throughout the study to evaluate the recovery of individuals after varying hours or days at liberty. Blood from recaptured fish will be collected < 3 min of fish being hooked to ensure the physiological state of the fish is sampled before the stress response to the current capture event occurs and biomarkers levels become elevated. Fish will likely be caught after a range of time at liberty, allowing us to determine the rate of recovery back to baseline levels of cortisol, glucose, and lactate following the initial catch and release. Recaptured fish will also be measured (SL cm), weighed (g), and notes on physical condition will be recorded before fish are released.

Page 6

Blood Sample Analysis: Plasma cortisol from samples will be quantified using enzyme immunoassays (EIA), while whole blood glucose and lactate will be measured using a hand-held OneTouch UltraMini glucose meter and a Lactate Plus meter in the field. The accuracy and precision of the portable glucose and lactate meters will be calibrated using glucose and lactate standards. Portable glucose and lactate meters have been proven comparable to other methods of analysis (Wells & Pankhurst 1999; Beecham et al 2006) and have the additional advantage of being less expensive, faster, and can be applied in a field setting. Statistical Analysis (Physiology): To ensure that we are able to measure an appreciable increase in biomarkers levels, we will compare the three holding time periods (10, 15, 20 min) to identify when levels peak for each species. We hypothesized that based on results from California sheephead, that the basses should also show significant increases in all three biomarkers within 15 min post angling and holding. To determine whether there is significant elevation of cortisol, glucose, and lactate after angling and handling stress we will compare each biomarker level measured from control fish (n = 25) against the biomarker level measured from fish captured and held before sampling (n= 25)(i.e. ‘stressed fish’). We expect to see a significant elevation in cortisol, glucose, and lactate indicating that angling and holding does result in a rapid and systemic stress response. Effects of angling time, handling time, and holding time (10, 15, 20 min) will be evaluated for each biomarker using a General Linear Model. The rate of recovery will be determined by comparing biomarker levels from recaptured (and rapidly sampled) fish (n > 25), after varying days at liberty, with the biomarker levels of control fish (baseline; n = 25) using an ANOVA. Behavioral Response to Angling Stress: Behavioral Baseline - Control: Normal (i.e. unstressed) behavior will be determined by monitoring the movements of 10 kelp bass and 10 barred sand bass in the CIMLR between June 2015 and August 2016. Transmitters, outfitted with depth and motion sensors (Lotek Wireless Inc, USA; MM-M-8-SO-PM), will be hidden inside a piece of squid and hand-fed to fish by SCUBA divers, thus, avoiding any stress caused by angling and handling (Winger et al 2002; Lowe and Kelley 2004). Fish will be actively tracked for 24 hrs or until the transmitter is regurgitated, at which point the transmitters will be recovered and used to monitor additional fish. An array of four underwater acoustic receivers (Lotek Wireless Inc; WHS3250) will be deployed at strategic locations around the CIMLR to use the UMAP system (Lotek Wireless, USA), which can trilaterate accurate fish location data if the signal is detected by 3 or more receivers. These acoustic tags transmit every 2 seconds coded pings containing the fish’s unique ID number, a motion (binary) value and a depth value which is recorded by each receiver detecting the signal. Lotek transmitters (MM-M-8-SO-PM) are 8.5 mm x 42 mm cylindrical tubes, weigh 5.5 g in water, have an expected battery life of 21 days, and have a 2 sec transmission rate of signals at 76 kHz. Activity rate and space use will be measured over the course of the 24 hr track to establish an unstressed baseline of behavior for these known home ranging fish (Lowe et al. 2003, Mason and Lowe 2010).

Page 7

Stress Behavior: To evaluate the effects of angling and handling stress on kelp bass and barred sand bass behavior 10 individuals of each species will be captured in the CIMLR using typical recreational angling methods. Fish will be anesthetized in MS-222 (75 mg/l; Schreck & Moyle 1990) before a small incision is made in the abdominal cavity; a wax-coated transmitter (paraffin-beeswax to reduce chance of immune rejection of the transmitter) will be inserted and the wound closed with 2 or 3 interrupted sutures of Chromic gut (Lowe et al. 2003; Mason and Lowe 2010). Immediately following surgery, fish will be measured (SL cm), weighed (g), and externally tagged with a spaghetti tag, as described previously, and released at the site of capture. Fish will actively tracked for 24 hrs upon release and further monitored by the acoustic array for the duration of the transmitter battery life. By monitoring movement and activity immediately after catch and release, and over time as the fish resumes normal behavior, we can assess the recovery rate of that individual. Previous experience with tagging and surgery on kelp bass and barred sand bass suggests that the survival rates of these fish are very high (>90%, Lowe et al. 2003; Mason & Lowe 2010; McKinzie et al. 2014), therefore, we expect to observe similar survival rates in this study. Statistical Analysis (Behavior): Daily activity space will be measured using 95% and 50% Kernel Utilization Distributions (KUDs) or biased random bridges determined from the active tracking data. KUD values are calculated as the area encompassed during a 24 hr monitoring period in which the fish can be found with a 50% or 95% probability, whereas bias random bridges provide much better measures of space use around complex habitats. These space use metrics can reflect the total daily area use of individual fish, as well as their home-range, and if tracks are georeferenced with benthic habitat maps then KUDs can also provide insight into habitat selectivity. It is predicted that stressed fish will move less than unstressed fish, and therefore, initial space use will be significantly smaller for stressed individuals than for control fish, but space use will increase to control fish levels as they recover. It is also expected that stressed fish will exhibit lower rates of movement (i.e., less active) immediately following release, but will increase their rates of movement as they recover. To determine whether activity rate is significantly different in fish after angling and handling stress and to account for natural diel differences in movement behavior, the first 24 hrs of tracking will be divided into 4 hr bins and mean space use and rate of movement (motion values) of each sequential period between the stressed and control fish will be compared using an ANOVA. To evaluate the effects of angling, handling, and holding duration on first 4 hrs of space use and rate of movement we will use General Linear Models. To quantify the rate of behavioral recovery we will use Repeated-Measure ANOVAs to compare the space use and motion values (4 hr bins) from the first 24 hrs of monitoring against the motion values from the corresponding periods on days 3 and 7 post-release. RELATED RESEARCH: The foundation for the experimental design of this study is based upon previous research conducted by Lowe and Kelley (2004) on California sheephead. This 2004 project was the first of its kind to integrate physiology and behavior into catch and release

Page 8

research and, ultimately, this study was able to provide both valuable insights into the potential effects of angling activity on sheephead populations, as well as an effective methodological framework for future angling stress research on other gamefish species. The 2004 sheephead research was similar to the current study in that they investigated the physiological stress responses of fish caught using recreational hook and line methods and the relative effects of increased angling and handling time. Blood samples collected from fish exposed to angling and handling stressors were analyzed to measure the levels of plasma cortisol, the major stress-regulating hormone, glucose, an index of energy availability, and lactate, a metric of physical exertion. The blood sampling protocol of the current project is based on results of the sheephead work which indicated a significant elevation in plasma cortisol occurred 10 min after angling stress was induced, and following the cortisol surge glucose was significantly elevated after 20 min, while lactate showed significant elevation in each sampling period (5, 10, 20 min). Therefore, sampling fish within 3 min of fish being hooked is sufficiently rapid to characterize the baseline state of these biomarkers. The previous sheephead study also monitored the stress response peak and recovery by sampling fish captured and confined in a live-well for varying amount of time (10, 20, 30, 45 min, 1 hr, 2 hr), as well as periodic sampling fish over a 30 day period in a captive setting. Results indicated that cortisol levels peaked after 45 min, but were still highly elevated above baseline 2 hrs after capture; similarly, glucose levels peaked after 45 min before leveling off, while lactate levels increased in each sampling period. These data indicate that while angling and handling elicited a significant stress response that lasted for several hours, sampling 10-20 min after initial stress would be sufficient to identify the presence of a significant stress response. There was also appreciable variation in physiological response at the shorter time periods indicating potentially different responses associated with angling and handling when compared to vary low variability observed from control sampled fish. Results of the 30-day confinement experiment indicated that while cortisol, glucose, and lactate concentrations had largely recovered by day 14, cortisol levels never actually returned to control levels. This was attributed to the additional stress of being held in captivity. However, Lowe & Kelley (2004) also recaptured previously sampled sheephead in the wild and found that if released back into their natural environment these individuals showed a complete recover to baseline levels within 18-24 hrs. These results clearly support the need of conducting these types of studies in the field rather than just under controlled laboratory conditions (Muoneke & Childress 1994; Skomal 2007; Donaldson et al 2008). The Lowe and Kelley (2004) sheephead study also measured behavioral responses of fish caught and release using acoustic telemetry methods. By tagging fish with acoustic transmitters and actively tracking individuals for multiple 24 hr periods, they were able to determine changes in area use and rate of movement (ROM) in response to angling and handling stressors, as well as quantify the rates of survival and recovery. They found that sheephead caught and surgically fitted with acoustic transmitters used less area and showed a lower rate of movement over the first 12 hrs of tracking than fish fed acoustic transmitters hidden in bait. However, there was no difference in the amount of area used and rates of movement of those caught, tagged and release fish after 18 hrs when compared with areas use and movement rate of control fish. These results suggest that

Page 9

sheephead caught and release show both a physiological and behavioral recovery of baseline levels within 18 hrs after release. We expect to see similar results with the basses as was observed with sheephead, including slower ROM, decreased area use, and reduced total distance moved for the first 6 hrs following release –but returning to normal within 48 hrs. The proposed bass study differs from, and improves upon, the experimental design of Lowe & Kelley (2004) in several important ways. The sheephead results indicated a peak cortisol and glucose response 45 min after initial stress; however, we predict that 10-20 min is sufficient time to observe a significant response in those biomarkers. Rather than repeat that part of the experimental design, we will only be holding fish for 3 time periods, assuming that we will be able to measure significant rises in biomarkers within 15 min and that variation in levels are attributed to different aspects of stress from angling and handling. The proposed study will also involve sampling fish from the WNAR area which is heavily exploited by the recreational fishery and where the catch history of individual fish will be unknown. However, this will allow us to compare the stress responses of MPA fish (where there is some assurance that fish have not been recently caught) with the potentially reduced stress response of WNAR fish which may have been recently caught and released multiple times (Gilmour et al 1994; Mesa 1994). In addition, fishing at WNAR will also allow us to establish a collaborative relationship with the sportfishing community and involving anglers in this research to build understanding and buy-in of scientific results. BUDGET-RELATED INFORMATION: A. SALARIES AND WAGES. The salary rates are based on the California State University

and CSULB Research Foundation established salary rate(s) paid during the Academic year. Faculty in the California State University system’s duties consists of 24 units per nine month Academic year. If applicable, the salary and wage rates for faculty employees include a projected 3% salary increase per year. The rates shown are for budgetary purposes; the actual rates in effect at the time the work is performed will be charged to the project.

Senior Personnel. Dr. Chris Lowe, PI, will devote 1.13 academic month(s) during year 1 and 2 (release time of 3 units out of a load of 12 units per semester) to carry out administrative, organizational, and research duties associated with the project. Organizational, research, and administration duties are outlined in the Project Plan. B. Fringe Benefits. Full time benefits for Release time and Assigned time include a benefit

package consisting of FICA, State Unemployment Insurance (SUI), Worker's Compensation, non-industrial leave including vacation and sick leave, medical, dental, and life insurance benefits, and retirement benefits (PERS). Rates vary with the number of dependents and type of coverage. Currently the rate of 42.3% is being used for budgetary purposes. Only actual rates in effect for each individual at the time the work is performed will be charged to the sponsor.

Page 10

C. Travel: • Domestic Travel: Nominal funds ($1000 in year 1 and $2000 in year two) have

been requested to assist with travel for either PI or one graduate student to a national meeting (e.g. Western Society of Naturalists, American Fisheries Society), including registration, hotel and transportation costs.

D. SCHOLARSHIPS/FEES/SUPPORT.

• Number of Participants: 1 • Fees: Are provided for each year for one (1) SeaGrant trainee ($19,500) • Travel: N/A • Subsistence: N/A • Other costs: N/A

E. Other Direct Costs.

• Operating Expenses: o Lotek acoustic transmitters (10 each year at a cost of $605 per transmitter) o Field Expendables – fishing tackle, surgical supplies for transmitter

implantation, blood sampling, tissue preservation, and blood chemistry test kit supplies - $2124 for year 1 and $1425 for year 2)

o Cortisol EIA kits to allow for over 300 samples ($4961 year 1) and 150 samples ($2640) for year 2.

o Boat fuel (@ $4.95/gal) for tracking and fishing ($2500 year 1 and $2000 year 2)

o Housing and lab fees for 2 people at Wrigley Marine Lab for $2500 for year 1 and $2500 for year 2.

F. Indirect Costs. CSULB’s Federal negotiated indirect rate is 47.5% (on campus rate) on a base of modified total direct costs as stipulated in the institution’s indirect cost rate agreement with DHHS dated August 8, 2012. G. Cost Share/Match (Required Obligation). The proposal with USC Sea Grant is supported between the Biological Sciences Department and CNSM (As agreed upon with Dean Kingsford and Chair Livingston). The cost match on the requested amount of $103,153 is $56,392 for project period 02/01/2016- 01/31/2018) and is provided as follows:

• Salary and Fringe: o Chris Lowe, Co-I: $22,681 + $9,603 = $32,285 year1 + year 2

Approx. 1.13 academic month(s) per project period (release time of 3 units out of a load of 12 per semester) Prof. Lowe will be responsible for study design and overseeing data collection, management, analysis and interpretation. The PI will participate in field sampling efforts and experimental studies. The PI will supervise the Sea Grant trainee.

Page 11

o Volunteer salary foregone. There will be as many as 5 University volunteers working on this project at any time contributing 2500 hrs of effort per year at $12/hrs, totally $6,000 in total effort.

• Forgone F&A: $18,107

• Total Cost Match: $56,392

ANTICIPATED BENEFITS: This research will provide both anglers and managers with valuable scientific data needed to quantify catch and release impacts on two of the most important recreational fisheries in southern California, but also provide science-based guidelines for best practices to further enhance efficacy of mandatory catch and release. Conclusions from this project are expected to have immediate and long-term benefits for recreational fishers targeting kelp bass and barred sand bass in southern California, as well as provide managers with better information on post-release success needed for adaptive management. By having immediate and easy access to information and training on the recommend ways to minimize stress on fish during catch and release anglers will have all the resources needed to assess the merit of modifying their own fishing practices in order to mitigate their impact on these populations. Anglers that participate and contribute to this project will benefit by learning about how we measure fish stress and why handling fish in certain ways may be important for their post-release survival and future population growth will be invaluable in convincing them that these management practices actually work and will promote buy-in of scientific results. Often anglers are reluctant to abide by the current fishing regulations because they see no evidence, or scientific research, verifying the restrictions are effective or necessary for population sustainability. With the results from this study, managers will have the data to assess whether the individual-level effects of angling and handling are minimal enough to support catch and release as an effective long-term management strategy. Managers and regulatory agencies can then use this information, together with improved angler education, to improve recognition and acceptance among the fishing community of the value of these policies. Additionally, by evaluating the impacts of catch and release on individual fish and the stock as a whole managers will gain a better understanding of how the current fishing regulations can be modified to enhance stock recovery and growth. In addition, this experimental design can become a model for use in other fisheries around the country and world. By combining these methods and techniques, we have the ability to better assess post-release survivorship, develop better angler education programs, and provide opportunities for citizen participation in research that is directly relevant to them. COMMUNICATION OF RESULTS: Results from this study will be presented in a variety of formats in order to reach the many user groups, government agencies, and other stakeholders that will benefit from this information. Upon completion of this project a technical report will be written for Sea Grant detailing the effects of catch and release on individual fish and our recommendations for best angling and handling practices. This report will be available to government agency

Page 12

employees, including those personnel responsible for management and policy for the southern California marine fisheries. To reach the wider academic world and contribute to field of marine and fisheries sciences, results of this study will be published in an appropriate peer-reviewed journal like the Canadian Journal of Fisheries and Aquatic Sciences, which publishes manuscripts related to fish ecology and management, or a journal like Comparative Biochemistry and Physiology –Part A, where the focus is on marine molecular and physiological processes. The findings of this study will also be communicated to other scientists and academics through presentations at research conferences (e.g. American Fisheries Society, Southern California Academy of Sciences, Western Society of Naturalists, etc) and scientific society meetings (e.g. American Institute of Fisheries Research Biologists).

We believe the findings of this study will be a great benefit to resource managers, whom will need this information to better inform stock models and improve on regulations that increase fishing opportunities, while increasing rate of stock recovery. We will provide our findings via reports, presentations and workshops to biologists and managers at Calif. Dept. of Fish & Wildlife and other persons involved in management or policy-making for California’s marine recreational fisheries.

Additional presentations and workshops will be organized for the public through the

Sportfishing Conservancy, Sportfishing Association of California (e.g., CPFV operators and crew), as well as for local fishing clubs (e.g. Los Angeles Rod & Reel Club, Southern California Tuna Club, Dana Point Yacht Club, etc), to educate anglers on catch and release and best fishing practices to minimize the negative stress based on the scientific findings from this project. This information will also be available to the public through the CSULB Shark Lab website (http://www.csulb.edu/explore/shark-lab), Facebook page (CSULB SharkLab), and Twitter feed (@CSULBSharkLab) where the project investigators will post updates on the study’s progress and data collection throughout the duration of the project. REFERENCES: Anderson, W., Booth, R., Beddow, T., McKinley, R., Finstad, B., Økland, F., Scruton, D. 1998.

Remote monitoring of heart rate as a measure of recovery in angled Atlantic salmon, Salmo salar (L.). In: Advances in Invertebrates and Fish Telemetry. Springer. pp 233-240.

Arlinghaus, R., Cooke, S. J., Lyman, J., Policansky, D., Schwab, A., Suski, C., Sutton, S. G., Thorstad, E. B. 2007. Understanding the complexity of catch-and-release in recreational fishing: an integrative synthesis of global knowledge from historical, ethical, social, and biological perspectives. Reviews in Fisheries Science 15. pp 75-167.

Beecham, R. V., Small, B. C., Minchew, C. D. 2006. Using Portable Lactate and Glucose Meters for Catfish Research: Acceptable Alternatives to Established Laboratory Methods? North American Journal of Aquaculture 68. pp 291-295.

California Dept. Fish & Game. 2009. Review of selected California fisheries for 2009: coastal pelagic finfish, market squid, red abalone, Dungeness crab, Pacific herring, groundfish/nearshore live-fish, highly migratory species, kelp, California halibut, and sandbasses. Fisheries Review. California Cooperative Oceanic Fisheries Review 51. pp 14-38

Cooke, S. J., Schramm, H. L. 2007. Catch-and-release science and its application to conservation and management of recreational fisheries. Fisheries Management and Ecology 14. pp 73-79.

Page 13

Donaldson, M. R., Arlinghaus, R., Hanson, K. C., Cooke, S. J. 2008. Enhancing catch‐and‐release science with biotelemetry. Fish and Fisheries 9. pp 79-105.

Dotson, R., Charter, R. 2003. Trends in the Southern California sport fishery. California Cooperative Oceanic Fisheries Investigations Report. pp 94-106.

Erisman, B. E., Allen, L. G., Claisse, J. T., Pondella, D. J., Miller, E. F., Murray, J. H. 2011. The illusion of plenty: hyperstability masks collapses in two recreational fisheries that target fish spawning aggregations. Canadian Journal of Fisheries and Aquatic Sciences 68. pp 1705-1716.

Galima, M. M., Lowe, G., Kelley, K. 2004. Catch-and-release stress and its impacts on the endocrine physiology of the California sheephead, Semicossyphus pulcher. In: Integrative and Comparative Biology: pp 555-555.

Gilmour, K. M., Didyk, N. E., Reid, S. G., Perry, S. F. 1994. Down-regulation of red blood cell beta adrenoreceptors in response to chronic elevation of plasma catecholamine levels in the rainbow trout. Journal of Experimental Biology 186. pp 309-314.

Grutter, A. 2000. The effects of capture, handling, confinement and ectoparasite load on plasma levels of cortisol, glucose and lactate in the coral reef fish Hemigymnus melapterus. Journal of Fish Biology 57. pp 391-401.

Hsieh, C-h, Reiss, C. S., Hunter, J. R., Beddington, J. R., May, R. M., Sugihara, G. 2006. Fishing elevates variability in the abundance of exploited species. Nature 443. pp 859-862.

Iwama, G. K. 1998. Stress in Fish. Annals of the New York Academy of Sciences 851. pp 304-310. Jarvis, E. T., Gliniak, H. L., Valle, C. F. 2014a. Effects of fishing and the environment on the long

term sustainability of the recreational saltwater bass fishery in southern California. Jarvis, E. T., Loke-Smith, K. A., Evans, K., Kloppe, R. E., Young, K. A., Valle, C. F. 2014b.

Reproductive potential and spawning periodicity in barred sand bass (Paralabrax nebulifer) from the San Pedro Shelf, southern California. California Fish and Game 100. pp 289-309.

Leet, W. S. 2001. California's living marine resources: A Status Report. UCANR Publications. Love, M.S., Brooks, A., Ally, J. R. R. 1996. An analysis of commercial passenger fishing vessel

fisheries for kelp bass and barred sand bass in the Southern California Bight. California Fish and Game 82. pp 105-121.

Lowe, C. G., Kelley, K. 2004. Catch and release of California sheephead: physiological and behavioral stress effects and post-release survival. California Sea Grant College Program – Final report.

Lowe, C.G., Topping, D. T., Cartamil, D. P., Papastamatiou, Y. P. 2003. Movement patterns, home range, and habitat utilization of adult kelp bass Paralabrax clathratus in a temperate no-take marine reserve. Marine Ecology Progress Series 256. pp 205-216.

Mason, T. J., Lowe, C. G. 2010. Home range, habitat use, and site fidelity of barred sand bass within a southern California marine protected area. Fisheries Research 106. pp 93-101.

McKinzie, M. K., Jarvis, E. T., Lowe, C. G. 2014. Fine-scale horizontal and vertical movement of barred sand bass, Paralabrax nebulifer, during spawning and non-spawning seasons. Fisheries Research 150. pp 66-75.

Mesa, M. G. 1994. Effects of multiple acute stressors on the predator avoidance ability and physiology of juvenile chinook salmon. Transactions of the American Fisheries Society 123. pp 786-793.

Mommsen, T. P. 1999. Cortisol in teleosts dynamics, mechanisms of action, and metabolic regulation. Reviews in Fish Biology and Fisheries 9. pp 211-268.

Muoneke, M. I., Childress, W. M. 1994. Hooking mortality: a review for recreational fisheries. Reviews in Fisheries Science 2. pp 123-156.

Pickering, A.D. 1981. Stress and fish. Academic Press. Schreck, C. B., Olla, B., Davis, M., Iwama, G., Pickering, A., Sumpter, J., Schreck, C. 1997.

Behavioral responses to stress. Fish stress and health in aquaculture 62. pp 145-170.

Page 14

Schreck, C. B., Moyle, P. B. 1990. Methods for fish biology. American Fisheries Society Bethesda, Maryland.

Schreer, J. F., Resch, D. M., Gately, M. L., Cooke, S. J. 2005. Swimming performance of brook trout after simulated catch-and-release angling: looking for air exposure thresholds. North American Journal of Fisheries Management 25. pp 1513-1517.

Skomal, G. 2007. Evaluating the physiological and physical consequences of capture on post release survivorship in large pelagic fishes. Fisheries Management and Ecology 14. pp 81-89.

Suski, C. D., Killen, S. S., Cooke, S. J., Kieffer, J. D., Philipp, D. P., Tufts, B. L. 2004. Physiological significance of the weigh-in during live-release angling tournaments for largemouth bass. Transactions of the American Fisheries Society 133. pp 1291-1303.

Thorstad, E. B., Næsje, T. F., Fiske, P., Finstad, B. 2003. Effects of hook and release on Atlantic salmon in the River Alta, northern Norway. Fisheries Research 60. pp 293-307.

Topping, D. T., Lowe, C. G., Caselle, J. 2005. Home range and habitat utilization of adult California sheephead, Semicossyphus pulcher (Labridae), in a temperate no-take marine reserve. Marine Biology 147. pp 301-311.

Topping, D. T., Lowe, C. G., Caselle, J. E. 2006. Site fidelity and seasonal movement patterns of adult California sheephead Semicossyphus pulcher (Labridae): an acoustic monitoring study. Marine Ecology Progress Series 326. pp 257-267.

Wells, R. M., Pankhurst, N. W. 1999. Evaluation of simple instruments for the measurement of blood glucose and lactate, and plasma protein as stress indicators in fish. Journal of the World Aquaculture Society 30. pp 276-284.

Wendelaar Bonga, S. E. 1997. The stress response in fish. Physiological Reviews 77. pp 591-625. White, A. J., Schreer, J. F., Cooke, S. J. 2008. Behavioral and physiological responses of the

congeneric largemouth (Micropterus salmoides) and smallmouth bass (M. dolomieu) to various exercise and air exposure durations. Fisheries Research 89. pp 9-16.

Wydoski, R. S. 1977. Relation of hooking mortality and sublethal hooking stress to quality fishery management. Catch-and-release fishing as a management tool. Humboldt State University, Arcata, California. pp 43-87.

Page 15

Projected Work Schedule

Project Title: Physiological and behavioral effects of angling stress on two important game fish in southern California, kelp bass (Paralabrax clathratus) and barred sand bass (P. nebulifer).

Activities 2016-2017

F M A M J J A S O N D J

Fishing & Blood sample collection

(Physiology Stress exp.)

x x x x x x x

Fishing & Blood Sample collection

(Physiology Control)

x x x x

Behavioral Tracking w/

acoustic transmitters

(control)

x x x x

Behavioral tracking with

acoustic transmitters (stress exp.)

x x x x x

Cortisol analysis using EIA methods

x x x x x

Data analysis and final report

writing x x x x x

Page 16

Budget – Year 1

OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: USC Sea Grant GRANT/PROJECT NO.:

DURATION (months): 24

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: Lowe 1 1.1 11,173 11,173b. Associates (Faculty or Staff):

Sub Total: 1 1.1 11,173 11,173

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians:h. Other:

Total Salaries and Wages: 1 1.1 11,173 11,173

B. FRINGE BENEFITS: 42.3% 4,731 4,731Total Personnel (A and B): 15,904 15,904

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT:Lotek AP transmitters (10 @$605) 6,050Cortisol EIA kits (15 @ $330) 4961.25

fishing supplies and tackle 500boat fuel 2,500Lactate test strips (25/vial @$51.50 X 8) 412OneTouch Ultra Mini glucose meter (2 units @ $26) 52meter control solutions (lactate and glucose) 560syringes and tissue tubes 675heprin and other assay reagents 425

Total supplies: 16,135 0

E. TRAVEL:1. Domestic 1,0002. International

Total Travel: 1,000 0

F. PUBLICATION AND DOCUMENTATION COSTS:

G. OTHER COSTS:1. Housing and lab fees at Wrigley Marine Lab 2,5002. Volunteer effort dedicated to fishing (250 hrs @ $12/hr) 3,000

Total Other Costs: 2,500 3,000

TOTAL DIRECT COST (A through G): 35,539 18,904

INDIRECT COST (On campus 46.5/47.5% ): 208.333333 16,733 8,901INDIRECT COST (Off campus % of $ ):

Total Indirect Cost: 16,733 8,901

TOTAL COSTS: 52,272 27,805

PRINCIPAL INVESTIGATOR: Chris Lowe

BRIEF TITLE: Physiological and behavioral effects of angling stress on kelpand barred sand bass

Page 17

Budget – Year 2

OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: USC Sea Grant GRANT/PROJECT NO.:

DURATION (months): 24

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: 1 1.1 11,508 11,508b. Associates (Faculty or Staff):

Sub Total: 1 1.1 11,508 11,508

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians:h. Other:

Total Salaries and Wages: 1 1.1 11,508 11,508

B. FRINGE BENEFITS: 42.3% 4,873 4,873Total Personnel (A and B): 16,381 16,381

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT:Lotek motion/pressure transmitters (10 @ $605) 6,050surgical materials (sutures, surgical tools, MS222) 925boat fuel 2,000fishing tackle 500Cortisol EIA kits (8 @ $330) 2,640

Total supplies: 12,115

E. TRAVEL:1. Domestic 2,0002. International

Total Travel: 2,000

F. PUBLICATION AND DOCUMENTATION COSTS: 1,500

G. OTHER COSTS:1. Housing and lab fees at Wrigley Marine Lab 2,5002. Volunteer effort dedicated to fishing (250 hrs @ $12/hr) 3,000

Total Other Costs: 2,500 3,000

TOTAL DIRECT COST (A through G): 65% 34,496 19,381

INDIRECT COST (On campus 47.5%): 16,386 9,206INDIRECT COST (Off campus of $ ):

Total Indirect Cost: 16,386 9,206

TOTAL COSTS: 50,882 28,587

PRINCIPAL INVESTIGATOR: Chris Lowe

BRIEF TITLE: Physiological and behavioral effects of angling stress on kelpand barred sand bass

Page 18

BRIEF CURRICULUM VITAE

NAME ___Christopher G. Lowe_____________________________________________ Address __Dept. of Biological Sciences, CSULB, 1250 Bellflower Blvd, Long Beach, CA 90840__ Phone (work) 562-985-4918_(cell) 562-212-7104 _Email: chris.lowe@csulb.edu EDUCATION PhD. Zoology - University of Hawaii at Manoa, Hawaii 1998 MS Biology – California State Univ. Long Beach, California 1991 BA Marine Biology – Barrington College, Rhode Island 1985 POSITIONS HELD 8/07-pres. Professor, Dept. of Biological Science, California State Univ. Long Beach 5/04-7/07 Associate Professor, Dept. of Biological Science, California State Univ. Long Beach 8/98-4/04 Assistant Professor, Dept. of Biological Science, California State Univ. Long Beach 8/97-8/98 Research Assistant, Hawaii Institute of Marine Biology, University of Hawaii. 9/88-8/91 Teaching Assistant, California State University Long Beach. SELECTED PUBLICATIONS Bernal, D. and C.G. Lowe. In press. Field physiology. In: R.E. Shadwick, A.P. Farrell, C.J. Brauner (eds.). Fish Physiology: Physiology of Elasmobranch Fishes. Vol 34A. Academic Press: Papastamatiou, Y.P., Y. Watanabe, D. Bradley, L. Dee, K. Weng, C.G. Lowe, J. Caselle. 2015. Drivers of daily routines in an ectothermic marine predator: Hunt warm, rest warmer. PLoS One. DOI: 10.1371/journal.pone.0127807 Wolfe, B., C.G. Lowe. 2015. Movement patterns, habitat use and site fidelity of the white croaker (Genyonemus lineatus) at the Palos Verdes Super Fund Site, Los Angeles, California. Marine Environmental Research. 109:69-80. Ahr, B., M. Farris, C.G. Lowe. 2015. Habitat selection and utilization of white croaker (Genyonemus lineatus) in the Los Angeles and Long Beach Harbors and the development of predictive habitat use models. Marine Environmental Research. 108:1-13. Freedman, R., C. Whitcraft, C.G. Lowe. 2015. Connectivity and movements of juvenile predatory fishes between discrete restored estuaries in southern California. Marine Ecology Progress Series. 520:191-201. McKinzie, M.K., E.T. Jarvis, and C.G. Lowe. 2014. Fine-scale horizontal and vertical movements of barred sand bass, Paralabrax nebulifer, during spawning and non-spawning seasons. Fisheries Research. 150:66-75.

Page 19

Lyons, K., R. Lavado, D. Schlenk, C.G. Lowe. 2014. Bioaccumulation of organochlorine contaminants in southern California stingrays (Urobatis halleri) and biochemical indicators of exposure to planar aromatic compounds. Environmental Toxicology & Chemistry. 33(6):1380-1390. TinHan, T., B. Erisman, O. Aburto-Oropeza, A. Weaver, D. Vazquez-Arce, C.G. Lowe. 2014. Residency and seasonal movements in Lutjanus argentiventris and Mycteroperca rosacea at Los Islotes Reserve, Gulf of California. 501:191-206. Lyons, K, E.T. Jarvis, S. Jorgensen, K. Weng, J. O’Sullivan, C. Winkler, C.G. Lowe. 2013. Assessment of degree and result of fisheries interactions with juvenile white sharks in southern California via fishery independent and dependent methods. Fisheries Research. 147:370-380. Clark, C.M., C. Forney, E. Manii, D. Shinzako, M. Farris, M. Moline, C.G. Lowe. 2013. Tracking and following of a tagged leopard shark with an autonomous underwater vehicle. Journal of Field Robotics. 30(3):309-322. Loke-Smith, K.A., A.J. Floyd, C.G. Lowe, S.L. Hamilton, J.E. Caselle, and K.A. Young. 2012. Reassessment of the fecundity of California sheephead. Marine and Coastal Fisheries: Dynamics, Management, and Ecosystem Science. 4:599-604. Rogers, B.L., C.G. Lowe, and E. Fernandez-Juricic. 2011. Does fishing-related eye trauma (exophthalmia) affect the visual performance of rockfish (Sebastes rosaceus). Fisheries Research. 112(2011):1-7. Mull, C.G., C.G. Lowe, and K.A. Young. 2010. Seasonal reproduction of female round stingrays (Urobatis halleri): Steriod hormone profiles and assessing reproductive state. General and Comparative Endocrinology 166(2010):379-387 Rogers, B.L., C.G. Lowe, E. Fernandez-Juricic, and L.R. Frank. 2008. Assessing the effects of angling-induced barotraumas on rockfish using magnetic resonance imaging (MRI). Canadian Journal of Fisheries and Aquatic Sciences. 65:1245-1249. Jarvis, E.T. and C.G. Lowe. 2008. The effects of barotrauma on the catch-and-release survival of southern California nearshore and shelf rockfish (Scorpaenidae, Sebastes spp.). Canadian Journal of Fisheries and Aquatic Sciences. 65:1286-1296.

Page 23

SUMMARY PROPOSAL FORM PROJECT TITLE: Physiological and behavioral effects of angling stress on two important game fish in southern California, kelp bass (Paralabrax clathratus) and barred sand bass (P. nebulifer). OBJECTIVE:

To evaluate the physiological and behavioral responses of kelp bass and barred sand bass to angling and handling stressors, and quantify the rates of post-release recovery, to aid fisheries managers in estimating long-term effects of fishing activity, and to educate anglers on best fishing practices that minimize stress on fish during catch and release. METHODOLOGY:

Baseline physiology will be determined by catching fish on hook & line within the Catalina Island Marine Life Reserve (CIMLR), which provides some assurance fish have not been recently caught. A blood sample will be collected from the caudal vein within 3 min of the fish being hooked and before the endocrine system has had time to respond and circulate cortisol. Physiological responses to stress will be assessed by catching fish using typical hook and line fishing practices in the CIMLR (no-take MPA) and on the Wheeler North Artificial Reef (fished reef) off San Clemente, CA. Angling time, handling time and other catch parameters will be recorded and the landed fish will be held in a live-well for a standard 10, 15, and 20 min period before blood sampling; delaying blood collection for > 10 min provides the endocrine system sufficient time to respond to stressors. All fish will be measured for length (SL cm), weighed (g), tagged with a unique ID spaghetti tag, and released at the site of capture. Recovery will be assessed by rapidly blood sampling recaptured individuals, likely after varying days at liberty. Blood glucose and lactate will be measured immediately in the field using hand-held meters, while plasma will be frozen and cortisol will be quantified later using enzyme immunoassay techniques. Physiological stress biomarkers of caught and stressed fish will be compared with those of control (baseline fish). Baseline, unstressed behavior for kelp bass and barred sand bass will be characterized by handfeeding individuals small acoustic transmitter (Lotek Wireless Inc, USA; MM-M-8-SO-PM) hidden in bait, eliminating effects of capture and handling. Ten fish per species will be actively tracking continuously in the CIMLR for at least 24 hrs or until the transmitter is regurgitated. Fish movements will be quantified using an array of 4 submerged acoustic receivers (Lotek Wireless Inc; WHS3250) that record the date/time, unique ID, motion, and depth data from the tag at 2 sec intervals. Fish geolocation can be localized via trilateration when a signal is detected by 3 or more receivers. The fine-scale depth, motion, and location data allow for measures of area use and rate of movement for as long as the transmitter is retained. Behavioral responses to stress will be evaluated by catching fish using typical hook and line practices in the CIMLR, immediately anesthetizing the individual in MS222 and surgically implanting the transmitter in the body cavity of the fish; the wound will be closed with 2-3 sutures of ChromicGut before the fish is measured (cm), weighed (g), tagged, and released. Fish will be actively tracked continuously for over multiple 24 hr periods to quantify differences in space use and rate of movement, and

Page 24

determine rate of behavioral recovery. Daily area use and rates of movement will be compared in 4 hrs bins between stressed fish and those of used in the control (non-angling).

The effects of angling and handling conditions (e.g. fight time, length of air exposure, physical injury, etc) with the stress responses (physiological and behavioral) exhibited by each individual will be compared using a GLM to identify fishing practices minimize stress. RATIONALE:

Kelp bass and barred sand bass have historically supported two of the largest recreational fisheries in southern California for over the last 60 years, providing valuable economic, social, and ecological functions in coastal communities. However, gamefish are experiencing increasing fishing pressures as the number of anglers increases every year with the rapidly growing human population. Increased fishing pressures, occurring simultaneously with poor environmental conditions for recruitment, have likely been driving the declines in stock abundances observed for kelp bass and barred sand bass over the last two decades (Hsieh et al 2005; Jarvis et al 2014). Annual kelp bass landings have declined 70% from 1980’s levels, and annual barred sand bass landings have declined 85% since 2001 alone (Jarvis et al 2014). Therefore, find methods to reduce stress associated with mandatory catch & release is essential for enhancing sustainability of the recreational fishery and for providing adequate management strategies.

Current fishing regulations for kelp bass and barred sand bass result in the widespread catch and release of individuals; however, released fish may be negatively, yet sub-lethally, effected by angling and handling stresses experienced during capture. This research is particularly important now given changes to the fishing regulations in Oct. 2013 (increased the min. size limit, reduced daily bag limit; Calif. Dept. Fish & Wildlife 2013) which have resulted in more fish being caught and released. Responses to angling and handling stresses in other species studied include physiological (e.g. metabolism, immune function, reproduction), as well as behavioral (e.g. feeding, predator avoidance, mating activity) modifications that can, ultimately, impact stock dynamics (Pickering 1981; Wendelaar Bonga 1997; Iwama et al 1997, 1998; Mommsen et al 1999). Therefore, it is important to quantify the effects, and rate of recovery, on an individual species-basis to aid managers in selecting effective policies and to educate anglers on their direct impacts, as well as the support need for current fishing regulations.

Results from this study will benefit the recreational fishing community by providing anglers with evidence of how certain angling and handling practices may significantly affect fish health and recovery, thus, empowering anglers to positively influence the fate of these fisheries. By offering anglers the knowledge and tools to engage in less deleterious fishing practices, the overall impacts of angling activity can be mitigated and the long-term sustainability of these recreational opportunities protected. Additionally, by evaluating the effects of catch and release on individual fish, managers can more accurately predict the long-term effects of angling activity on the entire stock and modify fishing regulations to enhance stock recovery and growth. Ultimately, the knowledge gained through this research will improve fishery sustainability by aiding mangers in implementing effective

Page 25

long-term regulations and educating anglers on fishing practices that reduce their impact on these important gamefish populations.

Page 26

200 NIETO AVENUE

SUITE 207 LONG BEACH, CA 90803

(805) 895-3000

July 5, 2015 University of Southern California Sea Grant Program Los Angeles, CA 90089-0373 Re: Support of Dr. Chris Lowe proposal on California basses To whom it may concern, I am writing a letter of support for Dr. Chris Lowe’s USC Sea Grant proposal “Physiological and behavioral effects of angling stress on two important game fish in southern California, kelp bass (Paralabrax clathratus) and barred sand bass (P. nebulifer).” The Sportfishing Conservancy has a long and successful history of working with the recreational fishing community to lighten our impact on marine resources. Dr. Lowe has been a key component in our efforts and his groundbreaking work on barotrauma has played a central role in our “Best Practices” fishing workshops. Chris has lectured at our seminars here in Southern California, at Gray’s Reef national Marine Sanctuary in Georgia and at Largo, Florida. His efforts have helped change the debate on the deep release of recreationally caught fish. We look forward to Chris and his team working on near shore basses, as they are a key component of our local California sportfishing efforts. His work would be incredibly valuable in terms of not only how to best treat these resources, but importantly in consequent management decisions. Please give this proposal your highest considerations. Sincerely,

Tom Raftican President, The Sportfishing Conservancy

www.californiasportfishing.org

5000 N. Harbor Drive, Suite 100, San Diego, CA 92106 / info@californiasportfishing.org / 619D 322D7421

 

                                                                                   July  7,  2015      To  the  Director  of  the  University  of  Southern  California  Sea  Grant  Program,    The  Sportfishing  Association  of  California  supports  Dr.  Chris  Lowe  and  his  graduate  student  Caitlin  McGarigal  on  their  project  entitled  “Physiological  and  behavioral  effects  of  angling  stress  on  two  important  gamefish  in  southern  California,  kelp  bass  (Paralabrax  clathratus)  and  barred  sand  bass  (P.  nebulifer)”.  The  goal  of  this  research  is  to  identify  ways  of  minimizing  stress  on  fish  caught  and  released  by  anglers  to  ensure  their  survival  and  growth.  We  look  forward  to  helping  them  with  this  important  research  by  providing  them  with  connection  to  CPFV  operators  and  recreational  fishers.  We  are  eager  to  hear  to  results  of  this  study  and  to  provide  anglers,  CPFV  operators,  and  crew  with  new  information  on  how  to  keep  our  fisheries  sustainable.    Sincerely,    Alayna  Siddall  Dir.  Science  and  Communications      

PROJECT TITTE

A NEW METHOD FOR MONITORING URBAN BEACH ECOSYSTEMS _ IMPLEMENTATION OF "ALL ASHORE"

PRINCIPAT INVESTIGATOR

Karen Martin, PhD, Professor of Biology, Pepperdine University

ASSOCIATE INVESTIGATOR

Jen¡fer Dugan, PhD, Associate Research B¡ologist, Mar¡ne Science Institute, University of Cal¡fornia, Santa

Barba ra

FUNDING REqUESTED

201,6-2017 s50,505 Federal/ State s52,405 Match

2Or7-2O18 s50,105 Federal/ State s53,405 Match

STATEMENT OF THE PROBLEM

This proposal addresses the coastal Ecology and Biology category of Sea Grant, in particular theHea lthy Coastal Ecosystems.

Although often valued primarily for recreation, sandy beaches are important natural ecosystems

that link terrestrial and marine environments. Key ecosystem functions of beaches include physical

processes such as water filtration, nutr¡ent cycling, sand storage, and coastal protect¡on. Vital ecological

functions of beach ecosystems include unique biodivers¡ty, high abundance and biomass of intertidalinvertebrates, coastalfood web support for birds and fishes, and wildlife habitat. The rich, diverse biotadependent upon beaches for some or alì of ¡ts l¡fe cycle can exist nowhere else. Some of these v¡tal

ecologicalfunctions can be ìdentified even on the most heav¡ìy v¡s¡ted urban beaches of southernCalifornia. These include shorebird roosting, feeding, and nesting; mar¡ne mammal haul-outs andpupping; and spawning of Calìfornia Grunion. Suspension feeders, such as clams and sand crabs, turnphytoplankton into rich prey biomass that supports abundant birds and fishes. Small crustaceans help

recycle nutrients from kelp wrack back into the ocean and are prey for birds, ¡ncluding threatenedspec¡es. Native beach and dune plants act as ecosystem engineers that generate habitat, and promotesand accumulation and stabilization, as well as beautiful flowers.

Occupying a very narrow str¡p of habitat between land and sea, many beaches are trapped

between growing coastal development and sea level rìse assoc¡ated with climate change making them

excellent examples of habitat loss due to "coastalsqueeze". At the same time, urban beaches are

subject to a w¡de var¡ety of anthropogenic impacts ¡nclud¡ng beach f¡lling, grooming, raking, vehicle use,

armoring, sand transport, berm building and grading, plus recreational uses. For example more than

25% of the coastline of southern Ca lifornia is a rmored w¡th seawa lls and revetments (Gr¡ggs et a 1.,2005).

Beach filling or nourishment is widely practiced ¡n the region, with >70 million m3 added to beaches in

the past 75 years (Orme et al. 2011). Dams on r¡vers in southern California have reduced the sand

supply to beaches by an estimated 50%. The extensive armoring of sea bluffs has also reduced the

supply of sediment to beaches (Runyan and criggs 2003) in the regìon. Ecological impacts to beach

ecosystems are rarely assessed. Robust quant¡tative evaluations of these human effects on beaches are

labor-intensive and expensive. lmportantly, rapid one-time assessments are not accurate or suitable forcharacterizing dynamic coastal ecosystems w¡th mobile fauna such as sandy beaches.

To date no long-term, consistent monitoring program ex¡sts for evaluat¡ng ecosystem conditionon urban beaches. The sandy beach ecosystem extends from the surf zone across the beach and strand,and inland to dunes or bluffs, although these natural features have been replaced by development in

many urban beaches. Most previous efforts to monitor beach cond¡tions have focused on social oreconomic approaches that rely on perceptions of tourists and occasìonal beach goers. Performance

assessments of beaches have evaluated safety and recreational amenìties rather than ecology (Ariza etal. 2007; Cervantes et al. 2008; Boevers 2008). Human safety, amenit¡es, and recreat¡on also prov¡de thebasis for the popular Blue Flag and Blue Wave râting systems (www. Blueflag.ore;

www.Clea nBeaches.com ). These assessments may be based mainly on aesthetics (Morgan & Williams1999; Vousdoukas et al. 2009; Pranz¡n¡ et al. 2010) or may simply be inaccurate (Pendleton et al. 2001).

current biological monitorìng programs on beaches are based primarily on human healthconcerns, such as water quality in the Clean Beaches lnitiative, or on a few species of special concern.Several ongoing monitoring programs assess single species, such as Western Snowy Plovers, Least Terns,

northern elephant seals ¡n San Simeon, harbor seals in La Jolla, the Grun¡on Greeters ¡n California, orsand crabs in the LiMPETS program. The COASST program in Washin8ton, Oregon, and northernCalifornia monitors beaches for seabird carcasses in order to assess oceanic condit¡ons rather than tounderstand the ecology of beaches themselves. NOAA's Beach Watch ¡n northern California countsseabird carcasses and also identifies shorebirds. Both the COASST and BeachWatch programs take place

mostly on rural beaches that receive few human visitors.

A few single species monitor¡ng programs (Western Snowy Plover, Least Tern, California

Grunion) are conducted on urban beaches in California. However only two comprehensive long termmonitoring programs for sandy beach ecosystems exist, both quite l¡mited in spatial scale and focused

primarily on natural beaches (Santa Rosa lsland, southern Santa Barbara County). Consequently rel¡able

informat¡on is scarce, data gaps are numerous and current ecological information is lacking for themâjority of beaches on the southern California coast. Many beaches, includ¡ng those w¡th major pend¡ng

construct¡on projects, have rarely or never been ecologically assessed. The glaring lack of information on

ecoìogicalconditions of beaches ¡n southern cal¡fornia is severely impeding conservation efforts forthese important and increas¡ngly threatened coastal ecosystems. There is a great need for informationthat could help evaluate ¡mpacts, track recovery trajectories, and identify best management practices

and optimal locations for restorat¡on projects on beaches.

With the help of funding from USC Sea Grant, we are developing ecological indicators and a

method that can be used by tra¡ned volunteers to conduct repeated assessment needed to evaluate theecological cond¡tion of sandy beaches. Our program is a broad survey of multiple ecological features and

indicators. This new method has the potential to be used over the long term to f¡ll existing data gaps and

examine the effects of management and natural perturbations on beach ecosystems in southerncal¡forn¡a. Engaging the public in the monitor¡ng of sandy beaches will accomplish two major goals 1)

advance public understanding and apprec¡at¡on of beaches as vitalcoastal ecosystems and 2) nurturethe development of a long term effort orgânized with common methods for data acquisition and

analysis that is locally sustainable.

I NVESTIGATORY QUESTIONS

can volunteer citizens learn to assess ecolog¡cal components of urban beaches reliably and

accurate ly?

Can a monitoring program with trained volunteers provide needed information on the basel¡ne

ecological condit¡ons of sandy beaches along the urban ocean of southern California?

2

Does increased knowledge about beach ecology change public attitudes and expectat¡ons forurban beaches and their management?

MOTIVATION

Beâches support unique flora and fauna, many endemic, some threatened or endangered. Fillingthe many data gaps on beach ecosystems along the coast of California has the potent¡al to change howbeaches are viewed and managed at a cr¡t¡cal time of climate change and coastal population growth.Californians love their beaches, but few know the k¡nds of ecosystem functions, or the rich dìversity ofanimals and plants these unique ecosystems support.

Over the past 14 years the Pls have collaborated with beach managers, lifeguards, and localmunicipalities to promote the integration of more ecological approaches into beach management. Thishas resulted ¡n the formation of a non-profit organization, the Beach Ecology coalit¡on, dedícated tobalancing human recreation with wildlife conservat¡on on sandy beaches. This organization meets twicea year and has provided valuable opportunities for educat¡on, outreach, dialogue, and fielddemonstrat¡ons for beach managers and workers from across the state of California. These meetings arewell attended and greatly valued by the part¡c¡pants. Members of this group state that these meetingsare the¡r only chance to dîscuss issues of common concern about beach management w¡th people whohave similar occupations ¡n d¡fferent locat¡ons.

Currently the annual Coastal Clean-Up Day for removing trash from beaches is a major draw forvolunteers throughout the country. Many organ¡zat¡ons and classrooms have "Adopted" a beach toremove trash year^round. Dur¡ng the weeks after the oil spill at Refugio State Beach th¡s spring, publicreaction ¡nd¡cated a great desire to be of use, and many took train¡ng in Santa Barbara to help with thecleanup. While removaì of contamination and trash are important, we hope that our mon¡toringprogram will provide a new way for the public to interact with the more natural aspects of the beach, ¡n

a more consistent and positive role.

Monitoring sandy beach ecosystems ¡s labor ¡ntens¡ve and expensive and due to the highly

mob¡le and often cryptic fauna and the inherent dynamics of both the ecosystem and the b¡ota. Manybeaches in the state have not been monitored on a regular or even ¡nfrequent basis. The use ofecological indicators can be an efficient approach to monitoring but requires the development ofreliable noninvasive protocols and the use of repeated surveys. Use of a standard, noninvasive methodfor monitoring beach ecosystems by trained community members will allow long term evaluation oftrends on local coastlines. By having the potential to cont¡nue far beyond the end of any requiredecological monitoring for a construction projects on beaches, this approach has the potent¡al to greatly

increase the effectiveness of recovery, m¡tigation or restoration efforts for sandy beach ecosystems.

GOALS AND OBJECTIVES

A. Overall Goals

Goal 1) We will ¡mplement a tra¡ning and data collection program, "All Ashore," for volunteer citizenscientists to monitor sandy beach ecosystems w¡th at least five locaì partnerships along the southernCalifornia coast, using tra¡ning mater¡als that are already in development with pr¡or Urban Oceanfu nd ing.

Goal 2) We will evaluate the hypothesis that a carefully designed c¡t¡zen sc¡ence program can help fillcrit¡cal data gaps on the status of beach ecosystems ¡n southern California with accurate, reliable,repeatable data for Iong-term monitor¡ng for beach ecosystems. We w¡ll also test the hypothes¡s that

beaches with different management practices exhlbit differences that can be accurately detected by

tra¡ned c¡tizen scient¡sts.

Goal 3) We will measure the effectiveness of the program for increasing awareness and appreciat¡onof the ecological resources on beaches for project part¡c¡pants, partner organ¡zations, and casual beach

goers by periodic surveys. We hypothesîze that people w¡ll become more aware of the biodiversity and

each species'role in the environment as the program cont¡nues.

Goal 4) We will assess and revise training materials and workshops in collaboration w¡th the partner

organizations and the volunteers ¡n order to maximize the level of participation and the likelihood oflong-term commitment in beach mon¡tor¡ng at the local level.

Goal 5) We will provide educational mater¡als and data summar¡es for the public and resource

managers online and through targeted presentations.

B. 2016-2017Objectives¡) Refine and publish the f¡eld guide, phone app, training manual, and data acquisition format

for volunteers and on an ¡nternet portalfor the public.

ii) Recruit and train up to 120 volunteers in four local partnerships to monitor beaches using

our educational materials and monitor¡ng methods.

iii) Assess volunteer att¡tudes and knowledge about beach ecosystems before the program.

iv) Carry out training workshops for volunteers at each partner location in spring (April/ May/June) and fall (August/ September/ october), and have follow-up meetings in winter(November/ December/ Janua ry).

2077-2078 Objectivesv) Continue working with up to 150 volunteers in five local partnersh¡ps to mon¡tor beaches

using our educational materials and monìtoring methods.

vi) Assess new volunteer attitudes and knowledge about beach ecosystems before theprogram.

vii) Carry out training workshops for volunteers at each partner location in spring (April/ May/June) and fall (August/ September/ October), and have follow-up volunteer appreciat¡onmeetings in w¡nter (November/ December/ January).

viii) Assess volunteer attìtudes and knowìedge about beach ecosystems after the program.

Compare with beginning attitudes and knowledge, and compare with those of beachgoers

who have not part¡cìpated in the program.

METHODS

1) A list of biotic and ab¡otic ¡ndicators of beach ecosystem status suitable for use by trainedcitizen sc¡ence partic¡pants has been developed with the current funding.

We have developed a rubric for scoring ind¡cators of the ecological features of sandy beaches

(see Append¡x). lndicators were chosen for a relationshìp to ¡mportant features of the status orcondition of the ecosystem, ìncorporat¡ng naturaì and anthropogen¡c processes. Assessments ¡nclude

direct measurements of physical features such as beach width, sediment type, presence of selected

species of plants and animals, tides and weather, and other observational data.

2) A non-invas¡ve assessment protocol for mon¡toring spec¡f¡c indicators on sandy beaches byc¡t¡zen sc¡entists has been created and tested,

The working group has developed a non-invasive protocol suitable for use in repeatedassessment of sandy beach ecosystems. This has been tested within the working group and is being

4

beta-tested with a small group of volunteers durin8 Year 2 of the current grant. The protocol is ¡ntendedto be stra ightforwa rd, s¡mple to follow, repeatable, and able to discern differences between beaches.

Although individual assessments are not suitable for sandy beach ecosystems due to theinherent dynamics of habitat and b¡ota, the use of consistent methods over time will alìow trends and

changes in the ecosystem to emerge and be ìdentified. Seasonal assessments over the course of thispilot project will provide baseline dâta on the variation in cond¡tions, ¡nformation that ¡s not presently

available for many locat¡ons. This site-spec¡fic baseline dâta will reveal current conditions along withvariability in selected animals and plants present, and seasonal changes in physical parameters, such as

beach zone widths and slopes for each location, to allow comparison over time/ among beaches,

3) "All Ashore" programs to train a corps of citizen sc¡entists will be implemented at mult¡plebeaches in five coastal counties, in cooperat¡on with local partnerships and stakeholders.

Train¡ng sess¡ons for volunteer cit¡zen Scientists to learn the newly developed monitoringmethod will be held at five coastal locations in southern California, with the help of Iocal partnershipsthat are already in place, including aquariums, env¡ronmental NGOs, and colleges and unìversit¡es (see

Letters of Support). Volunteers from the commun¡ty will be asked to comm¡t to a full year of the project.They wiìl attend field and classroom workshops in spring and fall. After one year of monitoring,partic¡pants will discuss and evaluate the mater¡als, the¡r new skills, and theìr perceived experience. The

workshops will help volunteers develop observation and identification skills, and provide the project

team with mult¡ple opportunities for editing and improvement of educational materials. The social

aspect of repeated meetings should increase the enjoyment and comm¡tment of volunteers.

The workshops will include act¡ve participation by sc¡ent¡sts, a program officer, and local partner

staff as well as the volunteers. This follows the model of the Grun¡on Greeters, an award-winning group

of citizen scientists that have contr¡buted to significant changes in beach management in California(Martin et al., 2006, ?.01,1],, discovered a range extension of an endemic marine fish (Roberts et al.,

2007), and documented new colon¡zat¡on of previously unknown spawning habitats in 5an Francisco Bay

(Johnson et al., 2009; Martin et al., 2013). We anticipate that this monitoring method w¡ll be

incorporated into regular activities of aquariums and environmentalvolunteer organizat¡ons over time.

Monitoring efforts will be focused within a window of scheduled dates and tidal heights.

Volunteers will assess specific local beaches that differ ìn their ecologicalfeatures. Results from the¡r

efforts will be compared both across teams of volunteers as well as to scientific assessments of these

beaches for data quality assurance. All data collected on ecolog¡cal ind¡cators in the program will be

examined for quality, accuracy and consistency. Species of special status may require additionalprecaut¡ons to prevent injury or poaching.

Volunteers will receive feedback on their level of accuracy, with some small tokens ofapprec¡ation for their efforts and increasing expert¡se.

4) Selected beaches will be monitored in parallel by tra¡ned volunteer c¡tizen scientists and

scientific professionals from the working Broup to verify the results and validate the reliability ofindicators, and inform adjustments to protocols and mater¡als.

Data verification for the cit¡zen scientists may take var¡ous forms including wr¡tten qu¡zzes, fieldquizzes, photo documentation, data validation by staff of monitoring forms, and cooperative discussions

between volunteer groups and staff (Bonter and Cooper, 2012). Test sites will be mon¡tored on separate

occasìons by teams of volunteers and teams of scientists for comparison. Participants will be surveyed

anonymously about their biological knowledge and their volunteer experiences dur¡ng and after the

5

program, Some will be selected to survey w¡th deta¡led interv¡ews. Changes will be incorporated intoprotocols and train¡ng materials.

Program evaluation surveys¿ ¡nterviews, and focus groups willtake place with the work¡nggroup, the citizen scientists, and community partners to assess the effectiveness and appeal ofthe All

Ashore program for the volunteers and partner organ¡zat¡ons. The goal ¡s to understand the potential forexpanding the mon¡tor¡ng program to add¡tional urban beaches in Calìfornia with additional local

partners in the future. Outside experts will be consulted for peer review and submission of data forpublication.

Verif¡ed results can be used for comparisons between beaches with different managementpract¡ces, such as different types of raking or berm building. As data accumulate over the study per¡od,

seasonaland annualchanges can be evaluated in realtime across the californ¡a coast. The goal ¡s todevelop a monitoring program that will allow recognitîon and rapid response to unusuals¡tuations,

making ecological responses to si8nificant perturbations more readily evaluated.

Data from this project w¡ll be made ava¡lable online in an aggregated form and by request fromqueries from beach managers, resource agencies, or other interested parties. Additional funding will be

needed (and sought) to provide more detailed information online, such as maps or G15 layers wìthd¡fferent specìes.

Seasonal monitoring by the volunteers will reveal dynamics in the physical and biological

components of sandy beaches on a fine scale. Volunteer efforts can complement more detailed surveys,

to record ecological data that would not otherw¡se be available. These data will help f¡ll crit¡caldâta gaps

and provide a new source of baseline ¡nformat¡on for comparison that can be used in assessment ofecological impacts following catastrophic events such as an oil spill, or more common perturbations

such as an intense storm, or a major construct¡on project on the beach.

While this new method cannot replace more ¡n-depth methods of scientifically mon¡tor¡ng

sandy beaches, it is des¡gned to complement those efiorts and provide new information on areas and

sites that could benefìt from detailed study. lt could potentially serve as an early warning system forsome beaches where monitoring has not previously been conducted. The new methods for education,

outreach, and data acquisition will enhance protection and understanding of the iconlc southern

California beach ecosystem for both c¡tizens and scientists.

REIATED RESEARCH

Coastal ecosystems are amongst the most product¡ve and heavily used ecosystems in the world

and provide many services to human society. Shorelines are vìtaltrans¡tional zones linking terrestrial

and marine realms (Polis & Hurd 1996). Urban¡zat¡on can sever these connections, reducing or

el¡m¡nating key exchanges and functions includìng organic and inorganic mater¡al transfers (detr¡tus,

nutr¡ents, prey, sediments), water f¡ltration and nutrient uptake (B¡lkovic & Roggero 2008, Dugan et al.

2012). Sandy beaches are one of the largest marine biomes on the planet, however our understanding

of the¡r ecological functions is limited. Defeo, McLachlan et al. (2009) descr¡be the ecosystem services

provided by beaches (Table 1). Although best known for recreat¡on (considered a direct use value),

beaches provide a wide variety of ecosystem functions, goods, and services, which ecologists are only

beginning to u ndersta nd.

Character¡zed by unconsol¡dêted sand, a lack of attached ¡ntert¡dal plant life, and highly mobìle

animals, sandy beaches represent a challenge for b¡ota and ecologists alike. lntertidalzonation can be

discerned on sandy beaches, however, its character d¡ffers profoundly from rocky or muddy shores

6

(Peterso n, 1991). The d istinctive mob¡lity of the ¡nte rt¡da I anima ls and of the sa nd itself mea ns thatconcepts of intert¡dal zonation used for exposed rocky shores cannot be applied to sandy beach

ecosystems.

Table l: Sandy Beach Ecosystems services by use value type.

Sandy Beach Ecosystem ServicesDirect Use

Valu e

lndirect Use

Value

sedìment storase and transooftì X

Wave dlssipation and assoc¡ated buffer¡ng against extreme events(storms, tsunamìs);

X

Dvnamic resoonse to sealevel rise (w¡thin limits X

Breakdown of orpanic mater¡als and Þollutants; X

Water f¡ltratìon and pur¡ficatìon; X

Nutrient mineralization and recvcl¡ns; X

Water storage ¡n dune aquifers and seawater d¡scharge throughbeaches-beaches w¡th dunes onlv;

X

Maintenance of biod¡vers¡tv and senet¡c resources; x

Nurserv areas for iuvenile fishes; X

Nestins s¡tes for turtles and shorebirds, and rooker¡es for p¡nnipeds; X

Prev resources for bìrds. fìshes. and terrestrial wildlife: X

Scenic vistas and recreational opportunities; X

Bait and food x

Functional l¡nks between terrestr¡al and marine environments ¡n thecoãstâl zone.

X

On intert¡dal shores with stable rocky substrates, many organisms surv¡ve the action of t¡des and

wave by strongly resisting movement with a variety of adaptations and behaviors. On sheltered muddy

shores, plants can take root and many animals build and ìnhabit relatively permanent burrows in the

well-consol¡dated sediments or attach to plants. On sandy beaches ¡t is not possible to attach to the

substrate and plants or to occupy permanent burrows. Sandy ¡ntert¡dal animals have to move;

swimming, scudding, crawling, running, hopping, or surfing, and then burrowing rapidly, to adjust to

ever-changing cond¡tions of tides, waves, storms, and shift¡ng beach profiles. This high mobility ofbeach animals is the foundation of many of the fundamental differences in the intertidal ecology and

zonatìon of sandy beaches compared to other ¡ntertidal ecosystems and poses a significant challenge forall monitor¡ng programs of beaches.

Although far less obvious than observed on rocky or muddy shores, three relat¡vely distinct

intert¡dal ecologìcal zones can often be identified for a given Iow tide cond¡tion on many of California's

sandy beaches and elsewhere (Mclachlan and Jaramillo 1995). These zones generally correspond to therelatively dry sand around and above the high tìde strand l¡ne or drift line, the damp to wet sand of the

middle intertidal and the saturated sand of the lower and swash intertidal zone (Figure 1). The low

intertidal zone consists of saturated sand that includes the lowest retreat of the tides and the upper and

lower bounds of the active swash zone. The m id-inte rt¡da I zone extends from below the high tide stra nd

l¡ne across the damp sand and to or below the water table outcrop depending on the slope and shape ofthe beach profile. Highest on the beach profile is an upper beach zone that is located above and around

the high tide strand lìne (HTS) or dr¡ftline and extends up to the landward boundary of wave and tide-

7

influenced sandy hab¡tat (e.9. foredune toe, rocky bluff, or man-made coastal ìnfrastructure).

lmportantly, the upper intertidal zone in the vicinity of the driftline (located above MHW) harbors 40-

50% of the total intertidal biodiversity in Californ¡a (DuBan et al. 2003).

Fìgure 1.: EcologÌcal zones ofsandy beaches a) diagram of a

Callfornia beach at low tideshowing zones and features;and b) a photograph of a

bluff-backed beach wìth thefeatures shown in thediagram (Arroyo Burro Beach,

Santa Barbara County)(adapted from book chapterin Ecosvstems of Californ¡â inpress, Photo: Jenny Dugan).

The high tide strand line (HTS) or drift line is a highly mobile feature that marks the highest

reach of the tides in a 24 hour period. Th¡s ¡s where the primary deposition of buoyant material from the

ocean and rivers including macrophyte wrack (kelps and red and green macroalgae, and seagrasses),

driftwood, carrion, and other marine and terrestrial debris, such as leaf l¡tter and trash, occurs. After a

spring t¡de series ¡n California grunion spawning season, thìs is also the zone where the nests of grunion

can be found. The upper beach zone varies greatly ¡n width with tide phases, wave events and across

accretion and erosion cycles. Although often termed the supralittoral meaning "above the reach of tidalinfluence", th¡s terminology is problemat¡c on beaches due to inundation of this zone during spr¡ng

t¡des, storms and large swell events and its regular use as hab¡tat by the mobile intertidal biota

cha racter¡stic of beaches.

Upper beach zones are often defined as critical or essential habitat required for wildlife,

including nesting shorebirds and sea turtles, many of which are considered threatened or endangered.

The landward-most edge of th¡s upper beach zone can support the establishment of coastal strand

vegetat¡on, at least during per¡ods of accretion when the beach is wide (Barbour et al, 1976,1985,

Barbour and Johnson 1988, Feagin et al., 2005; Dugan and Hubbard 2010). This colonizing vegetation,

although composed of perennial plant spec¡es, may be functionally annual on many beaches due to

strong seasonal cycles of sand erosion and accret¡on. When present for sufficient time, coastal strand

plants trap wind-blown sand to form hummocks and embryonic dunes, act¡ng as ecosystem engineers

(Dugan and Hubbard 2010). During periods with sufficient sand supplies and relat¡vely low wave energy,

these vegetat¡on-generated features may build ¡nto pr¡mary foredunes. On narrow beaches where high

tides reach cliffs or manmade structures regularly, coastal strand vegetat¡on and foredunes are usually

absent. lntact vegetation in the coastal strand and dunes buffers shores and retains sediments from the

8

effects of erosive processes including tides, waves and storms. These plant communities provide

valuable ecosystem functions including pr¡mary production, water filtration, uptake of nutrients, detr¡talproduction and degradat¡on and carbon fixat¡on (Constanza et al. 1997). Shoreline vegetat¡on ¡s oftenlost from coastal habitats as bulkheads and seawalls both directly alteÍ habitat and also prevent themigration of the shoreline in response to changing sea level (Dugan & Hubbard 2006, Jaram¡llo et al.

2012, Rodil et al. 2015). The effects of human activit¡es such as beach grooming and trampl¡ng, coastal

erosion and sea level rise on this already restricted habitat (e.9. Feagin et al. 2005, Dugan & Hubbard

2010) combined with the impacts caused by armoring create significant concern for the survival of the

coastalstrand zone and its functions on coastlines that are either retreating or developed or both.

Although ecolog¡cally dist¡nct intertidal zones can be recognized on beaches, it ¡s important tounderstand that the locat¡ons of these zones and of many of their characteristic biota constantly move

up and down the beach in response to tides and water motion, shift¡ng dramatically in just a few hours.

As the tide floods after a low tide, animals burrowed in the swash and low zone of a beach, such as sand

crabs, emerge from the sand to migrate up the shore with the swash zone. On the ebb tide they move

down the shore with the swash zone and reburrow. Zone widths as well as the pos¡tions of many beach

anìmals on the profile also respond distinctly to the lunar t¡de cycle. Dur¡ng sprìng tides b¡ota occupy

wider zones and burrow higher on the beach than during neap tides (Dugan et a1.2013). This means thatwhile overall abundance remains the same, these semilunar movements create major changes in thedensity of animals burrowed in a particular zone across lunar phases. These animals must move much

greater distances up and down the beach profile to adjust to changing conditions and to survìve rapid

shifts in beach width and volume associated with the seasonal or event-dr¡ven erosion and accretion

typical of many Calìfornia beaches (Dugan et al. 2013). ln fact, annual sh¡fts in intertidal pos¡t¡on def¡ned

as the ecological envelopes of beach animals have been shown to extend across >60% ofthe overall

beach width (Dugan et al. 2013). ln summary, these ecolog¡cal envelopes illustrate how thecharacteristic mobile biota of sandy beaches require large buffers of sandy beach habitat to use as the

beach contracts and expands in width with seasonaland event-driven erosion or accretion.

Along with habitat loss, the alterat¡on of physical processes that affect the deposition and

retent¡on of sediments on urbanized coasts can also affect the deposition and retention of buoyant

material, including macrophyte wrack, driftwood and other natural debris, which can be important tobiota as food or habitat (e.g. Colombini & Chelazzi 2003, Dugan et al. 2003). The s¡gnificant relationship

between wrack abundance and dry beach width found on California beaches (Revell et al. 2011)

suggests that when dry upper beach zones are narrow or absent, wrack accumulation and ¡ts availability

to beach consumers¡ microbìal processing, and rem inera l¡zation are greatly reduced. For example,

recent studies of open coast beaches of California (Dugan & Hubbard 2006) and protected beaches ofPuget Sound (Sobocinski et al. 2010, Heerhartz et al. 2014) reported significantly lower stand¡ng stocks

of wrack and driftwood on armored beaches compared to natural beaches. This impact on subsidies

could significantly impact intertidal biodiversity and the function of open coast beach ecosystems in

coastal nutrient cycling and dynamics (Dugan et al. 2011).

The loss of ecologìcal zones, structural complexity and habitat types associated withurbanization could be expected to d¡rectly affect the diversity and abundance of intert¡dal benth¡c fauna

of sheltered and open coastlines. For open coast beaches in California, the abundance and biomass ofmobile upper shore invertebrates have been shown to respond sìgnificantly to grooming and armoring,

which include talitrid amphipods, the dominant ìntertidalconsumers of marine wrack (Dugan et al.

I

2003; 2008). The d¡stribution and survival of mobile invertebrates of the lower shore (e.9. donac¡d

bivalves, whelks, isopods and hippid crabs) may be also reduced by loss of habitat, changes ¡n habitat

quality, and by restrictions on tidal m¡grat¡on as well as the reduced availability of alternat¡ve sandy

habitats (Klapow I972t Dugan et al. 2013) ìmposed by urbanizat¡on, ìncluding armoring.

For beach-spawnìng fishes, shoreline armoring and changes to shading negatively ¡mpact the

egg surv¡vaì of surf smelt In Puget Sound (R¡ce, 2006), and coastal development coupled with erosion

have resulted in loss of spawning habitat for Cal¡fornia Grunion (Mart¡n, 2015). California Grunion

require upper intertidal beach zone habitats of sufficient width during spring high tide nights to

successfully spawn and lay their eggs in suitable habitat for incubation and development. lt is est¡mated

that only about 0.7 square mile of critical spawning habitat for this endemìc species exists in California,

an area smaller than Disneyland (Martin 2015).

The support of wìldlife species, ¡ncluding birds, marine mammals, and on some coasts, sea

turtles, is a very important ecologicalfunction of coastal ecosystems (e.9. Schlacher et al.2007,20741..

Beaches provide valuable coastal hab¡tat and prey resources for foraging, roosting and nesting avifauna,

including shorebirds or waders, gulls, waterb¡rds, seabirds and a variety of land birds (Hubbard and

Dugan 2003, Deluca et al. 2008, Neuman et al 2008). Shorebirds requ¡re abundant prey resources in

order to meet their high metabolic rates and relatively high daily energy requirements (Kersten &

Piersma 1987). Loss of habitats used during migration, foraging, and over-winter¡ng has been implicated

in the declines of populat¡ons of many species of shorebirds and ¡s a major concern for shorebird

conservat¡on (Howe et al. 1989, Brown et al. 2001.), as are the effects of climate chan8e (e.9. Kendall et

al. ZOO4).

Shorebird d¡versity and abundance are strongly correlated with intertidal prey availability on

California beaches, including threatened species such as the Western Snowy Plover (Dugan et al. 2003).

Many species of birds have been observed to feed on the eggs of the California Grunion on California

beaches, including shorebirds such as Long-Billed Curlews, Marbìed Godwits and Whimbrels (Martin

2015). Changes ¡n habitat area, tidalavailability, and qual¡ty; ônd in ¡ntertidal prey availability resulting

from urbanization and armoring have the potentialto cause sign¡ficant negative impacts to coastal

avifauna. Herons that prey on spawning runs of California Grunion were more common and more

successful on beaches bordered by upland natural habitat than on beaches bordered by coastal

development (Martin & Raim, 2014).

For open coast beaches, existing evidence, although l¡m¡ted, suggests that coastal avifauna can

respond very strongly to urbanization of beaches. For example, significant differences found in the

d¡versity and abundance of shorebirds (2-fold and 3.7-fold lower, respectively), as well as the d¡versity

and abundance of seabirds and gulls (3.3 fold and 7.7-fold (seabirds) and 2-fold and 4.8-fold (gulls)

lower, respectively), between armored and unarmored segments of narrow exposed beaches ìn

California (Dugan & Hubbard 2006). Dugan et al, (2008) results also su8gest that ecolo8ical impacts to

coastalavifauna from armoring alone can be substant¡al.

It is predicted that species that live in the narrow interface between ocean and land will be

more strongly and rap¡dly impacted by cllmate change than fully marine or fully terrestrial organisms

(Harley et al.2006). As the climate sh¡fts, organisms currently living on sandy beaches along the coast

will need to adjust to increasing ocean temperatures and rising sea levels (Dugan et al., 2008, 2011;

Dugan and Hubbard, 2006, 2010). These adjustments can include moving landward as beaches retreat

10

and moving along the coast to follow suitable temperatures. ln places where beaches have room toretreat, intertidal and upper shore organ¡sms can follow the beach and suitable hab¡tats landward.

However much ofthe Californ¡a coastline has l¡m¡ted scope for retreat, ¡ncluding shorelines that have

been urbanized and/or armored and those that are backed by resistant naturalbluffs or cliffs. ln

addition, some of these coastal spec¡es may require different habitats for different lífe cycle stages

(Mart¡n 2015). For example, it is possible that sand temperatures will increase faster than ocean

temperatures, forcing the beach-spawning California Grunion to move to more northern habltats forspawning even while the ocean temperatures are still acceptabìe for adult life (Roberts et al.2007l.

Johnson et a1.2009; Martin et a1.2013).

BU DGET-RELATED INFORMATION

A. Budget Explanation/Just¡fication

Personnel - S23,160 (+ S18,160 match)

Dr. Karen Martin will devote one-half summer month to the project in both years of the project.

Grant funds are requested to cover summer salary in both years (55,050). Dr. Martin will devote theequivalent of one-half month to the project during the academic year in both years of the project. Salary

for this time wiìì be provided through Un¡versìty match (S5,050).

The project will utiìize undergraduate research assistants ¡n year one and year two of the project,

for a total of 57,500 per year. Grant funds are requested to support undergraduate research assistants,

or $5,000 in each year. The Un¡vers¡ty will provide addit¡onal support for undergraduate research

assistants.

Total 0ersonnel costs include Frinse Benefits - S3060 (+ S3060 match)

Pepperdine University's federal negotiated fringe benefit rate of 30.3% ¡s applied to full-timesalaries and wages (excluding students). Grant funds are requested to cover fringe benefÍts (51,530 in

each year). The Un¡versity w¡ll match full-time fringe benef¡ts at the same rate.

Permanent Eq uioment - S0

There are no anticipated expenses for permanent equipment related to this proiect.

Supplies and Equipment S6,000 (+ S2000 match)

In year one of the project, grant funds of 54,000 are requested for the cost of printing worksheets

and educational materials, as well as supplies for a field k¡t to be used in the mon¡toring program. This

kit will include a clipboard, a bag, instructìonal materials, a field guide, and other materials such as sand

cards, water bottles, pens, measur¡ng ropes, etc. ln year two of the project, grant funds are requested tocover the cost of training mater¡als and supplies for educat¡onal outreach for a total of 52,000, as some

supplies from the previous year wilì continue to be used for continu¡nB volunteers.

Travel - 58.640

Grant funds are requested to cover the cost of ground travel ¡n California for the trainingworkshops to implement and val¡date protocols central to the project. There will be at least two people

traveling for three tra¡nìng workshops at each location each year, and additionaltraveì to val¡date theprotocols, for a total of 54320 each year. Travel will include mileage, and one night hotel stay per

workshop as needed.

Publ¡cat¡on and Documentat¡on - S0

'Lr

No expenses are antic¡pated for publication or documentat¡on.

Other Costs - 560,800 (+ 585.650 match and in-kind)

Scientists: Grant funds are requested to prov¡de a social scientist to design and analyze surveys toassess the volunteer experience and knowledge, at 54000 each year.

Web Development: ln year one, grant funds are requested to cover the cost of web contentmanagement and database development, estimated at 51,100 (S91 per month year 1), and $too per

month year 2 for S1200.

UCSB Sub-contract: A sub-contract will be issued to UC Santa Barbara for a total of $10,500 tocover salary and fr¡nge benefit expense for Co- Invest¡gato r, Dr. Jenifer Dugan. UCSB's off-campus

¡nd¡rect cost rate of 26%o will be included.

Project Coord¡nator: A Project Coord¡nator will be contracted to organize and facilitate theworkshops to train volunteers on the implementation of the protocol, for a total of 515,000 in year one

and 516,000 in year two (3 workshops each site in each year).

Workshop and Meeting sites: We have requested 55,000 each year from the grant to support th¡s

partnership, to be used by the partner agency to support staff or programs or materials as needed, at

$1000 per partner group. We expect to add a fifth partner to the group in the coming months if funded.

lndirect Costs

Pepperdine has applied a reduced indirect cost rate of 10% to personnel salarìes and wages.

B. Match¡ng Funds

Personnel

Dr. Karen Martin w¡ll devote the equivalent of one-half month to the project dur¡ng the academíc

year in both years of the project (510,100 x 2 years = 520,200). Salary for each year will be covered by

grant funds and Universìty match (55,050 each).The Un¡versity will provide additional support of S2,500per year for undergraduate research assistants.

Fringe Benefits

Frìnge benefits are calculated at 30.3% of eligible sâlarìes and wages. Grant funds are requested to cover

fringe benefits for salary funds paid by grant fundine ($f,s:o in each year). The University matches full-t¡me fringe benefits at the same rate.

Permanent Eq uipment

There are no antic¡pated expenses for permanent equipment related to this project.

Su pplies and Equipment

ln each year of the project, the University w¡ll provide matching funds up to S1,000 for the cost ofprinting worksheets and educational materials. Additional outside funds will be sought for the field kìt

and other mater¡als to be used for outreach.

Travel

Volunteers prov¡de the¡r own transportation.

Publicatíon and Docume ntation

No fu nds are requested.

T2

Other Costs

Volunteers: We anticipate 50 or more volunteers in each year of the project will provide an est¡mated

30 hou rs each to collect data d u ring the each yea r of the project, valued at 57 4,250 in-kind (100 x 30 x

S24.75 per hour).

Web hosting will be provided by the match at a value of $1,200 each year.

Four sites have agreed to offer space for scientific working group meetings, and for volunteer workshoptrainings. A total of 3 meetings are included at each site in each year for trainings, for a veryconservative total value of 55000 in-kìnd, including recruitment of volunteers, space for train¡ng,miscellaneous mater¡als, and staff involvement. A f¡fth site will be added for the second year.

ANTICIPATED BENEFITS

The program provides opportunities for publ¡c partÎcipation in community-based habitatmonitoring, increasing stakeholder involvement on a local level. lncreased public knowledge and

appreciation of beach ecology through experiential learning will enhance ecosystem conservat¡on along

coastlines, supporting local and regional efforts to develop strategies for coastal resilience and

adaptation to climate change. This project will immediately benefit participating ìndividuals and

organizations, and ultimately will benefit educational outreach in aquariums, schools, and

environmental NGOs, as well as occupat¡onal education for beach workers ofvarious types.

This project supports the USC Sea Grant Strateg¡c Plan for Healthy Coastal Ecosystems and its

desired outcomes. Assessing the beach ecosystem, including the physical aspects of the beach, the typeof beach zones present, the actual and potential biological resources and ecolog¡cal functions the beach

may be expected to support, and the human uses and influences, will improve understanding and

stewardship of th¡s vital, ìconic coastal ecosystem. Over tìme, the proposed monitoring by cit¡zen

scient¡sts will allow a far greater understand¡ng of the ecology and natural var¡abil¡ty of urban beach

ecosystems than has been realized to date. At the same time, the exper¡ential learning and trainingprovided by the monitoring program for local residents wìll significantly enhance apprec¡ation and

recognit¡on of beaches as vital coâstal ecosystems. This will cascade upward to increase understanding

of beach ecology for specialists as well as localgovernment and the public, and improve understandingofthe effects of management practices. lncreased scientific data on beach ecology will enhance

ecosystem conservation along coastlines, support ecosystem-based adaptat¡on for climate change, andprovide new opportunit¡es for public outreach and community-based coastal mon¡tor¡ng.

A citizen science based monitorìng program for urban beach ecosystems will be usefultoresource managers by identifying beaches for which more extens¡ve information is needed tocharacterize ex¡stìng habitat and ecosystem conditìons, including the presence of sensitive species forreference (Jackson, 2002). The project is consistent with the objectives of the Ocean Protection Council's

lOPc) TOI2-20L7 Strategic Plan because it will provide valuable new ¡nformation to support science-

based decision making, raise awareness of early warnings of impacts of cl¡mate change and otherthreats to marine ecosystems and fisheries, and help identify changes ìn beach ecosystems from land

based activit¡es. The ¡nitiation of time series data collect¡on by c¡tizen scìentists will help implement theOPC's Resolution to reduce and prevent ocean l¡tter and ¡mpacts to sandy beach ecosystems by trackingtrends that may help identify sources of trash and marine debris.

The proposed monitoring protocol development will also address the following pr¡orities set by

the 2015 State Wildlife Action Plan:

13

1. Conserve the resources in the nation's most b¡olog¡cally diverse state.

2. Create a flexible but sc¡ent¡fic process to respond to changìng challenges, includingpopulat¡on growth, the need for renewable energy, and global climate change.

3. The Department seeks to make best use of lim¡ted resources while develop¡ng lastingpartnerships and increasing publ¡c part¡cipatìon in the conservation and management ofCa lifornia's va lued naturalresources.

Urban sandy beaches are coastalecosystems vulnerable to habitat loss through erosion and

flooding by sea level rise, and by coastal development and shoreline armoring. lncreased resilience ofspecies and ecosystem function are goals of management, and the proposed project will help identifyfeatures of sandy beaches that are res¡lìent to perturbation. As sea level rises, erosion accelerates, and

as human interventions and populations expand on the coast, describing and evaluating the ecological

consequences of these intensifying pressures on beach ecosystems is increasingly urgent. The limits ofour understanding of sandy beach ecosystems have emerged as cruc¡al impediments for theconservation of these threatened ecosystems. lt is împortant to develop time series data that can be

used to understand and incorporate the natural mutability of open coast sandy beaches and thevariab¡l¡ty ¡n their key features and characteristics in evaluat¡ons.

Understanding how to increase res¡lience of urban beach ecosystems is critical in a time of rapidclimate change, particularly as ¡ntense storms can rapidly and dramatically alter sandy beaches. Theproposed project seeks to address these l¡mitations by increasing our knowledge of ecological

conditions and broadening the appreciation of sandy beaches as v¡tal coastal ecosystems ¡n California.

This program has the support of many informal sc¡ence educators, environmentaì groups, and

resource agencies including California State Parks, Surfrider Foundation, cabrillo Marine Aquar¡um,

California Department of F¡sh and Wildlife, Birch Aquarium at Scr¡pps, Santa Monica Bay Restorationcommissìon, CrystalCove Alliance, Santa Barbara ChannelKeepers, the Beach Ecology Coalition, and theOcean Institute at Dana Point (see attached letters of support and appendix). These groups recognize

the need for increased knowledge and monitoring of sandy beach ecosystems and have staff and

enthusiastìc volunteers to contrìbute to this effort. Many of these same organ¡zatìons were integral tothe launch and continued success of the Grunion Greeters program (www.Grunion.ore). Since 2002, a

network of more than 150 organ¡zations and agencies have collaborated with Dr. Martin, along withhundreds ofvolunteers, to collect data during spawning runs and submit reports from the field. The

results effected significant and lasting change in official beach grooming procedures in San Diego and

other m unicipa lit¡es th roughout Californ¡a.

The readiness to proceed now helps to maximize the Cal¡fornia CoastalComm¡ss¡on's goaltoencourage localgovernment to address climate change and impacts of sea ievel rise in Local Coastal

Plan permits for new construction and rebuilding along the coast. The proposed project expands thedialogue beyond protection of physical structures, to the protection of coastal ecology, w¡th tools thatwiìl reveal changes over t¡me.

COMMUNICATION OF RESULTS

Data obtained throughout the duration of this project will be mainta¡ned in a central location forconsistency, and made avaìlable to resource managers, localgovernment, scient¡sts, and the general

public. Regular briefings will keep partner agencies informed of progress and findings. A field guide w¡ll

be produced to define monitoring methods for all particìpants. ongoing educational workshops willengage scientists and volunteers. Public outreach and educat¡on will be fac¡litated through partnerorganizations, including aquariums, env¡ronmentalgroups, and localgovernment agencies. lnformationabout the beach ecosystem and its components will be provided for the press and the beach-go¡ngpublic to promote greater understanding of this cr¡tical habitat. Finally, sc¡ent¡fic papers regarding the

1,4

methodology, appl¡cation, and findings supported by the project w¡ll be written and subm¡tted forpublicat¡on.

Collaboration with public aquar¡ums in San Diego (Birch Aquarium at Scripps), Orange County(Ocean lnstitute in Dana Po¡nt) and Los Angeles (Cabrilìo Marine Aquarium) will prov¡de manyopportunities for educational outreach to a diverse public and to schoolchildren during the program.

Surfrider Foundation, Beach Ecology Coalition, and other env¡ronmentalorganizations provide

¡nformation to their members with newsletters, web portals, and press releases. Dr. Martin and Dr.

Dugan both regularly present programs for the public about urban beach ecology.

lnformation about the beach ecosystem and its components will be provided for the press and

the beach-going public, for greater understanding of the flora and fauna as well âs the types of habitatpresent withìn the beach ecosystem and the cr¡tical l¡nk to nearshore habitats. This increases the local

knowledge and stewardship, and the breadth of data available. Public awareness of beach ecosystem

values and functions is generally very low compared to other coastal ecosystems. lncreas¡ng theinvolvement of the pubìic in outreach and in local, community-based monitoring of sandy beach

ecosystems can ¿ddress this concern proactively. Direct involvement of local stakeholders and grass

roots organizat¡ons in mon¡tor¡ng activities w¡ll improve understanding and stewardship of this v¡tal

coastal ecosystem and increase the likelihood of long-term commitment and additional funding.

REFERENCES

Ariza, E.,5arda, R., Jimenez, J.4., Mora, J., and Avila, C., 2007. Beyond performance assessment

measurements for beach management: appl¡cation to Spanish Mediterranean beaches. Coastal

Management 36, 47-66.Barbour, M.G., and A.F. Johnson. 1988. Beach and dune. ln Terrestr¡al vegetation of Calìfornia,

ed. M.G. Barbour, and J. Major, 223-262. New York: W¡ley lnterscience. Reprinted with supplement by

California Native Plant Society, Sacramento, CA.

Barbour, M.G, T.M. de Jong, and B.M. Pavlik. 1"985. Mar¡ne beach and dune plant communÎties.Phvsiolos¡cal ecolosv of North American plant communities. pp.296-322.

Barros, F., 2001. Ghost crabs as a tool for rap¡d assessment of human impacts on exposed sandy

beaches. Biological Conservat¡on 97 : 399- 4O4.

Bilkov¡c, D.M., Roggero, M.M., 2008. Effects of coastal development on nearshore estuarinenekton communities. Marìne Ecology Progress Series 358: 27-39.

Bìrd, E. 2000. coastalGeomorpholoÊv: An lntroduction. Wiley & Sons, ch¡chester, England. 322

pp.

Boevers, lust¡n. 2008. Assessing the util¡ty of beach ecolabels for use by local management.

Coasta I Management 36: 524-531.Bonter, D. N. and Cooper, C.B.2OI2. Data val¡dation in c¡tizen science:A case study from Project

Feeder Watch. Fronteris in Ecology and the Environment 10: 305-307, doi: 1'0.1'89O/I1O273.

Burger, J., 1994. The effect of human disturbance on foraging behavior and habitat use in piping

plover (Choradrius melodus). Estuaries 17(3): 695*701.California Marine Life Protection Act lnitiative, 2009. Regional Profile of the MLPA South Coast

Study Region (Point Conception to the Ca lifornia-Mexico Border). Cal¡fornia Natural Resources Agency,

Sacramento, CA. 196 pp.+ maps and appendices.Carlton, J.T., Hodder, J., 2003. Mar¡time mammals: terrestr¡al mammals as consumers in marine

intert¡dal communities. Marine Ecology Progress Series 256: 27 L-286.Cervantes, O., Espejel, 1., Arellano, E., and Delhumeau, S., 2008. Design of an ¡ntegrated

evaluatìon index for recreational beaches. Env¡ronmentaì Management 42, 249-

264. Dot'. IO.IO07 /sOO267 -008-9104-8

15

Ch ristoffers, E.W., 1986. Ecology of the Bho st üab Ocypode quodrota (tabricius) on Assateague

lsland, Maryland and the ¡mpacts ofvarious human uses of the beach on the¡r d¡stribution and

abundance. Ph.D. Thesis, M¡ch¡gan State University, Ann Arbor, Ml, USA.

Colombini, 1., Chelazzi,1., 2003. lnfluence of marine allochthonous input on sandy beach

commun¡ties. Oceanography and Marine Biology: Annual Review 41:115-159.Costanza, R., D'Arge, R., De Groot, R., Farber, S., Grasso, M., Hannon, B, Limburg, K., Limburg,

K., Naeem, S., O'Neill, R.V., Paruelo, J., Raskin, R.G., Sutton, P. Van Den Belt, M. 1997. The value of theworld's ecosystem services and natural capital. Nature, 387(6630\, 253-260

Defeo, O., A. lvlclachlan, D. S. Schoeman, T. A. Schlacher, J. Dugan, A. Jones, M. Lastra, and F.

Sca pini. 2009. Threats to sa ndy beach ecosystems: a review. Estuârine, Coastaland ShelfScience 81, 1-

12.

DeLuca, W.V., Studds, C.E., King, R.S., Marra, P.P., 2008. Coastal urbanization and the integrity of

estuarine waterbird communities: threshold responses and the importance of scale Biological

Conservat¡on 141 (1.1\, 2669-267 8.

Dugan J. E., D.M. Hubbard. 2006. Ecological responses to coastal armoring on exposed sandy

beaches. Shore and Beach 74(1): 10-16.Dugan J.E., D.M. Hubbard, l.F. Rodil, D. Revell. 2008. Ecological effects of coastal armoring on

sandy beaches. Mar. Ecol. 29: L6O-U0Dugan J.E., D.M. Hubbard. 2010. Loss of coastal strand habitat in southern California: the role of

beach grooming. Estuaries and Coasts 33(1): 67-77.

Dugan J.E., D.M. Hubbard, M. Mccrary, M. Pierson. 2003. The response of macrofauna

communìties and shorebirds to macrophyte wrack subsidies on exposed sandy beaches of southern

California. Estuarine coastal Shelf science 585:133-148.

Dugan, J. E-, D. M. Hubbard, and B. Quigley.2013. Beyond beach width: steps toward identifying

and integrating dynamic ecological envelopes w¡th geomorphic features and datums for sandy beach

ecosystems. Geomorphology 199: 95-105.Dugan, J. E., D. M. Hubbard, L F. Rodil, D. L. Revell, and S. Schroeter. 2008. Ecolog¡caleffects of

coastalarmor¡ng on sandy beaches. Marine Ecology 29, S1, 160-170. DOI: 10.1111/j.1439-

0485.2008.00231.xDugan, J. E., D. M. Hubbard, M. D. Mccrary, and M. O. Pierson. 2003. The response of

macrofauna commun¡ties and shorebirds to macrophyte wrack subsidies on exposed sandy beaches ofsouthern California. Estuarine, Coastal and Shelf Sciences 585, 25-40.

Dugan, J. E., D. M. Hubbard. ln press. Sandy beach ecosystems. Contributed chapter ìn

Ecosvstems of California (eds E. Zavaleta, H. Mooney) University of Californ¡a Press.

Dugan, J. E., D.M. Hubbard, B.J. Qu¡gìey.2013. Beyond beach w¡dth:steps toward identifying

and integrat¡ng dynamic ecologicalenvelopes with geomorph¡c features and datums for sandy beach

ecosystems. Geomorphology 199: 95-105Dugan, J. E., L. A¡roldi, chapman MG, Walker SJ, and Schlacher T. 2012. Estuarine and Coastal

Structures: Environmental Effects, A Focus on Shore and Nearshore Structures. ln: E. Wolansk¡ and D. S.

Mclusky (eds.) Treat¡se on Estuarine and Coastal Science, Vol 8, pp.7741. Waltham: Academic Press.

Dugan, J. E., O. Defeo, E. Jaramillo, A. R. Jones, M. Lastra, R. Nel, C H Peterson, F. Scapini, T.

Schlacher, and D, S. schoeman. 2010, Give beach ecosystems their day ¡n the sun. Science 329, 1146.

Dugan, J., L. Airoldi, M. G. Chapman, S. Walker & T. A. Schlacher. 2012. Estuarine and Coastal

Structures: Environmental Effects: a focus on shore and nearshore structures. ln: Human-induced

Problems (Uses and Abuses) pp I7-4L, in Estuaries and Coasts (eds. M. Kennìsh, M Elliot). Treatise on

@Chapter2, Elsevier.

Dugan, J.E. and D. M. Hubbard. 2010a. Loss of coastal strând habitat in southern California:The

role of beach groom¡ng. Estuaries and Coasts 33(1):67- 77.

1.6

Dugan, J. E. and D. M. Hubbard. 2010b. Ecological effects of coastaì armoring: a summary ofrecent results for exposed sandy beaches in southern California. ln: Puget Sound Shorelines and thelmpacts of Armoring-Proceedings of a State of the Science Workshop, USGS Publications, pp. 187-193.

Dugan, J.E., & Hubbard, D.M. 2006. Ecological responses to coastal armoring on exposed sandy

beaches. Shore and Beach, 74,10-L6.Dugan, J.E., D. M. Hubbard, H.M.Page, J. Sch¡mel. 2011. Marine macrophyte wrack ¡nputs and

dissolved nutrients in beach sands. Estuaries and Coasts 34(4):839-850Dugan, J.E., D.M. Hubbard, K.J. Nielsen, J. Altstatt and J. Bursek.2015. Baseline characterizat¡on

of sandy beach ecosystems along the south coast of California. Final report to Cal¡fornia Sea Grant.

https://caseagra nt. ucsd. ed u/slte s/d efa u lt/f¡les/5cM PA-24-F¡na l- Re po rt_0. pdfDugan, J.E., Hubbard, D.M., & Lastra, M. 2000. Burrowing abil¡ties and swash behavior of three

crabs, Emerito onølogo Stimpson, Blepharipodo occidenfolls Randall and Lep¡dopã colifornico Eflord(Anomura, Hippoidea), of exposed sandy beaches. Journal of Experimental Marine Biology and Ecology,

255: 229-245.Dugan, J.E., Hubbard, D.M., Mccrary, M.D., & Pierson, M.O. 2003. The response of macrofauna

commun¡ties and shorebirds to macrophyte wrack subsidies on exposed sandy beaches of southernCalifoÍnia. Estuar¡ne, Coastal and Shelf Science, 58S, 25-40.

Dugan, J.E., Hubbard, D.M., Page, H.M., Schimel, J. 2011. Marine macrophyte wrack inputs and

dissolved nutrients in beach sands. Estuaries and Coasts ¡n press.

Dugan, J.E., Hubbard, D.M., Rod¡1, 1., Revell, D.1., & Schroeter, S. 2008. Ecologicaleffects ofcoastal armoring on sandy beaches. Mar¡ne Ecology, 29,160-170.

Feagin, R.4., D. i. Sherman, and W. E. Grant. 2005. Coastal eros¡on, global sea-level rise, and theloss of sand dune plant habitats. Frontiers in Ecology and the Environment 7(3), 359-364.

Griggs,G., Patsch, K. and Savoy, L.,2005. L¡v¡ng w¡th the Chonqing Colìforn¡o Codst. Univers¡ty

Press,Berkeley.55l pp.

Heerhartz, S.M., M.N. Dethier, J.D. Toft, J.R. Cordell and A.s, ogston. 2014. Effects of shorelinearmoring on beach wrack subsidies to the nearshore ecotone in an estuarine fjord. Estuar¡es and Coasts

37 (5): L256-7268.Howe, MA, PH Geissler, BA Harrington. 1989. Populat¡on trends of North American shorebirds

based on the lnternationalShorebird Survey. Biological Conservation 49: 185-199

Hubbard, D. M. and J. E. Dugan 2003. Shorebìrd use of an exposed sandy beach in southernCalifornia. Estuarine, Coastal, and Shelf Scìence 585, 169-182.

Jaramillo, E, J.E. Dugan, D.M. Hubbard, D. Melnick. M. Manzano, c. Duarte, c. campos, R.

Sánchez. 2012. Ecological legacìes of extreme events: footprints of the 2010 earthquake along theCh¡lean coast. PloS ONE. 7(5): e35348

lohnson P. 8., K. L. Martin, T. L. Vandergon, R. L. Honeycutt, R. S. Burton and A. Fry. 2009.

M¡crosatellite and mitochondrialgenetic comparisons between northern and southern populat¡ons ofcalifornia Grunion ¿eures¡hes tenuis. Copeia 2009, 465^474.

Kendall, M.4., Burrows, M.T., Southward,4.J., Hawkins, S.J., 2004. Pred¡ctinB the effects ofmar¡ne climate change on the invertebrate prey of the birds of rocky shores. lbis 146(51): 40-47.

Kersten, M., Piersma, T., 1987. High levels of energy expenditure in shorebirds: metabolicadaptations to an energetically expensive way of life. Ardea 75: 1.75-1-87.

Klapow, 1.4., 1972. Fortnightly molt¡ng and reproductive cycles in the sand-beach isopod,

Excirolana chiltoni. Biolog¡cal Bullet¡n 143: 568-591.Lucrez¡, S.,Schlacher, T.4., Walker,5.J.,2009. Monitoring human impacts on sandy shore

ecosystems: a test of ghost crabs (Ocypode spp.) as biological ¡ndicators on an urban beach.

Environmenta I Mon¡tor¡ng a nd Assessment t52: 413-424.

17

Mart¡n, K. L. M.2015. Beach-spawn¡ng Fìshes: Reproduct¡on in an Endanqered Ecosvstem. CRC

Press, Taylor & Francis Group, Boca Raton, Ft, USA.199 pp. .

Martin, K.L.M. and J.G. Ra¡m. 2014. Av¡an predators target nocturnal runs of the beach-

spawn¡ng marine fish, California Grunion, Leuresthes tenuis (Ather¡nopsidae). Bulletin of the Southern

California Academy of Scìence 113(3).Martin, K. L. M., K. A. Hieb, and D. A. Roberts.2013. A southern california icon surfs north: Iocal

ecotype of California Grunion Leuresthes tenuis (Atherinopsidae) revealed by multiple approaches

during temporary hab¡tat expansion into San Francisco Bay. Copeia ZO1-3,7 29-7 39. Dol 10.1643/Cl-L3-

036.Martin, K., T. Speer-Blank, R. Pommerening, J. Flannery, and K. Carpenter.2006. Does beach

grooming harm grunion eggs? shore & Beach74, U-22.Martin K. L. M., R. C. Van Winkìe, J. E. Drais and H. Lakis¡c. 2004. Beach spawning fishes,

terrestr¡al eggs, and aìr breathing. Physiological and Biochemical Zoology 77:750-759.Martin K. L. M., C. L, Moravek, A.D. Mart¡n and R. D. Mart¡n. 2011. Community based monitor¡ng

¡mproves management of essential fish habitat for beach spawn¡ng Californ¡a Grun¡on. ln Bayed A. (ed.),

Sandy Beaches and Coastal Zone Management - Proceedings ofthe Fifth lnternational Symposium on

Sa ndy Beaches, Ra bat, Morocco. Trava ux de l'lnstitut Scient¡fiq ue 2OIt(6].: 65-72.McLachlan, A. and A. C. Brown. 2006. The Ecolosv of Sandv Shores, 2nd Ed. Academic Press, San

Diego, california. 373 pp.

Mclachlan, 4., Jaramillo, E., 1995. Zonation on sandy shores. Oceanography and Marine Biology:

An Annual Rev¡ew 33: 305-335.Mclachlan, 4., Wooldr¡dge, T., Van der Horst, G., 1979. T¡dal movements of the macrofauna on

an exposed sandy beach in South Africa. Journal of Zoology (London) 188: 433-442.Miles, J.R., Russell, P.8., Huntley, D.4., 2001. Field measurements of sediment dynamics in front

of a seawall. Journal of Coastal Research 17l7l: 195-206.Morgan, R. and Williams, A. T. 1999. Video panorama assessment of beach landscape aesthetics

on the coast of Wales. Journal of Coastal Conservation 5: 13-22. DOI: 10.1007/8F028O2735

Mo¡ser, 4.8., Witherington, 8.E., 2002. Documented effects of coastal armoring structures on

sea turtle nesting behav¡or. In: Mosier 4., Foley 4., Brost B. (Eds)., Proceedings of the Twentieth Annual

Svmposium on Sea Turtle B¡olosv and Conservat¡on. NOAA Tech. Memo. NMFS-SEFSC-477.

Nakâsh¡ma B.S. and C.T. laggart.2002.ls beach-spawning success for capel¡n, Mallotus víllosus

(Muller), a function of the beach? ICES J Mar Sci 59:897-908.Neuman, K.K. L.A. Henkel, c.W. Page 2008. Shorebird Use of Sandy Beaches ¡n Central Calìforn¡a.

Waterbirds, 31(1): 115-121.N¡les, 1.J., Bart, J., Sitters, H.P., Dey,4.D., Clark, K.E., Atkinson, P.W., Baker,4.J., Bennett, K.4.,

Kalasz, K,S., Clark, N.4., Clark, J., Gill¡ngs, s., Gates,4.S., Gonzalez, P.M., Hernandez, D.E., Minton, C.D.T.,

Morrison, R.l.G., Porter, R.R., Ross, R.K., Ve¡tch, C.R.,2009. Effects of horseshoe crab harvest ¡n

Delaware Bay on red knots: are harvest restrìctions working? Bioscience 59(2): 153-164.Nordstrom, K.F., 2000. Beaches and Dunes of Developed Coasts. cambrìdge Univers¡ty Press,

Cambridge.Orme, A. R., G. B. Griggs,, D. L. Revell, J. G. Zoulas, C. C. Grandy, and H. Koo. 2011. Beach

changes along the southern California coast during the 20th century: a compar¡son of natural and

human forcing factors. Shore & Beach 79,38-50.Pendleton, 1., Martin, N., and Webster, D.G., 2001. Public perceptions of environmental quality:

a survey study of beach use and percept¡ons in Los Angeles County. Marine Pollution Bulletin 42, 1155-1160.

Peterson, C.H., 1991. lntertidalzonat¡on in sand and mud. American Sc¡entist 79(3): 236-249.Pilkey, O. H. and A. G. cooper.2014. The Last Beach. Duke University Press,256 pp.

18

Pol¡s, G.A., Hurd, s.D., 1996. Link¡ng marine and terrestr¡alfood webs: allochthonous input fromthe ocean supports high secondary productivity on small island and coastal land communit¡es. AmericanNatura list 147 : 396423.

Pranzini, Enzo, D Simonetti, and G V¡ta|e.2010. Sand colour rating and chromatic compatib¡lityof borrow sediments. Journal of Coastal Research 26: 798 - 808.

Reeves, 8., Bookhein, 8., Berry, H., 2003. Using Shorezone inventory data to identify potentialforage fish spawning habitat. Abstract from the 2003 Georgia Bas¡n/Puget Sound Research Conference.

Revell D.1., J.E. Dugan, D.M. Hubbard. 2011. Physicaland ecological responses to the 1"997-98 El

Nino. Journal of Coastal Research 27(4\:7L8-73O.Rice, C. 2006. Effects of shorel¡ne modification on a northern Puget Sound beach: Microclimate

and embryo mortality in surf smelt lHypomesus pret¡osus). Estuar¡es and Coasts 29, 63-71.Roberts, C. M., Branch, G., Bustmante, R. H., Castilla, J. C., Dugan, J., Halpern, B. S., & Lafferty, K.

D. 2003. Applicat¡on of ecological criteria in select¡ng mar¡ne reserves and developing reserve networks.Ecological Applicat¡ons, 13(sp1), 215-228.

Roberts D., R. N. Lea and K. L. M. Martin.2007. First record ofthe occurrence ofthe CaliforniaGrunion, Leuresthes tenu¡s, ¡n Tomales Bay, Californ¡a; a northern extens¡on of the species. CaliforniaFish & Game 93, 107-110.

Rod¡1, l.F, E. Jaramillo, D.M. Hubbard, J.E. Dugan, D. Melnick, C. Velasquez. 2015. Responses ofdune plant communities to continental uplift from a major earthquake:sudden releases from coastalsq ueeze. PloS ONE DOI:1,Q.1,371,/joornal. pone.0124334

Runyan, K., Griggs, G., 2003. The effects of armoring seacliffs on the natural sand supply to thebeaches of California. Journal of Coastal Research 19(2\:336-347 .

Schlacher, T. 4., D. S. Schoeman, A. R. Jones, J. E. DuBan, D. M. Hubbard, O. Defeo, C. H.

Peterson, M. A. Weston, B. Maslo, A. D. Olds, F. Scapinì, R. Nel, L. R. Harris,5. Lucrezi, M. Lastra, C. M.Huijbers, and R. M. Connolly. 2014. Metrîcs to assess ecological condìtion, change, and impacts in sandybeach ecosystems. Journal of Environmental Management L44,322-335.

Schlacher, T.4., D. S. Schoeman, J. Dugan, M. Lastra, A. Jones, F. Scapini, and A. Mclachlan.2008. Sandy beach ecosystems: key features, sampling issues, management challenges and climatechange ¡mpacts. Marine Ecology 29,70-90.

Schlacher, T., J. E. Dugan, D. S. Schoeman, M. Lastra, A. Jones, F. Scapin¡, A. Mclachlan, and O.

Defeo. 2007. Sandy beaches at the brink. D¡vers¡ty and Distributions 13: 556-560.Schlacher, T.4., Lucrezi, S., & Robinson, W. (2010). Can storms and shore armouring exert

additive effects on sandy-beach hab¡tats and b¡ota? Mar¡ne and Freshwater Research, 61,95L-962.Schlacher, T.4., Schoeman, D.S., Dugan, J., Lastra, M., Jones, A., Scapini, F., & Mclachlan, A.

(2008). Sandy beach ecosystems: key features, management challenges, climate change ¡mpacts, and

sampling issues. Marine Ecology, 29, 70-90.Schlacher, T.S., A.R. Jones, J. E. Dugan, M. Weston, L. Harr¡s, D. S. Schoeman, D. Hubbard, F.

Scapini, R. Nel, M. Lastra, A. Mclachìan, C.H. Peterson.2014. Chapter 5:Open-coast sandy beaches andcoastaldunes. J. Lockwood, B. Mazlo (Eds.) pp37-94|n: CoastalConservation. Cambridge UniversityPress, Ser¡es in Conservation B¡ology

Schooler, N. K., J. E. Dugan, D.M. Hubbard, 2014. Detecting change in ¡ntertidal species richnessover time on sandy beaches: calibrating across sampling designs. Estuar¡ne, Coastal and Shelf Science

150:58-66.sobocinsk¡, K-1., cordell, J.R., Simenstad, c.4., 201"0. Effects of shoreline modifications on

supratidal macroinve rtebrate fauna on Puget Sound, Washington beaches. Estuaries and Coasts 33,

699-7 1-1.. doi:lO.IOO7 / sL2237 -009-9262-9.

L9

Toft, J.D., Cordell, J. R., Simenstad, C.4., Stamatiou, L.A.,2007 . Fish distribut¡on, abu nda nce, a nd

behavìor along city shorel¡ne types in Puget Sound. North Amer¡can Journal of F¡sheries Management27 , 465-480.

Vousdoukas, M¡chal¡s 1., Adonis F. Velegrakis, Aret¡ Kontog¡anni, Efstratia -N ata lia Makrykosta.

2009. lmpl¡cations of the cementation of beach sed¡ments for the recreational use of the beach. Tourism

Management 30: 544-552.Wood, D.W., Bjorndal, K.4., 2000. Relation of temperature, moisture, salin¡ty and slope to nest

site selection in loggerhead sea turtles. Copeia 2000, tt9-128.Yates, M. 1., R. T. Guza, W. C. O'Reilly, and R. J. Seymour. 2009. Overv¡ew of seasonal sand level

changes on southern californ¡a beaches. Shore & Beach 77:39-46.zhang, K., B. C. Douglas, and S. P. Leatherman.2004. Global warming and coastal erosion. Climate

Change 64: 41-58.

20

LETTERS OF SUPPORT

See Attached

APPENDIX

From Pope Francis, Encyclical 2015:

ln the face of possible risks to the environment which may affect the common good now and ìn the

future, decìs¡ons must be made "based on a comparison of the risks and benef¡ts foreseen for thevarious possible alternatives"

It is not enough, however, to think of different species merely as potential "resources" to be exploited,

while overlooking the fact that they have value in themselves. Each year sees the disappearance ofthousands of plant and anìmal species which we will never know, which our children w¡ll never see,

because they have been lost forever. The great major¡ty become extinct for reasons related to human

act¡v¡ty. Because of us, thousands of species will no longer give glory to God by the¡r very ex¡stence, nor

convey the¡r message to us. We have no such r¡ght.

Greâter investment needs to be made in research aimed at understand¡ng more fully the functioning ofecosystems and adequately analyzing the different variables associated with any significant modification

of the environment. Because all creatures are connected, each must be cherished with love and respect,

for allof us as liv¡ng creatures are dependent on one another.

See Attached for more appendices

21-

Projected Work Schedule

Project Title: A NEW METI{OD FOR MONITORING IJRBAN BEACII ECOSYSTEMS

¡\cfivities 2016-2017 2017-2018M M J J S o N D J F M M S o N D J

Partnerschedulingfor'wolkshopsandorientation

X x X X x X x

Printing andolganizingfield geal forvolunteeÌs

x X x x X X

Tlainilgworkshopsand

monitoringwith oarlners

x X X X x x

Weboutreacll,databaselnanagen'ìent

X X X X X x x x x X X X x X X X x X X x

Dafa analysisand reporting

X x X X X X X X X X X X X

I{ecognitionofvoluntgels,evaluation of

X X X

l(eltnelìtentof proglarnarìd protocol

X X X x X X X

Oulreach toBeachEcologyCoalition andscientilÌcgroups

x X X x X

O¡lB Control No. 0648,0362

Expiration Dâte 7/3'1/2015

SEA GRANT BUOGET FORM 9O-4

JRANTEE: PEPPERDINE UNIVERSITY JHANI/T'KUJTUINU,:

IRIEF TITLE: A NEW IVIETHOD FOR MONITORING URBAN BEACH ECOSYS- DURA I ION (monthrFebruary 1,2016 - January 31 , 2017

)RINCIPAL INVESTIGATORì KAREN MARTIN, Ph.D.12 months 1 Yr

\. SALARIES AND WAGES:

L Senior Personnel

man-monthsNo. of lAmount ofPeople lenort Sea Grant Funds MâtchinÕ Funds

a. (Co) Pr¡nc¡Þal lnvestrqator Ut 5.05(b. Assocrates (l-acultv or St¿

SrJ¡, lotel 0.€ 5,05 5.05(

2 Other Personnela. Prolesstonals:

c. Res. Asst./Grad Students: Underqraduate Stude 5.( 5 2,50td. Prof. School Studentse. Pre-Bachelor Student(s):

h. Other:Total Salar¡es and Waqes 5 1(

3. FRINGE BENEFITS: (30,3%} '1.53(

Total Personnel (A and B): 'l 1.58( 9.0r

PERMANENT EOUIPMENI:

4.00( 1.00(

uomeslc - Prôtocol lmôlementalron 4,32{2. lnlernatronâl

Total Travel: A

PUBLICATION AND DOCUMENTATION COSTS:

.t. ut¡-itsKU(Jùtù:1 Volunteers - C¡tizens (¡n-k¡nd) 50 12

4 UUT

3 Web Development / Host¡nq (in-kind) 't0( 1 .20(4S.

ltoa n 5.50(15.00(

letinos l5 s¡tes) 4.C 4.00cTotel Other Costs: 29.60(

rOTAL DIRECT COST lA thÌouoh Gl: 49.50( 52.404

NDIRECT COST 110% of salaries and waqes / Pl and students):INDIRECT COST loff campus 26% of $ ):

Total lndirect Cost:

U IAL UUù I ò: 5U 5Ut 524

Ol\¡A Control No. 0648'0362Expiration Date 7/31/2015

SEA GRANT BUDGET FORM 904

iRANT/PROJECT NO.ì

3RIEF TITLE: A NEW METHOD FOR MONITORING URBAN BEACH EcoSYSTt DURA I l(JN (months):Februarv I 2017 - JanttaN 31 2018

.KII\UIHAL II\Vtrù I IUA I (JK: I\AKtrI\ IVIAK I II\, FN,L.¡

12 months 1 Yr\. SALARIES AND WAGES:

'l Sen¡or Personnel

man-monrnsNo. of lAmount ofPeoote lgrort Sea Grant Funds Matchinq Funds

a. lco) PrinciDal lnvestioator: Dr. Karen Martin 0 5 5

b. Assoc¡ates (Facultv or Staff):SUb TÔtaI: UT 5.U51

2 ()ther Personnela. Prolessronâls:b. ReseaÍch Assoc¡ates:c. Res. Asst./Grad Students: Underqraduate Student 5 )d. Prof . School Studentse. Pre-tsachelor Student(s)

o lechntctansh. uther:

Total Salar¡es and Waoes 1U

ð. tr ötsNErl I ù: (JU.J7ol 1.53t 53{.

Total Personnel (A and Bl: 11.58( 9.08(

2

E. I XAVtsL:1 Dômêslia - Prôtôaôl lmôlêmêntâhôn 4.3zt2. lnternatronal

4.32C

PUBLICATION AND DOCUMENTATION COSTS:

C¡t¡zens (¡n-k¡nd) b04.00(

:l Web Hostrno I rn-Krnr 1 2o,( 1.20(

5 Sub-contract UCSB - Co-Pl Dr. Jennv Duqan 5,

6 Pro¡ect Coofdinator (Melissa - contract) 16

srtes 5 5 U(J(

I Orat utner uosrs: 31.

49,10( 53.40{

NDIRECT COST 110% salaries and waqes / Pl and studentsl:NDIRECT COST (Off campus 26% of $ ):fotal lnd¡rect Cost:

50,10t 53.40t

BIìIBIì CURRICUI-UM VITAE

NAME: Kalen L. MartinAddress: Deparrnrent of Biology, Peppeldine University, 24255 Pacihc Coast Iìighway, Malibu,cA 90263-4321Phone (work) 310-506-4808 (home) 310-713-4808 Ernail kmaltin(¿?peppçrç[¡c-9ds

EDUCATIONB.S. Zoology, Univelsity of OklaliomaM. S. Zoology, University of OklahornaPh.D. Biology, University of California, l.os Angeles

POSITIONS I{ELDl99l- Ptesent: Professor III iu Biology, Peppeldine Unìversìty, Malibu, Califolnia, 1991- present.

Plomoted from Assistant fo Associate in 1994, tenured 1997. ht2000 p|ornoted to lìull Professor'and awarded F-rank R. Seavel Endowed Chail,

2009- P¡esent: Associate Editor'. Physiology and Physiological Ecology, for COPEIA, the peer-reviewedscientific.ioulnal of the Arnerican Society of Ichthyologists and Herpetologists.

1990-1991 Friday Harbor Postdoctoral Fellow, Fliday I-larbor Laboratolies, University of Washington.

SELECTED PUBLICA'I'IONSMartin, K. L. M. 2015. lleach Spowning l;'ishes; Re¡ roduclion in cn lìndangered EcosysÍem. Oxfold, tJK:'faylor'& Flancis Gloup. CRC Pless,223 pp. ISBN: 978-1-4822-0191-2. Also available as an e-Book.

Martin, K. L. M. and J. G. Railn. 2014. Avian pledators target beach spâwrlirìg nlaline lish,California Grunion, Leuresthes tenuis.l)ulletin ofthe Southeln California Academy ofSciences113; 187-199.

Martin, K. L. 2014. Review paper': Theme and variations: amphibious air'-breathing inteltidalfrshes. Journal of Ì-islr tsiology 84,577-602. doi: 10.1111/.jft.12270

Mâftin, K. L. M., K. A. I-lieb, and D. A. Robelts. 201 3. A southern Califolnia icou surfs north: localecotype of Califolnia Glunion Leuresthes lett zir (Athelinopsidae) revealed by rnultiple apploaohes tlulingtenrporaly lratritat expansion into San Frarcisoo llay. Copeia 2013: 729-139 . Doi 1 0. 1643/Cl- I 3-03 6

Maltin K. 1,. and A. L. Caller. 2013. Blave New Propagules: Telrestlial Eniblyos in Anamniolic lìggs.Integlative and Compalative Biology 53: doi:10. I093/icb/ict01 8.

Martin K. L., K. Ilailey, C. Moravek ancl K. Callson. 201 I . 'l-aking the plunge: California Gnrnioncmblyos cmergc rapidly with environrnentally cLrcd hatclting (ECIJ). hitegrative and CotnparativeBiology 5l:l-12. doi: I 0. 1093/icb/icr'03 7

Moravek C. L. and K. L. Martin. 201 l. Life goes on: Delayed liatching, extended incubation, audhetelokairy irr developnrent ofemblyonic Californja Grutrion, Leure,slhe.g Íenui.ç. Copeia 201l(2): 308-3 t4. DOI 10.16431CG-10-164

Martin K. L. M., C. 1,. Molavek and A. J. Vr'alker'. 201 l. Waiting for a sign: Exlendcd incubationpostpones lalval stage in the beach spawning Califolnia Glunion Leureslhe,s lenuis (Ãyres).Errvironnrental Biology ol' Irislres 91:63-'10. doi:/ I 0. I 007/s I 06 41-0lr0-9160-4

Martin K. I-. M., C. I-. Molavek, A.D. Maltin and Iì. D. Martin. 201 I . Community based monitolirrgimploves management ofessential fish hatritat fol beach spawrring Calilornia Glunion. In Bayed A. (ed.),

Sandy Beaches and Coastal Zone Mauagement - Proceediugs ofthe F'ifth IntelnationaI Synrposium onSandy Beaclies, Rabat, Morocoo. Travaux de l'Institut Scientifiqre201I(6):65-72.

Johnson P.8., K. L. Marlin, T. L. Vandelgon, R. L. lìoneycutt, R. S. Burton and A. Ir1y.2009.Microsatellite and lnitochondlial genetic cornpalisons between northern and sor.rtheln populations ofCalifolrria G¡trl'tion Leureslhe:i tenuis. Copeia 2009: 465-474.

MaÍin K, L. M., C. L. Moravek and J. A. F'lannery. 2009. Ernbryonic staging seties llor the beachspawning, tenestrially incubating Califolnia gruniou Leuresthes tenuis with cor'ì'ìparisons to ofl'ìer

Atherinomolpba. Journal of Fish Biology 75: l7-38.

Matsunoto, J, K. and K. L. M. Malin. 2008. Lelhâland sublethal effects of alteled sand salinity onenrbryos of beach-spawning Califorlia Grunion. Copeia 2008: 483-490.

Martin, K., A. Staines, M. Studer, C. Stivers, C. Molavek, P. Johnson and J. Flannery. 2007. GrunionGleetels in California: Beach Spawning Fislì, Coastal Stewardship, Beach Managernent and Ecotoulisrn.Pp. 73-86 r)r Liick, M.; Gräupl, A.; Auyong, J.; Miller, M.L. & M.B. Orarns (eds.): Proceedings of the 5't'

Inlernational Coaslal & Marine Tom'isnt Congres,s: Balancing Marine Tourisnt, Development andSustoinability. Auckland, New Zealand: New Zealand Tourism Research lnstitute.

Robelts D., R. N. Lea and K. L. M. Maftin.2007. Fitst record of the occulrence of the CalifolniaGlunion, Leuresthes tenuis, it't Tornales Ilay, Califolnia; a northern extensior'ì ofthe species. CaliforniaFish & Ganre 93:107-l10.

Maltin K., T. Speer-Blank, R. Pommerening, J. Flannery and K. Carpenter.2006. Does beach gtoonringlrann glunion eggs? Shore & Beach 14: 11-22.

Iloln M. Il. and K. L. M. Martin. 2006. Intertidal fishes. Pp. 205-226 in: L. Allen, M, I-ioln, and D.Porrdella (eds.),.åcolog of Caliþrnia Marine Fishes. Univelsily oîCalifornia Press.

Manin K. L. M., I{. C. Van Winkle, J. E. Dlais and IJ. Lakisic. 2004. Beach spawning fishes, lerrestrialeggs, and air breathing. Physiological and Biochemical Zoology 77:150-759.

Speer-Blank T. and K. L. M. Maltin. 2004. Ilafching cvents in the California Grunion, Zearesf hes tenui.t.

Copeia 2004: 2l -27 .

Srryder E. A. and K. L. M. Martin. 2002. Temperatule effects on egg survival and hatching during theexterrded incubation peliod of Califomia gluuiou, Leure,\lhe.\ lenuis. Copeia 2002: 3 l3-320.

Martin K. and K. A. Nagy.2002. Animal physiology and global environnental change. Pp. 136-139 inIlarold A. Moorrey and Josep Canadell (Eds), Dncyclopedia of Global Dnvirutnrcnttrl Change, Volunte 2,

T-he Earth St¡stent: Biological and Ecological Dinrcnsions ofGlobal Ent,ironmenlol Cltange. London:John Wiley and Sons.

Maltin K. l-. M. and D. t,. Swiderski,2001. Beach spawning in fishes: Phylogenetic tests of hypotheses.A nrerican Zoologist 4l: 526-531.

Grieni, J. N. and K. l-. M. Maltin, 2000. Wave actiou: 'l'he envilonmental tligger for hatohing in theCaliforrria gluniory Leuresthes len uls ('l'eleostei: Atherinopsidae). Marine lliology 131: 111-l8l.

Martin K. L. M. 1999. Ileady and waiting: Delayed hatching and exlended incubation of ananrniolicvcltebrale terrestlial eggs. Anerican Zoologist 39: 279-288.

Holn, M. H., K. L. M. Maltin and M. A. Chotkowski, Eds. 1999. Intertidal Ì'ishes: Lile in Tu,o Tl/orlds.

San Diego: Acaderric Pless. Also available as an e-[rook. ISI]N-13: 978-0123560407

S. S. S. Sunrida and K. L. M. Martin, Eds., Antttiote Origins: Conry eting lhe Tronsilion lo Lund.NewYolk: Acadenric Pless- Also available as an e-book. ISBN-13: 978-0123992604

BRII]F CTJRRICUI,IJM VITAI]

NAME: .Ienifel E. l)uganAddress: Marine Science Institute, University ol California, Sanla Balbala, CA 93106-6150Plrone : (work) 805-893-2675 (home) 805-685 -8427 EmaiI: Ldugan@lifesci.ucsb.edu

EDUCATIONB.A. Aquatic Biology, high honols, Univelsity of Caìifornia, Santa BarbaraPh.D. Biology, {Jnivelsity of Calilbrnia, Santa Barbara

POSITIONS IIELD2003-present Associate Research Iliologist, Maline Science Institute, UC Santa Barbara, CA2002-present Science Coordinator, Salìta Barbala Coastal LTER UC Santa Balbala, CA2000-2007 Deputy Dilector', Coastal Maline lnstitute, UC Santa Balbala, CA1995-2002 Assistant Research Biologist, Malinc Science Lrstitùte, U.C. Santa Batbara1994 Posldoctoral Fellow, Maline Science, Univ. of Otago, DLrnedin, New Zealand1993 Postcloctoral Fellow, Dept. ofZoology, Univ. of Port Elizabeth, Republic of South Aflical99l-2004 l,ectuter, Envilon Studies/Ecol Evol,Mar Biol UC Santa Barbara, CA. (20 terrrs).1988-1993 Marine Biologist, Coop. Palk Sci. Unit, UC Davis, Channel Islands Nat. Palk

SELECTED PUBL]CATIONSln pless Dugan, JE, DM I lubbard. ir 7:rc.rs. Sarrdy Beach Ecosystems. in: Ecosystems of Califol nia - A

Source Book. Mooney, 11, E, Zavaleta, eds. University ofCalifornia Press2014 Schlacher', I'S, DS Schoeman, A[ì Jones, JE Dugan, D l-lubbald, O Defeo, CH Peterson, MA

Weston, B Maslo, AD Olds, F Scapini, R Nel, I-R Hal'ris, S l,ucrezi, M Lastla, CM Iluilbers,RM Connolly. Metrics to assess ecological condition, ohange, and impacts ir.r sandy beachecosysteÌìrs. ,I Environ Manag 144: 322-335.

2014 llubbard, DM, JE Dugan, NK Schooler, S Viola. Local extirpations and legional declines: tlrecase of endemic upper beach fauna in southern Califorria. Est. Coastl. She(Sci. 150:67-75

2014 Viola, S, JE Dugan, DM lìr¡bbard, NK Schoolel. Bunowing in beach fill, implications for'recovery ofsandy beach ecosysterns. Est. Coastl. She(Sci. 150: 142-148.

2014 Schooler', NK, J. E. Dugan, D.M. l{ubbard. Detecting change in intedidal species richness:calibrating the effect ofsurvey method and sampling effolt fol sandy beaches. Èsl. Coastl.Sht( S< i. 150: 58-ó6.

2014 Schlachel, TS, AR Jones, JE Dugan. M 'Weston, L Halris, f)S Schoeman, D l{ubbard, FScapini, R Nel, M Lastla, A Mcl-achlan, CI I Peterson. Chapter' 5: Open-coast sandy beachesand coastal dunes. In: Coastal Conservation, Cambridge University Pless.

2013 Dugan, JE, DM l-lubbald, B. Quigley, Beyond beach width: steps toward identifying andintegrating dynamic ecological envelopes with geornorphic featules and clatums fol sandybeach ecosystems . Geontor¡thol 199: 95-l 05.

2012 Jalamillo, E, JE Dugan, DM ìJubbard, D Melnick. M Manzano, C Dualte, C. Campos, R.Sánchez. Iìcological irnplications of extlelne events: foofprints of the 2010 earthquake alongthe Chilean coasl. PLoS One 7(5), e35348

2012 Dugan, Jli, I- Ailoldi, MG Chapman, S Walker,'fA Schlacher. Estuarine and CoastalStluctures: EnviloumentaI Effects: a focus on shole and nealshole sttuctutes. Pp l7-4) ln:I'lurnan-induced Problems (Uses and AbLrses) in Estuaries aud Coasts (eds. M. Kennish, M.Elliot), 'l'reatise on Èstualin931¡l-C-p4¡!al Science Vol 8 Ch 2, lilsevier.

2012 Balnard, PL, DM I-lubbald, JE DLrgan. Beach response dynamics ofa lilloral cell using a l7-year single-poin1 tirne serics ol'sand thickness . Geontorphol.,139- 140:5 88-598,

2011 l)ugan, JLì, DM lìubbald, llM I'age, J Schirnel. Marine macrophyte wtack inputs anddissolved nutrieuts in beach sands. lì,,it. Coo:jrj.34(4): 839-850.

201 I Revell DL, JìJ Dugan, DM lìt¡bbard. Physical and ecological responses of beaches to the1997-98 El Nino. J. Coastal lÌ.es.27 (4):118-730.

2011 Dawson, MN, PI'ì Barber, LI Gonzales, Iì.J'l'oonen, JE Dugan, lìK Glosberg. Pbylogeoglaphyoî Enrerita analoga (Crustacea, l)ecapoda, llippidae), an easteLr'ì Pacific Ocean sand crab withIong-livcd pelagic Iawae . l./ìiogeog. 38(8): 1600-1612.

2010 Dugan, JE, O Defeo. E Jaramillo, AR Jones, M l-âstra, R Nel, CII Petelson, F Scapini, TSclrlacher', DS Schoeman. Give beach ecosysterrs theil day in the sun. Science,329'. 1146.

2010 l)ugan, JE, DM l{ubbard. Loss ofcoastal stland habitat in southem Califolnia: the role ofbeach glooming. Est. Coqsts.33(I): 67-71.

2009 Defeo O, A McLachlan, D Schoernan, l- Schlacher, J Dugan, A Jones, M Lastra, F Scapini.Tl'ìreats to sandy beaclr ecosysterns: a review. Est. Cousll ShelfSci. Sl:1-12

2008 Dugan J.E., D.M. Hubbald, I.F. Rodil, D. Revell. Iìcological effects of coastal annoring onsandy beaches. Mar. Ecol.29: 160-170.

2008 Schlacher TA, ì)S Schoernan, J l)ugan, M. Lastra, A Jones, F Scapini, A Mclachlan. Sandybeaclr ecosystenrs: key features, lnarlagement challenges, clinrate change irnpacts, andsanpling issues. Mai'. Ecol.29: 70-90.

2008 Page HM, DC Reecl, M Brzezinski, J Melack, JE Dugan Assessing the importance of Iand andmarine soulces ol olganic lnatter to kelp folest ltrod webs- Mar. Ecol. Prog. Ser. 360:4'1-62.

2008 Laslra M, HM Page, JE Dugan, DM lirbbald, IF'Iìodil. Processing ofallochthonousmaclophyte subsidies by sandy beaclr consumels: estirnates offeeding lates and irnpacts onfood resources. Mor. Biol- 154:163-174.

2001 Schlacher TA, JE Dugan, DS Schoernan, M Lastla, A Jones, Iì Scapini, A Mclachlan, ODefeo. Sandy beaches at the brink. Dñ,. Dnr. l3(5): 556-560.

2007 Page IìM, Jts Dugan, DM Schloeder', MM Nishimoto, MS Love, JC lJoesterery. Tlophic linksand condition ofa teÍì'ìperate reeffisb: corn¡ralisons among offshole oil platfolni and naturalreefhabitats. Mar. Ecol. Prog, Ser.344: 245-256.

2006 Page HM, JI3 Dugan, CC Culver, J Hoesteley. Exotic inveftebrate species on offshole oilplatforms. Mar Ecol Prog.,S¿r. 325: l0l-107.

2006 Dugan JE, DM Ihrbbard. Ecological respol'ìses fo coastal armoring orr exposed sandy beachcs.Shore & lJeach.74( l): 10-16.

2005 Bram JB, IIM Page, JE Dugan. Spatial and ternporal variability in early successional patlernsofan inverteblate assemblage at an offshore oil plalforrn..l Exp. Mar. Biol. Ecol. 311(2):223-Itt.

2004 Bornkarnp R, IìM Page, JE Dugan. Role offood subsidies and habitat structure ir'ì influencingbenthic communilies ofshell mounds at sites ofexisting and fornicl offihole oil platforms.Mar. ßiol.l432-1193

2004 Dugan JE, DM lìubbard, E Jaramillo, IJ Contreras, C Duârte. Colnpetitive interactions iunracloinfauna I animals of exposed sandy beaches. Oeco l ogia. l 39 (4): 630 -640

2003 Dugan JË, DM llubbald, M McCrary, M Pierson. 'lìlre lesponse of uracrofauua communitiesancl shorebirds to mâcropl'ìyto wrack subsidies on exposed sandy beaches ofsouthenrCalifomia. Est Coastl ShelfSci.58S: I33-I48.

2003 Ilubbald DM, JE Dugan Shorebird use ofan exposed sandy beach in southeln California. Es¡.Coastl. ShelfSci.5SS: 169- I 82.

2003 Ailame S, JE Dugan, KD l-affer1y, I'lM Leslie, D McArdle, RR Warner. Applying ecologicalcl iteria to the design of marine reserves: a case study flom the California Channel Islands.Ecol. Appl. l3( I Suppl S):S170-S184.

2000 DLrgan JE, DM IìLrbbard, M Lastla. Ilunowing abilities and swash behaviol ofthree crabs,Enterita analoga Stit'r'tpson, Blepharipodo occidentalis lìandall and Lepidopct calìþrnicuIìfford (Anornura, Hippoidea), ofexposecl sancly beaches. J. Exp. Mar. Iliol. Ecol.255(2):229-245.

1999 Dtrgarr JB, A McLachlan. An assessmert of longslrole rnovement in l)onax serrtr. Röding(Bivalvia: Donaciclae) on an exposed sandy beach..l Exp. Mar. Biol. Ecol.234 (l): lll-124.

1995 Mclachlan A, E Jaranillo, O Defeo, J Dugan, A de Ruyck, P Coetzee. Adaptations ofbivalves to different beach types. ,/. Exp. Mar ßiol. Dcol. 187l. )41-160.

1996 Mclachlan A, J Dugan, O Dcl'co, A Anscll, D Ilubbard, E Jaramillo, P Penchaszadeh. Beaclrclarrr fishelies. Oceon. Mat'. Biol. Ann. Rev.34: 163-232.

1994 DLrgan JE, DM Ilubbald, AM Wenner. Geoglaphic variation in life history in populations ol'tlre sand clab, Emerila unaloga Stimpsol, on the California coasl: relationships 1o

errvilonnrental valiables..l Exp. Mar. BioL Lcol. |81:255-278.

SUMMARY PROPOSAI" FORM

Project No. (Fol ofhce use)

PROJECT TITL.E: A New Method for Monitoring Ulban Beach Ecosystetns - Impletneutationof "All Ashore"

OBJECTIVES:

i) Refine and publish the f¡eld guide, phone app, training manual, and data acquisìtion format

for volunteers and on an ¡nternet portalfor the pubìic.

¡i) Recruit and train up to 150 volunteers ìn five local partnerships to monitor beaches using

our educational materials and monitoring methods.

iii) Carry out training workshops for volunteers at each partner location in spring (April/ May/

June) and fall (August/ September/ October), and have follow-up meetings in winter(November/ December/ January).

iv) Assess volunteer attitudes and knowledge about beach ecosystems before and after theprogram. Compare w¡th attitudes and knowledge of beachgoers who have not part¡c¡pated

in the program.

METIIODOLOGY:

1) A l¡st of b¡otic and ab¡otic ind¡cators of beach ecosystem status su¡table for use by tra¡ned cit¡zen

science participants has been developed with the current funding.

2) A set of assessment protocols for monitoring specif¡c indicators on sandy beaches by citizen

sc¡entists has been created and tested.

3) Pilot programs to tra¡n citizen scientists will be initiated at multiple beaches in five coastal

count¡es, in cooperat¡on with localpartnerships and stakehoìders, including universities, NGOS,

aq uariums and science educators.4) Selected beaches will be monitored in parallel by tra¡ned volunteer cit¡zen scientists and

sc¡entif¡c professionals from the work¡ng group to verify the results and validate the reliability ofindicators, and inform adjustments to protocols and materíals.

IìA'I-IONAI,E:

Every urban sandy beach ¡n Calîforn¡a, no matter how altered or how many millions of human v¡sitors itaccommodates, reta¡ns v¡tal ecologicalfunctions. These functions include physical processes such as

shoreline protect¡on and water filtratìon, and biological functions such as nutrient cyclìng through foodwebs and nursery functions for birds, mammals, fish, reptiles, and invertebrates. Little data exists toevaluate natural variat¡on in sandy beach ecosystems. The lack of ìnformation on ecologicalconditionsand functions of urban beaches in southern California impedes planning for management and

conseruation of these ¡mportant coastal ecosystems. More data on the ecological condition of beaches

in southern California are urgently needed to address coastal resil¡ence. Work¡ng with c¡t¡zen sc¡entists

us¡ng our new method will increase the ìikelihood for long-term susta¡nabil¡ty of beach monitoring incollaboration with local partners. The outreach and reliable data will enhance recognition of beaches as

important coastal ecosystems, to protect the biodiversity and wildl¡fe that depend on them and the vitalecological funct¡ons beaches provide.

ffiffiffiffiffi$ ffiffiffitffiffiw ffiffiffiffi.ffirffiffiffiTo onhance ecosystem conservãtion

and beach managementto bâlance nâturâ¡ resource

protect¡on and recreationäl use.

July B, 2015

USC Sea Grant Urban Oceans Program

Greetings,

I âm writing in support of the proposal "All Ashore" for "A New Method for Monitoring Urban

Beach Ecosystems - lmplementation," for funding by the USC Sea Grant Urban Oceans

Program. We are an organizat¡on w¡th a long history of working collaboratively with manydifferent stakeholders and const¡tuencies. We provide connect¡on between groups that didnot exist previously, open¡ng discussions and sharing expertise ¡n powedul new ways.

There is a nêed for greater public understanding of the beach ecosystem, and ourorganizat¡on supports the working group's efforts to develop a new method and a pilotprogram that works with partners at the local level to ìmplement community-basedecosystem monitor¡ng. We will provide expertise, advice, forums fol discussion, andelectronic distribution of information for ihis effort.

9inqerely,...t \/I) -.-...-\-)'\ -\a .---_, -\L-/ ( )v_/

- \_. ,.-/

Denn ib ll Sim rnons

President, Beach Ecology Coalition

Beach Manager, City of San Diego (retired)

24255 Facific Coasl lliShwiry, Malil)u, CA 90263ùeachl:coloßvcoalltíon.OrrÌ

bay restoration commissionSTEWARDS OF SANTA MONICA BAYsanfa mon¡ca bay restoral¡on commiss¡on 2' 320 wesl 4tt' sfreet, ste 2oo; Ios angeles, Çatíforn¡a 90013

sanÍamon¡cabay.org213/576-6615 þhone 2 213/576-6646 fax ,

July 3, 2015

Dr. Linda Duguay, DirectorUSC Sea Grant Program3616 Trousdale Pkwy AHF 253Los Angeles, CA 90089-0373

RE: Proposal Appl¡cat¡on - A New Method for Monitoring Urban BeachEcosystem - lmplementation

Dear Dr. Duguay:

On behalf of the Santa Monica Bay Restoration Comm¡ssion (SMBRC), I amwr¡ting in support of this application for a grant to fund "A New Method forMonitor¡ng Urban Beach Ecosystems - lmplementation."

Sandy beaches are important natural habitats directly linking marÌne andterrestrial environments. Healthy natural sandy beaches support unìque, oftenendem¡c plants and animals and are also critical for protecting our coastline fromerosion and other impacts of climate changes, However, sandy beaches in ourState have been managed primarily as recreational areas, and the ecologicalservices and benefits provided by sandy beaches have been gravelyunderstudied and u nderappreciated. To address this problem, the proponents ofthÌs project has developed, with Urban Ocean funding support from USC SeaGrant, a science-based and user-friendly method for repeatable assessment ofselected indicators of the ecological condition of sandy beaches, This newassessment tool has the potential to be used over the long term to f¡ll existingdata gaps, examine the effects of management and natural perturbat¡ons onbeach ecosystems, and increase public awareness of the ecological value ofsandy beaches in southern California. The proposed project is the critical nextstep for implementing training and data collection based on the new assessmentmethod and for establishing local partnerships to ensure long{erm commitmentand participation in beach monitoring.

Protecting and restoring the ecological health of sandy beaches is an importantpart of our organizatton's m¡ssion. To ach¡eve our mission, the SMBRC hasactively supported and participated in the activities of the Beach EcologyCoalition, including the development of the new beach assessment method. Weare excited about this new grant opportunity and are committed to our

ou¡ Ít¡ss¡otÌ: to resfore and enhance lhe santa mon¡ca bay lhroLtgh act¡ons and pafulersh¡ps that ¡mprcvewater quatity, conserve and rehabililate natural resources, and prolect the bay's benef¡ts and values

bay restoration commissionSTEWARDS OF SANTA MONICA BAYsanta nonica bay restorat¡on comm¡s$on 'r' 320 west 4tt¡ street, ste 200; tos angetes, Çal¡fom¡a 90013

21 3/57 6-661 5 phone ) 21 3/57 6-6646 fax / san famonrcabay.org

continuous support and participation. Thank you for your consideration. Pleasefeel free to contact me at 213-576-6639 (qwanq@waterboards.ca.qov) shouldyou have further questions.

Sincerely,/14 \¡*--.7?--

Guangyu WangDeputy DirectorSanta Monica Bay Restoration Commission

ou tniss¡oii: to resÍore and enhanÇe the santa monica bay through acL¡ons and pañnersh¡ps that ¡mprovewaÍer qual¡ty, conserve and tehab¡l¡lale natural resoLtrces, and prctect the bay's benefits and values

*@1".æXt r¿¡l þ4

FR¡ÐERFOUNDATION

8UR

June 25,20l,3

USC Sea Glant U|ban Oceans Progtanr

Deal Sil ol Madam:

On behaìloftlle Surfridel Foundatiou, I arn wI.iting in supporl ofthe proposal on the developntent ofa new

method for cour¡¡unity-based monitorilìg of beach ecosystetns, sübmittsd by Dr. Kalen Martir.

The Sur'fi idel Foundation is a non-plofit envilonlnental organization dedicated to the protection and

enjoyment ofthe world's oceans, waves, and beacltes thtough a powerful network. We have over'50,000mel:rbels alld ll0 all volunteer chapters atound the nation who are active beach usets and ale corlnlilted to

beach and coastal preseNation.

Beaches, like many coastal ecosystelns a[e tl]reatened by coastal development, maDagemetìt decisions, sea

level rise and exlensive humall use. I lowever, unlike other coaslal ecosystem such a wetlands, lockyinteÍidal or kelp forcst ecosysteln, thele is no metlic for evalualing the ecological lìealth ofsandy beach

ecosysterìrs. The ploposed project will devclop beach ecosysten metrics will be useful for conselvationplanning, lol example through setting ecosystenì-basod ÌestoÌation or preservation goals, chalacterizirtg theexisting habitat and defining reference colìditions to measure impacts or ostablish mitigation rcquiremel]ts.The pro.ject will also support citizerì-bascd monitoting and education and outreach opportunities

'lhis project is suppofed by a bload range of orgalt izations including academia, coastal conservationolganizations, eDvi¡onntental consultants alìd state resoutcc ard coastal ntanagement agencies.

The Surflider Foundation is keenly interested in this research and supporlive ofthis proposal because il can

have direct application to on-the-gtound projects beirìg coltsidered on beaches cveryday. Fullher, itplovides an excellent tool to incroase awareness ofthe connectivity and inìpoÍanca ofcoastal sandy beach

ecosysfen]s in protecting the mat ine and coastal ecosystems broadly.

Sincelely,

#Æd{-Chad NelsenEuviroDlnental Dilectol'Sult ider Foutldation

PO Box 6010 . San Cler¡ente, CA 9267 4 . 949 492-8170 . www.surfrider.o rq

ã&"OCEAN'INSTITUTEEXPERIEI.ICE ¡S fHE TÉACHER

Júne 25, 2013

To Whom lt l\¡ay Concernl

The Ocean Institute is pleased to participate in A New Method for Community-Bdsed Monítor¡ng of Urbdn Bedch

Ecosystems, a collaborative project w¡th stakeholders, Pepperdine Univers¡ty, and UCsB,

The Ocean lnst¡tute ¡s commìtted to promoting excellence in sc¡ence educat¡on and welcomes the opporlun(y toeducate students to value and take action to improve the environmental health of the planet's frag¡le ecosystems.Annually, the Oôean lnstitute educates ovêr 115,000 students and we constêntly skive to provide authentic

current experiential leãrning opportunities to our community.

We know firsthand that one cannot protect what they don't know is there. Our volunteers and students alikerepeat lessons learned to those that are unaware, The awareness ¡s exponential.

Participât¡on in A New Method Íor community-Bosed Monitorinq of Urbon Beach Ecosystems provides new

opportunit¡es in ocean and environmental science education for Ocean lnstitute's interns, volunteers, and staff.

Therefore, the Ocean lnst¡tute w¡ll:

. Facilitate the recruitment of interns (high school and university level), volunteers, and staff ìn NewMethod for Community-Bosed Monitor¡ng of Urbdn Bedch Ecosystems Taintng,

. Drive the partic¡pation of trained ¡nterns, volunteers, and staff in monitoring local beaches;

Our involvement in these types of research wörk ón many levels to ¡nsp¡re young students to pursue careers ¡n

science, inform future c¡tizens of the importance of conservat¡on and preservat¡on of the sandy beach ecosystem,

Wè Iook foMard to this partnership w¡th Pepperdine University and UCSB.

Regards,

il^Ð2ffi//'J ulianne E steersD¡rector of Husbandry24200 Oarâ Point Harbor DriveDana Point, CA 92629949-456-2274 X333jsteers@ocean-institute.org

':li.i:;,,1, Fîüä.J&d$

June 24,2013

IJSC Sea Grant Ulban Oceans Plogram

Dear Sir or Madam:

As the Education Director for- Bilch Aquarium at Scripps Instìtution of Ooeanogr-aphy,Ianr writing to lend my suppoú for the Grunion Greetcls program entitled ,4 New Method

for Community-llased. Mottitoríng oJ Urban Be ach Ecosyslems.

Sandy beaches are iconic cultural assets of San Diego. Serving as impol tant naturalhabitat, vital to the survival of many animal aud plaut species, these resoulces need to be

preserved and protected for future genelations to enjoy and prosper fiotl. Establishing a

lioh rnonitoring prcgram, that involves the community ând plolnotes stewardship.

Iìircb Aquarium has been a long-standing Grunion Gleetel collaborative pal'tnel',

supporting the prograln with workshop space, volunteel recruitnent and communityoutleach, including website marketing fot over 10 years. Through our partnership wehave been able to engage oul community and visiting public, of which there arc 410000annually, with a regionally situated and highly valuable resealch ploject. As a scienceeducation institutìon, these types of proglams and pattnerships help us fulfill our outreachand educational goals.

We look forward to continuing our collâboratiolì with Dr. Kârin Martin by extending out'involvement into the proposed progfam, by supporting the La Jolla pilot site eff'orts,including hosting wolkshops, recluiting volunteers and sharing resoutces tlirough out'website. We believe that lhis vital project is inìportânt to the health of ouf beaches ancl

directly aligns with the mission of Bilch Aqualium at Sclipps.

Sincerely,¡

íl a

f¡' Irl.rè*-...,-€'

å-¿_.KristiD EvâDsBducation l)irector

¡-^/-/.x- \-ø?-/n-iANTABARBAPA:HANNELKËEPER"trolecflng ând Rcsforroge stnlø Batbøtø Chønnel

and lk Wafutsheds

goard ol D¡rectors

Ptesldenlsherry Madsen

Vlcê Ptcsldent'lim

Robin$on

TrcasurerJulie Ringler

Sccfcl¡ryKen Falslrom

Davìd Cowan

James l\¡unro

Jeff Phillips

Kalia Rork

DanielWaldman

Robert Wårner

DarrylYin

Advlsory Council

PresldentMichael S. Brc\4n

David Anderson

MichsefCrooke

Dân Emmell

Rae Emmell

Sleven Gaines

Susan Jordan

llolly Sherwin

Jack Stapelmann

Paul Junger Witt

June 2 I, 201 3

RE: Beach Ecosystem Community Based Monitoring Project

To the USC Sea Grant Urban Oceans Program:

Santa Barbara Channelkeeper works to protect and restore the Santa Barbara Channel and itswatersheds through science-based advocacy, education, field work and enforcement. On behalfof Santa Barbara Channelkeeper and our 700+ members. I am writ¡ng ¡n strong support of theBeach Ecology coalition's Community-Based Ecosystem Project for Sandy Beaches.

Channelkeeper has been a long supporter of citizen beach mon¡tor¡ng projects as demonstratedby our many years of partic¡pation and support of the Grunion Greeters Project.

Channelkeeper is committed to protecting our areas sandy beach habitats, and we env¡sion ourvolunteers' enthusiastic participation in a broader effort to mon¡tor and document beach

ecosystems. We hope to support the development and ¡mplementation ofthis project byproviding, as needed, volunteer outreach, training, and coordination services, and we lookforward to future pa rtne rships.

Sincerely,

Ben P¡tterleWatershed Programs DirectorSanta Barba ra Cha n nelkeeper

ïffi>æ,>

Tl4BondAvenue,SaÛlaBa¡bara,Câlifomia 93103 ú Tel (805)563.3377i, Fax (805)687.5635 $ www.sbck.org

Stäte of C¿l¡fornia . Nal.ural Resources Agency Edmund G. Brown Jr., covernot

DEPARÌIMENT OF PARKS AND RECREATION

Orange Coast Diskict 8471 N. Coâst HighwâyLeguna Beach CA 949.497.1421

Majot Gêneral (Rol.) Anthony L. Jackson, Directot

June 12,2413

Re: USC Sea Grant Research and Outreach, The Urban Ocean Program

Dear Sea Grant:

The Orange Coast D¡str¡ct of the Siate Deparlment of Parks and Recreation supportsthe efforls of the Beach Metric Project and their efforis to better assess beach ecologyand it's valuation of ecosystenl fr¡nctions. The Orange Coast District owns and operatessix park units over 17 miles of Orange and San Diego County coastline, and welcomesa diverse population of over 12 million visitors annually. Our goals are to offer highquality outdoor recreation while protecting, enhancing, and interpreting our resources.

We have been an active padicipant in the recent Southcoast MLPA process, theOrange County Marine Protectecj Area Council working on rocky shorel¡ne habitat, andnow with one of the more excíting efforts, that of the Beach Metrics Program, a spin offfrom other treach management efforts triggered by Dr. Martin's grunion focus.

State Parks has collaboraied on the formulation of a set of indices to sample sandbeach habitat. We've hosted meetings within our parks and offered beta testingsessions on our shores, We feel that baseline measures of our high-use beaches will beuseful over time, but especially when we assess impacts from repeated dredging effortsat four locations, after orl spìlls, dur¡ng sea level surges, and/or coastal proiectionefforts.

At Crystal Cove State Park (CCSP) we have begun a set of c¡tizen scíence stations atour new El Moro Campground and day use area, and have folded a Beach Metricresearcher's efforts ¡nto one of the sampling stations. Citizens will conduct counts ofamphipod burrows within a square area of the wrack line at Moro Beach, and enter theirdata.

ThÌs CCSP citizen science outreach follows exìsting efforts of annually interpreting toover 5000 students, and over 4000 live-feed, remote learning presentations by¡nterpreters. Tidepools have been the major focus within these prograrns, but our intentis to fold beach metric measures into existing curricula.

Thank you for th¡s opportunity to show support for the further investigation and outreachat this "forgotten" habitat type- our Southenr California beaches.

Senior Environmental Scient¡st

1

University of Southern California Sea Grant Proposal Submitted by Cal Poly State University, San Luis Obispo

1. PROJECT TITLE:

RECOVERY OF THE PISMO CLAM (TIVELA STULTORUM) IN CALIFORNIA: THE IMPORTANCE OF POLLUTION

2. PRINCIPAL INVESTIGATORS:

Dr. Benjamin Ruttenberg Assistant Professor, Biological Sciences Cal Poly State University, San Luis Obispo Dr. Lisa Needles Lecturer, Biological Sciences Cal Poly State University, San Luis Obispo

3. ASSOCIATE INVESTIGATORS:

Dr. Dean Wendt Dean of Research and Director, Center for Coastal Marine Sciences Cal Poly State University, San Luis Obispo

4. FUNDING REQUESTED:

2016-2017 $45,755 Request $30,999 Match 2017-2018 $19,245 Request $32,394 Match

5. STATEMENT OF THE PROBLEM: As in much of the world, California is increasingly urbanized, with 95% of the state’s population living in cities. These urban populations are also increasingly near the coast, with over 68% of Californians living in a coastal county (US Census Bureau 2010). These growing coastal and urban populations can impact coastal resources both directly (e.g. harvest) and indirectly (e.g. habitat loss, pollution). Understanding these impacts is critical to managing these coastal resources sustainably (e.g. Cooke and Cowx 2006). Many bivalves play essential roles in coastal ecosystems, and yet often live in nearshore environments in close proximity to human populations, subject to many of the threats of urbanization (e.g. Dame 2012). One species that exemplifies this issue is the Pismo clam (Tivela

2

stultorum). The Pismo clam, which ranges from Monterey Bay to southern Baja California, Mexico once supported a thriving commercial and recreational fishery in California. Commercial landings averaged nearly 100 metric tons per year between 1916 and 1947 and recreational clammers harvested ~2 million clams over a 2½ month period from the Pismo Beach-Oceano area alone in 1949 (Shaw and Hassler 1989, Pattison and Lampson 2008). Since that time, abundance of Pismo clams has declined precipitously; commercial harvest was prohibited in 1948 and recreational harvest is no longer viable in many locations (Shaw and Hassler 1989, Pattison and Lampson 2008). One factor that has likely affected the recovery of Pismo clams is the resurgence of the Southern sea otter (Enhydra lutris nereis) in locations from which it had previously been extirpated. In a survey of clam populations from Monterey to Newport Beach, Miller et al. (1975) found that catch per unit effort of clams dropped to near zero on beaches where sea otters had been foraging for at least a year. In Pismo Beach, the recreational catch declined from 343,000 clams in 1978 prior to otters to 0 in 1983 after otters moved into the area (Wendell et al. 1986). Abundance increased slightly during the early 1990s but these populations remain small today (Pattison and Lampson 2008), and transplant efforts to increase abundance have generally failed (Shaw and Hassler 1989). While otters may be impacting Pismo clam recovery north of Point Conception (the southern extent of the otters current range), our preliminary data show that abundance in Southern California is also low (Fig. 1). Therefore, it is clear that factors other than otters are limiting Pismo clam abundance in Southern California. One potential factor that may be affecting the recovery of Pismo clams in Southern California is pollution. Water pollution can have negative impacts on the survival and physiological processes of both adult and larval stages of many aquatic species (e.g. Dinnel et al. 1989, Key et al. 1998).

Figure 1. Density of Pismo clams in the intertidal of sandy beaches in California from Jan 2014-Mar 2015. Note that Rincon, the large red dot, had a density of more than 10 times any other site, and that Coal Oil Point is the closest site to Refugio State Beach where clams were found (yellow circle west of Rincon). Both Coal Oil Point and Rincon were surveyed in June 2015, after the Refugio Oil Spill; densities at both of these locations had declined by around six-fold but we cannot conclusively state that the spill caused these declines.

3

In addition, early life stages of many marine invertebrates are particularly sensitive to pollutants and water quality (e.g. Beiras and His 1994, Key et al. 1998). Anthropogenic pollutants may limit recruitment of many species in Southern California, where human population densities, urbanization, and pollution is much higher (e.g. Fowler 1990, Nelson et al. 2008). To better understand the current status of Pismo clams and the factors limiting their recovery, we must address a number of questions. First, we need information on the abundance and distribution of Pismo clams to understand the local and regional factors that may correlate with high and low abundance. The California Department of Fish and Wildlife (CDFW) has collected some data on Pismo clam populations over the last few decades, but with few resources available for this project, CDFW data are scattered spatially and temporally, reducing their utility for management. Starting in early 2014, our research team built on the CDFW surveys to generate preliminary data on the size structure and distribution of Pismo clams across their range in California (see Fig. 1) and we are initiating a citizen-science program to further increase spatial and temporal resolution of these data. Second, we need a better understanding of the potential factors limiting Pismo clam populations. Population limitation could occur in the adult, larval, or juvenile/recruit life stages and may be driven by a number of factors such as predation (e.g. sea otters and other predators) and pollution. In addition, limiting factors may be different in different locations. For example, sea otters are thought to be important predators of adult Pismo clams along the central coast (e.g. Miller et al. 1975), but they are not found south of Point Conception/Gaviota. Conversely, human population densities, urbanization and pollution are much higher in Southern California. Understanding both the distribution and abundance of Pismo clams as well as the factors that limit their populations will help us develop appropriate management strategies and guide restoration of this iconic but depleted species. 6. INVESTIGATORY QUESTION:

Our primary objectives are to evaluate the levels of toxins present in Pismo clam adults and recruits to determine the impacts of environmentally relevant levels of these toxins on survivorship of Pismo clam larvae, with an emphasis on urbanized areas in Southern California. These objectives will help us understand the impact of pollution as a limiting factor on Pismo clam populations, and they also generate a series of testable hypotheses: Hypothesis 1: clams collected from Southern California will have higher levels of toxins than those from Central California, and sites close to large urban centers (e.g. Los Angeles, San Diego) will have the highest levels of toxins. To test this hypothesis, we will make collections of adults and recruits from several beaches in Central and Southern California. We will collect clams from sites where our preliminary abundance surveys suggest adults and/or recruits are likely to be present, and where anthropogenic pollutants are likely to vary (i.e. Central vs Southern California and more urbanized vs less urbanized locations). We will conduct standard toxicological assays on clam tissues for a variety of toxins including pesticides and herbicides, endocrine disrupters, and hydrocarbons.

4

Hypothesis 2: toxin concentrations at the upper bounds of levels found during the evaluation of hypothesis 1 will result in increased developmental times, increased developmental abnormalities, and increased mortality in Pismo clam larvae compared to lower concentrations. To evaluate this hypothesis, we will conduct a series of experiments on larvae reared in water with high and low levels of toxins that were identified in hypothesis 1. We will set upper and lower concentrations of these toxins based on values from hypothesis 1 as well as data from the literature and input from water quality professionals, and evaluate larval development and survivorship. 7. MOTIVATION:

Pismo clams once supported thriving commercial and recreational fisheries in California, but populations of clams have declined dramatically in recent decades (Pattison and Lampson 2008). For example, the City of Pismo Beach has a Pismo clam festival every year, despite the fact that no legal-sized clams (>115 mm) have been found in the area since the mid-1990s. Our interest in this topic was sparked by conversations with City officials, who sought information about why Pismo clams have all but disappeared from the region, and what, if anything, might be done to bring them back (see letters of support). Furthermore, population declines are not limited to the central coast; Pismo clams were once abundant in Southern California, but have declined there as well (Fitch 1950, Miller et al. 1975; Fig. 1). Therefore, our long-term research objectives are to understand the causes of the decline of Pismo clams across their range in California and to identify the factors that are inhibiting population recovery. Ultimately, we hope to use this information to develop and evaluate restoration actions. In recognition that these objectives will require many years of research both locally and across the state, we have initiated a multi-pronged research program. The first step is to document the status of populations statewide. Our initial surveys included over 23 sites in Central and Southern California. These data show that abundances are generally low statewide, even in places that have been reported to have high abundances in the past, such as south San Diego County and Orange County (Fig. 1). The one outlier in our data is Rincon Point on the Santa Barbara-Ventura County line, with densities more than 10 times greater than those of any other site. Interestingly, our preliminary statewide data do not reveal any clear spatial pattern in the abundance of Pismo clams. Furthermore, they are not correlated with any of the proposed drivers of Pismo clam abundance, such as the presence/absence of sea otters as predators, strong thermal gradients between Central and Southern California, variability in human populations, human harvest pressure, or other stressors that may vary with urbanization (e.g. habitat modification, pollution). To increase our temporal and spatial coverage, we are expanding our survey program to include a citizen science component to this project; we have developed smartphone apps to facilitate data collection in collaboration with Cal Poly computer engineering students, and we plan to begin field testing these apps in the fall. This survey component of our research program will help provide the first comprehensive statewide assessment of the status of Pismo clams populations in many decades.

5

In addition, our size structure data reveal differences in size frequencies in different regions (Fig. 2). Central California populations are clumped around moderate sizes with few larger and few smaller individuals, and no legal-sized individuals. Southern California populations are more evenly distributed amongst size classes, but legal-sized individuals are still very rare. At the same time, the fact that there is a at least one location with extremely high densities of Pismo clams—Rincon—suggests that the right conditions still exist to support large populations. Furthermore, the size structure at Rincon is truncated at the legal size limit, and we have observed many recreational clammers at this site each time we have surveyed it, suggesting that this large population persists in spite of heavy human harvest pressure. Combined, these preliminary data suggest that recovery of Pismo clam populations may be limited by different factors in different parts of the state. Previous work has suggested that sea otters and human harvest have reduced Pismo clam populations in Central California. However, human harvest is likely lower in Southern California than at the peak in Pismo Beach, and sea otters are not present in Southern California. Pollution, on the other hand, is one factor for which we have no historical nor current data for Pismo clams. In Southern California, an extensive suite of anthropogenic pollutants have been detected in the ocean, marine sediment, and bivalve tissue, including pesticides, herbicides, endocrine disrupters, and hydrocarbons (Lauenstein and Daskalakis 1998, Nelson et al. 2008, Alvarez et al. 2014). A large body of research suggests that these contaminants can have both lethal and sublethal effects on marine organisms (e.g. Dinnel et al. 1989, Key et al. 1998), and that these impacts may be particularly detrimental to filter-feeding, sessile invertebrates found in nearshore habitats (Doddler et al. 2014). Studies have shown that many of these nonlethal effects may reduce reproductive output (e.g. Dinnel 1989, Depledge and Billinghurst 1999, Rodriguez et al. 2007) and lethal effects of toxins can be especially acute on larvae (Key et al. 1998). Together, these

Figure 2. Size structure of Pismo clams. Dark gray bars above 114.3mm are legal sized clams (note: legal size is 127mm from Monterey County northwards, but no clams were found in that region). Clams found at Rincon are only included in that plot (e.g. they are excluded from the plot of South of Pt Conception). Note the small number of legal sized clams found in the study.

6

impacts of pollutants may cause synergistic reductions in recruitment of affected species, with ultimate reductions in adult population sizes. As a species that lives in the low intertidal on beaches, Pismo clams may be particularly vulnerable to the impacts of anthropogenic pollutants. The recent oil spill at Refugio State Beach near Santa Barbara highlights the potential negative effects of hydrocarbon toxins. Following the spill, there was widespread mortality on a range of marine organisms, including nearshore marine invertebrates (Refugio Response Joint Information Center and CDFW, unpublished data). We had pre-spill survey data from Coal Oil Point and Rincon Point (roughly 20 and 55 km east of the spill site, respectively). Even though these sites were far from the location where oil entered the ocean, there were reports of oil washing up on these beaches. Cal Poly researchers resurveyed these two locations approximately two weeks after the spill and found that abundance at both locations was much lower after the spill. Densities declined from 60 clams to 9 clams per transect at Rincon, and 2 clams to 0.3 clams per transect at Coal Oil Point. Bivalves will incorporate compounds released from anthropogenic oil spills into their tissues (e.g. Carls et al. 2001). While there is a paucity of before oil spill abundance data for many species, and Pismo clams in particular, the few studies examining mortality or changes in abundance have shown declines of 10 – 20% in transplanted bivalve abundance after oiling (e.g. Dow 1975, Fukuyama et al. 2000) While our data are currently insufficient to conclude that the spill caused the declines in abundance at these two sites, they are consistent with known lethal and nonlethal impacts of oil pollution on bivalves. Our data, evaluating the levels of toxins in Pismo clams and the impacts of these toxins on the development and survivorship of larvae, will provide guidance on the relative importance of pollutants to the decline of Pismo clam populations, particularly in urban Southern California. Ultimately, we will combine this information with related data on the abundance of adult and recruit clams throughout California to guide actionable restoration activities designed to return Pismo clams to previous levels of abundance. We will provide our results to all interested state and federal resource management agencies; we have excellent working relationships with staff at CDFW, NOAA’s National Marine Sanctuaries, the National Park Service, the Central Coast Regional Water Quality Control Board, and a number of local municipalities (see letters of support). 8. GOALS AND OBJECTIVES:

A. Overall Goals

We have several short-term and long-term goals and objectives for this research program. Over the long term, we seek to document the current status of Pismo clam populations throughout California and understand the causes of their decline, including the impacts of predation, pollution, habitat modification, and recreational harvest. We will provide all of our data and results to the relevant state and federal management agencies—many of whom have written letters of support—and we will use our findings to make concrete suggestions to guide restoration activities of Pismo clams throughout the state.

B. 2016-2018 Objectives

7

Over the next two years, we seek to understand the relative importance of pollution on adult and recruit Pismo clams and on how pollution may impede recovery of Pismo clam populations. Specifically, we have two primary objectives:

1. We will evaluate the levels of anthropogenic toxins in the tissues of adults and recruits of Pismo clams throughout California, emphasizing both urbanized areas with significant anthropogenic impacts and more remote areas with less human influence. These data will provide information on potential levels of toxins on individual clams and how toxins are distributed in space and across life stages. These data will also help us set levels for manipulative experiments using larval clams in part 2.

2. We will quantify the effects of environmentally relevant levels of toxins on Pismo clam larval development and survivorship. Much of the previous work on Pismo clams suggests that recruitment processes and recruitment failure may be key factors in limiting adult populations (Miller et al. 1975), but few of these previous studies have examined recruitment at all (but see Stephenson 1974) and none have correlated high or low recruitment events with any potential driver. These data will be the first to experimentally evaluate one of the hypothesized mechanisms (larval development and survivorship) to explain low recruitment in Pismo clams.

9. METHODS: Population surveys and toxicological assays The first step in this project will be to evaluate levels of toxins in the tissues of Pismo clam adults and recruits at sites throughout the state. Urban areas are likely sources of many environmental pollutants through sewage outfalls, storm and surface runoff, harbors, and river mouths. These sources can include a variety of toxins such as pesticides/herbicides, endocrine disrupters, hydrocarbons, and other industrial waste products. Therefore, we will sample locations close to and further from urban centers (high and low anthropogenic impact), since urban areas will have many of these potential sources of toxins. While our sampling will emphasize Southern California with its large urban areas, we will include high and low anthropogenic impact sites in Central and Southern California. High impact sites in Southern California may include Imperial Beach near the mouth of the Tijuana River; Coronado near San Diego Bay; Santa Monica, Manhattan Beach/Redondo Beach, and Long Beach/Huntington Beach near Los Angeles. Low impact sites in Southern California may include Camp Pendleton/San Onofre; Malibu/Point Mugu; Carpinteria State Beach; Hollister Ranch; and potentially the Northern Channel Islands. We will also include Rincon Point, since it has the highest densities of clams we recorded, and Coal Oil Point in Santa Barbara, since it is the closest site we have surveyed to the Refugio Oil Spill, a known source of significant hydrocarbon pollution. Since human populations are much lower in Central California, sites in central California will serve as a comparison to the urban oceans of Southern California. We will make collections near the highest population centers in Pismo Beach and Morro Bay and in more remote areas, such as Point Sal, Purisima Point, Jalama State Beach, and the Big Sur Coast. Monterey Bay is also

8

populated but our preliminary survey data and anecdotal evidence suggests that densities of Pismo clams are extremely low in this region. We will conduct surveys for adult Pismo clams using the standard methodologies we have been employing (e.g. Pattison and Lampson 2008); briefly, beaches will be surveyed on low tides of at least -0.5 ft; the survey team will lay out a transect perpendicular to the shoreline around 50 cm higher in elevation from the low water mark and will dig a transect towards the waterline the width of a standard flat shovel (around 25 cm wide), recording GPS coordinates at the start and end of each transect. The length of the transect will vary depending on the slope of the beach; transects will end just past the waterline when digging becomes difficult. To survey recruits, we will shovel excavated sand into a large bin with a ~1cm mesh size screen. The bin will be shaken to remove the sand and only larger objects such as rocks, shells, and smaller Pismo clams remain (Stephenson 1974). All clams found will be counted and measured. A subset of adult and recruit clams from each site will be collected for further analyses and experiments. We will collect ~5 adult and recruit clams for toxicological assays; these samples will be immediately placed on ice, and the soft tissue will be homogenized (Kimbrough et al. 2006). The homogenized tissue will be stored on dry ice and later transferred to a -80°C freezer at Cal Poly for storage until samples are prepared and sent for analysis. Samples will be sent to the Analytical Lab in the Institute for Integrated Research in Materials, Environments and Society at California State University Long Beach. Toxicology data will be analyzed using nested linear mixed effects models, including region (Southern vs Central) and human impact (more vs less urbanized) as fixed factors, site as a random factor, and clam size as a covariate. We will also collect 5-10 adult clams from the higher density sites for spawning experiments, including high and low human impact sites in both Central and Southern California. These clams will be etched to permanently identify them and placed in aerated seawater for transport to the flow through seawater lab at the Cal Poly pier. We have developed a tank system that mimics wave action at this facility, and we have ~40 clams at the moment that we are using for preliminary experiments. All collections have been and will be made in non-MPA areas under our permit no. 6681, issued by the CDFW. We will also archive a small amount of tissue in an -80°C freezer at Cal Poly a from a subset of clams for potential future proteomic analyses; these analyses provide detailed information about specific protein expression, and are therefore extremely useful in understanding physiological responses to environmental toxins. Cal Poly has an Environmental Proteomics Laboratory, but these analyses are extremely expensive and beyond the scope of this proposal. However, we will archive tissue in the event that funding for this work becomes available in the future. Impacts of toxins on Pismo clam larval development and survivorship Our second objective is to evaluate the impacts of toxins on larval development and survivorship. We will conduct experiments on Pismo clam larvae reared in water with high and low levels of key toxins; we will select toxins based on preliminary results from hypothesis 1 and as well as input from water board staff and publically available water quality monitoring data. Because maternal effects (e.g. temperature regime, adult exposure to toxins) may impact larval development and survivorship, we will include information on spawner source location as

9

additional factors (i.e. Central or Southern California and high or low human impact). We will set upper and lower concentrations of these toxins based on information from the literature and water quality monitoring reports, and evaluate larval development and survivorship using standard developmental assays. We will also include controls in seawater. After collection, clams will be maintained in a holding tank with unfiltered flow through seawater at the Cal Poly pier at 15±1°C. Individuals will be allowed to acclimate for at least two weeks before spawning experiments, but since spawning generally occurs in late summer to fall (Coe 1947, Alvarado-Alvarez et al. 1996), some may be acclimated for many months. We will induce spawning by exposing clams to macerated gonads (Strathman 1987) and/or following the methods of Alvarado-Alvarez et al. (1996) using serotonin to induce spawning. These two methods have shown the fastest response of spawning (Singh and Azam 2013). Experimental clams will be transported to the larval rearing lab on Cal Poly’s main campus and placed in individual containers of 1.5 L of clean, filtered seawater for 1 h. To induce spawning, we will inject a solution of 0.4 ml of 5 mM serotonin in seawater buffered with 5 mM Tris-HCl (pH 8) directly into the gonad and/or we will add 10 ml of a slurry of macerated gonad to the containers with individual clams. Impacts of toxins on Pismo clam fertilization success and early development Treatments and fertilization: After spawning (generally ~30 min following injection/exposure to macerated gonad), gametes from each clam will be collected with a glass pipette and transferred to sterile beakers. We will observe eggs and sperm under a compound microscope to determine normal appearance (eggs) or motility (sperm), and we will discard abnormal gametes. Eggs from all clams spawned from a given source location will be washed in 0.2 µm filtered seawater using a 20 μm mesh screen and combined into a single beaker for fertilization. Sperm will be combined in a similar manner as eggs. To insure that our gamete concentrations are not limiting fertilization, we will conduct a series of preliminary fertilization experiments using serial dilution of sperm, with a target concentration that yields a 50% fertilization success rate. We will add 100-200 eggs in 1 ml of filtered seawater to each of 5 tubes with with 8 ml of filtered seawater. We will add 1 ml of a sperm solution to each egg tube, beginning with 106 sperm per ml and diluting each subsequent tube of sperm 10 fold by adding 1 ml of the previous concentration to a clean tube with 9 ml of filtered seawater (Babcock and Keesing 1999, Baker and Tyler 2001). After 4 h, eggs will be fixed in formalin and examined under a dissecting microscope to estimate fertilization success rate. After mixing, eggs will be divided into 1 L beakers with a solution of each toxin/concentration treatment in 0.2 μm filtered sea water or a control with filtered seawater only. Sperm will be added at the appropriate concentration as determined by the preliminary fertilization experiment. Larval rearing: Fertilized eggs will be allowed to develop in larval rearing tanks incubated at 15±1°C. Larval rearing tanks will have an inner container suspended above the bottom of the larval rearing tank to allow influx of seawater from the larval rearing tank through the bottom of the container, but isolated with a 20µm bottom mesh to keep eggs inside each inner container. This allows for frequent water changes. A 50% water change will occur daily throughout the duration of the experiment. Larvae will be kept at a density of no more than 10 larvae/ml. Larvae will be fed Isochrysis galbana weekly.

10

Effect of toxins on different stages of development: Approximately 100 larvae from each treatment will be removed at various stages throughout development and placed in 25ml falcon tubes with 100 μL of buffered formalin to stop development and preserve larvae. We will assess arrested development at the following stages (times are approximate and based on the tropical congener Tivela mactroides [Reverol et al. 2004] so Pismo clam developmental times in colder waters are likely longer): 1. fertilization membrane (5 minutes) 2. first cleavage stage (1 hour) 3. blastula stage (3 hours) 4. gastrula stage (5 hours) 5. trocophore stage (10.5 hours) 6. straight-hinged veliger (14.5 hours) 7. umbo (veliger) (7.5 days) 8. pediveliger (22 days) Percent of fertilized embryos and normally developing larvae will be determined by randomly observing 100 individuals from each tube (toxin/concentration treatment) under a Leica EZ4D dissecting microscope. Fertilization success, percent of malformed embryos and percent of abnormal larvae will be calculated for each treatment. Larval condition and survivorship data will be analyzed using generalized linear mixed effects models, including region (Southern vs Central) and human impact (more vs less urbanized) as fixed factors and site as a random factor. 10. RELATED RESEARCH: Pismo clams are an iconic fishery species in California, and have a long history of exploitation and study. Some fishery data are available for most of the first half of the 20th century (Weymouth 1923, Fitch 1950, Wendell et al. 1986, Pattison and Lampson 2008), and researchers recognized that stocks were overexploited nearly 100 years ago (e.g. Weymouth 1923, Herrington 1929). The commercial fishery was closed in 1945 to protect the species (Pattison and Lampson 2008), but populations remain low in most of the state despite greatly reduced fishing pressure (Fig. 1, Pattison and Lampson 2008). However, despite the long history of exploitation and the iconic status of the species, there have been few studies on Pismo clam biology and ecology over the last several decades. Miller et al. (1975) conducted surveys of Pismo clam diggers from Monterey to Newport Beach, and found high densities of clams outside of the sea otter foraging zone, and Stephenson (1974) investigated adult ecology, reproduction and recruitment in Monterey Bay. To our knowledge, there have been few statewide surveys of abundance and no follow up studies on recruitment in the field in any location since then. Other more recent work has spawned Pismo clams in the lab (Alvarado-Alvarez et al. 1996), but the emphasis of this work was on propagation through aquaculture. Until we began our statewide assessment study, there were only data on Pismo clam densities from a few locations and a few time periods.

11

There is also a rich literature on the levels of toxins in the tissues of bivalves as sentinel species (e.g. Fowler 1990, Lauenstein et al. 1998, Kimbrough et al. 2008, Dodder et al. 2014), and some work has examined these patterns in the genus Tivela (Jaffe et al. 1995), but fewer studies that have investigated the impacts of toxins on the development or survivorship of larvae (Beiras and His 1994, Alzieu 2000). No published work has sought to understand the impacts of toxins on the development or survivorship of Pismo clams. Furthermore, there are no studies attempting to understand the factors that have led to the decline of Pismo clams or the factors that have impeded their recovery (e.g. fishing, predation and pollution), nor how any of these factors vary regionally. 11. BUDGET RELATED INFORMATION:

A. Budget Justification

Personnel The salary rates are based on the California State University and Cal Poly Corporation established salary rate paid during the 2014-2015 Academic year (July 1 – June 30). The salary and wage rates for all employees include a projected 4.5% salary increase per year. The rates shown are for budgetary purposes; the actual rates in effect at the time the work is performed will be charged to the project. A Research Associate, Grant Waltz, will contribute 5% effort, or 104 hours per year, to this project per year. Mr. Waltz will help coordinate and participate in some field collection activities. This proposal requests that one undergraduate student assistant be supported for each year of this grant. For this student, this will include 100 hours to be worked during the academic year and summer, which will be paid at a rate of 12.00 per hour. This student will be responsible for maintaining spawning adults and larval cultures of Pismo clams at the CCMS Pier and on Cal Poly’s main campus. Fringe Benefits & Employer Payroll Taxes Fringe benefits for Corporation staff are calculated at 56.8%, and include Workers Compensation, FICA, State Unemployment Insurance (SUI), and Medicare. Student benefits are estimated at 4.9% and include FICA (when applicable) as well as SUI and Workers Compensation, which is determined by the work the students are doing and the environment in which they do that work and their enrollment status. Rates in effect at the time the work is performed will be billed to the project. Domestic Travel A total of $2,000 is requested in year one to support the costs of the proposed field survey. These will enable the PIs, Research Associate and students, to travel to field sites in Central and Southern California for 20 days. This funding will support all costs associated with vehicles, lodging, and meals and incidentals.

12

A total of $1,650 is requested in year two to support conference travel costs. The PIs and graduate student will attend a regional marine ecology/conservation conference, location and timing TBD. This funding will support all costs associated with transportation, lodging, and meals and incidentals. Supplies & Materials A total of $18,952 has been requested in year 1 for project related supplies and materials. These supplies and materials will include culturing supplies ($7,500), holding tanks ($2,000), analysis of toxins ($7,500) and miscellaneous consumable field supplies ($1,952). Other Direct Costs A total of $20,000 ($10k per year) will pay for in-state tuition for a graduate student for two years. The student will have several responsibilities on this project, including co-leading and participating in all field activities, co-supervising undergraduates and being ultimately responsible for maintaining larval culturing experiments, executing lab studies on larvae, as well as assisting the PIs with data analysis and report/publication preparation. Indirect Costs Cal Poly State University’s Federal negotiated indirect rate is 38.5% of modified total direct costs, effective July 1, 2015. Modified total direct costs exclude equipment, capital expenditures, participant support, charges for patient care, tuition remission, rental costs of off-site facilities, scholarships, and fellowships as well as that portion of each subgrant and subcontract in excess of $25,000.

B. Matching Funds

The Sponsor requires a minimum of 50% match on all requested funds. The matched funding for this proposal will be contributed as follows: In-Kind PI Benjamin Ruttenberg will contribute 13.34% assigned time to the project, which is equivalent to 1.2 academic year months. Costs for his time are calculated at his normal academic salary rate. Fringe benefits associated with assigned time are calculated at 48.03%, and can include the following: FICA, State Unemployment Insurance, Worker’s Compensation, non-industrial leave, health and life insurance benefits, and retirement benefits (PERS). Cash Match The City of Pismo Beach has provided $15,000 cash match to cover salary support for PI, Lisa Needles. This funding will cover the costs of approximately 86 hours per year, and associated fringe benefits. Fringe benefits for Corporation staff are calculated at 56.8%, and include Workers Compensation, FICA, State Unemployment Insurance (SUI), and Medicare.

13

12. ANTICIPATED BENEFITS: This study will provide the first data on the distribution of toxins in Pismo clams and the impact of these toxins on larval development and survivorship. The primary users of our results will be the CDFW and other state agencies (e.g. State Parks) charged with managing Pismo clam populations. While CDFW’s Marine Region has adopted a policy to not write letters of support for any proposal, staff have indicated that they would like to be involved in this project, particularly as these data may inform stock assessments (P. Kalvass, pers. comm.). In addition, we anticipate that a variety of municipalities, particularly the Cities of Pismo Beach and Morro Bay, as well as other state, regional, and local water boards will use our results in policymaking (see letters of support). We also expect federal agencies, such as NOAA’s National Marine Sanctuaries, the National Park Service and the Bureau of Ocean Energy Management, to use the this information in their management decisions as well as for outreach (see letters of support). This information will allow us to evaluate the relative importance of toxins on the replenishment of populations, and will shed new light on one of the factors that may be impeding Pismo clam recovery throughout the state. When combined with data from our ongoing assessment program, our information will help guide regional and site specific management strategies and restoration by helping identify locations and activities were restoration will be more likely—and less likely—to succeed. 13. COMMUNICATION OF RESULTS: We will provide copies of all of our peer-reviewed and other publications and all data to all relevant agencies, organizations, and non-profits via our growing list of contacts for this project, many of whom have written letters of support for this project. These include CDFW, California State Parks, Central Coast Regional Water Quality Control Board, the Cities of Pismo Beach and Morro Bay, U.S. National Park Service, NOAA’s National Marine Sanctuaries, BOEM, Central Coast Salmon Enhancement, and others. Furthermore, we will host workshops and meetings through the San Luis Obispo Science and Ecosystem Alliance, an integrated group of scientists, resource managers and stakeholders studying, supporting, and managing marine resources on the California Central Coast. This group is a particularly effective venue for sharing information because of the wide range of participating organizations, including many of the partner organizations listed above as well as other non-profits and commercial fishing and aquaculture organizations. We will also give presentations and briefings at local municipal management meetings (e.g. Pismo Beach city council meetings) as well as outreach presentations to the public (e.g. Santa Barbara Sea Center, San Simeon Coastal Discovery Center, San Luis Obispo “Science After Dark” public seminar series, presentations on local radio shows). We will also coordinate with Dr. Jennifer O’Leary, the Sea Grant Extension Specialist based at Cal Poly and Cal Poly’s Office of Public Affairs on these and other media and social media outreach activities. Finally, undergraduate and Graduate students involved in this research will give talks at local and regional scientific conferences (e.g. Cal Poly Undergraduate Research Conference, Western Society of Naturalists) to advance their professional training and preparation.

14

14. REFERENCES: Alvarado-Alvarez, R., M. C. Gould, and J. L. Stephano. 1996. Spawning, in vitro maturation,

and changes in oocyte electrophysiology induced by serotonin in Tivela stultorum. Biological Bulletin 190: 322-328.

Alvarez, D. A., K. A. Maruya, N. G. Dodder, W. Lao, E. T. Furlong, and K. L. Smalling. 2014.

Occurrence of contaminants of emerging concern along the California coast (2009–10) using passive sampling devices. Marine Pollution Bulletin 81: 347-354.

Alzieu, C. 2000. Impact of tributyltin on marine invertebrates. Ecotoxicology 9: 71-76. Babcock, R. and J. Keesing. 1999. Fertilization biology of the abalone Haliotis laevigata:

laboratory and field studies. Canadian Journal of Fisheries and Aquatic Sciences 56: 1668-1678.

Baker, M. C. and P. A. Tyler. 2001. Fertilization success in the commercial gastropod Haliotis

tuberculata. Marine Ecology Progress Series 211: 205-213. Beiras, R., and E. His. 1994. Effects of dissolved mercury on embryogenesis, survival, growth

and metamorphosis of Crassostrea gigas oyster larvae. Marine Ecology Progress Series 113: 95-103.

Carls, M. G., M. M. Babcock, P. M. Harris, G. V. Irvine, J. A. Cusick, and S. D. Rice. 2001.

Persistence of oiling in mussel beds after the Exxon Valdez oil spill. Marine Environmental Research 51: 167-190.

Coe, W. R. 1947. Nutrition, growth and sexuality of the Pismo clam (Tivela stultorum). Journal

of Experimental Zoology 104:1-24. Cooke, S. J. and I. G. Cowx. 2006. Contrasting recreational and commercial fishing: Searching

for common issues to promote unified conservation of fisheries resources and aquatic environments. Biological Conservation 128: 93-108.

Dame, R. F. 2012. Ecology of marine bivalves: an ecosystem approach, 2nd Ed. CRC Press. Dinnel, P. A., J. M. Link, Q. J. Stober, M. W. Letourneau, and W. E. Roberts. 1989.

Comparative sensitivity of sea urchin sperm bioassays to metals and pesticides. Archives of Environmental Contamination and Toxicology 18: 748-755.

Depledge, M. H., and Z. Billinghurst. 1999. Ecological significance of endocrine disruption in

marine invertebrates. Marine Pollution Bulletin 39: 32-38. Dodder, N. G., K. A. Maruya, P. L. Ferguson, R. Grace, S. Klosterhaus, M. J. La Guardia, and J.

Ramirez. 2014. Occurrence of contaminants of emerging concern in mussels (Mytilus spp.)

15

along the California coast and the influence of land use, storm water discharge, and treated wastewater effluent. Marine Pollution Bulletin 81: 340-346.

Dow, R. L. 1975. Reduced growth and survival of clams transplanted to an oil spill site. Marine

Pollution Bulletin 6: 124-125. Fitch, J. 1950. The Pismo clam. California Department of Fish and Game 36:285-312. Fowler, S. W. 1990. Critical review of selected heavy metal and chlorinated hydrocarbon

concentrations in the marine environment. Marine Environmental Research 29: 1-64. Fukuyama, A. K., G. Shigenaka and R. Z. Hoff. 2000. Effects of residual Exxon Valdez oil on

intertidal Protothaca staminea: mortality, growth, and bioaccumulation of hydrocarbons in transplanted clams. Marine Pollution Bulletin 40: 1042-1050.

Herrington, W. C. 1929. The Pismo clam: Further studies of its life history and depletion.

Division of Fish and Game of California. Fish Bulletin No. 18. Jaffe, R., I. Leal, J. Alvarado, P. Gardinali, and J. Sericano. 1995. Pollution effects of the Tuy

River on the Central Venezuelan coast: anthropogenic organic compounds and heavy metals in Tivela mactroidea. Marine Pollution Bulletin 30: 820-825.

Key, P. B., M. H. Fulton, G. I. Scott, S. L. Layman and E. F. Wirth. 1998. Lethal and sublethal

effects of malathion on three life stages of the grass shrimp, Palaemonetes pugio. Aquatic Toxicology 40: 311-322.

Kimbrough, K. L., G. G. Lauenstein and W. E. Johnson (Editors). 2006. Organic Contaminant

Analytical Methods of the National Status and Trends Program: Update 2000-2006. NOAA Technical Memorandum NOS NCCOS 30.

Kimbrough, K. L., W. E. Johnson, G. G. Lauenstein, J. D. Christensen and D. A. Apeti. 2008.

An Assessment of Two Decades of Contaminant Monitoring in the Nation’s Coastal Zone. Silver Spring, MD. NOAA Technical Memorandum NOS NCCOS 74.

Lauenstein, G. G., K. D. Daskalakis. 1998. US long-term coastal contaminant temporal trends

determined from mollusk monitoring programs, 1965–1993. Marine Pollution Bulletin 37: 6-13.

Miller, D. J., J. E. Hardwick and W. A. Dahlstrom. 1975. Pismo clams and sea otters. California

Department of Fish and Game. Marine Resources Technical Report No. 31. Nelson, W. G., J. L. Hyland, I. I. Lee, C. Cooksey, J. O. Lamberson, F. A. Cole and P. J.

Clinton. 2008. Ecological condition of coastal ocean waters along the US Western Continental Shelf: 2003. NOAA/National Ocean Service, NOAA Technical Memorandum NOS NCCOS, 79.

16

Pattison, C. and K. Lampson 2008. “Pismo Clam.” In, Status of the Fisheries Report: An update through 2006, K. Barsky, ed. California Department of Fish and Game.

Reverol, Y. M., J. G. Delgado, Y. G. de Severeyn, and H. J. Severeyn. 2004. Embrionary and

larval development of the marine clam Tivela mactroides (Bivalvia: Veneridae) in Zulia State, Venezuela. Revista de Biologia Tropical. 52: 903-909.

Rodriguez, E. M., D. A. Medesani, and M. Fingerman. 2007. Endocrine disruption in crustaceans

due to pollutants: a review. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 146: 661-671.

Shaw, W.N., and T.J. Hassler. 1989. Species profiles: life histories and environmental

requirements of coastal fishes and invertebrates (Pacific Southwest)-Pismo clam. U.S. Fish and Wildlife Service Biological Report 82 (11.95). U.S. Army Corps of Engineers, TR EL-82-4.

Singh, N. K., and K. Azam. 2013. Comparative study of available spawning methods of the giant

clam Tridacna squamosa (Bivalvia: Tridacnidae) in Makogai, Fiji. World Journal of Fish and Marine Sciences 5: 353-357.

Stevenson, M. D. 1974. The distribution and reproduction of the Pismo clam, Tivela stultorum,

in Monterey Bay. M.S. Thesis, California State University Hayward. Strathmann, M. F. 1987. Reproduction and development of marine invertebrates of the northern

Pacific coast: data and methods for the study of eggs, embryos, and larvae. University of Washington Press.

US Census Bureau. 2010. Coastline Population Trends in the United States: 1960 to 2008. http://www.census.gov/prod/2010pubs/p25-1139.pdf

Wendell, F., R. Hardy, J. Ames, and R. Burge. 1986. Temporal and spatial patterns in sea otter

(Enhydra lutris) range expansion and in the loss of Pismo clam fisheries. Calif. Fish Game 72: 197-212.

Weymouth, F. W. 1923. The life-history and growth of the Pismo clam (Tivela stultorum). State

of California Fish and Game Commission. Fish Bulletin No. 7.

PROJECTED WORK SCHEDULE

Recovery of the Pismo clam (Tivela stultorum) in California: the importance of pollution

Activities 2016-2017 F M A M J J A S O N D J

Initial field collection of Pismo clam adults and recruits for toxin analysis

Sample preparation and toxin analyses

Data analyses for field toxin data and prep for year 1 larval rearing experiments

Field collections of Pismo clam adults for year 1 larval rearing experiments

Year 1 larval rearing experiments

Data analyses for year 1 larval rearing experiments

Activities 2017-2018 F M A M J J A S O N D J

Data analyses for year 1 larval rearing experiments

Field collections of Pismo clam adults for year 2 larval rearing experiments

Prep for year 2 larval rearing experiments

Year 2 larval rearing experiments

Data analyses for year 2 larval rearing experiments

Report preparation/ writing and ongoing scientific and outreach presentations

Year 1: 2/1/2016 - 1/31/2017 OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: GRANT/PROJECT NO.:

DURATION (months):

2/1/16 - 1/31/18 (24 months)

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator:Benjamin Ruttenberg 1 1.2 $0 $10,165Lisa Needles 1 0.5 $0 $4,678

b. Associates (Faculty or Staff): 0 - $0 $0 Sub Total: 2 1.7 $0 $14,843

2. Other Personnela. Professionals: 0 - $0 $0b. Research Associates: 1 0.6 $2,299 $0c. Res. Asst./Grad Students: 0 - $0 $0d. Prof. School Students: 0 - $0 $0e. Pre-Bachelor Student(s): 1 0.9 $1,200 $0f. Secretarial-Clerical: 0 - $0 $0g. Technicians: 0 - $0 $0h. Other: GRADUATE TRAINEE 1 4.5 $0 $0

Total Salaries and Wages: 5 7.7 $3,499 $14,843

B. FRINGE BENEFITS: varied $1,365 $7,539Total Personnel (A and B): $4,864 $22,382

C. PERMANENT EQUIPMENT: $0 $0

D. EXPENDABLE SUPPLIES AND EQUIPMENT: $18,952 $0

E. TRAVEL:1. Domestic $2,000 $02. International $0 $0

Total Travel: $2,000 $0

F. PUBLICATION AND DOCUMENTATION COSTS: $0 $0

G. OTHER COSTS:1. Tuition Remission $10,000 $0234567

Total Other Costs: $10,000 $0

TOTAL DIRECT COST (A through G): $35,816 $22,382

INDIRECT COST (On campus 38.5% ): 833.33333 $9,939 $8,617INDIRECT COST (Off campus % of $ ):

Total Indirect Cost: $9,939 $8,617

TOTAL COSTS: $45,755 $30,999

Benjamin Ruttenberg & Lisa NeedlesPRINCIPAL INVESTIGATOR:

Cal Poly CorporationBRIEF TITLE:Recovery of the Pismo clam (Tivela stultorum) in California: the importance of pollution

Year 2: 2/1/2017 - 1/31/2018 OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: GRANT/PROJECT NO.:

DURATION (months):

2/1/16 - 1/31/18 (24 months)

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator:Benjamin Ruttenberg 1 1.2 $0 $10,622Lisa Needles 1 0.5 $0 $4,889

b. Associates (Faculty or Staff): 0 - $0 $0 Sub Total: 2 1.7 $0 $15,511

2. Other Personnela. Professionals: 0 - $0 $0b. Research Associates: 1 0.6 $2,402 $0c. Res. Asst./Grad Students: 0 - $0 $0d. Prof. School Students: 0 - $0 $0e. Pre-Bachelor Student(s): 1 0.9 $1,200 $0f. Secretarial-Clerical: 0 - $0 $0g. Technicians: 0 - $0 $0h. Other: GRADUATE TRAINEE 1 4.5 $0 $0

Total Salaries and Wages: 5 7.7 $3,602 $15,511

B. FRINGE BENEFITS: varied $1,423 $7,878Total Personnel (A and B): $5,025 $23,389

C. PERMANENT EQUIPMENT: $0 $0

D. EXPENDABLE SUPPLIES AND EQUIPMENT: $0 $0

E. TRAVEL:1. Domestic $1,650 $02. International $0 $0

Total Travel: $1,650 $0

F. PUBLICATION AND DOCUMENTATION COSTS: $0 $0

G. OTHER COSTS:1. Tuition Remission $10,000 $0234567

Total Other Costs: $10,000 $0

TOTAL DIRECT COST (A through G): $16,675 $23,389

INDIRECT COST (On campus 38.5% ): 833.33333 $2,570 $9,005INDIRECT COST (Off campus % of $ ):

Total Indirect Cost: $2,570 $9,005

TOTAL COSTS: $19,245 $32,394

Benjamin Ruttenberg & Lisa Needles

Cal Poly CorporationBRIEF TITLE:Recovery of the Pismo clam (Tivela stultorum) in California: the importance of pollutionPRINCIPAL INVESTIGATOR:

June 2015

BRIEF CURRICULUM VITAE (Needed for all Principal and Associate Investigators)

NAME Benjamin Ruttenberg . Address California Polytechnic State University, San Luis Obispo . One Grand Avenue, San Luis Obispo, CA 93407 . Phone (work) 805-756-2498 . Email bruttenb@calpoly.edu EDUCATION Department of Ecology, Evolution and Marine Biology, UCSB, Ph.D., 2006 Thesis: Causes and consequences of geographical variation in demography and larval exchange in

reef fishes School of Forestry and Environmental Studies, Yale University, M.S., 1999 Thesis: The effects of artisanal fishing on marine communities in the Galápagos Islands Tufts University, B.A., 1997 POSITIONS HELD 2013-present Assistant Professor, Biological Sciences Department, Cal Poly

2009-2013 Research Fishery Biology, NOAA Fisheries Southeast Fisheries Science Center

2008-2009 Marine Ecologist, U.S. National Park Service

2007-2008 Postdoctoral Fellow, Scripps Institution of Oceanography/UCSD

2006-2007 UC-MEXUS Postdoctoral Fellow and Science of Marine Reserves in Latin America

Project Manager, Universidad Autónoma de Baja California

SELECTED PUBLICATIONS 1. Adam, T. C., D. E. Burkepile, B. I. Ruttenberg, and M. J. Paddack. 2015. Herbivory and the

resilience of Caribbean coral reefs: knowledge gaps and implications for management. Marine Ecology Progress Series 520: 1-20.

2. Ruttenberg, B. I. and S. E. Lester. 2015. “Patterns and processes in geographic range size in coral reef fishes.” In Ecology of Fishes on Coral Reefs. C. Mora ed. Academic Press, pp. 97-103.

3. Ruttenberg, B. I., S. L. Hamilton, S. M. Walsh, M. K. Donovan, A. Freidlander, E. DeMartini, E. Sala, and S. A. Sandin. 2011. Demographic shifts in coral reef fish communities across a gradient of human disturbance. PLoS One 6(6): e21062.

4. Ruttenberg, B. I., S. L. Hamilton, and R. R. Warner. 2008. Spatial and temporal variation in the natal otolith chemistry in a Hawaiian reef fish: prospects for measuring population connectivity. Canadian Journal of Fisheries and Aquatic Sciences 65: 1181-1192.

5. Ruttenberg, B. I. and R. R. Warner. 2006. Spatial variation in the chemical composition of natal otoliths from a reef fish in the Galápagos Islands. Marine Ecology Progress Series 328: 225-236.

6. Ruttenberg, B. I., A. J. Haupt, A. I. Chiriboga, and R. R. Warner. 2005. Patterns, causes and consequences of regional ecological variation in a reef fish. Oecologia 145: 394-403.

7. Lester, S. E., B. S. Halpern, K. Grorud-Colvert, J. Lubchenco, B. I. Ruttenberg, S. D. Gaines, S. Airamé, and R. R. Warner. 2009. Biological effects within no-take marine reserves: a global synthesis. Marine Ecology Progress Series 384: 33-46.

8. Ruttenberg, B. I. and E. F. Granek. 2011. Bridging the marine-terrestrial disconnect in coastal zone science and management. Marine Ecology Progress Series 434:203-212.

9. Lester, S. E., B. I. Ruttenberg, S. D. Gaines, and B. P. Kinlan. 2007. The relationship between dispersal ability and geographic range size. Ecology Letters 10: 745-758.

10. Ruttenberg, B. I., P. J. Schofield, J. L. Akins, A. Acosta, M. W. Feeley, J. Blondeau, S. G. Smith and J. S. Ault. 2012. Rapid invasion of Indo Pacific lionfishes (Pterois volitans and Pterois miles) in the Florida Keys, USA: evidence from multiple pre- and post-invasion datasets. Bulletin of Marine Science. 88: 1051-1059.

June 2015

BRIEF CURRICULUM VITAE (Needed for all Principal and Associate Investigators)

NAME Lisa Needles . Address California Polytechnic State University, San Luis Obispo . One Grand Avenue, San Luis Obispo, CA 93407 . Phone (work) 805-756-2896 . Email lneedles@calpoly.edu . EDUCATION University of California Davis, Zoology, B.S., 1990

Oregon State University, Science and Mathematics Education, M.A.T., 1997

California Polytechnic State University, Biological Sciences, M.S., 2007

University of California Santa Barbara, Ecology, Evolution and Marine Biology, Ph.D., 2013

POSITIONS HELD 2012-present Part-time Faculty, California Polytechnic State University

2003-present Research Associate, Center for Coastal Marine Sciences

SELECTED PUBLICATIONS Needles, LA, S Gosnell, GT Waltz, DE Wendt, and SD Gaines (2015). Trophic cascades in a

novel ecosystem: Native apex predators facilitate a dominant invader in an estuarine community. Oikos. doi: 10.1111/oik.01865.

Needles, LA, SE Lester, R Ambrose, A Andren, M Beyeler, M Connor, J Eckman, B Costa-Pierce, SD Gaines, K Lafferty, H Lenihan, J Parrish, MS Peterson, A Scaroni, J Weis, DE Wendt (2015). Managing bay and estuarine ecosystems for multiple services. Estuaries and Coasts 38(1): 35-48.

Needles, LA and DE Wendt (2013). Big changes to a small bay: Introduced species and long-term compositional shifts to the fouling community of Morro Bay (CA). Biological Invasions 15(6): 1231-1251.

Woodson CB, DI Eerkes-Medrano, A Flores-Morales, Foley MM, SK Henkel, M Hessing-Lewis, D Jacinto, LA Needles, MT Nishizaki, J O'Leary, CE Ostrander, M Pespeni, KB Schwager, JA Tyburczy, KA Weersing, AR Kirincich, JA Barth, MA McManus, L Washburn (2007). Local diurnal upwelling driven by sea breezes in northern Monterey Bay. Continental Shelf Research 27:2289-2302

June 2015

BRIEF CURRICULUM VITAE (Needed for all Principal and Associate Investigators)

NAME Dean Wendt . Address California Polytechnic State University, San Luis Obispo . One Grand Avenue, San Luis Obispo, CA 93407 . Phone (work) 805-756-1508 . Email dwendt@calpoly.edu . EDUCATION

California Polytechnic State Univ. San Luis Obispo, Biology, Magna Cum Laude, B.S. 1993 Harvard University, Biology, A.M. 1996 Harvard University, Biology, Ph.D. 1999 University of Hawaii, Manoa, Marine Biology, 1999-2000

POSITIONS HELD

Dean of Research, California Polytechnic State University, 2014-present Interim Dean of Research, California Polytechnic State University, 2013-14 Director, Center for Coastal Marine Sciences, California Polytechnic State University, 2012-present Associate Dean, College of Science and Math, California Polytechnic State University, 2010-14 Professor of Biology California Polytechnic State University, San Luis Obispo, 2010-present Associate Professor of Biology, California Polytechnic State University, San Luis Obispo, 2006-10 Assistant Professor of Biology, California Polytechnic State University, San Luis Obispo, 2002-06 Assistant Professor of Biology, The University of North Carolina at Greensboro 2000-02

SELECTED PUBLICATIONS

Starr, R.M., Wendt, D.E., Barnes, C.L., Marks, C.I., Malone, D., Waltz, G., Schmidt, K.T., Chiu, J., Launer, A.L., Hall, N.C., and Yochum, N. (2015). Variation in Responses of Fishes across Multiple Reserves within a Network of Marine Protected Areas in Temperate Waters. PLoS ONE 10(3): e0118502. doi:10.1371.

Needles, L. A., Gosnell, J. S., Waltz, G. T., Wendt, D. E. and Gaines, S. D. 2015. Trophic cascades in an invaded ecosystem: native keystone predators facilitate a dominant invader in an estuarine community. – Oikos doi: 10.1111/oik.01865

Kimura, S., G.T. Waltz, J.R. Steinbeck, and D.E. Wendt (2014) A comprehensive approach for understanding the impacts of visitation to temporally variable ecological systems. Ocean and Coastal Management, 95:241-253.

Needles, L.A. and D.E. Wendt (2013) "Big changes to a small bay: Introduced species and long-term compositional shifts to the fouling community of Morro Bay (CA). Biological Invasions 15:1231-1251

Mireles, C., R. Nakamura, and D.E. Wendt (2012) A collaborative approach to investigate site fidelity, home range, and homing behavior of cabezon (Scorpaenichthys marmoratus). Fisheries Research 113:133-142.

Yochum, N., R.M. Starr and D.E. Wendt (2011) Utilizing fishermen knowledge and expertise: Keys to success for collaborative fisheries research. Fisheries 36: 593-605.

Caselle, J.E., J.R. Wilson, M.H. Carr, D.P. Malone, and D. E. Wendt (2010) Can we predict interannual and regional variation in delivery of pelagic juveniles to nearshore populations of rockfishes (genus Sebastes) using simple proxies of ocean conditions? CalCOFI Reports 51:91-105.

Wendt, D.E. and R.M. Starr (2009) Collaborative Research: An Effective Way to Collect Data for Stock Assessments and Evaluate Marine Protected Areas in California. Marine and Coastal Fisheries: Management, Dynamics, and Ecosystem Science. 1: 315-324.

Wendt, D.E, L. Pendleton and D.L. Maruska (2009) “Morro Bay, California: A case study of ecosystem-based management through community action” In: K. L. McLeod and H. M. Leslie (editors). Ecosystem-Based Management for the Oceans. Island Press.

Rienecke, S.J., Stephens, J.S., Jr., R. Nakamura, E. Nakada D.E. Wendt, D. Wilson-Vandenberg (2008) Spatial and temporal approaches in analyzing recreational groundfish data from southern central California and their application toward marine protected areas. CalCOFI Rep., Vol. 49: 241-255.

Wilson, J.R., B.R. Broitman, J.E. Caselle, and D. E. Wendt (2008) Recruitment of coastal fishes and oceanographic variability in central California. Estuarine, Coastal, and Shelf Science 79:483-490.

Stephens, J. S. Jr., D. E. Wendt, D. Wilson-Vandenberg, J. Carroll, and R. Nakamura, E. Nakada, S. Rienecke, J. Wilson (2006) A review of the groundfish assemblage of California’s south central coast, 1980-2004. Is there an argument for regional management of this rockfish resource? CalCOFI Reports 47:140-155.

Johnson, C.H. and D.E. Wendt. (2007) Availability of Dissolved Organic Matter (DOM) Offsets Ecological Costs Associated with a Protracted Larval Period for Bugula neritina (Bryozoa). Marine Biology 151: 301-311).

Wendt D.E . and C.H. Johnson (2006) Using latent effects to determine the ecological importance of dissolved organic matter to marine invertebrates. Integrative and Comparative Biology 46:634-642.

Wendt, D.E., G.L. Kowalke, J. Kim, and I.L. Singer (2006) Factors that influence elastomeric coating performance: the effect of coating thickness on basal plate morphology, growth and critical removal stress of the barnacle Balanus amphitrite. Biofouling 22: 1-9.

Wendt, D. E. (2000) Energetics of swimming and metamorphosis in larvae of 4 species of Bugula (Bryozoa). Biol. Bull. 198: 346-356.

Pechenik, J.A., D.E. Wendt, and, J.N. Jarret. (1998) Metamorphosis is not a new beginning. BioScience. 48: 901-909.

SUMMARY PROPOSAL FORM

PROJECT TITLE:

RECOVERY OF THE PISMO CLAM (TIVELA STULTORUM) IN CALIFORNIA: THE IMPORTANCE OF POLLUTION OBJECTIVE: Our main objectives are twofold: 1) evaluate the levels of toxins present in Pismo clam adults and recruits in more urbanized and less urbanized areas of California, and 2) determine the impacts of environmentally relevant levels of these toxins on development and survivorship of Pismo clam larvae. Answers to these questions will help us understand the impact of pollution as a limiting factor of Pismo clam populations. Results from this study, combined with other data we are collecting on abundance, size structure, and other potential limiting factors, will help us suggest and evaluate management strategies and restoration activities that are most likely to be successful in increasing Pismo clam abundance. METHODOLOGY: Our methods follow our objectives. To evaluate levels of toxins in adult and recruit Pismo clams, we will make collections of individual clams from beaches in more urbanized and less urbanized areas of Southern and Central California. Tissue will be dissected and homogenized, and analyzed for a suite of environmental toxins, including pesticides, herbicides, endocrine disrupters, and hydrocarbons. To measure the impact of toxins on development and survivorship of Pismo clam larvae, we will spawn clams and grow the larvae in varying concentrations of the important toxins identified by objective 1. We will use standard larval assays to measure larval developmental rate, developmental abnormalities, and survivorship. RATIONALE: The Pismo clam (Tivela stultorum) once supported a thriving commercial and recreational fishery in California, but abundance has declined dramatically throughout California in recent decades. While some populations appear stable, others remain small despite limited human take for many years. Conventional wisdom suggests that sea otters limit Pismo clam abundance where otters are present, but aside from a few high density sites outside of the otters’ range (i.e., below Pt Conception), abundance across the state is still low. The other factors that limit Pismo clam recovery are presently unknown, but anthropogenic pollutants may be one of these factors. Pismo clams’ preferred habitats are the lower intertidal and shallow subtidal of sandy beaches; in these habitats, they are exposed to elevated levels of many toxins, especially in areas near urban centers. Like many marine invertebrates, the larvae of Pismo clams may be particularly vulnerable to pollutants, a vulnerability that may limit larval supply, recruitment, and ultimately adult population sizes. We seek to understand the relative importance of pollution as a limiting factors on the recovery of Pismo clam as a step towards developing successful management and restorations strategies.

Central Coast Salmon Enhancement, Inc.

229 Stanley Avenue, Arroyo Grande, CA 93420 Phone: (805) 473-8221 Fax: (805) 473-8167

www.centralcoastsalmon.com

229 Stanley Avenue, Arroyo Grande, CA 93420

Phone: 805-473-8221 www.centralcoastsalmon.com Fax: 805-473-8167

June 25, 2015 Dr. Linda Duguay Director USC SeaGrant Program Los Angeles, CA 90089 Dear Dr. Duguay: Please accept our strong support for the SeaGrant proposal “Recovery of the Pismo clam (Tivela stultorum) in California: the importance of pollution,” submitted by Cal Poly. At Central Coast Salmon Enhancement, we seek to ensure that our natural resources continue to support the ecological, recreational, and economic needs of our community, with an emphasis on watershed and coastal ecosystems of the California Central Coast. Historically, Pismo clams were an important part of both sandy beach ecosystems as well as recreational fisheries in the area. However, in recent years, their abundance has declined rapidly. Unfortunately, we do not know the causes of this decline, complicating management of the species. The proposed project will collect valuable data on the effects of toxins on Pismo clams, providing key information on one factor that may be limiting recovery. Furthermore, the broader project has excellent potential for education and outreach to local communities; Pismo clams are important to the local economy and culture of the Central Coast, and as such they fit extremely well within the mission of Central Coast Salmon Enhancement. I strongly urge you to support this important research, and I welcome any questions you may have. Sincerely yours,

Christopher Lim Executive Director

July 7, 2015 Dr. Linda Duguay, Director USC SeaGrant Program Los Angeles, CA 90089 Dear Dr. Duguay: I write to express my strong support of the Cal Poly grant submission to USC Sea Grant titled: “Recovery of the Pismo clam (Tivela stultorum) in California: the importance of pollution.” The proposal by the Cal Poly team supports the efforts of our agency to understand and monitor the impacts of pollutants in Calfornia's waters. For many years I have been the lead staff scientist implementing the research and monitoring program in Central California for the Region 3 Water Quality Control Board. The proposed work compliments the work we do, especially as the research will be monitoring emerging pollutants in tissues of adult animals and investigating their impact on larval development and survival. It goes without saying that our agency has limited resources, and we do not have the ability to collect data on all of the species and pollutants we would wish to; for this reason a study like that proposed by Cal Poly is essential to helping our agency meet our research and monitoring goals. Please contact me if you have additional questions. I can be reached at (805) 549-3333 or Karen.worcester@gmail.com. Sincerely, Karen R. Worcester Senior Environmental Scientist, Central Coast Ambient Monitoring

June 2015 University of Southern California Sea Grant Proposal

PROJECT TITLE: DEVELOPMENT  OF  DIGITAL  RT-­‐PCR  METHODS  TO  QUANTIFY  HUMAN-­‐ASSOCIATED  BACTERIOPHAGE  IN  STORM  WATER  AND  COASTAL  RECREATIONAL  WATERS   PRINCIPAL INVESTIGATORS: Joshua  A.  Steele,  Microbiologist,  Southern  California  Coastal  Water  Research  Project  Adam  C.  Martiny,  Associate  Professor,  University  of  California  Irvine,  Director  UCI  OCEANS     ASSOCIATE INVESTIGATORS: John  F.  Griffith,  Principal  Scientist,  Southern  California  Coastal  Water  Research  Project   FUNDING REQUESTED: 2016-2017 $59,463 Federal/State $50,406 Match 2017-2018 $59,210 Federal/State $50,568 Match STATEMENT OF THE PROBLEM: Concentrations  of  Fecal  Indicator  Bacteria  (e.g.  Enterococcus,  E.  coli,  fecal  coliforms)  in  recreational  waters  are  monitored  to  protect  swimmers  from  exposure  to  waterborne  pathogens.  Despite  these  efforts,  swimmers  may  still  be  at  risk  from  exposure  to  pathogenic  human  viruses  even  when  levels  of  FIB  meet  standards.  The  problem  is  with  the  indicators:  FIB  methods  are  slow,  non-­‐specific  (i.e.  they  cannot  distinguish  the  source  of  the  contamination),  and  do  not  reliably  predict  the  presence  of  human  viruses  in  recreational  water.  Traditional  viral  indicators,  such  as  bacteriophage,  are  better  indicators  of  viral  contamination,  but  the  methods  are  also  slow  (e.g.  24  hour  incubation  before  a  result)  and  insensitive  (i.e.  low  levels  of  bacteriophage  can  be  missed).    However,  F+RNA  coliphage  (bacteriophage  which  infect  E.  coli  and  related  bacteria)  have  been  shown  to  distinguish  between  human  and  non-­‐human  associated  sources  of  contamination  based  on  their  genotype  and  were  better  predictors  of  gastrointestinal  illness  than  FIB  in  two  recent  epidemiological  studies  at  southern  California  Beaches.    Direct  molecular  assays  of  the  F+RNA  coliphage  using  reverse  transcriptase-­‐quantitative  PCR  (RT-­‐QPCR)  provide  a  rapid  method  to  measure  viral  indicators  and  to  track  sources  of  microbial  contamination  in  environmental  water.  In  their  current  form  (using  reverse-­‐transcriptase  PCR),  these  techniques  are  susceptible  to  inhibition  by  organic  compounds  found  in  environmental  waters  and  have  exhibited  low  sensitivity  to  their  target.  Here,  we  propose  to  adapt  these  assays  to  droplet  digital  reverse-­‐transcriptase  quantitative  PCR  (ddRT-­‐QPCR)  to  increase  their  sensitivity  and  decrease  their  susceptibility  to  inhibition.  The  adapted  molecular  assay  will  support  efforts  by  US  EPA  to  develop  a  rapid  coliphage  assay  

INVESTIGATORY QUESTIONS:

1. Can  the  RT-­‐QPCR  assays  for  F+RNA  coliphage  be  successfully  adapted  to  digital  droplet  PCR  and  used  to  quantify  and  distinguish  the  4  genogroups  in  southern  California  storm  water  and  recreational  coastal  waters?  

2. Can  the  molecular  quantification  F+RNA  coliphage  genogroups  be  used  as  a  viral  indicator  in  storm  water  and  near  shore  coastal  waters,  i.e.  will  the  human-­‐associated  coliphage  correlate  with  pathogenic  viruses  in  contaminated  storm  water  and  coastal  waters?  

3. Can  the  molecular  quantification    of  F+RNA  coliphage  genogroups  be  used  to  distinguish  human-­‐associated  from  non-­‐human  associated  contamination  in  storm  water  and  near  shore  coastal  waters?  

MOTIVATION:  Fecal  indicator  bacteria  (FIB),  such  as  Enterococcus  are  monitored  to  protect  swimmers  and  surfers  from  potentially  harmful  microbial  contamination  in  recreational  waters.  Beaches  must  be  posted  or  closed  when  these  indicators  exceed  the  concentration  set  by  state  and  federal  law.  While  these  bacterial  indicators  are  predictive  of  health  risk  when  there  is  an  acute,  human  source  of  contamination  (i.e.  human  sewage),  they  do  not  consistently  predict  the  presence  of  human  pathogenic  viruses  (Jiang  et  al.  2001;  Noble  &  Fuhrman  2001;  Boehm  et  al.  2003;  Jiang  &  Chu  2004;  McQuaig  et  al.  2012),  or  gastrointestinal  illness  (Colford  et  al.  2007).  Further,  they  are  unable  to  distinguish  between  human-­‐associated  and  non-­‐human  associated  sources  of  contamination,  which  can  alter  the  risk  of  swimming-­‐related  illness  (Soller  2010,  2014).    

 Recognizing  the  inadequacy  of  FIB  as  an  indicator  organism,  the  US  Environmental  Protection  Agency  (EPA)  has  embarked  on  a  path  to  develop  water  quality  standards  for  coliphage  (US  EPA  2015).  Recent  epidemiology  studies  conducted  by  our  organization  in  cooperation  with  EPA  in  southern  California  (Mission  Bay  in  San  Diego,  Avalon  Beach  on  Catalina  Island,  and  at  Surfrider  Beach  in  Malibu)  found  an  association  between  F+  coliphage  and  gastrointestinal  illness  (Colford  et  al.  2007,  Griffith  et  al.  submitted).  In  the  two  studies  in  which  genotyping  was  conducted,  genotypes  III  (at  Avalon)  and  III  (at  Malibu)  were  found  to  be  significant  predictors  of  gastrointestinal  illness  (Griffith  et  al.  submitted).    SCCWRP  has  a  history  of  working  together  with  EPA  on  development  of  rapid  water  quality  measurements.    Our  organization  was  instrumental  in  testing  and  promoting  the  QPCR  method  for  Enterococcus  (EPA  Method  1609,  USEPA  2013)  that  was  included  in  the  2012  Recreational  Water  Quality  Criteria  and  we  are  currently  collaborating  with  EPA  Office  of  Water  on  coliphage.    

 It  is  not  surprising  that  FIB  do  not  correlate  with  human  viruses  at  southern  California  beaches,  as  unless  there  is  a  sewage  spill  or  equipment  failure,  our  beaches  are  not  impacted  by  either  treated  or  untreated  wastewater.  Here,  one  of  the  most  likely  routes  for  

viruses  to  reach  beach  water  is  through  contaminated  groundwater.  Unlike  bacteria,  waterborne  viruses  and  bacteriophage  (i.e.  viruses  that  infect  bacteria)  are  not  as  effectively  filtered  out  as  water  moves  through  sand  or  soil.  Further,  bacteriophage  are  more  abundant  than  human  viruses  (since  their  bacterial  hosts  are  much  more  abundant)  which  makes  them  more  attractive  water  quality  indicators  at  beaches  where  the  source  is  groundwater  contaminated  leaking  infrastructure,  rather  than  acute  inputs,  such  as  storm  water  pulses  or  direct  sewage  spills.        F+RNA  coliphage  (i.e.  single  stranded  RNA  viruses  infecting  E.  coli  and  related  bacteria),  bacteriophage  infecting  human-­‐associated  Bacteroides  bacteria  (e.g.  Bacteroides  GB-­‐124  phage  Ebder  et  al.  2007,  McMinn  et  al.  2012),  and  a  bacteriophage  discovered  from  human  gut  microbiome  metagenomes  (crAssphage,  Stachler  &  Bibby  2014)  have  been  proposed  as  potential  fecal  indicators.    The  EPA  is  in  the  process  of  creating  recreational  water  quality  criteria  using  coliphages  as  fecal  indicators  in  ambient  waters.  Towards  this  end,  the  Office  of  Sceince  and  Technology  has  recently  published  a  review  assessing  the  role  of  coliphages  as  fecal  indicator  viruses  (USEPA  2015).      

 F+RNA  coliphage  have  been  used  as  fecal  indicators  to  protect  drinking  water  supplies  through  cultivation  techniques  for  decades.    However,  the  cultivation  is  slow  (24  hours  before  getting  a  result)  and  does  not  provide  any  indication  of  source  of  the  contamination.  Molecular  techniques  targeting  the  genogroups  of  F+RNA  coliphage  can  distinguish  between  human-­‐associated  (genogroups  II  and  III)  and  non-­‐human  associated  (genogroups  I  and  IV)  sources,  but  until  recently  this  was  performed  as  a  post-­‐cultivation  step  (Hsu  et  al.,  1995;  Beekwilder  et  al.  1996;  Cole et al. 2003; Vinje  et  al.  2004;  Long et al. 2005; Stewart-Pullaro et al. 2006),  requiring  additional  time  to  result.  Recently,  direct  molecular  quantification  (through  reverse  transcription-­‐  quantitative  PCR  i.e.  RT-­‐QPCR)  of  the  F+RNA  coliphage  genogroups  from  environmental  sources  has  been  developed  and  used  as  a  source-­‐tracking  tool  (Orgozaly  &  Gantzer  2006,  Orgozaly  et  al.  2009,  Wolf  et  al.  2008,  2010,  Friedman  et  al.  2009,  2011,  Paar  II  et  al.  2015,  Vergara  et  al.  2015).  This  method  is  rapid,  with  the  potential  of  producing  results  within  4  hours  from  sample  collection,  and  specific,  identifying  genogroups  I-­‐IV.      In  addition  to  the  long  incubation  time  many  bacteriophage  cultivation  techniques  are  relatively  insensitive.  Because  bacteriophage  abundance  is  variable  and  phage  can  go  undetected  by  culture  methods,  requiring  non-­‐quantitative  enrichment  in  order  to  enhance  detection.    Molecular  quantification  of  bacteriophage  directly  from  environmental  waters  avoids  the  lengthy  cultivation  process  and,  in  the  case  of  F+RNA  coliphage,.  However,  the  difficulty  of  effectively  capturing  coliphage  from  environmental  water  and  amplifying  their  signal  in  the  frequent  presence  of  inhibitory  substances  such  as  humic  acids  makes  this  kind  of  measurement  difficult.    

Digital  droplet  PCR  (ddPCR)  has  the  potential  to  overcome  some  of  the  problems  associated  with  PCR  inhibition  and  provides  absolute  quantification  even  at  low  target  concentrations.  Unlike  qPCR,  which  has  been  the  most  popular  method  for  quantifying  molecular  targets  for  many  years,  ddPCR  does  not  depend  on  cycle  threshold  and  comparison  to  a  dilution  series  of  reference  standards  for  quantification.  Rather,  ddPCR  

utilizes  dilution  of  the  target  to  1  copy  per  droplet,  followed  by  amplification,  and  then  counting  and  quantification  using  Poisson  statistics  to  determine  the  number  of  gene  copies.  This  technique  both  eliminates  the  need  for  a  standard  curve  and  combats  inhibition  because  the  cycle  at  which  the  fluorescent  signal  appears  is  no  longer  relevant  for  quantification.  Droplets  with  any  positive  signal  are  counted  as  1’s  and  those  without,  as  0’s  regardless  of  the  cycle  at  which  they  appear.  In  addition,  because  of  the  digital  nature  of  the  data,  multiple  wells  can  be  run  concurrently  from  the  same  sample  and  the  results  combined,  raising  sensitivity  and  eliminating  the  limitations  associated  with  qPCR  where  one  may  only  use  a  small  fraction  of  the  DNA  extracted  from  a  sample  in  each  reaction.    

Current  epidemiology  and  Quantitative  Microbial  Risk  Asessment  (QMRA)  studies  in  San  Diego  and  a  QMRA  studies  in  the  Port  of  Los  Angeles  at  inner  Cabrillo  Beach  will  also  provide  a  direct  link  to  water  quality  measurements  and  human  health  outcomes  and  enable  us  to  test  the  relationship  of  the  F+RNA  coliphage  to  pathogens  and  to  FIB  on  the  same  samples.    Inclusion  of  F+RNA  phage  digital  RT-­‐QPCR  assays  will  enhance  both  projects  and  provide  a  comparative  analysis  of  the  utility  of  the  assay  as  a  predictor  of  illness  in  swimmers  and  as  a  fecal  source  tracking  tool.      

  GOALS AND OBJECTIVES:

A. Overall Goals Our  goals  are  to  further  EPA  efforts  to  develop  rapid,  sensitive  bacteriophage  assays  for  water  quality  monitoring  and  as  source  identification  tools  in  coastal  recreational  watersheds.  Specifically  we  aim  to  1)  to  develop  a  sensitive,  robust  droplet  digital  RT-­‐PCR  assay  to  measure  and  distinguish  human-­‐associated  and  non-­‐human-­‐associated  F+RNA  coliphage  genogroups;  and  2)  apply  this  assay  as  microbial  source  tracking  tool  in  coastal  recreational  waters  and  storm  waters.    

B. 2016-2017 Objectives

As  stated  above  our  overall  aim  is  to  develop  an  assay  targeting  F+RNA  coliphage  as  a  viral  indicator  in  coastal  watersheds  and  stormwater.  Specifically  our  objectives  are  to  1)  Adapt  RT-­‐QPCR  methods  for  F+RNA  coliphage  genogroups  to  droplet  digital  RT-­‐PCR;  2)  Collect  stormwater  and  nearshore  coastal  waters  suspected  of  microbial  contamination  and  capture  viruses;  3)  Apply  the  droplet  digital  RT-­‐PCR  assay  as  a  human  and  non-­‐human  associated  microbial  source  tracker  in  stormwater  and  recreational  coastal  waters  likely  to  be  impacted  by  microbial  contamination.  

METHODS:

 We  will  develop  and  test  sensitive  (potentially  detecting  a  single  gene  copy)  and  robust  (resistant  to  PCR  inhibition)  droplet  digital  RT-­‐PCR  methods  adapted  from  recently  developed  RT-­‐QPCR  assays  applied  to  wastewater  and  environmental  samples  (e.g.  Wolf  et  

al.  2010,,  Paar  III  et  al  2015,  Vergara  et  al.  2015).  These  assays  can  distinguish  multiple  F+RNA  coliphage  genotypes  at  once  by  targeting  shared  coat  protein  and  RNA  replicase  genes.            Duplexing  the  digital  RT-­‐QPCR  assay  will  allow  for  two  targets  to  be  detected  in  one  reaction,  doubling  the  information  from  a  given  sample.    Because  it  was  designed  as  a  multiplex  assay  in  environmental  samples  and  sewage,  we  are  planning  to  adapt  the  set  of  primers  and  probes  from  the  viral  tool  box  of  Wolf  et  al.  (2010)  shown  in  Table  1.    Although  there  are  other  primer  sets  for  F+RNA  coliphage  (e.g.  primer  and  probe  sets  developed  by  Friedman  et  al.  2011  and  recently  employed  in  environmental  samples  by  Paar  III  et  al.  2015,  Vergara  et  al.  2015),  we  chose  the  Wolf  et  al.  primer  set  due  to  the  optimization  of  Wolf  et  al.  for  multiplexing  and  the  potentially  broader  range  for  F+RNA  phage  GIII.      After  conversion  of  the  RNA  in  the  sample  to  complementary  DNA  using  reverse  transcriptase,  the  complementary  DNA  will  be  quantified  via  droplet  digital  PCR.  The  multiplexed  primers  and  probes  can  all  be  amplified  at  the  same  temperatures  dissociation  at  95°C  15s,  annealing/extension  at  59°C  60s  for  45  cycles.    Cultivable  bacteriophage  (e.g.  MS2  for  GI,  GA  for  GII,  Qβ  for  GIII,  or  HB  for  GIV)  will  be  used  as  positive  controls  and  for  optimization  during  the  development  of  the  ddRT-­‐QPCR  assay.    We  expect  that  we  will  maintain  similar  specificity  (i.e.  amplifying  only  the  intended  genogroup)  and  will  increase  the  sensitivity  (i.e.  lower  the  limit  of  detection)  compared  to  the  RT-­‐QPCR  assay.  In  order  to  account  for  potential  inhibitory  compounds  found  in  environmental  samples  (e.g.  humic  acids,  phenolic  compounds),  we  will  conduct  both  spike-­‐dilution  tests,  and  use  an  internal  amplification  control  (following  Friedman  et  al.  2011).  This,  in  addition  to  the  RT  control,  will  enable  us  to  determine  robustness  of  the  ddRT-­‐PCR  assay.  We  have  found  in  previous  studies  that  the  nature  of  the  small-­‐volume  ddPCR  itself  tends  to  be  robust  to  inhibition.      The  reactions  will  be  placed  into  droplets  generated  on  the  BioRad  ddPCR  system,  run  on  BioRad  CFX  thermocyclers  and  read  in  the  BioRad  QX-­‐100  or  QX-­‐200  digital  droplet  reader.  The  reagents  and  equipment  have  been  previously  tested  by  SCCWRP  and  represent  the  state-­‐of  –the-­‐art  for  droplet  digital  PCR  (Cao  et  al.  2015,  Steele  et  al.  2015,  in  prep).      In  addition  to  this  technology,  SCCWRP  is  collaborating  with  Arizona  State  University  and  the  Monterey  Bay  Aquarium  Research  Institute  to  develop  an  automated  sampler  and  field-­‐worthy  droplet  digital  PCR  platform.  The  proposed  assays  would  be  ideal  for  adaptation  and  testing  on  the  field  platform  for  microbial  source-­‐tracking  studies.    The  adaptation  and  testing  will  likely  require  the  first  half  of  the  year  1  to  complete.    Once  we  are  assured  that  the  assay  is  performing  satisfactorily,  we  will  apply  the  assay  to  quantify  F+RNA  coliphage  genotypes  in  fresh  and  archived  samples                    

F+RNA phage

Genogroup Primer Name Forward Primer Reverse Primer Probe

GI FphGI GTCCTGCTCRACTTCCTGT

ATGGAATTSCGGCTACCTACA

CGAGACGCTACCWTGGCTATCGC

GII FphGII ACCTATGTTCCGATTCASAGAG

GGTAGGCAAGTCCATCAAAGT

CACTCGCGATTGTGCTGTCCGATT

GIII FphGIII (MX1)

TTTGAGGCTRTGTTGCGACA

CCGTGGSGTACACTCTTG

CGGYCATCCGTCCTTCAAGTTTGC

GIII FphGIII (Qβ)

CCGTCCGTTGAGGGTATGTT

CGAGGSGTACACGCTTG

CGGYCATCCGTCCTTCAAGTTTGC

GIV FphGIV AAGACWGGTCGGTACAAAGT

ARCTTCACCTCGGGAAKTC

CCGGATGAAGGCACTGTCCTGAATC

 We  will  begin  collecting  samples  from  storm  water,  estuaries,  and  marine  waters  in  the  coastal  zone  in  Southern  California  while  the  adaptation  of  the  RT-­‐QPCR  to  digital  PCR  is  underway.  Thus,  we  plan  to  collect  samples  during  the  first  18  months  of  the  project.  This  will  give  us  both  wet  and  dry  seasons  to  collect  storm  water  and  beach  water.    We  will  target  5  locations  throughout  southern  California  likely  to  suffer  from  aging,  leaky  infrastructure  including  watersheds  in  San  Diego,  Orange  County,  and  Los  Angeles  County.    We  anticipate  collecting  storm  water  samples  from  San  Diego  and  Malibu,  near-­‐shore  beach  samples  from  beaches  in  the  City  and  County  of  San  Diego,  Doheny  State  Beach,  and  Newport  Beach  (in  Orange  County),  and  Inner  Cabrillo  Beach,  and  Malibu  (Los  Angeles  County).      

 Doheny  State  Beach  and  Newport  Beach  are  at  the  end  of  urbanized  watersheds.  Newport  Back  Bay  is  less  urbanized,  but  still  has  a  profound  urban  influence  that  ends  in  a  wetland,  water  treatment  ponds  to  reduce  nutrients,  and  a  small  marina.  These  locations  are  all  near  to  UC  Irvine  and  SCCWRP’s  laboratory  and  will  be  easily  accessible.    An  ongoing  study  of  surfer  wet  weather  epidemiology,  water  quality  and  quantitative  microbial  risk  assessment  in  San  Diego  in  one  large,  urbanized  watershed,  and  one  small,  urbanized  watershed  at  SCCWRP  is  directly  measuring  pathogens,  but  virus  samples  can  be  collected  and  archived  for  F+RNA  coliphage  analysis.  The  Martiny  lab  conducts  regular  sampling  for  phytoplankton,  bacteria,  and  viruses,  in  the  near  shore  ocean  off  of  Newport  Beach,  which  is  influenced  by  Orange  County  and  South  Los  Angeles  County  watersheds.    Samples  of  opportunity  alongside  the  Bight  ’13  wet  and  dry  weather  stormwater  sampling  in  Malibu  

Table 1. Primers and Probes from Wolf et al. 2010 used for multiplex digital RT-QPCR

and  the  upcoming  Inner  Cabrillo  Beach  water  quality  and  QMRA  study  (in  the  heavily  urbanized  port  of  Los  Angeles)  which  SCCWRP  is  beginning  this  year.  Malibu,  a  less  urbanized  but  frequently  contaminated  watershed,  and  Doheny  State  Beach  have  both  been  the  focus  of  earlier  epidemiology  and  microbial  source  tracking  studies  (Griffith  et  al.  submitted).    We  also  have  access  to  archived  virus  samples  from  epidemiology  and  water  quality  studies  collected  during  2008-­‐2015  from  Malibu,  Avalon,  Doheny  State  Beach,  and  San  Diego  which  can  be  used  for  F+RNA  coliphage  assay  application.  Viral  samples    from  Newport  Beach,  Newport  Back  Bay,  and  Doheny  will  also  be  collected  and  tested  on  the  automated  sampler  and  portable  ddPCR  system  being  developed  by  the  Monterey  Bay  Aquarium  Research  Institute,  Arizona  State  University,  and  SCCWRP.    The  adapted  ddRT-­‐PCR  assay  will  be  tested  on  the  new  instrument  to  gauge  the  feasibility  of  automating  viral  indicators  and  RT-­‐PCR  on  the  portable  digital  PCR  instrument.  

 Samples  at  all  sites  will  be  taken  in  duplicate.  For  large  volume  samples  we  will  concentrate  the  viruses  using  a  30  kDa  hollow  fiber  filter  with  a  foam  elution  from  InnovaPrep  (recently  tested  on  environmental  samples  at  SCCWRP,  Fig  1).  For  small  volume  samples  we  will  use  the  alumina  coated  nanoCeram  filters  (Li  et  al.  2010;  Ikner  et  al.  2011)  or  multi-­‐cellulose  ester  type  HA  filters  (after  Katayama  et  al.  2002)  both  of  which  capture  viruses  by  electrostatic  charge.  For  the  type  HA  filters,  water  samples  will  be  amended  with  MgCl2  and  acidified  to  pH  3.5  to  allow  viruses  to  adsorb  to  the  filter  membrane  and  then  be  directly  extracted  (Conn  2012,  Katayama  et  al.  2002).  For  the  nanoCeram  filters,  the  viruses  will  adsorb  to  the  nano-­‐aluminum  coating  and  be  eluted  by  a  solution  of  phosphate  buffered  saline  at  pH  9.3,  with  0.1%  NaPP  and  0.05M  glycine  (Ikner  et  al  2011).    Once  viruses  are  captured  they  will  either  be  preserved  and  stored  in  RNAlater  or  flash  frozen  in  liquid  N2  and  stored  at  -­‐80°C  until  extraction.        These  virus  capture  techniques  performed  well  in  a  recent  comparison  of  virus  recovery  from  stormwater,.  HA  filters  showed  the  highest  recovery  at  a  low  (105  phage  gene  copies  per  L),  and  InnovaPrep  showing  the  most  consistent  recovery  with  large  (20L)  volume  samples.    The  filters  or  the  concentrates  will  be  extracted  using  MoBio  environmental  virus  kit  with  mechanical  lysis  using  glass  beads,  β-­‐mercaptoethanol  and  a  phenol:chloroform:isoamyl  alcohol  extraction.  A  standard  RNA  extraction  control  (e.g.  Mouse  Lung  β-­‐actin  RNA)  will  be  added  to  each  sample  (after  Conn  et  al.  2012).  All  RNA  work  will  use  cleaned  dedicated  lab  space  (e.g.  prep-­‐stations  or  hoods)  and  cleaned,  dedicated  pipets  to  avoid  contamination  with  enzymes  that  would  degrade  the  RNA  in  the  samples.  

     All  data  generated  by  the  project  will  cleaned,  formatted,  and  be  made  publicly  available  through  the  California  Environmental  Data  Exchange  Network,  or  on  SCCWRP’s  website.  In  addition,  the  publications  will  be  open-­‐access  and  data  and  protocols  generated  by  this  project  will  be  housed  on  a  publicly  accessible  website  either  in  an  open  sharing  site  such  as  GitHub.  Water  quality  data  collected  by  SCCWRP  is  routinely  incorporated  into  public  databases  including  the  California  Environmental  Data  Exchange  Network  (CEDEN)  which  combines  sample  location,  date,  and  water  quality  information  and  other  metadata.  

RELATED RESEARCH: While  there  has  been  no  human-­‐associated  bacteriophage  research  funded  recently  by  USC  Sea  Grant,  there  have  been  prior  Sea  Grant  projects  that  examined  the  relationship  of  fecal  indicator  bacteria  (FIB)  and  pathogenic  microorganisms  including  bacteria  and  viruses.  Prior  research  by  Jones  and  Fuhrman  examined  the  fate  and  dispersal  of  pathogens  in  stormwater  at  Southern  California  Beaches,  and  will  inform  this  study.  This  work  on  transport  will  also  provide  a  means  to  extend  the  current  research  beyond  the  sites  that  we  are  able  to  test  and  provide  necessary  context  for  the  proposed  research.    Development  of  

Figure 1. Percent recovery of bacteriophage MS2 (F+RNA Coliphage GI) from three different virus capture filtrations. Data from (Steele et al. 2015, in prep.). The recovery is shown as a percent of the bacteriophage MS2 quantity spiked. The high concentration contained 108 phage gene copies per L and the low concentration contained 105 phage gene copies per L.

Percen

t  Recov

ery  

0

10

20

30

40

50

60

70

80

HA NanoCeram InnovaPrep

High Concentration

Low Concentration

Filter TypeFilter  Type  

molecular  assays  for  viruses  have  been  funded  in  the  past  by  USC  Sea  Grant  in  research  performed  by  SCCWRP  and  USC  including  hepatitis  A  virus  assays  (research  to  J.F.  Griffith)  and  enterovirus  assays  (Noble  et  al.  2003,  Fuhrman  et  al.  2005)  in  coastal  water  and  storm  water.    Research  on  the  correlation  between  human  enteric  viruses  and  FIB  by  Noble  and  Fuhrman  was  crucial  to  understanding  the  limitations  of  FIB  and  exploring  the  behavior  of  viruses  as  the  basis  for  rejecting  the  links  between  FIB  and  pathogens  in    beach  water  (Noble  &  Furhman  2001,  Fuhrman  et  al.  2005).    The  proposed  work  will  add  to  the  physical  oceanography  and  molecular  assays  performed  as  USC  Sea  Grant  projects.    We  note  that  while  there  is  unlikely  a  direct  connection,  the  Sea  Grant  studies  by  Shipe  and  Sanudo-­‐Wilhelmy  looking  at  nutrient  and  metal  inputs  and  their  effect  on  phytoplankton,  along  with  the  harmful  algal  bloom  research  are  related  in  that  the  proposed  research  would  be  able  to  identify  likely  sources  of  nutrient  and  pathogen  contamination;  particularly  at  locations  with  groundwater  seeping  into  the  beach,  contaminated  by  leaky  infrastructure.          Current  research  at  the  Southern  California  Coastal  Water  Research  Project  is  complementary  to  the  proposed  research.    Two  ongoing  studies  are  using  source  identification  and  direct  pathogen  quantification  to  inform  a  Quantitative  Microbial  Risk  Assessment  of  urbanized  coastal  and  harbor  waters.  The  Surfer  Health  Study  in  San  Diego  is  currently  pairing  health  outcomes  during  wet  weather  events  to  water  quality  measurements  using  fecal  indicators,  direct  measurement  of  pathogens  by  ddPCR,  and  the  microbial  source  identification  for  QMRA.    A  separate  QMRA  study  will  begin  this  year  to  measure  the  water  quality,  quantify  pathogens,  and  predict  risk  at  Inner  Cabrillo  Beach  in  Los  Angeles  Harbor.    SCCWRP  also  coordinates  the  Southern  California  Bight  Montioring  Program  acting  as  the  source  of  QPCR  standards  and  the  data  analysis  clearing  house  for  microbial  measurements  using  QPCR.    SCCWRP  also  performs  sampling  at  5  sites  in  watersheds  in  Northern  Los  Angeles  County..  SCCWRP  is  also  collaborating  with  the  Monterey  Bay  Aquarium  Research  Instititue  and  Arizona  State  Unviersity  to  develop  an  automated  environmental  sampler  for  microbial  samples  (including  viruses)  and  a  portable,  field-­‐based  droplet  digital  quantitative  PCR  machine.  This  research  will  enable  SCCWRP  to  add  capabilities  to  this  project  and  make  a  wider  comparison  between  quantitative  molecular  assays  for  microbial  source  tracking.  Combining  the  proposed  F+RNA  phage  digital  PCR  assays  with  the  bight  samples,  and  to  other  archived  samples  where  available,  will  also  allow  for  correlation  to  earlier  cultivation  assays  and  other  pathogen  and  FIB  measurements  

 SCCWRP  recently  coordinated  a  27-­‐laboratory  comparative  study  of  41  microbial  source-­‐tracking  assays  referred  to  collectively  as  the  Source  Identification  Protocol  Project  (SIPP;  Boehm  et  al.  2013)  and  specifically  investigated  virus  and  coliphage  assays  in  13  labs.  Although  pathogenic  viruses  and  F+RNA  coliphage  genotypes  were  analyzed,  the  coliphage  assays  relied  on  cultivation  prior  to  genotyping.  (Harwood  et  al.  2013).  SCCWRP  has  also  been  at  the  forefront  of  developing  rapid  molecular  methods  for  microbial  water  quality  and  has  developed  many  bacterial  and  viral  assays  over  the  past  15  years,  collaborating  with  the  US  EPA  and  leading  academic  laboratories  including  development  of  pathogenic  virus  assays  (e.g.  Gregory  et  al.  2011,  Love  et  al  2014),  pathogenic  bacteria  assays  (e.g.  Lu  et  al.  2012),  and  molecular  indicator  methods  targeting  functional  genes  and  fecal  indicator  bacteria  (e.g.  Johnston  et  al.  2010,  Converse  et  al  2012).    The  microbiology  department  at  

SCCWRP  has  developed  digital  PCR  assays  for  Enterococcus  and  a  human-­‐specific  Bacteroides  marker  (HF183)  and  applied  them  to  water  quality  analysis  in  the  Bight  Monitoring  Program  (Cao  et  al.  2015).    In  addition,  SCCWRP  is  in  the  process  of  adapting  human  adenovirus,  human  norovirus,  murine  norovirus,  and  coliphage  MS2  to  digital  PCR  (Cao  et  al.  in  prep,  Steele  et  al  2015,  in  prep).    The  proposed  research  would  add  another  tool  to  the  cultivation  independent  source  identification  toolbox  and  provide  a  rapid  viral  indicator  that  can  be  used  for  source  identification.      In  collaboration  with  other  groups  at  UCI  and  USC,  the  Martiny  lab  manages  a  time-­‐series  MiCRO  (Microbes  In  the  Coastal  Region  of  Orange  County)  at  Newport  Pier  (Allison  et  al.,  2012).  This  time-­‐series  is  located  in  conjunction  with  a  SCCOOS  automatic  shore  station  and  includes  continuous  measurements  of  salinity,  temperature  and  chlorophyll  as  well  as  weekly  samples  of  dissolved  and  organic  nutrients,  bacterial  and  phytoplankton  counts  using  flow  cytometry,  DNA  measurements  of  bacterial  diversity  and  various  extra  cellular  enzyme  activites.  The  Martiny  lab  also  examines  the  molecular  analyzes  of  bacterial  diversity  in  the  broader  region  of  Orange  County  and  have  a  large  collection  of  DNA  samples  that  can  be  used  in  this  project.  The  Martiny  lab  also  has  ample  experience  with  complex  molecular  analyses  and  harbors  extensive  equipment  for  the  proposed  work.    Coliphage  plaque  assays  have  been  a  part  of  EPA  standard  methods  1601  and  1602  for  recreational  water  quality  for  over  a  decade  (EPA  2001a,b)  and  have  been  found  to  be  useful  indicators  of  viruses  in  environmental  waters  (LeClerc  2000).  The  US  Environmental  Protection  Agency  has  recently  announced  that  it  is  reviewing  F+RNA  coliphage  (including  direct  quantification  via  RT-­‐QPCR)    as  a  fecal  viral  indicator  of  water  quality  and  will  incorporate  coliphage  assays  into  the  new  water  quality  criteria  (EPA  2015).  Earlier  genotyping  work  was  performed  on  cultivated  coliphage  plaques  as  a  secondary  identification  step  (Hsu  et  al.,  1995;  Beekwilder  et  al.,  1996;;  Vinje  et  al.,  2004).  Further  genotyping  work  has  shown  that  genogroups  I  and  IV  are  more  associated  with  non-­‐human  E.coli    sources,  i.e.  animal  fecal  material,  and  genogroups  II  and  III  are  more  often  associated  with  human  E.  coli  sources  i.e.  fecal  material  (Cole et al., 2003; Long et al., 2005; Stewart-Pullaro et al., 2006).    Direct  quantification  of  the  coliphage  genogroups  without  cultivation  has  been  developed  to  get  around  limitations  of  cultivation  methods  and  to  compare  coliphage  indicators  to  pathogenic  virus  measurements  through  methods  such  as  RT-­‐PCR  line  blots  (Love  et  al.  2008)  or  RT-­‐QPCR  (Kirs and Smith, 2007; Ogorzaly and Gantzer, 2006, Orgozaly et al. 2009 Wolf et al., 2008, 2010, Flannery et al. 2013, Paar III et al. 2015, Vergara et al. 2015).    US  EPA  has  also  developed  assays  to  identify  genogroups  I-­‐IV  from  both  cultivated  F+RNA  coliphage  (Friedman  et  al.  2009,  2011)  and  directly  quantifying  them  from  environmental  RT-­‐QPCR  (Paar  III  et  al.  2015)  as  well.  However,  these  molecular  assays  have  rarely  been  applied  to  in  California  coastal  waters  and  only  a  few  have  been  applied  to  California  estuaries  and  watersheds.  The  proposed  work  will  not  only  adapt  the  method  to  a  new  molecular  technology,  but  will  also  be  the  first  to  apply  these  molecular  methods  widely  to  Southern  California  stormwater  and  coastal  waters.      

BUDGET-RELATED INFORMATION:

A. Budget Explanation/Detailed Justification $109,869  is  requested  ($59,463  Federal  and  $50,406  matching)  for  the  first  year  and  $109,778  is  requested  ($59,210  Federal  and  $50,568  matching)  for  the  second  year  to  perform  the  proposed  research.      SEA  GRANT  TRAINEE  One  Sea  Grant  Trainee  is  requested  for  the  2-­‐year  duration  of  the  proposed  research  for  9  months  at  50%  time  (4.5  months)  each  year.  The  Sea  Grant  Trainee  will  be  a  graduate  student  at  UC  Irvine  and  is  expected  to  perform  the  bulk  of  the  lab  work  after  training  by  the  PIs  and  SCCWRP  staff,  The  Sea  Grant  Trainee  will  get  assistance  from  SCCWRP  staff  and  the  Principal  and  Associate  Investigators  in  planning,  sample  collection,  processing,  data  analysis  and  manuscript  preparation.    Southern  California  Coastal  Water  Research  Project  Budget  Justification    SALARIES  AND  WAGES  Salary  support  is  requested  for  Dr.  Joshua  Steele.  As  the  PI,  Dr.  Steele  will  be  responsible  for  project  planning  and  management  of  the  study.  Also,  Dr.  Steele  will  oversee  data  analysis  and  publications  along  with  the  mentoring  of  the  Sea  Grant  Trainee.  Dr.  Steele  will  spend  one  month  annually  on  this  study  at  a  starting  base  salary  of  78,960.  Salary  support  is  also  requested  for  Dr.  John  Griffith  who  will  be  responsible  for  project  planning,  mentoring  the  Sea  Grant  Trainee,  contribution  to  data  analysis  and  manuscript  preparation.  Dr.  Griffith  will  spend  two  weeks  annually  on  the  study  at  a  starting  base  salary  of  $124,848.  Salary  equivalent  to  2.25  months  annually  for  lab  technicians  to  collect  samples  is  also  included.      EMPLOYEE  BENEFITS  Fringe  benefits  for  SCCWRP  employees  are  calculated  at  52.2%  of  the  base  salary  rate.    MATERIAL  AND  SUPPLIES  Materials  and  supplies  are  requested  at  $26,000  for  year  1  ($18000  Federal  and  $8000  match)  and  $20,000  ($15000  Federal  and  $5000  match)  in  year  2.  This  includes  $12,000  in  ddPCR,  QPCR,  and  reverse  transcriptase  reagents  and  supplies,  primers  and  fluorescent  Taqman  probes,  $8000  in  sample  collection  and  filtration  supplies,  $2000  for  coliphage  cultivation  positive  controls,  E.coli  hosts,  and  media,  and  $4000  for  dedicated  pipets  for  RNA-­‐work,  and  lab  expendables  such  as  pipet  tips,  DNAse  and  RNAse-­‐free  water,  lo-­‐bind  tubes  for  nucleic  acid  storage.    

 TRAVEL  Travel  support  is  requested  at  $6000  ($3000  Federal  $3000  match)  in  year  one  and  $4000  ($3000  Federal;  $1000  match  in  year  two)  for  sample  collection  at  potentially  contaminated  beaches  as  outlined  in  the  methods,  this  will  allow  for  mulitple  collection  

trips  to  6  southern  California  beaches  (Malibu,  Avalon,  Inner  Cabrillo  Beach,  Doheny  State  Beach,  San  Diego)  and  transportation  of  the  samples  back  to  the  lab  at  UC  Irvine  or  SCCWRP  on  ice  (if  live)  or  on  dry  ice  (if  captured  on  filters  or  concentrated).  The  average  travel  cost  per  collection  trip  is  $584,  including  gas,  vehicle  use  fees  or  rentals,  ice,  coolers,  dry  ice,  and  food  costs  for  the  sampling  trip.  Annual  travel  support  is  requested  for  the  PI  to  travel  to  a  national  meeting  (e.g.  ASM)  to  present  the  results  from  the  project.  The  projected  costs  for  the  meeting  are  $1500  for  each  meeting  (~$400  flight,  ~$500  registration,  $400  hotel  and  $200  for  meals).    PUBLICATION  COSTS  Costs  for  page  fees,  figure  fees  and  open  access  publications  are  requested  ($0  federal,  $3000  match).      INDIRECT  COSTS  Indirect  costs  are  calculated  using  SCCWRP’s  federally  approved  indirect  rate  of  86.94%  exclusively  on  wages  and  benefits  only.    No  indirect  costs  are  added  to  supplies  or  travel  funds.  

University  of  California  Irvine  Budget  Justification    SALARIES  AND  WAGES  Two  weeks  of   summer  salary   is   requested   for  PI  Adam  Martiny  each  year.  He  will  be  responsible  for  project  planning,  mentoring  the  graduate  student,  contribute  to  the  data  analysis,   and   writing   the   papers.   Actual   salary   rate   was   used.     A   2%   cost   of   living  increase  was  applied   to  each  period  of   this  proposal  as  well  as  an  8%  merit   increase,  where  applicable.    EMPLOYEE  BENEFITS  The  composite  benefit  rate  for  PI  Adam  Martiny  is  12.7%.  The  composite  benefit  rates  are  agreed  upon  by  the  University  of  California  and  the  UC  Office  of  the  President.    TRAVEL  Annual   travel   support   is   requested   for   the   PI   and   graduate   student   to   travel   to   a  national  meeting  (e.g.,  Ocean  Sciences  or  ASM)  to  present  the  results  from  the  project.  The  projected  costs  are  $1500  for  each  meeting  (~$400  flight,  ~$500  registration,  $400  hotel  and  $200  for  meals).    INDIRECT  COSTS  Facilities  and  Administrative  costs  were  estimated   in  accordance  with  UCI’s  approved  indirect   cost   rate   agreement.  The  54.5%   indirect   cost   rate   effective  7/1/11  was  used  based   on   the   nature   of   the   work   proposed.   UCI’s   indirect   cost   rate   agreement   was  approved  by  DHHS,  the  Federal  Cognizant  Audit  Agency  for  UCI  on  4/27/11.  

B. Matching Funds

SCCWRP  will  match  $50,406  in  the  first  year  and    $50,568  in  the  second  year  of  the  proposed  research.    The  match  will  come  from  internal  funding  for  adapting  the  F+RNA  coliphage  digital  RT-­‐QPCR  Assay  ($40,000)  this  will  be  used  for  salary,  benefits,  travel,  sample  collection  and  processing,  and  supplies.    In  addition,  $60,974  in  sample  collection,  processing,  nucleic  acid  extraction,  lab  supplies,  travel,  and  in  kind  salary  will  be  matched  from  three  ongoing  grants  as  follows:  $20,000  from  the  Wet  Weather  Epidemiology  grant  from  the  City  and  County  of  San  Diego  to  SCCWRP  and  it  has  extensive  field  research  in  San  Diego  County.    $25,000  will  be  used  from  the  Inner  Cabrillo  Beach  QMRA  Study  and  $10,974  will  be  used  from  the  Automated  Digital  PCR  study  which  are  California  State  Clean  Beach  Initiative  Grants  and  have  extensive  field  research  and  sampling  components.  Adding  extra  sample  collection  and  processing    in  support  of  this  project  will  help  .  While  not  exclusively  used  for  this  project,  and  thus  not  included  in  matching,  we  note  that  this  project  is  possible  due  to  the  droplet  digital  PCR  machine,  PCR-­‐clean  hoods,  and  biosafety  cabinets  in  the  laboratories  at  SCCWRP.  

ANTICIPATED BENEFITS: This  rapid,  sensitive  detection  of  fecal  indicator  viruses  will  further  efforts  by  EPA  to  develop  coliphage  as  a  water  quality  indicator  for  microbial  monitoring,  used  as  a  source  tracking  tool  by  marine  beach  managers  and  water  quality  regulators,  and  should  also  inform  stormwater  agencies  and  sanitation  agencies  trying  to  prioritize  infrastructure  maintenance  along  heavily  developed  and  populated  beaches.  This  project  will  also  serve  as  a  West  Coast  case  study  for  EPA’s  efforts  to  develop  criteria  for  ambient  water  quality  standards  using  coliphage.  We  note  that  epidemiology  studies  done  at  Doheny  State  Beach,  Avalon,  Malibu,  Ocean  Beach  and  Tourmaline  Surfing  Park  will  also  provide  a  link  to  beachgoer  health  and  a  broader  context  for  these  results  that  will  interest  public  health  agencies.  Visitors  to  the  beaches,  surfers,  and  swimmers  will  also  benefit  from  a  greater  understanding  of  the  beach  water  quality.  Environmental  advocacy  and  citizen  science  groups  such  as  the  Surfrider  Foundation  (see  attached  letter  from    CEO  Chad  Nelsen)  will  also  benefit  from  the  assay  and  source  tracking  results.  The  droplet  digital  RT-­‐PCR  protocols  will  be  available  for  academic  institutions,  private,  and  public  environmental  research  in  water  quality.  SCCWRP  will  also  provide  training  in  the  capture,  extraction,  and  molecular  quantification  of  F+RNA  coliphage  using  ddPCR    to  academic  and  public  environmental  labs.  The  research  will  provide  support  and  training  in  environmental  microbiological  research  and  cutting  edge  molecular  analyses  for  a  graduate  student  (Sea  Grant  Traineeship)  at  UC  Irvine  advised  by  A.  Martiny;  and  will  also  provide  research  support  for  an  early  career  scientist  (J.  Steele).      

COMMUNICATION OF RESULTS:

The  new  OCEANS  Initiative  at  UC  Irvine  lead  by  PI  Martiny  has  a  mission  to  promote  interdisciplinary  research  to  understand  and  improve  California  ocean  health.  It  will  provide  a  platform  to  inform  and  educate  the  public  in  Southern  California  and  communicate  with  the  broader  scientific  community.    SCCWRP  can  communicate  this  information  directly  to  decision  makers  in  California,  and  is  a  leader  in  implementing  new  technologies  and  scientific  methods  for  microbial  beach  water  quality.  This  research  will  be  presented  to  the  SCCWRP  Commission  and  Commission  Technical  Advisory  Group  with  members  from  the  Southern  California  Wastewater  and  Stormwater  Agencies,  the  State  and  Southern  California  Regional  Water  Resources  Agencies,  the  California  Ocean  Protection  Council  and  California  Ocean  Science  Trust,  EPA  Region  IX.  Co-­‐PIs,  Associate  Investigator,  and  the  Sea  Grant  Trainee  will  have  opportunities  to  address  the  State  Water  Resources  Control  Board  Beach  Water  Quality  Working  Group  and  the  Surfrider  Foundation.  The  trainee  and  Co-­‐PIs  will  also  be  encouraged  to  communicate  with  the  EPA  and  stormwater,  sanitation,  and  environmental  agencies  outside  of  California  through  such  venues  as  the  UNC  Water  Microbiology  Conference.     REFERENCES: Allison,  SD,  Chao,  Y,  Farrara,  JD,  Hatosy,  SM  and  AC  Martiny.  Fine-­‐scale  temporal  variation  in  marine  ectoenzymes  of  coastal  southern  California.  Front.  Microbio.  2012.    Beekwilder,  J.,  Nieuwenhuizen,  R.,  Havelaar,  A.H.,  vanDuin,  J.,  1996.  An  oligonucleotide  hybridization  assay  for  the  identification  and  enumeration  of  F-­‐specific  RNA  phages  in  surface  water.  J.  Appl.  Bacteriol.  80  (2),  179–186.    

Boehm,  A.B.,  Fuhrman,  J.A.,  Mrse,  R.D.,  Grant,  S.B.,  2003.  A  tiered  approach  for  the  identification  of  a  human  fecal  pollution  source  at  a  recreational  beach:  Case  study  at  Avalon  Bay,  Catalina  Island,  California.  Environmental  Science  and  Technology  37,  673e680.    

Boehm,  A.B.,  Van  De  Werfhorst,  L.C.,  Griffith,  J.F.,  Holden,  P.A.,  Jay,  J.A.,  Shanks,  O.C.,  Wang,  D.,  Weisberg,  S.B.,  2013.  Performance  of  forty-­‐one  microbial  source  tracking  methods:  A  twenty-­‐seven  lab  evaluation  study.  Water  Research  47:  6812–6828.    

Cao,  Y.,  Raith,  M.R.,  J.F.  Griffith.    2015.    Droplet  digital  PCR  for  simultaneous  quantification  of  general  and  human-­‐associated  fecal  indicators  for  water  quality  assessment.  Water  Research  70:337-­‐349    Cole,  D.,  Long,  S.C.,  Sobsey,  M.D.,  2003.  Evaluation  of  F+  RNA  and  DNA  coliphages  as  source-­‐specific  indicators  of  fecal  contamination  in  surface  waters.  Appl.  Environ.  Microbiol.  69  (11),  6507–6514.    

Colford  Jr.,  J.M.,  Wade,  T.J.,  Schiff,  K.C.,  Wright,  C.C.,  Griffith,  J.G.,  Sandhu,  S.K.,  Burns,  S.,  Hayes,  J.,  Sobsey,  M.,  Lovelace,  G.,  Weisberg,  S.B.,  2007.  Water  quality  indicators  and  the  risk  of  illness  at  non-­‐point  source  beaches  in  Mission  Bay,  California.  Epidemiology  18,  27e35.    

Conn,  K.E.,  Habteselassie,  M.Y.,  Denene  Blackwood,  A.,  Noble,  R.T.,  2012.  Microbial  water  quality  before  and  after  the  repair  of  a  failing  onsite  wastewater  treatment  system  adjacent  to  coastal  waters.  Journal  of  Applied  Microbiology  112  (1),  214–224.    Converse,  R.R.,  Griffith,  J.F.,  Noble,  R.T.,  Haugland,  R.A.,  Schiff,  K.C.,  and  S.B.  Weisberg.    2012.    Correlation  between    quantitative  PCR  and  culture-­‐based  methods  for  measuring  Enterococcus  spp.  over  various  temporal  scales  at    three  California  marine  beaches.    Applied  and  Environmental  Microbiology  78:  1237-­‐1242    Ebdon,  J.;  Muniesa,  M.;  Taylor,  H.  The  application  of  a  recently  isolated  strain  of  Bacteroides  (GB-­‐124)  to  identify  human  sources  of  faecal  pollution  in  a  temperate  river  catchment.  Water  Res.  2007,  41  (16),  3683−3690.    

Flannery  J,  Keaveney  S,  Rajko-­‐Nenow  P,  O'Flaherty  V,  Doré  W  (2013)  Norovirus  and  FRNA  bacteriophage  determined  by  RT-­‐qPCR  and  infectious  FRNA  bacteriophage  in  wastewater  and  oysters.  Water  Res  47:5222–5231    Friedman  SD,  Cooper  EM,  Casanova  L,  Sobsey  MD,  Genthner  FJ  (2009)  A  reverse  transcription-­‐PCR  assay  to  distinguish  the  four  genogroups  of  male-­‐specific  (F+)  RNA  coliphages.  J  Virol  Meth  159:47–52    Friedman  SD,  Cooper  EM,  Calci  KR,  Genthner  FJ  (2011)  Design  and  assessment  of  a  real  time  reverse  transcription-­‐PCR  method  to  genotype  single-­‐stranded  RNA  male-­‐specific  coliphages  (Family  Leviviridae).  J  Virol  Meth  173:196–202    Fuhrman,  J.A.,  Liang,  X.L.,  Noble,  R.T.,  2005.  Rapid  detection  of  enteroviruses  in  small  volumes  of  natural  waters  by  real-­‐time  quantitative  reverse  transcriptase  PCR.  Applied  and  Environmental  Microbiology  71  (8),  4523e4530.    

Griffith,  J.F.,  Weisberg,  S.B.,  Arnold,  B.F.,  Cao,  y.,  Schiff,  K.C.,  and  Colford,  J.M.  submitted  Epidemiologic  evaluation  of  alternate  microbial  water  quality  indicators  at  three  California  Beaches.  Water  Research    Harwood  VJ,  Boehm  AB,  Sassoubre  LM,  Vijayavel  K,  Stewart  JR,  Fong  T-­‐T,  Caprais  M-­‐P,  Converse  RR,  Diston  D,  Ebdon  J,  Fuhrman  JA,  Gourmelon  M,  Gentry-­‐Shields  J,  Griffith  JF,  Kashian  DR,  Noble  RT,  Taylor  H,  Wicki  M  (2013)  Performance  of  viruses  and  bacteriophages  for  fecal  source  determination  in  a  multi-­‐laboratory,  comparative  study.  Water  Res  47:6929–6943    Hsu,  F.C.,  Shieh,  Y.S.C.,  Vanduin,  J.,  Beekwilder,  M.J.,  Sobsey,  M.D.,  1995.  Genotyping  male-­‐  specific  RNA  coliphages  by  hybridization  with  oligonucleotide  probes.  Appl.  Environ.  Microbiol.  61  (11),  3960–3966.    

Ikner,  L.A.,  Soto-­‐Beltran,  M.,  Bright,  K.R.,  (2011).  New  method  using  a  positively  charged  microporous  filter  and  ultrafiltration  for  concentration  of  viruses  from  tap  water.  Applied  and  Environmental  Microbiology  77  (10),  3500–3506.    Jiang  SC,  Chu  W  (2004)  PCR  detection  of  pathogenic  viruses  in  southern  California  urban  rivers.  J  Appl  Microbiol  97:17–28    Jiang,  S.C.,  Noble,  R.,  Chui,  W.P.,  2001.  Human  adenoviruses  and  coliphages  in  urban  runoff  impacted  coastal  waters  of  Southern  California.  Applied  and  Environmental  Microbiology  67,  179-­‐184.      Johnston  C,  Ufnar  JA,  Griffith  JF,  Gooch  JA,  Stewart  JR  (2010)  A  real-­‐time  qPCR  assay  for  the  detection  of  the  nifH  gene  of  Methanobrevibacter  smithii,  a  potential  indicator  of  sewage  pollution.  J  Appl  Microbiol  109:1946–1956    Katayama,  H.H.,  Shimasaki,  A.A.,  Ohgaki,  S.S.,  (2002).  Development  of  a  virus  concentration  method  and  its  application  to  detection  of  enterovirus  and  norwalk  virus  from  coastal  seawater.  Applied  and  Environmental  Microbiology  68  (3),  1033–1039.    Kirs  M,  Smith  DC  (2007)  Multiplex  Quantitative  Real-­‐Time  Reverse  Transcriptase  PCR  for  F+-­‐Specific  RNA  Coliphages:  a  Method  for  Use  in  Microbial  Source  Tracking.  Applied  and  Environmental  Microbiology  73:808–814    Leclerc,  H.,  Edberg,  S.,  Pierzo,  V.,  Delattre,  J.M.,  2000.  Bacteriophages  as  indicators  of  enter-­‐  ic  viruses  and  public  health  risk  in  groundwaters.  J.  Appl.  Microbiol.  88  (1),  5–21.    

Li,  D.,  Shi,  H.-­‐C.,  Jiang,  S.C.,  (2010).  Concentration  of  viruses  from  environmental  waters  using  nanoalumina  fiber  filters.  Journal  of  Microbiological  Methods  81  (1),  33–38.    Long,  S.C.,  El-­‐Khoury,  S.S.,  Oudejans,  S.J.G.,  Sobsey,  M.D.,  Vinje,  J.,  2005.  Assessment  of  sources  and  diversity  of  male-­‐specific  coliphages  for  source  tracking.  Environ.  Eng.  Sci.  22  (3),  367–377.    

Love  DC,  Vinje  J,  Khalil  SM,  Murphy  J,  Lovelace  GL,  Sobsey  MD  (2008)  Evaluation  of  RT-­‐PCR  and  reverse  line  blot  hybridization  for  detection  and  genotyping  F+  RNA  coliphages  from  estuarine  waters  and  molluscan  shellfish.  J  Appl  Microbiol  104:1203–1212    Love  DC,  Rodríguez  RA,  Gibbons  CD,  Griffith  JF,  Yu  Q,  Stewart  JR,  Sobsey  MD  (2014)  Human  viruses  and  viral  indicators  in  marine  water  at  two  recreational  beaches  in  Southern  California,  USA.  Journal  of  Water  and  Health  12:136–16    Lu  J,  Ryu  H,  Domingo  JWS,  Griffith  JF,  Ashbolt  N  (2011)  Molecular  Detection  of  Campylobacter  spp.  in  California  Gull  (Larus  californicus)  Excreta.  Applied  and  Environmental  Microbiology  77:5034–5039    

McMinn  BR,  Korajkic  A,  Ashbolt  NJ  (2014)  Evaluation  of  Bacteroides  fragilis  GB-­‐124  bacteriophages  as  novel  human-­‐associated  faecal  indicators  in  the  United  States.  Lett  Appl  Microbiol  59:115–121    McQuaig,  S.,  Griffith,  J.F.  and  V.J.  Harwood.    2012.    Association  of  fecal  indicator  bacteria  with  human  viruses  and     microbial  source  tracking  markers  at  coastal  beaches  impacted  by  nonpoint  source  pollution.    Applied  and     Environmental  Microbiology  78:6423-­‐6432    Muniesa,  M.;  Lucena,  F.;  Blanch,  A.  R.;  Payan,  A.;  Jofre,  J.  Use  of  abundance  ratios  of  somatic  coliphages  and  bacteriophages  of  Bacteroides  thetaiotaomicron  GA17  for  microbial  source  identification.  Water  Res.  2012,  46  (19),  6410−6418.    

Noble,  R.T.,  Fuhrman,  J.A.,  2001.  Enteroviruses  detected  by  reverse  transcriptase  polymerase  chain  reaction  from  the  coastal  waters  of  Santa  Monica  Bay,  California:  low  correlation  to  bacterial  indicator  levels.  Hydrobiologia  460,  175e184.    

Noble,  R.T.,  Allen,  S.M.,  Blackwood,  A.D.,  Chu,  W.,  Jiang,  S.C.,  Lovelace,  G.L.,  Sobsey,  M.D.,  Stewart,  J.R.,  Wait,  D.A.,  2003.  Use  of  viral  pathogens  and  indicators  to  differentiate  between  human  and  non-­‐human  fecal  contamination  in  a  microbial  source  tracking  comparison  study.  Journal  of  Water  and  Health  1  (4),  195e207.    

Ogorzaly  L,  Gantzer  C  (2006)  Development  of  real-­‐time  RT-­‐PCR  methods  for  specific  detection  of  F-­‐specific  RNA  bacteriophage  genogroups:  Application  to  urban  raw  wastewater.  J  Virol  Meth  138:131–139  

Ogorzaly  L,  Tissier  A,  Bertrand  I,  Maul  A,  Gantzer  C  (2009)  Relationship  between  F-­‐specific  RNA  phage  genogroups,  faecal  pollution  indicators  and  human  adenoviruses  in  river  water.  Water  Res  43:1257–1264  

Paar  J  III,  Doolittle  MM,  Varma  M,  Siefring  S,  Oshima  K,  Haugland  RA  (2015)  Development  and  evaluation  of  a  culture-­‐independent  method  for  source  determination  of  fecal  wastes  in  surface  and  storm  waters  using  reverse  transcriptase-­‐PCR  detection  of  FRNA  coliphage  genogroup  gene  sequences.  Journal  of  Microbiological  Methods  112:28–35  

Soller  JA,  Schoen  ME,  Bartrand  T,  Ravenscroft  JE,  Ashbolt  NJ  (2010)  Estimated  human  health  risks  from  exposure  to  recreational  waters  impacted  by  human  and  non-­‐human  sources  of  faecal  contamination.  Water  Research  44:4674–4691  

Soller  JA,  Schoen  ME,  Varghese  A,  Ichida  AM,  Boehm  AB,  Eftim  S,  Ashbolt  NJ,  Ravenscroft  JE  (2014)  Human  health  Risk  implications  of  multiple  sources  of  faecal  indicator  bacteria  in  a  recreational  waterbody.  Water  Research:1–35  

Stachler  E,  Bibby  K  (2014)  Metagenomic  Evaluation  of  the  Highly  Abundant  Human  Gut  Bacteriophage  CrAssphage  for  Source  Tracking  of  Human  Fecal  Pollution.  Environ  Sci  Technol  Lett  1:405–409  

Steele,  J.A.,  Raith,  M.R.,  Layton,  B.A.,  Blackwood,  A.D.,  Noble,  R.  T.,  Griffith,  J.F.  2015  Comparison  of  Three  Filtration  Methods  to  Capture  Pathogenic  Viruses  and  Bacteria  from  Brackish  Storm  Water.  ASM  General  Meeting  Abstracts    Stewart-­‐Pullaro  J,  Daugomah  JW,  Chestnut  DE,  Graves  DA,  Sobsey  MD,  Scott  GI  (2006)  F  +RNA  coliphage  typing  for  microbial  source  tracking  in  surface  waters.  J  Appl  Microbiol  101:1015–1026    U.S.  Environmental  Protection  Agency,  2001.  Method  1601:  Male-­‐specific  (F+)  and  Somatic  Coliphage  in  Water  by  Two-­‐step  Enrichment  Procedure.  Office  of  Water,  EPA  EPA  821-­‐R-­‐01-­‐030.  Washington,  DC.      U.S.  Environmental  Protection  Agency,  2001.  Method  1602:  Male-­‐specific  (F+)  and  Somatic  Coliphage  in  Water  by  Single  Agar  Layer  (SAL)  Procedure.  Office  of  Water,  EPA  821-­‐R-­‐01-­‐029.  Washington,  DC.      U.S.  Environmental  Protection  Agency.  2013.  Method  1609:  Enterococci  in  Water  by  TaqMan®  Quantitative  Polymerase  Chain  Reaction  (qPCR)  with  Internal  Amplification  Control  (IAC)  Assay.  Office  of  Water,  EPA-­‐820-­‐R-­‐13-­‐005.  Washignton,  DC.    U.S.  Environmental  Protection  Agency,  2015.  Review  Of  Coliphages  As  Possible  Indicators  Of  Fecal  Contamination  For  Ambient  Water  Quality.  Office  of  Water,  EPA  820-­‐R-­‐15-­‐098  Washington,  DC.    Vinje,  J.,  Oudejans,  S.J.G.,  Stewart,  J.R.,  Sobsey,  M.D.,  Long,  S.C.,  2004.  Molecular  detection  and  genotyping  of  male-­‐specific  coliphages  by  reverse  transcription-­‐PCR  and  reverse  line  blot  hybridization.  Appl.  Environ.  Microbiol.  70  (10),  5996–6004.    

Vergara  GGRV,  Goh  SG,  Rezaeinejad  S,  Chang  SY,  Sobsey  MD,  Gin  KYH  (2015)  Evaluation  of  FRNA  coliphages  as  indicators  of  human  enteric  viruses  in  a  tropical  urban  freshwater  catchment.  Water  Res  79:39–47    Wolf  S,  Hewitt  J,  Rivera-­‐Aban  M,  Greening  GE  (2008)  Detection  and  characterization  of  F+  RNA  bacteriophages  in  water  and  shellfish:  Application  of  a  multiplex  real-­‐time  reverse  transcription  PCR.  J  Virol  Meth  149:123–128    Wolf  S,  Hewitt  J,  Greening  GE  (2010)  Viral  Multiplex  Quantitative  PCR  Assays  for  Tracking  Sources  of  Fecal  Contamination.  Applied  and  Environmental  Microbiology  76:1388–1394      

 

Projected Work Schedule Project Title: DEVELOPMENT  OF  DIGITAL  RT-­‐PCR  METHODS  TO  QUANTIFY  HUMAN-­‐ASSOCIATED  BACTERIOPHAGE  IN  STORM  WATER  AND  COASTAL  RECREATIONAL  WATERS  

Activities 2016-2017 F M A M J J A S O N D J

Adapt RT-QPCR assays to ddPCR Begin X X X X X End

Sample Collection and

Processing Begin X X X X X X X X X

F+RNA analysis on fresh and

archived samples

Begin X X X X

Data Analysis Begin X

Progress Reports X X

Presentations X X

Manuscript Preparation

Projected Work Schedule Project Title: DEVELOPMENT  OF  DIGITAL  RT-­‐PCR  METHODS  TO  QUANTIFY  HUMAN-­‐ASSOCIATED  BACTERIOPHAGE  IN  STORM  WATER  AND  COASTAL  RECREATIONAL  WATERS  

Activities 2017-2018 F M A M J J A S O N D J

Adapt RT-QPCR assays to ddPCR

Sample Collection and

Processing X X X

F+RNA analysis on fresh and

archived samples

X X X X X

Data Analysis X X X X X X X X End

Progress Reports X X

Presentations X X X X

Manuscript Preparation Begin X X

OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: Southern California Coastal Water Research Project GRANT/PROJECT NO.:

DURATION (months 12

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: 1 1.00 4,935 1,645b. Associates (Faculty or Staff): 1 0.50 1,300 3,902

Sub Total: 2 1.50 6,235 5,547

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians: 2 2.25 1,800 7,916h. Other: Sea Grant Trainee 1 4.5

Total Salaries and Wages: 5 8.25 8,035 13,463

B. FRINGE BENEFITS: 52.6% 4,226 7,082Total Personnel (A and B): 12,261 20,545

C. PERMANENT EQUIPMENT: 0 0

D. EXPENDABLE SUPPLIES AND EQUIPMENT: 18,000 8,000

E. TRAVEL:1. Domestic 3,000 1,0002. International

Total Travel: 3,000 1,000

F. PUBLICATION AND DOCUMENTATION COSTS: 3,000

G. OTHER COSTS:1 - UCI subcontractor- Co-PI Adam Martiny 15,542 0234567

Total Other Costs: 15,542 0

TOTAL DIRECT COST (A through G): 48,803 32,545

INDIRECT COST (86.94% on wages/benefits only ): 1 10,660 17,861INDIRECT COST (Off campus % of $ ):

Total Indirect Cost: 10,660 17,861

TOTAL COSTS: 59,463 50,406

PRINCIPAL INVESTIGATOR: Joshua A. Steele, Adam C. Martiny

BRIEF TITLE: Human-associated Coliphage Detection using Digital PCR in C

OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: Southern California Coastal Water Research Project GRANT/PROJECT NO.:

DURATION (months 12

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: 1 1.00 5,082 1,695b. Associates (Faculty or Staff): 1 0.50 1,340 5,358

Sub Total: 2 6,422 7,053

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians: 2 2.25 2,500 6,642h. Other: Sea Grant Trainee 1 4.5

Total Salaries and Wages: 5 6.8 8,922 13,695

B. FRINGE BENEFITS: 52.6% 4,693 7,204Total Personnel (A and B): 13,614 20,899

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT: 15,000 5,000

E. TRAVEL:1. Domestic 3,000 3,0002. International

Total Travel: 3,000 3,000

F. PUBLICATION AND DOCUMENTATION COSTS: 3,500

G. OTHER COSTS:1 - UCI subcontractor - Co PI Adam Martiny 15,760 0234567

Total Other Costs: 15,760 0

TOTAL DIRECT COST (A through G): 47,374 32,399

INDIRECT COST (86.94% on wages/benefits only ): 65% 11,836 18,169INDIRECT COST (Off campus of $ ):

Total Indirect Cost: 11,836 18,169

TOTAL COSTS: 59,210 50,568

PRINCIPAL INVESTIGATOR: Joshua A. Steele, Adam C. Martiny

BRIEF TITLE: Human-associated Coliphage Detection using Digital PCR in C

Joshua  A.  SteeleScien&st  (Microbiologist) Phone:  (714)  755-­‐3218Southern  California  Coastal  Water  Research  Project   Fax:          (714)  755-­‐3299Costa  Mesa,  California,  92626 Email:  joshuas@sccwrp.org

PROFESSIONAL  PREPARATION:  Ph.D. Biology,  University  of  Southern  California,  2010B.S. Molecular  Biology,  University  of  California,  San  Diego,  2000

PROFESSSIONAL  EXPERIENCE:2014  –  Present   Scien&st  -­‐  Southern  California  Coastal  Water  Research  Project  2013-­‐2014 Associate  Research  Scien&st  -­‐  California  Ins&tute  of  Technology,  Division  of  Geology  and  

Planetary  Sciences2010-­‐2013   Postdoctoral  Scholar  in  Geomicrobiology,  California  Ins&tute  of  Technology,  Division  of  

Geology  and  Planetary  Sciences2008-­‐2009 NOAA  Sea  Grant  Knauss  Marine  Policy  Fellow:  Legisla&ve  Assistant  for  Rep.  Sam  Farr  (CA-­‐17);  

U.S.  House  of  Representa&ves

SELECTED  PUBLICATIONS:

Steele,  J.A.,  Raith,  M.R.,  Layton,  B.A.,  Blackwood,  A.D.,  Noble,  R.  T.,  Griffith,  J.F.  2015    Comparisonof  Three  Filtra&on  Methods  to  Capture  Pathogenic  Viruses  and  Bacteria  from  Brackish  Storm  Water.  ASM  General  Mee&ng  Abstracts

Marlow  JJ,  Steele  JA,  Case  DH,  Connon  SA,  Levin  LA  and  Orphan  VJ  2014  Microbial  abundance  and  diversity  paeerns  associated  with  sediments  and  carbonates  from  the  methane  seep  environments  of  Hydrate  Ridge,  OR.  Front.  Mar.  Sci.  1:44.  doi:  10.3389/fmars.2014.00044

Marlow,  J.J.,  Steele,  J.  A.,  Ziebis,  W.,  Thurber,  A.  R.,  Levin,  L.  A.,  &  Orphan,  V.  J.  2014  Carbonate-­‐hosted  methanotrophy  represents  an  unrecognized  methane  sink  in  the  deep  sea.  Nature  Communica&ons.,  5,  5094.  doi:10.1038/ncomms6094

Cram,  J.  A.,  Chow,  C.-­‐E.  T.,  Sachdeva,  R.,  Needham,  D.  M.,  Parada,  A.  E.,  Steele,  J.  A.,  &  Fuhrman,  J.  A.  2014.  Seasonal  and  interannual  variability  of  the  marine  bacterioplankton  community  throughout  the  water  column  over  ten  years.  Isme  Journal..  doi:10.1038/ismej.2014.153

Glass,  J.B.,  H.  Yu,  J.A.  Steele,  K.S.  Dawson,  S.  Sun,  K.Chourey,  R.L.  Hekch,  V.J.  Orphan.  2014  Geochemical,  metagenomic  and  metaproteomic  insights  into  trace  metal  u&liza&on  of  methane-­‐oxidizing  microbial  consor&a  in  sulfidic  marine  sediments.  Environmental  Microbiology  16(6),  1592–1611.  doi:10.1111/1462-­‐2920.12314

Hatosy,  S.M.,  J.B.H.  Mar&ny,  R.  Sachdeva,  J.  Steele,  J.A.  Fuhrman,  A.C.  Mar&ny  2013  Beta-­‐diversity  of  marine  bacteria  depends  on  temporal  scale.  Ecology  94  (9),  1898-­‐1904

Chow,  C.E.T.,  R.  Sachdeva,  J.A.  Cram,  J.A.  Steele,  D.M.  Needham,  A.  Patel,  A.E.  Parada,  J.A.  Fuhrman  In  press.  Temporal  variability  and  coherence  of  eupho&c  zone  bacterial  communi&es  over  a  decade  in  the  Southern  California  Bight  ISME  Journal  7,  2259–2273;  doi:10.1038/ismej.2013.122

Tavormina,  P.L.,  W.  Ussler  III,  J.A.  Steele,  S.A.  Connon,  M.G.  Klotz,  V.  J.  Orphan.  2013.  Depth  distribu&on  of  Cu-­‐MMO  variants  through  the  oxygen  minimum  zone  along  the  Costa  Rica  convergent  margin.  Environmental  Microbiology  Reports  5  (3),  414-­‐423

Gilbert,  J.A.,  J.A.  Steele,  J.G.  Caporaso,  L.  Steinbrück,  P.  Somerfield,  J.  Reeder,  B.  Temperton,  S.  Huse,  I.  Joint,  A.C.  McHardy,  R.  Knight,  J.A.  Fuhrman,  D.  Field.  2012  Defining  seasonal  marine  microbial  community  dynamics.  ISME  Journal  6:298-­‐308.

Steele,  J.A.,  P.D.  Countway,  L.  Xia,  P.  D.  Vigil,  J.M.  Beman,  D.Y.  Kim,  C.  T.  Chow,  R.  Sachdeva,  A.C.  Jones,  M.S.  Schwalbach,  J.  M.  Rose,  I.  Hewson,  A.  Patel,  F.  Sun,  D.A.  Caron,  J.A.  Fuhrman.  2011  Marine  bacterial,  archaeal,  and  pro&stan  associa&on  networks  reveal  ecological  linkages  ISME  Journal  5:1414-­‐1425.

Xia,  L.  C.,  J.A.  Steele,  J.  Cram,  Z.G.  Cardon,  S.L.  Simmons,  J.J.  Vallino  ,  J.A.  Fuhrman,  F.  Sun  2011.  Extended  local  similarity  analysis  (eLSA)  of  microbial  community  and  other  &me  series  data  with  replicates.  BMC  Systems  

Biology  5:S15.Beman,  J.M.,  J.A.  Steele,  and  J.A.  Fuhrman.  2011  Co-­‐occurrence  paeerns  for  abundant  marine  archaeal  and  bacterial  

lineages  in  the  deep  chlorophyll  maximum  of  coastal  California.  ISME  Journal  5:1077-­‐1085.

Fuhrman  J.A.,  J.A.  Steele.  2008  Community  Structure  of  Marine  Bacterioplankton:  Paeerns,  Networks,  and  Rela&onships  to  Func&on.  Aqua&c  Microbial  Ecology  53:69-­‐81.

Fuhrman,  J.A.,  J.A.  Steele,  I.  Hewson,  M.  S.  Schwalbach,  M.V.  Brown,  J.  Green,  Brown,  J.H.  2008  A  La&tude  Diversity  Gradient  in  Planktonic  Marine  Bacteria.  Proceedings  of  the  Na&onal  Academy  of  Sciences  105:7774-­‐7778.

Patel,  A.,  R.  Noble,  J.A.  Steele,  M.S.  Schwalbach,  I.  Hewson,  J.A.  Fuhrman  2007  Virus  and  Prokaryote  Enumera&on  from  Planktonic  Marine  Environments  by  Epifluorescence  Microscopy  with  SYBR  Green  I.  Nature  Protocols  2:269-­‐276.

Ruan,  Q.,  D.  Duea,  M.S.  Schwalbach,  J.A.  Steele,  J.A.  Fuhrman,  F.  Sun  2006  Local  Similarity  Analysis  Reveals  Unique  Associa&ons  Among  Marine  Bacterioplankton  Species  and  Environmental  Factors.  Bioinforma&cs  22:  2532-­‐2538.

Fuhrman,  J.  A.,  Hewson,  I.,  Schwalbach,  M.  S.,  Steele,  J.  A.,  Brown,  M.  V.,  &  Naeem,  S.  2006.  Annually  reoccurring  bacterial  communi&es  are  predictable  from  ocean  condi&ons.  Proceedings  of  the  Na&onal  Academy  of  Sciences,  103(35):  13104–13109.

Ruan,  Q.,  Steele,  J.  A.,  Schwalbach,  M.  S.,  Fuhrman,  J.  A.,  &  Sun,  F.  2006.  A  dynamic  programming  algorithm  for  binning  microbial  community  profiles.  Bioinforma&cs,  22(12),  1508–1514.

Hewson,  I.,  D.G.  Capone,  J.  A.  Steele,  J.A.  Fuhrman.  2006  Influence  of  Amazon  and  Orinoco  Offshore  Surface  Water  Plumes  on  Oligotrophic  Bacterioplankton  Diversity  in  the  West  Tropical  Atlan&c.  Aqua&c  Microbial  Ecology  43:11-­‐22.

Hewson,  I,  J.A.  Steele,  D.G.  Capone,  J.A.  Fuhrman.  2006  Remarkable  Heterogeneity  in  Meso-­‐  and  Bathypelagic  Bacterioplankton  Community  Composi&on.  Limnol.  Oceanography  51:1274-­‐1283.

Hewson,  I,  J.A.  Steele,  D.G.  Capone,  J.A.  Fuhrman.  2006  Temporal  and  Spa&al  Scales  of  Oligotrophic  Surface  Water  Bacterioplankton  Assemblage  Varia&on.  Marine  Ecology  Progress  Series  311:67-­‐77.

Steele,  J.A.,  F.  Ozis,  J.A.  Fuhrman,  J.S.  Devinny.  2005.  Structure  of  Microbial  Communi&es  in  Ethanol  Biofilters.  Chemical  Engineering  Journal  113:135-­‐143.

SYNERGISTIC  ACTIVITIES:-­‐Doctoral  Fellow,  NSF-­‐IGERT:  Env.  Studies,  Policy  and  Engineering-­‐  Sustainable  Ci&es  Program,  USC  (2003-­‐2004)-­‐Par&cipant  USC  Sustainable  Ci&es  Internship  in  Hong  Kong  SAR,  China  2004-­‐Sea  Grant  Trainee,  Beach  Water  Quality  Study,  2002

RECENT  COLLABORATORS:

R.  Noble  (UNC),  J.  Stewart  (UNC),  A.  Mar&ny  (UCI),  V.  Orphan  (Caltech),    L.  Levin  (UCSD),  W.  Ziebis  (USC),  J.  Fuhrman  (USC),  J.  Gilbert  (ANL/U.  Chigago),  F.  Sun  (USC)

Assoc. Prof. Adam C. Martiny University of California – Irvine Department of Earth System Science Department of Ecology and Evolutionary Biology 3208 Croul Hall, Irvine, CA 92697 http://ess.uci.edu/researchgrp/amartiny/adam-martiny-lab

Tel: (949) 824 9713 Fax: (949) 824 3874 Home: (949) 5725 636 E-mail: amartiny@uci.edu

A. Professional Preparation: Massachusetts Institute of Technology

Ocean Microbiology, Post Doctoral scholar

2003 - 06

Technical University of Denmark Environmental Microbiology Ph.D. 2003

Technical University of Denmark Chemical Engineering M.S. 2000

B. Scientific Appointments: UCI OCEANS, Director University of California – Irvine Associate Professor, Dept. of Earth System Science & Dept. of Ecology and Evolutionary Biology University of California – Irvine

2015 – current 2012 – current

Visiting Professor University of Copenhagen

2012 – 13

Assistant Professor, Dept. of Earth System Science & Dept. of Ecology and Evolutionary Biology University of California – Irvine

2006 – 12

C. Selected publications (50 total): Galbraith, E and AC Martiny. A simple nutrient-dependence mechanism for

predicting the stoichiometry of marine ecosystems. PNAS. 2015.

Mouginot, C, Zimmerman, AE, Bonachela, JA, Fredricks, H, Allison, SD Van Mooy, BAS and AC Martiny. Resource allocation by the marine cyanobacterium Synechococcus WH8102 in response to different nutrient supply ratios. Limnol. Oceanogr. 2015.

Berlemont , R and AC Martiny. Genomic potential for polysaccharides deconstruction in bacteria. Appl. Environ. Microbiol. 2015.

Johnson, ZI, and AC Martiny. New tools for quantifying phytoplankton community structure. Annu. Rev. Mar. Sci. 2015.

Batmalle, C, Chiang, HI, Zhang, K, Lomas, MW and AC Martiny. Development and bias assessment of a method for targeted metagenomic sequencing of marine Cyanobacteria. Appl. Environ. Microbiol. 2014.

Lomas, MW, Bonachela, JA, Levin, SA and AC Martiny. Impact of ocean phytoplankton diversity on phosphate uptake. PNAS. 2014.

Hatosy, SM, Martiny, JBH, Sachdeva, R, Steele, J, Fuhrman, JA, and AC Martiny. Beta-diversity of marine bacteria depends on temporal scale. Ecology. 2013.

Flombaum, P, Gallegos, JL, Gordillo, RA, Rincón, J, Zabala, LL, Jiao, N, Karl, DM, Li, WKW, Lomas, MW, Veneziano, D, Vera, CS, Vrugt, JA, and AC Martiny. Present and future global distributions of the marine Cyanobacteria Prochlorococcus and Synechococcus. PNAS. 2013.

Allison, SD, Chao, Y, Farrara, JD, Hatosy, SM and AC Martiny. Fine-scale temporal variation in marine ectoenzymes of coastal southern California. Front. Microbio. 2012.

Rusch, D.B., Martiny, A.C., Dupont, C.L., Halpern, A.L., and J.C. Venter. Characterization of Prochlorococcus clades from iron depleted oceanic regions. PNAS 107:16184-89. 2010.

Martiny, AC, Kathuria, SK, and P Berube. Widespread metabolic potential for nitrite and nitrate assimilation among Prochlorococcus ecotypes. PNAS. 2009.

Kettler, G, Martiny, AC, Huang, K, Zucker, J, Coleman, ML, Rodrigue, S, Chen, F, Lapidus, A, Ferriera, S, Johnson, J, Steglich, C, Richardson, P, Church, GM and SW Chisholm. Patterns and implications of gene gain and loss in the evolution of Prochlorococcus. PLoS Genet. 2007.

Martiny, AC, Jørgensen, TM, Albrechtsen, HJ, Arvin, E, and S Molin. Long-term succession in structure and diversity of a biofilm formed in a model drinking water distribution system. 2003.

D. Synergistic Activities: • Founder and director of a new interdisciplinary academic initiative at UC

Irvine named UCI OCEANS. The goal of this initiative is to elevate the level and visibility of oceans-related research, strengthen connections with a local community that deeply values ocean health, recruit and engage top students at all levels. The initiative will focus on the ocean system and integrate urban-ocean couplings.

• Director of the Flow Cytometry and Cell sorting Facility for research and training at UCI

• Collaboration with Minority Science Programs for mentoring undergraduate students at UC-Irvine

• Collaboration with Orange County K-12 teachers to use art in the science curriculum

• PI for Gateway program for Community College students in Orange County. The program provides research opportunities for underrepresented students.

E. Graduate and Postdoctoral Advisors: Søren Molin, DTU, Hans-Jørgen Albrechtsen, DTU, Erik Arvin, DTU Sallie Chisholm, MIT F. Ph.D. Thesis Advisor (6 total) and Postgraduate-Scholar Sponsor (5 total): Grad Students: Chau Pham, Cecilia Batmalle Georgia Tech, Alyssa Kent UCI, Stephen Hatosy UCI, Allison Moreno UCI, Catherine Garcia UCI. Post docs: Pedro Flombaum CLIMA, Renaud Berlemont, CSULB, Agathe Talarmin KAUST, Nathan Garcia UCI, Junhui Li UCI.

John  F.  GriffithPrincipal  Scien,stDepartment  of  Microbiology Phone:  (714)  755-­‐3228Southern  California  Coastal  Water  Research  Project   Home:  (714)  756-­‐0990Costa  Mesa,  California,  92626 Email:  johng@sccwrp.org

PROFESSIONAL  PREPARATION:  Ph.D. Biology,  University  of  Southern  California,  2006B.S. Biology  and  environmental  Studies,  University  of  Southern  California,  1995

PROFESSSIONAL  EXPERIENCE:2010  -­‐  Present Principal  Scien,st,  Microbiology,  Southern  California  Coastal  Water  Research  Project  2006  -­‐  2010 Supervising  Scien,st,  Southern  California  Coastal  Water  Research  Project2005  -­‐  2006 Senior  Scien,st,  Southern  California  Coastal  Water  Research  Project2001-­‐  2005 Microbiologist,  Southern  California  Coastal  Water  Research  Project

SELECTED    PUBLICATIONS:

Cao,  Y.,  Raith,  M.R.  and  J.F.  Griffith.    2015.    Droplet  digital  PCR  for  simultaneous  quan,fica,on  of   general  and  human-­‐associated  fecal  indicators  for  water  quality  assessment.  Water  Research  70:337-­‐349

Love,  D.C.,  Rodriguez,  R.A.,  Gibbons,  C.D.,  Griffith,  J.F.,  Stewart,  J.R.  and  M.D.Sobsey.    2014.    Human  viruses  and  viral  indicators  in  marine  water  at  two  recrea,onal  beaches  in  southern  California,  USA.  Journal  of  Water  and  Health  12:136-­‐150

Yau,  V.,  Schiff,  K.C.,  Arnold,  B.F.,  Griffith,  J.F.,  Gruber,  J.S.,  Wright,  C.C.,  Wade,  T.J.,  Burns,  S.,  hayes,  J.M.,  McGee,  C.,  Gold,  M.,  Caa,  Y.,  Boehm,  A.B.,  Weisberg,  S.B.  and  J.M.  Colford.    2014.    Effect  of  submarine  groundwater  discharge  on  bacterial  indicators  and  swimmer  health  at  Avalon  Beach,  CA,  USA.    Water  Research  59:23-­‐36

Riedel,  T.E.,  Zimmer-­‐Faust,  A.G.,  Thulsiraj,  V.,  Madi,  T.,  Hanley,  K.T.,  Eben,er,  D.L.,  Byappanahalli,  M.,  Layton,  B.,  Raith,  M.,  Boehm,  A.B.,  Griffith,  J.F.,  Holden,  P.A.,  Shanks,  O.C.,  Weisberg,  S.B.,  and  J.A.  Jay.    2014.    Detec,on  limits  and  cost  comparisons  of  human-­‐  and  gull-­‐associated  conven,onal  and  quan,ta,ve  PCR  assays  in  ar,ficial  waters.    Journal  of  Environmental  Management  136:112-­‐120

Arnold,  B.M.,  Schiff,  K.C.,  Griffith,  J.F.,  Gruber,  J.S.,  Yau,  V.,  Wright,  C.C.,  Wade,  T.J.,  Burns,  S.,  Hayes,  J.M.,  McGee,  C.,  Gold,  M.,  Cao,  Y.,  Weiseberg,  S.B.  and  J.M.  Colford.    2013.    Swimmer  illness  associated  with  marine  water  exposure  and  water  quality  indicators:  Impact  of  widely  used  assump,ons.  Epidemiology  24:845-­‐53.  doi:  10.1097/01.ede.0000434431.06765.4a

Raith,  M.,  Eben,er,  D.,  Cao,  Y.,  Griffith,  J.  and  S.  Weisberg.    2013.    Factors  affec,ng  the  rela,onship  between  quan,ta,ve  polymerase  chain  reac,on  (qPCR)  and  culture-­‐based  enumera,on  of  Enterococcus  in  environmental  waters.  Journal  of  Applied  Microbiology  116:737-­‐746.  DOI:  10.1111/jam.12383

Ryu,  H.,  Henson,  M.,  Elk,  M.,  Toledo-­‐Hernandez,  C.,  Griffith,  J.,  Blackwood,  D.,  Noble,  R.,  Gourmelon,  M.,  Glassmeyer,  S.  and  J.W.  Santo  Domingo.    2013.  Development  of  quan,ta,ve  PCR  assays  targe,ng  the  16S  rRNA  genes  of  Enterococcus  spp.  and  their  applica,on  to  the  iden,fica,on  of  Enterococcus  species  in  environmental  samples.    Applied  and  Environmental  Microbiology  79:196-­‐204

Bourlat,  S.J.,  Borja,  A.,  Gilbert,  J.,  Taylor,  M.I.,  Davies,  N.,  Weisberg,  S.B.,  Griffith,  J.F.,  Lejeri,  T.,  Field,  D.  and  J.  Benzie.    2013.    Genomics  in  marine  monitoring:  New  opportuni,es  for  assessing  marine  health  status.  Marine  Pollu,on  Bulle,n  DOI:10.1016/j.marpolbul.2013.05.042

Cao,  Y.,  Van  De  Werkorst,  L.C.,  Dubinsky,  E.A.,  Badgley,  B.D.,  Sadowsky,  M.J.,  Andersen,  G.L.,  Griffith,  J.F.  and  P.A.  Holden.    2013.    Evalua,on  of  molecular  community  analysis  methods  for  discerning  fecal  sources  and  human  waste.  Water  Research  DOI:10.1016/j.watres.2013.02.06

Harwood,  V.J.,  Boehm,  A.B.,  Sassoubre,  L.M.,  Kannappan,  V.,  Stewart,  J.R.,  Fong,  T-­‐T.,  Caprais,  M-­‐P.,  Converse,  R.R.,  Diston,  D.,  Ebdon,  J.,  Fuhrman,  J.A.,  Gourmelon,  M.,  Gentry-­‐Shields,  J.,  Griffith,  J.F.,  Kashian,  D.R.,  Noble,  R.T.,  Taylor,  H.  and  M.  Wicki.    2013.    Performance  of  viruses  and  bacteriophages  for  fecal  source  determina,on  in  a  Mul,-­‐laboratory,  compara,ve  Study.    Water  Research  DOI:10.1016/j.watres.2013.04.064

Schriewer,  A.,  Goodwin,  K.D.,  Sinigalliano,  C.D.,  Cox,  A.M.,  Wanless,  D.,  Bartkowiak,  J.,  Eben,er,  D.L.,  Hanley,  K.T.,  Ervin,  J.,  Deering,  L.A.,  Shanks,  O,  C.,  Peed,  L.A.,  Meijer,  W.G.,  Griffith,  J.F.,  Santodomingo,  J.,  Jay,  J.A.,  Holden,  P.A.  and    Stefan  Wuertz.    2013.    Performance  evalua,on  of  canine-­‐associated  Bacteroidales  assays  in  a  mul,-­‐laboratory  comparison  study.    Water  Research  DOI:10.1016/j.watres.2013.03.062

Boehm,  A.B.,  Van  De  Werkorst,  L.C.,  Griffith,  J.F.,  Holden,  P.A.,  Jay,  J.A.,  Shanks,  O.C.,  Wang,  D.  and  S.  B.  Weisberg.    2013.    Performance  of  forty-­‐one  microbial  source  tracking  methods:  a  twenty-­‐seven  lab  evalua,on  study.    Water  Research    DOI:10.1016/j.watres.2012.12.046

Cao,  Y.,  Van  De  Werkorst,  L.C.,  Scol,  E.A.,  Raith,  M.R.,  Holden,  P.A.  and  J.F.Griffith.    Bacteroidales  terminal  restric,on  fragment  length  polymorphism  (TRFLP)  for  fecal  source  differen,a,on  in  comparison  to  and  in  combina,on  with  universal  bacteria  TRFLP    Water  Research  DOI:10.1016/j.watres.2013.03.060

Layton,  B.A.,  Cao,  Y.,  Eben,er,  D.L.,  Hanley,  K.,  Ballesté,  E.,  Brandão,  J.,  Byappanahalli,  M.,  Converse,  R.,  Farnleitner,  A.H.,  Gentry-­‐Shields,  J.,  Gidley,  M.L.,  Gourmelon,  M.,  Lee,  C.S.,  Lee,  J.,  Lozach,  S.,  Madi,  T.,  Meijer,  W.G.,  Noble,  R.,  Peed,  L.,  Reischer,  G.H.,  Rodrigues,  R.,  Rose,  J.B.,  Schriewer,  A.,  Sinigalliano,  C.,  Srinivasan,  S.,  Stewart,  J.,Van  De  Werkorst,  L.C.,  Wang,  D.,  Whitman,  R.,  Wuertz,  S.,  Jay,  J.,  Holden,  P.A.,  Boehm,  A.B.,    

                           Shanks,  O.,  and  J.F.  Griffith.    2013      Performance  of  Human  Fecal  Anaerobe-­‐Associated  PCR-­‐Based  Assays  in  a                                Mul,-­‐Laboratory  Method  Evalua,on  Study  Water  Research  DOI:10.1016/j.watres.2013.05.060Converse,  R.R.,  Griffith,  J.F.,  Noble,  R.T.,  Haugland,  R.A.,  Schiff,  K.C.,  and  S.B.  Weisberg.    2012.    Correla,on  between  

quan,ta,ve  PCR  and  culture-­‐based  methods  for  measuring  Enterococcus  spp.  over  various  temporal  scales  at  three  California  marine  beaches.    Applied  and  Environmental  Microbiology  78:  1237-­‐1242

McQuaig,  S.,  Griffith,  J.F.  and  V.J.  Harwood.    2012.    Associa,on  of  fecal  indicator  bacteria  with  human  viruses  and  microbial  source  tracking  markers  at  coastal  beaches  impacted  by  nonpoint  source  pollu,on.    Applied  and  Environmental  Microbiology  78:6423-­‐6432

Dubinsky,  E.A.,  Esmaili,  L.,  Hulls,  J.R.,  Cao,Y.,  Griffith,  J.F.  and  G.  L.  Andersen.  2012.    Applica,on  of  Phylogene,c  Microarray  Analysis  to  Discriminate  Sources  of  Fecal  Pollu,on.    Environmental  Science  and  Technology  46:4340–4347

Colford  Jr,  J.M,,  Schiff,  K.C.,  Griffith,  J.F.,  Yau,  V.,  Arnold,  B.F.,  Wright,  C.C.,  Gruber,  J.S.,  Wade,  T.J.,  S  Burns,  Hayes,  J.,  McGee,  C.,  Gold,  M.,  Cao,  Y.,  Noble,  R.T.,  Haugland,  R.  and  S.B.  Weisberg.    2012.    Using  rapid  indicators  for  Enterococcus  to  assess  the  risk  of  illness  aqer  exposure  to  urban  runoff  contaminated  marine  water.  Water  Research  46:2176-­‐2186

Goodwin,  K.D.,  McNay,  M.,  Cao,  Y.,  Eben,er,  D.,  Madison,  M.  and  J.F.  Griffith.    2012.    A  mul,-­‐beach  study  of  Staphylococcus  aureus,  MRSA,  and  enterococci  in  seawater  and  beach  sand.  Water  Research  46:4195-­‐4207

Shanks,  O.C.,  Sivaganesan,  M.,  Peed,  L.,  Kelty,  C.,  Blackwood,  A.D.,  Greene,  M.R.,  Noble,  R.,  Bushon,  R.,  Stelzer,  E.A.,  Kinzelman,  J.,  Anna'eva,  T.,  Sinigalliano,  C.,  Wanless,  D.,  Griffith,  J.F.,  Cao,  Y.,  Weisberg,  S.,  Harwood,  V.J.,  

Fuhrman,  J.A.,  Griffith,  J.F.,  and  M.S.  Schwalbach.  2000.    Prokaryo,c  and  viral  diversity  in  marine  plankton.    Ecological  Research.    17:183-­‐194

Stol,  L.D.,  T.P.  Hayden,  and  J.F.  Griffith.    1996    Benthic  Foraminifera  at  the  Los  Angeles  County  Whites  Point  Ousall  Revisited.    Journal  of  Foraminiferal  Research.    26  357-­‐368

Griffith,  J.F.  and  S.B.  Weisberg.  2011.  Challenges  in  Implemen,ng  New  Technology  for  Beach  Water  Quality  Monitoring:  Lessons  Learned  form  a  California  Demonstra,on  Project.  Marine  Technology  Society  Journal  45:65-­‐73

SYNERGISTIC  ACTIVITIES:Doctoral  Fellow,  NSF-­‐IGERT:  Env.  Studies,  Policy  and  Engineering-­‐  Sustainable  Ci,es  Program,  USC  (1999-­‐2000)-­‐Sea  Grant  Trainee,  Pathogenic  Viruses  in  the  Coastal  Ocean,  1995  -­‐  2001

RECENT  COLLABORATORS:M   Sadowsky   (U  MN),   R.   Noble   (UNC),   J.   Stewart   (UNC),   A.   Boehm   (Stanford),   J.   Jay   (UCLA),   P.   Holden   (UCSB),   J.  Fuhrman  (USC),  V.  Harwood  (USF),  B.  Arnold  (UCB),  J.  Colford  (UCB)  

THESIS  ADVISORY  &  POSTGRADUATE-­‐SCHOLAR  SPONSOR:

C.Lee  (UCLA),  R.  Converse  (UNC,  Chapel  Hil)

SUMMARY PROPOSAL FORM PROJECT TITLE: DEVELOPMENT  OF  DIGITAL  RT-­‐PCR  METHODS  TO  QUANTIFY  HUMAN-­‐  ASSOCIATED   BACTERIOPHAGE   IN   STORM   WATER   AND   COASTAL   RECREATIONAL  WATERS   OBJECTIVE: Our overall goals are to adapt and further develop a rapid, sensitive water quality monitoring and source-tracking tool that can be used to track the movement of viruses in coastal recreational waters and can be used to track human-associated contamination. Specifically we aim to 1) to develop a sensitive, robust droplet digital RT-PCR assay to measure and distinguish human-associated and non-human-associated F+RNA coliphage genogroups; and 2) apply this assay as microbial source tracking tool in coastal recreational waters and storm waters. METHODOLOGY: We will develop and test sensitive (potentially detecting a single gene copy) and robust (resistant to PCR inhibition) droplet digital RT-QPCR methods adapted from recently developed multiplex Reverse Transcriptase-QPCR assays applied to wastewater and environmental samples. These assays can distinguish multiple F+RNA coliphage genotypes at once by targeting shared coat protein and RNA replicase genes. Using this assay, we will quantify F+RNA coliphage genotypes collected from storm water, estuaries, and marine waters in the coastal zone in Southern California. Specifically we will target beaches likely to suffer from aging, leaky infrastructure and collect and filter 1-5L of seawater to capture the viruses by adsorption onto electronegative mixed cellulose ester filters. We also will draw on a sample archive previously collected by SCCWRP and the Martiny lab at UC Irvine consisting of large (20L) and small (0.5-1L) volume storm water samples from San Diego and Malibu, and near-shore beach samples from Ocean Beach and Tourmaline Surfing Park (San Diego), Doheny State Beach, Newport Beach (Orange County), Avalon, and Malibu (Los Angeles County). RATIONALE: Levels  of  fecal  indicator  bacteria  (FIB)  are  used  to  monitor  the  recreational  water  quality  to  protect  swimmers  from  exposure  to  pathogens  found  in  fecal  material,  but  are  an  imperfect  indicator.  The  main  limitation  is  that  concentrations  of  FIB  have  been  shown  to  be  poorly  correlated  with  the  presence  of  human  enteric  viruses  (e.g.  Human  Norovirus,  Enterovirus  or  Adenovirus)  that  are  responsible  for  the  majority  of  gastrointestinal  illnesses  in  swimmers.  Other  limitations  include  discerning  the  source  of  FIB  (human  or  non-­‐human),  the  dilution  and  degradation  of  FIB  in  the  environment,  and  the  physical  removal  of  bacteria  as  they  are  transported  through  groundwater.    Viruses  and  bacteriophage  (i.e.  viruses  that  infect  bacteria)  are  not  filtered  out  by  sand  or  soil  at  the  same  rate  as  much  larger  bacteria.  Further,  bacteriophage  are  more  abundant  than  human  viruses  (since  their  bacterial  hosts  are  much  more  abundant)  which  makes  them  more  attractive  water  quality  indicators  at  beaches  where  the  source  of  contamination  is  leaking  infrastructure,  rather  than  acute  inputs,  such  as  storm  water  pulses  or  sewage  spills.    F+RNA  coliphage  (i.e.  

viruses  infecting  E.  coli),  bacteriophage  infecting  human-­‐associated  Bacteroides  bacteria  (e.g.  Bacteroides  GB-­‐124  phage),  and  a  bacteriophage  discovered  from  human  gut  microbiome  metagenomes  (crAssphage)  have  been  proposed  as  potential  fecal  indicators.      Traditional  cultivation  techniques  are  slow,  taking  up  to  18-­‐24  hours  to  quantify  the  number  of  phage,  followed  by  molecular  analysis  to  identify  phage  genotypes.    Adding  to  these  difficulties,  bacteriophage  abundance  is  variable  and  can  go  undetected  by  culture  methods,  requiring  non-­‐quantitative  enrichment  cultivation  in  order  to  enhance  detection.    Molecular  quantification  of  bacteriophage  directly  from  environmental  waters  avoids  the  lengthy  cultivation  process  and,  in  the  case  of  F+RNA  coliphage,  measures  genotypes  associated  with  human  (genotypes  II  and  III)  and  non-­‐human  (genotypes  I  and  IV)  fecal  sources.  

DATA SHARING PLAN: All  data  generated  by  the  project  will  cleaned,  formatted,  and  be  made  publicly  available  through  the  California  Environmental  Data  Exchange  Network,  or  on  SCCWRP’s  website.  In  addition,  the  publications  will  be  open-­‐access  and  data  and  protocols  generated  by  this  project  will  be  housed  on  a  publicly  accessible  website  either  in  an  open  sharing  site  such  as  GitHub.    

                                                                                                                  July 7, 2015 Dr. Joshua Steele Department of Microbiology Southern California Coastal Water Research Project 3535 Harbor Blvd. Suite 110 Costa Mesa, CA 92626 Dear Dr. Steele,  I am pleased to hear about your proposal to USC Sea Grant seeking to develop a digital PCR assay for human-associated coliphage in the urban ocean. At the Surfrider Foundation, we are interested in innovative techniques to measure the health of the coastal ocean and in rapid, sensitive methods for monitoring coastal water quality. As you know from our previous collaborations, we are especially interested in the links between coliphage as a measure of viral contamination and gastrointestinal illness in swimmers and surfers. We would find this technique a useful addition to the rapid, molecular water quality methods that we can use to measure coastal health. Sincerely,

Dr. Chad Nelsen CEO

Global Headquarters P.O. Box 6010 San Clemente, CA USA 92674-6010 Phone: (949) 492 8170 Fax: (949) 492 8142 Email: info@surfrider.org www.surfrider.org

University of Southern California Sea Grant Proposal Format and Required Forms

PROJECT TITLE: EXPANSION OF OXYGEN DEFICIENCY IN SANTA MONICA BASIN? PRINCIPAL INVESTIGATORS: Will Berelson, Professor, USC Tina Treude, Associate Professor, UCLA FUNDING REQUESTED: Berelson 2016-2017 $25,998 Federal/State $32,489 Match 2017-2018 $25,998 Federal/State $32,489 Match Treude 2016-2017 $26,000 Federal/State $24,185 Match 2017-2018 $25,989 Federal/State $24,476 Match STATEMENT OF THE PROBLEM: The ocean is warming, as is the planet, and one consequence, direct or indirect, is a redistribution of oxygen and a decline in oxygen across many regions. The Southern California Bight region has been experiencing a decline in water column oxygen within the oxygen minimum zone (OMZ) such that low oxygen waters are even further depleted and the zone or width of low oxygen water has expanded. The cause(s) of this decline are not well known nor are the consequences. The oxygen minimum zone intersects the sediments adjacent to Los Angeles at a depth of approx. 200 m. Yet with further shoaling of the upper boundary this low-oxygen water will contact sediments that have heretofore been overlain by oxic waters. Thus subtle and dramatic consequences may ensue, benthic macrofauna may suffocate, and sediment diagenetic reactions will shift with the potential of ‘releasing’ benthic supplies of nutrients (phosphate PO42-, iron Fe2+) that had previously been ‘locked up’ by more oxic conditions. This sort of positive feedback would certainly exacerbate the dire conditions of encroaching hypoxia. INVESTIGATORY QUESTION: We are proposing to assess sedimentary metrics that track changes in local ocean oxygen content. We divide our work into these questions and hypotheses: Q1: Have there been recent (last 35 years) changes to sedimentation pattern and deep water hypoxia in the Santa Monica Basin?

H1: The expansion of the OMZ in Southern California is driven by increased production and carbon export (driven by changes in nutrient loading in the California Current system). Basinal sedimentation in Santa Monica Basin will show a) an increase in sedimentation rate, b) an increase in biogenic content, and c) an expansion of the laminated sediment zone beyond the area last defined in the 1980’s. Q2: What is the distribution of PO42-, and Fe2+ in porewaters of Santa Monica Basin sediments and how might a flux of these nutrients across the sediment-water interface change with changes in overlying water oxygen content? H2: We will find that sediments underlying low oxygen waters will show enhanced fluxes of PO42- and Fe2+ into the water column. Q3: How do we connect changes in the Santa Monica Basin benthos to climate/urban change in a way that students and the public will understand and remember? H1: We propose that a time-lapse video demonstrating changes in sediment color and benthic life during experimental deoxygenation of the bottom water will make a dramatic impact. MOTIVATION: The increase in atmospheric CO2 levels and associated increase in global temperatures is considered a factor in oceanic oxygen levels. The Potsdam Institute for Climate Impact Research (PIK) and Climate Analytics has recently predicted that the global temperature could increase by as much as 4 degrees C by the end of the century, even if greenhouse emissions are curbed. Changes in climate occur in a non-linear fashion, and thus it is difficult to predict exactly what changes will occur in the future. It is critical to assess what impacts this increase in temperature will have on the ocean, since the ocean is essential in modulating climate (Levitus et al., 2000). Studies indicate the anthropogenic addition of greenhouse gases has resulted in warming of the upper ocean and freshening of the ocean in high latitude areas. Both of these factors contribute to density stratification of the ocean (Keeling and Garcia, 2002). Increased stratification reduces upwelling, which reduces the supply of nutrients to the photic zone. This results in the reduction of photosynthesis and complete utilization of nutrients. Decreased production of organic matter can reduce the amount of oxygen consumed through aerobic respiration, however, significantly more oxygen is lost as a result of increased stratification of the water column. Stratification limits ventilation (atmosphere-ocean gas exchange), which restricts oxygen replenishment in the ocean interior. Will the reduction in ventilation and subsequent losses of dissolved oxygen (DO) have a more substantial effect on the overall concentration of DO in the water column than the increase of DO due to reduced production and respiration of organic matter due to stratification? This is an important regional and global question. Global Climate Models (GCMs) estimate that in the past several decades, the rate of DO loss is between 0.2 to 0.7 × 1014 moles per year, and predict that this rate will increase between 2.3 and 5 times (to a rate of 1.0 to 1.6 × 1014 moles per year) by the late 21st century (Bopp et al., 2002; Keeling and Garcia, 2002; Matear et al., 2000; Plattner et al., 2001; Sarmiento et al., 1998). A quarter of this increase is due to reduced solubility of O2 in a warmer ocean while the remainder is due to increased stratification in the North Pacific, Eastern Tropical Pacific, the Atlantic and Indian Basins (Keeling et al., 2010; Stramma et al., 2008; Stramma et al., 2010).

Page 1

Many, but not all model estimates predict declines in oceanic oxygen. (Deutsch et al., 2011) showed how a 1% drop in DO, equivalent to ~2 μM decline in DO, will result in the doubling in size of the current suboxic zone. Not only do declines in oxygen impact organisms that consume oxygen, but (Deutsch et al., 2011) have shown that small changes in DO concentrations will have large impacts on ocean nitrogen budgets. The global ocean rate of decline predicted is on the order of 0.03-0.1 µM/yr. Oxygen consumption rates in the waters off Los Angeles are 10-100 times faster than these model estimates. We feel compelled to address this issue and would suggest that modeling is one of the most promising approaches to address regional-scale change. Yet models are only as strong as data that provides constraint. Measurements of the actual decline in oxygen over time and actual evidence of changes over time are part of the data that models must simulate.

Healthy Ecosystems and Sustainable Fisheries—diminishing oxygen concentrations in the upper water column effect both pelagic and benthic ecosystems. Crustaceans and fish are particularly sensitive to oxygen levels and many oceanic ecosystems rely on the benthos. What is so critical to this discussion is that the continental shelf is at ~100 m. Declining levels of O2 will pinch oxygen-sensitive fish to a shallow zone between the ocean surface and the hypoxic zone. It will also impact shelf benthic fauna. Some benthic organisms, unable to escape the encroaching hypoxic waters, will perish. Others will be squeezed closer and closer to the shore. Squid fisheries, a major marine economy in Southern California, will also be severely impacted as the commercial species Loligo sp., may be out-competed by the Humboldt squid, a much less commercially valuable species.

If the trend in lower oxygen levels (Figure 1) continues and if the public begins to see effects of this phenomena, there will be fingers pointed and many will try to blame aspects of the urban-ocean interface. Sewage outflow quantity and quality has improved markedly over the period of oxygen decline, but there will still be those who point their finger in this direction. The coastal ocean ecosystem is complex and not one

Figure 1. Changes in oxygen concentration in San Pedro Channel water column between 1998-2010 at 100 m and at 500 m.

Page 2

single source/sink for nutrients is alone responsible for changes in ocean chemistry. Insofar as the sediments provide an integrated picture of changes over time, and the sediments provide a store of bound but potentially available nutrients, we must take careful inventory of changes in coastal sedimentation. GOALS AND OBJECTIVES:

A. Overall Goals To collect and analyze 6-9 cores from a transect of Santa Monica Basin, from 900 to 100 m. Once accomplishing this goal, we will make measurements that: a) define changes in sedimentation and lamination over the past 35 years, b) define sediment chemistry and the potential for chemical changes driven by changes in overlying water oxygen content, c) produce video and biological specimen evidence of what a changing OMZ means to life on the sea floor

B. 2016-2018 Objectives In the first year of funding we will organize and lead a coring expedition. For this

objective a new coring device (miniaturized multicorer, T. Treude, UCLA), the RV Yellowfin (Southern California Marine Institution, SCMI), and a methodology that both PI’s have great experience with will be utilized. Subsequent to core collection, sampling and analysis as well as work-up of data will ensue. The sediment accumulation rate and the zone of sediments found to be laminated will be compared to similar data from work accomplished in the 1980’s (Christensen et al. 1994). Biogenic composition (and accumulation rate) will be compared to composition and accumulation rate in the 1980’s. Sediment pore water profiles will be modeled (as discussed below) to estimate benthic fluxes and pore water inventories will be assessed. The second year of funding will focus on public outreach and communication of results. We will shoot a time-lapse video of a sediment core undergoing an experimental deoxygenation and organize an exhibition at the Santa Monica Pier Aquarium in collaboration with "Heal the Bay" to communicate the deoxygenation problematic to the public. We will share our results with LA County Outfall managers and at public and scientific meetings. METHODS: A. Year 1: Sediment Collection for Analyzes Multicores will be collected using a miniaturized multicorer (Mini-MUC, K.U.M., Kiel, Germany) device deployed from the RV Yellowfin (SCMI). We are requesting 3 days of shiptime (and one extra day to account for weather or other problems). We anticipate the collection of cores at 2-3 sites per day-trip and hence plan on obtaining cores at 6-9 stations. Station locations will be selected according to (a) bathymetry, (b) water column oxygen data available from SPOT (Fig. 2, J.C. Fleming, Dissertation, 2015), (c) pre-sampling (see UCLA seed money by Treude), and (d) from CTD/O2 hydrocasts conducted on our coring cruises prior to each Mini-MUC deployment. Coring sites will define a transect

Page 3

from the oxic shelf (~100 m) to the suboxic basin floor (~880 m). At each station we plan on collecting 4 cores (core length ca. 30-40 cm), which preserve the sediment-water interface. One core will be dedicated to porewater studies (TT) including the analyzes of the key parameters PO42- and Fe2+ as well as selected parameters that provide additional information about degradation and redox processes in the sediment (total sulfide. sulfate SO42-, ammonium NH4+, total alkalinity). The core will be brought to the lab at UCLA, stored and transported at near in situ temperature in an ice-filled garbage can. At UCLA, the core will be sub-sampled in a cold room at 2 cm intervals under anoxic conditions using an argon-filled glove bag to preserve redox sensitive chemical species. Porewater will be extracted by centrifugation at 4500 rpm for 20 min (4°C). Prior to analysis, the supernatant (= porewater) will be filtered with cellulose acetate filters (0.2 μm) inside the glove bag. Additional samples will be taken from the water overlying the sediment core for bottom water analysis prior to core sub-sampling. Table 1 provides methodological details of all porewater analyzes. A second core from each station will serve as backup in case the extraction of the first core should not result in sufficient porewater volume for the determination of all parameters. Priority will always be given to the analyzes of PO42- and Fe2+. Porewater concentration profiles and sediment porosity (see below) will be used to determine diffusional fluxes of PO42-, Fe2+, NH4+, and total sulfide from the sediment into the water column according to Fick's Fist Law assuming steady-state conditions (Berner, 1980). Fluxes of these solutes into the water column will be compared between stations along the oxic-hypoxic depth transect and with data from the literature (e.g. Peruvian OMZ (Bohlen et al., 2011; Dale et al., 2015), Eckernfoerde Bay (Dale et al., 2013; Dale et al., 2011) to discuss potential benthic feedbacks to the water column. Profiles of NH4+, SO42-, and Total Alkalinity in combination with data gained from solid sediment phase determinations (organic carbon content, sedimentation rate; see below) will provide information on trends in benthic organic mater degradation along the depth transect. Table 1. Porewater parameter analyzes Porewater Parameter Type of Analyses Reference PO42- Photometry (Grasshoff et al., 1999) Fe2+ Photometry (Grasshoff et al., 1999) NH4+ Photometry (Grasshoff et al., 1999) Total Sulfide Photometry (Cline, 1969) Total Alkalinity Titration (Dale et al., 2015) SO42- Ion Chromatography (Bertics et al., 2013)

Two cores will be preserved for solid-phase analyses (WB). Both of the solid-phase cores will be brought to the lab at USC, stored and transported at near in situ temperature in an ice-filled garbage can. At USC, one set of cores will have overlying waters drained and they will be archived in a cold-room (for subsequent analysis as described below). The other set of cores will be extruded and sectioned (upon overlying

Page 4

water removal via siphoning). Sectioned wet mud will be split, one split will go into a pre-weighed glass vial for subsequent weighing and determination of weight loss. This will lead to the establishment of porosity profiles that are key to all the analyses described here. The other split from this sectioned core will be sieved at 63 µm and all organisms caught on the sieve from 0-2 cm and 2-5 cm will be preserved in buffered fixative solution. Porosity sampling will proceed at 1 cm resolution from 0-5 cm and by 2 cm resolution thereafter. Selective samples (but no fewer than 10 samples per core) of dried sediment will be ground by mortar and pestle and splits analyzed for Total carbon (via EA analysis) and inorganic carbon (via acidification and analysis on Picarro C isotope analyzer). Splits of 0-1 cm interval sediment will also be analyzed for the presence/absence of aragonite. This measurement will be made at USC on an x-ray diffraction device and peaks identifying aragonite (and calcite) will be scanned. The second core that was set aside will lose water to evaporation over the course of months. This is necessary and planned to allow the sediment to consolidate enough to withstand core cutting. When it is observed that the sediment has settled and consolidated sufficiently (like firm jello) the multicore tube will be cut lengthwise on opposite sides. Passing a wire through the core allows separation of the two half-cores; one half-core will be placed in a plexiglass x-ray tray as designed and used for decades by Donn Gorsline. A half-core in an x-ray tray is cut again with a wire to a uniform thickness. This ‘slab’ is available for x-radiography, which will be accomplished using a Faxitron HP434805N x-radiography instrument that is housed in the Earth Sciences building. X-ray film is developed (the old fashioned way) in a USC dark room and the film is then scanned and digitized on computer. Variation in grey scale will be used to identify laminae and quantify the degree of homogenization and hence depth of bioturbation. We use Image J software as a digital grey scale analysis program. The depth of lamination will be assessed as will the nature and extent of bioturbation. Following x-ray analysis, we will sample 7-10 intervals for Cs-137 and Pb-210 analysis. Mud will be dried, ground and 1-2 g placed in a small plastic test tube for gamma counting. At USC we have 3 gamma counters (Ortec) with well-type detectors, we have experience with calibration of the detectors and typically count for 24 hours per sample. Porosity data will be used to determine integrated mass with depth in the core. We will develop an age model based on the location of the Cs-137 peak, representing fallout from bomb testing in the 1960’s. Pb-210 profiles and inventory will also be evaluated for accumulation determination.

Page 5

B. Year 2: Sediment Collection for Public Outreach Fresh sediment cores will be taken by Mini-MUC (see above) from a fully oxygenated and a fully suboxic station along the transect studied in Year 1. One core from each station will serve as exhibit to be displayed during public outreach events (see more details below) to demonstrate the difference between oxic and suboxic conditions. The oxygenated core will be continuously flushed with air bubbles using an aquarium air pump connected to a bubbling frit to prevent deoxygenation during storage. A second core from both stations will be sliced into glass vials. Sediments from suboxic stations will be sealed gas-tight with rubber stoppers. Sediments from oxic stations will be sealed with gas-permeable parafilm including an air headspace. The glass vials will serve as "smell samples" during the public events to demonstrate the difference between "non-smelly" oxic and "smelly" = anoxic/sulfidic sediments. A third core from the fully oxygenated station will be used for a video time-lapse deoxygenation demonstration. The sediment core will be sealed with rubber stoppers to prevent gas exchange and filmed over a period of several days to weeks (depending on the developments) using a digital time-lapse camera, to follow the gradual effects of oxygen decline in the bottom water. An artificial light source, scheduled by a digital timer, will be offered only during picture capturing to avoid photosynthetic reactions. During the deoxygenation experiment, we expect to document the "escape" and die off of benthic macrofauna and the gradual change of the sediment color from brown-green (oxidized, iron oxides) to black (reduced, iron sulfides). Additional digital photographs will be taken to document details in the core, e.g., animals or colored hot spots. RELATED RESEARCH: This research builds on collaborative work conducted in the S. California borderland by UCLA and USC scientists over the last 60 years! Specifically, we are building on the studies of D. Gorsline (Christensen et al., 1994) who identified a region of laminated sediments that had been expanding through the 1980’s. More than twenty-five years have

0

50

100

150

200

250

300

350

400

450

0 100 200 300D

ep

th (

m)

Oxygen (µM)

3/14/2013

10/14/2013

2/13/2014

3/5/2014

3/13/2014

4/4/2014

4/11/2014

4/24/2014

5/22/2014

6/19/2014

Mean

Figure 2. Traces of oxygen concentration (µM) vs. depth in the upper 400 m of San Pedro Basin (from JC Fleming, USC dissertation, 2015). The water column in adjacent Santa Monica Basin should be nearly identical. Hypoxic waters are defined by [O2] = 64 µM which occurs at approx. 200 m.

Page 6

passed since that conclusion has been re-examined. Thus one important outcome of the proposed study will be to establish the continuation of expanding hypoxic conditions in Santa Monica Basin or otherwise. It is in Donn Gorsline’s honor that we propose this study. This work also builds on decades of studies of sediment pore water profiles, used to examine organic and biogenic matter diagenesis. It further builds on the historical archives of the Hancock Foundation insofar as benthic organisms will be collected and archived for future study and comparison (although this aspect of study is beyond the scope of the proposed work here). The PI’s have been in contact with S. Kidwell (U. Chicago) who has expressed interest in melding modern sediment faunal information with ‘fossil’ records from buried sediments. The PI’s will share this macrofaunal data with her. Another related study is that of WB and collaborators who are investigating rates of CaCO3 dissolution in undersaturated sea water (NSF OCE supported through 2016). The influence of ocean acidification on coastal waters is well documented (Bednaršek and Ohman, 2015; Feely et al., 2004). The relative proportion of water column and benthic dissolution is not well known, yet Santa Monica Bay is a site where aragonite pteropods live in the upper ocean, yet the deeper water column is undersaturated with respect to aragonite. Thus our study helps relate the impact of acidification on the benthic record. Further, TT has currently seed money from UCLA to conduct one field trip each to the Santa Monica and San Pedro Basin. The aim of the field trips is to collect primary water column (oxygen) and sediment (porewater, sulfate reduction) data from three stations above, below and at the interface of the oxygen minimum. The field trip to Santa Monica Basin (scheduled for fall/winter 2015) will provide important information for the selection of stations along the depth transect of the proposed study. BUDGET-RELATED INFORMATION:

A. Budget Explanation/Detailed Justification The budget of WB for Year 1: WB has requested $26,000 from Sea Grant of which $18,000 is in direct costs. Berelson will take a fraction of a month’s summer salary for this work and will be supported by a technician, Nick Rollins, who will perform many of the analytical efforts. We are also requesting a Sea Grant Trainee for graduate student assistance on this project. The student could delve deeply into the sedimentation rate analysis, the x-ray analysis and/or the biogenic sedimentation analysis. Expendable supplies include the cost of coring supplies, CTD operations, costs of Cs and Pb-210 analysis, costs of EA and TC analysis (approx. $10/sample) and general cruise supplies. Both PI’s are including ship usage in their budgets to cover the 3 (or 4) days of RV Yellowfin time. USC vehicles will be used to transport supplies and samples to/from the ship and these costs are included as is the cost of attending local meetings. The budget of WB for Year 2: Some money will be allocated for travel to domestic science meetings and some money allocated to publication costs. Otherwise, costs for year two include the analytical cost of making measurements and processing cores. Salary monies will cover the expense of a technician to supervise the data collection and summary. The budget of TT for Year 1:

Page 7

TT has requested $26,000 from Sea Grant of which $16,883 is in direct costs. 1.5 months summer support (including Technology Infrastructure Fee) is requested for a PhD student (Sydnie Lemieux), who will be involved in field sampling, geochemical analyzes and public outreach. In addition, Sea Grant Trainee support is requested to cover the academic months for the PhD student (Sydnie Lemieux). Expendable supplies include the cost of core tubes (to be sacrified for x-ray analyses) and costs for porewater extraction and analyzes (6 parameters x 9 stations x approx. 20 depth sections = 1080 samples, approx. $6/sample). Both PI’s are including ship costs in their budgets to cover the 3-4 days of RV Yellowfin time. UCLA vehicles will be used to transport the Mini-MUC, supplies, and samples to/from the ship. These costs are included as is the cost of attending local meetings. The budget of TT for Year 2: TT has requested $25,989 from Sea Grant of which $ 16,876 is in direct costs. The PhD student support remains the same. Further support is requested for 1 day of Yellowfin time (public outreach sampling), outreach equipment and consumables (digital video camera, timer, light source, poster wall, monitor, laptop etc.), travel to two domestic science meetings (ASLO, AGU), and publication costs.

B. Matching Funds WB: Matching funds for this project come as part of WB’s academic year salary (approx. 1 month). This time he will spend during the academic year working on this project. TT: Matching funds for this project come as part of TT's academic year salary (approx. 1 month). This time she will spend during the academic year working on this project. Additional matching funds come as part of the PhD student's (Sydnie Lemieux) summer support (1.5 months at 100%). For confirmation of matching funds see letter by Professor Kevin McKeegan, Chair of the UCLA Department of Earth, Planetary and Space Sciences.

ANTICIPATED BENEFITS: We have focused this study to provide specific benefit to various stakeholders. The public sanitation districts are interested in changes that are occurring in local waters and how those changes can be attributed to anthropogenic and natural forcing. The sediments are a repository of information about changing productivity and sedimentation and we provide a ‘map’ of changes that may have occurred over the past 25-35 years. This time-window is a critical time in terms of anthropogenic changes in the local ocean. While we have not yet made contact with fishing organizations, we know that the benthos is a key ecosystem, both to benthic invertebrates that fish and mammals feed upon, to benthic fish but also to squid, that are the major fishery in the S. California Bight. A key to understanding complex system behavior is to understand the feedbacks embedded in a system. The sediment-nutrient-flux feedback is an overlooked aspect of coastal water chemical evolution under changing climate forcing, thus our emphasis on sediment pore water. COMMUNICATION OF RESULTS:

Page 8

We have outlined in this proposal a number of outreach efforts to effectively communicate sediment geochemical changes to the public. Our time-lapse movie of the sediment-water interface becoming anoxic will convey, in graphic terms, the impact of water column loss of oxygen. This video will be presented at public aquaria. We are in contact with the non-profit environmental group "Heal the Bay", who is working to restore Santa Monica Bay and is operating the Santa Monica Pier Aquarium as their public marine-education center. Heal the Bay is welcoming our outreach efforts (see support letter by José Bacallao, Heal the Bay operations manager). Together with the video we will prepare an educational poster, oxic/anoxic sediment core displays, "smell" samples of stinking anoxic (sulfidic) sediment, and offer scientific presentations. Further, we plan to communicate our results to the public via the Heal the Bay website http://www.healthebay.org We are also building outreach efforts to target high school students interested in the sciences. TT and her UCLA colleagues are involved with a Science-Lunch program with University High School in West Los Angeles. University High School belongs to one of the most tolerant and diverse campuses in the Los Angeles Unified School District. Presenting our results at this high school will give us the opportunity to reach out to a diverse group of students. WB is faculty advisor to the Young Researchers Program (http://youngresearchers.usc.edu) hosted at USC. Here, high school students from underrepresented groups spend a summer working in a lab on campus. We also plan to communicate our results through the usual scientific publication channels and via meetings. At the beginning of the second year, we will focus on presenting scientific results at international conferences (e.g. ASLO meeting, February 26 - March 3 2017, Honolulu, HI). Towards the end of the second year, we will present the public outreach activities of our project. For example, AGU conferences (December 2017, San Francisco, CA) offer public affairs sessions on science communication, which would allow us to demonstrate our interaction with the public to a scientific community. REFERENCES: Bednaršek, N., Ohman, M.D., 2015. Changes in pteropod distributions and shell dissolution

across a frontal system in the California Current System. Mar. Ecol. Prog. Ser. 523, 93-103.

Berner, R.A., 1980. Early diagenesis - A theoretical approach. Princeton Univ. Press. Bertics, V.J., Löscher, C.R., Salonen, I., Dale, A.W., Gier, J., Schmitz, R.A., Treude, T.,

2013. Occurrence of benthic microbial nitrogen fixation coupled to sulfate reduction in the seasonally hypoxic Eckernfoerde Bay, Blatic Sea. Biogeosciences 10, 1243-1258.

Bohlen, L., Dale, A.W., Sommer, S., Mosch, T., Hensen, C., Noffke, A., Scholz, F.,

Wallmann, K., 2011. Benthic nitrogen cycling traversing the Peruvian oxygen minimum zone. Geochim. Cosmochim. Acta 75, 6094-6111.

Page 9

Bopp, L., LeQuere, C., Heimann, M., Mannung, A.C., Monfray, P., 2002. Climate-induced oxeanic oxygen fluxes: Implications for the contemporary carbon budget. Biogeochem. Cycles 16 (2).

Christensen, C.J., Gorsline, D., Hammond, D.E., Lund, S.P., 1994. Non-annual laminations

and expansion of anoxic basin-floor conditions in Santa Monica Basin, California Borderland, over the past four centuries. Mar. Geol. 116, 399-418.

Cline, J.D., 1969. Spectrophometric determination of hydrogen sulfide in natural waters.

Limnol. Oceanogr. 14, 454-458. Dale, A.W., Bertics, V.J., Treude, T., Wallmann, K., 2013. Modeling benthic-pelagic nutrient

exchange processes and porewater distributions in a seasonally hypoxic sediment: evidence for massive phosphate release by Beggiatoa? Biogeosciences 10, 629-651.

Dale, A.W., Sommer, S., Bohlen, L., Treude, T., Bertics, V.J., Bange, H.W., Pfannkuche, O.,

Schorp, T., Mattsdotter, M., Wallmann, K., 2011. Rates and regulation of nitrogen cycling in seasonally hypoxic sediments during winter (Boknis Eck, SW Baltic Sea): Sensitivity to environmental variables. Estuar. Continent. Shelf Sci. 95, 14-28.

Dale, A.W., Sommer, S., Lomnitz, U., Montes, I., Treude, T., Liebetrau, V., Gier, J.,

Hensen, C., Dengler, M., Stolpovsky, K., Bryant, L.D., Wallmann, K., 2015. Organic carbon production, mineralisation and preservation on the Peruvian margin. Biogeosciences 12, 1537-1559.

Deutsch, C., Brix, H., Ito, T., Frenzel, H., Thompson, L., 2011. Climate-Forced Variability of

Ocean Hypoxia. Science 333 (6040), 336-339. Feely, R.A., Sabine, C.L., Schlitzer, R., Bullister, J.L., Mecking, S., Greeley, D., 2004.

Oxygen utilization and organic carbon remineralization in the upper water column of the Pacific Ocean. J. Oceanogr. 60, 45-52.

Grasshoff, K., Ehrhardt, M., Kremling, K., 1999. Methods of seawater analysis. Wiley-VCH

Verlag GmbH, Weinheim. Keeling, R.F., Garcia, H.E., 2002. The change in oceanic O2 inventory associated with

recent global warming. PNAS 99 (12), 7848-7853. Keeling, R.F., Körtzinger, A., Gruber, N., 2010. Ocean Deoxygenation in a Warming

World. Annual Review of Marine Science. Ann. Rev. Mar. Sci. 2, 199-229. Levitus, S., Antonov, J.I., Boyer, T.P., Stephens, C., 2000. Warming of the World Ocean.

Science 287, 2225-2229.

Page 10

Matear, R.J., Hirst, B.I., McNeil, B.I., 2000. Changes in dissolved oxygen in the Southern Ocean with climate change. Geochem. Geophys. Geosyst. 1 (11).

Plattner, G.-K., Joos, F., Stocker, T.F., Marchal, O., 2001. Feedback mechanisms and

sensitivities of ocean carbon uptake under global warming Tellus Ser. B 3, 564-592. Sarmiento, J.L., Hughes, T.M.C., Stouffer, R.J., Manabe, S., 1998. Response of the Ocean

Carbon Cycle to Anthropogenic Climate Warming. Nature 393, 245-249. Stramma, L., Johnson, G.C., Sprintall, J., Mohrholz, V., 2008. Expanding oxygen-minimum

zones in the tropical oceans. Science 320, 655-658. Stramma, L., Schmidtko, S., Levin, L.A., Johnson, G.C., 2010. Ocean oxygen minima

expansions and their biological impacts. Deep-Sea Research I 57, 587-595.

Page 11

BRIEF CURRICULUM VITAE

(Needed for all Principal and Associate Investigators) Will Berelson Department of Earth Sciences, USC 213-740-5828 berelson@usc.edu EDUCATION University of Rochester Geology B.A. (cum laude) 1977 Duke University Geology M.S. 1979 University of Southern California Geochemistry Ph.D. 1985 POSITIONS HELD 2012- Chairman, Department of Earth Sciences, USC 2008-present Professor, University of Southern California 2004-2008 Associate Professor of Geobiology, USC 1996-2004 Research Associate Professor, USC 1988-1995 Research Assistant Professor, USC 1985-1987 Post-doctoral Research Associate, USC SELECTED PUBLICATIONS (a = student) Monteverdea, D. R., L. Gomez-Consarnau, L. Cutter, L. Chong, W. Berelson and S. A.

Sanudo-Wilhelmy (2015) Vitamin B1 in marine sediments: pore water concentration gradient drives benthic flux with potential biological implications. Frontiers in Microbiology, doi: 10.3389/fmicb.2015.00434, Article 434

Berelson, W. M., W. Z. Haskella III, M. Prokopenko, A. Knapp, D. Hammond, N. Rollins and

D. Capone (2015). Biogenic particle flux and benthic remineralization in the Eastern Tropical South Pacific. Deep-Sea Research, 99, 23-34.

Temsa, C., W. Berelson and M. Prokopenko (2014) Particulate d15N in laminated sediments

provide a proxy for mixing between the California Undercurrent and the California Current: A proof of concept. GRL, 10.1002/2014GL061993

Deutsch, C., W. Berelson, R. Thunell, T. Weber, C. Tems, J. McManus, J. Crusius, T. Ito, T.

Baumgartner, V. Ferreira, J. Mey and A. van Geen (2014) Centennial changes in North Pacific anoxia linked to tropical trade winds. Science, 345, 665; DOI: 10.1126/science.1252332.

Townsend-Small, A., M. Prokopenko and W. Berelson (2014) Nitrous oxide in the water

column and sediments of the oxygen minimum zone, Eastern Tropical North Pacific, Southern California and Northern Mexico. JGR-Oceans, 119.

Page 12

Berelson, W. M., J. McManus, S. Severmann, C. E. Reimers (2013) Benthic flux of oxygen and nutrients from Oregon/California shelf sediments. Cont. Shelf Research,55, 66-75.

Chonga, L. E., M. G. Prokopenko, W. M. Berelson, A. Townsend-Small, and J. McManus

(2012), Nitrogen cycling within Suboxic and Anoxic Marine Sediments from the Continental Margin of Western North America, Marine Chemistry, 128-129, 13-25.

McManus, J., W. Berelson, S. Severmann, K. S. Johnson, D. E. Hammond, M. Roy and K.

H. Coale (2012). Benthic manganese fluxes along the Oregon-California continental shelf and slope. Continental Shelf Research, 43, 71-85.

Severmann, S., J. McManus, W. Berelson and D. E. Hammond (2010) The continental

shelf benthic iron flux and its isotope composition. Geochim. Cosmochim. Acta, 74, 3984-4004

Chonga, L., W. M. Berelson, J. McManus, D. E. Hammond, N. E. Rollins and P. L. Yager

(2013) Biogenic matter export influenced by the Amazon River plume: Patterns of remineralization in deep-sea sediments. Deep-Sea Research, 85, 124-137.

Prokopenko, M. G., D. M. Sigman, W. Berelson, D. E. Hammond, B. Barnett, L. Chong and

A. Townsend-Small (2011), Denitrification in anoxic sediments supported by biological nitrate transport, Geochimica Cosmochimica Acta, 75, 7180-7199.

Collinsa, L. E., W. M. Berelson, D. E. Hammond, A. Knapp, R. Schwartz and D. Capone

(2010) Particle fluxes in San Pedro Basin, California: A four-year record of sedimentation and physical forcing. Deep Sea Research, 58, 898-914

Cheng, Tao, D. E. Hammond, W. M. Berelson, J. G. Hering, and S. Dixit (2009), Dissolution

kinetics of biogenic silica collected from the water column and sediments of three southern California borderland basins, Marine Chemistry 113, 41-49.

Berelson, W. M., Prokopenko, M., Graham, A., Sansone, F. J., McManus, J., Bernhard, J.

M. (2005), Anaerobic diagenesis of silica and carbon in continental margin sediments: Discrete zones of TCO2 production, Geochim. Cosmochim. Acta, 69, 4611-4629.

Berelson, W. and L. Stott (2003) Productivity and organic carbon rain to the California

margin sea floor: Modern and paleoceanographic perspectives. Paleoceanography, v. 18, 1002, doi:10.1029/2001PA000672 2003

Berelson, W., K. Johnson, K. Coale and H-C. Li (2002) Organic matter diagenesis in the

sediments of the San Pedro Shelf along a transect affected by sewage effluent. Continental Shelf Research, v. 22, 1101-1115.

Page 13

Tina Treude University of California, Los Angeles Department of Earth, Planetary and Space Sciences Department of Atmospheric and Oceanic Sciences 310-267-5213 ttreude@g.ucla.edu EDUCATION University of Kiel, Germany Biology Diploma 1999 University of Bremen, Germany Biology PhD 2004 POSITIONS HELD 2014-present Associate Professor, UCLA 2011-2014 Professor (W2), GEOMAR and Kiel University, Germany 2007-2011 Assistant Professor (W1), GEOMAR and Kiel University, Germany 2005-2007 Postdoctoral Researcher (DFG Fellow), USC 2004-2005 Postdoctoral Researcher, Max Planck Institute for Marine Microbiology, Bremen, Germany SELECTED PUBLICATIONS (a = student/postdoc) Steinlea, L., C.A. Graves, T. Treude, B. Ferré, A. Biastoch, I. Bussmann, C. Berndt, S.

Krastel, R.H. James, E. Behrens, C.W. Böning, J. Greinert, S. Sommer, C.-J. Sapart, M.F. Lehmann and H. Niemann (2015): A rapid oceanographic switch controls aerobic methane oxidation in the water column above cold seeps off Svalbard. Nature Geosciences, DOI: 10.1038/NGEO2420

Dale, A.W., S. Sommer, U. Lomnitz, I. Montes, T. Treude, J. Giera, C. Hensen, M. Dengler,

K. Stolpovsky, L. D. Bryant, and K. Wallmann (2015): Organic carbon production, mineralization and preservation on the Peruvian margin. Biogeosciences 12, 1537-1559

Treude, T., S. Krausea, J. Schweersa, R. Coffin, L.J. Hamdan (2014): Sulfate reduction and

methane oxidation activity below the sulfate-methane transition zone in Alaskan-Beaufort continental margin sediments: Implications for deep sulfur cycling, Geoch. Cosmoch. Acta, 144, 217-237

Berndt, C., T. Feseker, T. Treude, S. Krastel, H. Niemann, V.J. Berticsa, I. Dumke, K.

Dünnbier, B. Ferré, C. Graves, F. Gross, K. Hissmann, V. Hühnerbach, S.Krausea, V. Liebetrau, K. Lieser , J. Schauer, L. Steinlea (2014): Temporal constraints on hydrate-controlled methane seepage off Svalbard, Science, 343, 284-287

Berticsa, V.J., C.R. Löscher, I. Salonen, A.W. Dale, R. A. Schmitz, T. Treude (2013):

Occurrence of benthic microbial nitrogen fixation coupled to sulfate reduction in the seasonally hypoxic Eckernförde Bay, Baltic Sea, Biogeosciences,10, 1243–1258

Page 14

Dale, A.W., V J. Berticsa, T. Treude, S. Sommer, K. Wallmann (2013): Modeling benthic-

pelagic nutrient exchange processes and porewater distributions in a seasonally-hypoxic sediment: evidence for massive phosphate release by Beggiatoa? Biogeosciences, 10, 629-651

Krausea, S., V. Liebetrau, S. Gorb, M. Sánchez-Román, J.A. McKenzie, T. Treude (2012):

Microbial nucleation of Mg-rich dolomite in exopolymeric substances (EPS) under anoxic modern seawater salinity: New insight into an old enigma, Geology 40 (7), 587-590

Treude, T. (2011): “Biogeochemical reactions in marine sediments underlying anoxic water

bodies”, In: “Anoxia: Paleontological Strategies and Evidence for Eukaryote Survival”, A. Altenbach, J. Bernhard, J. Seckbach (Eds.), Cellular Origins, Life in Extreme Habitats and Astrobiology (COLE) Book Series, Springer, p 19-38, ISBN: 978-9400718951

Dale, A.W., S. Sommer, L. Bohlen, T. Treude, V.J. Berticsa, H.W. Bange; O. Pfannkuche, T.

Schorp, M. Mattsdotter, K. Wallmann (2011): Rates and regulation of nitrogen cycling in seasonally-hypoxic sediments during winter (Boknis Eck, SW Baltic Sea): sensitivity to environmental variables”, Estuarine, Coastal and Shelf Science, 95: 14-18

Treude, T., W. Ziebis (2010): “Methane oxidation in permeable sediments at hydrocarbon

seeps in the Santa Barbara Channel, California”, Biogeosciences, 7: 1-14 Bertics, V.J., J.A. Sohm, T. Treude, C-E.T. Chow, D.G. Capone, J.A. Fuhrman, W. Ziebis

(2010): “Burrowing deeper into the benthic nitrogen cycling: the impact of bioturbation on nitrogen fixation coupled to sulfate reduction”, Mar. Ecol. Prog. Ser. 409: 1-15, Feature Article

Treude, T., C.R. Smith, F. Wenzhöfer, E. Carney, A.F. Bernardino, A.K. Hannides, M.

Krüger, A. Boetius (2009): ‘ Biogeochemistry of a deep-sea whale fall: sulfate reduction, sulfide efflux and methanogenesis’, Mar. Ecol. Prog. Ser. 382, 1-21, Feature Article

Treude, T., J. Niggemann, J. Kallmeyer, P. Wintersteller, C.J. Schubert, A. Boetius, B.B.

Jørgensen (2005): ‘ Anaerobic oxidation of methane and sulfate reduction along the Chilean continental margin’. Geochim. Cosmochim. Acta, 69(11), pp 2767-2779

Michaelis, W., R. Seifert, K. Nauhaus, T. Treude, V. Thiel, M. Blumenberg, K. Knittel, A.

Gieseke, K. Peterknecht, T. Pape, A. Boetius, R. Amann, B.B. Jørgensen, F. Widdel, J. Peckmann, N.V. Pimenov, M.B. Gulin (2002): ‘Microbial reefs in the Black Sea fueled by anaerobic oxidation of methane’. Science, 297, pp. 1013-1015

Page 15

SUMMARY PROPOSAL FORM

PROJECT TITLE: EXPANSION OF OXYGEN DEFICIENCY IN SANTA MONICA BASIN? OBJECTIVE: We propose to look at changes in sedimentation in Santa Monica Basin and use this well documented repository to extract information about recent changes in water column oxygen content. Laminated sediments are indicators of oxygen deficiency in the bottom-near water. The depth of lamination marks the onset of ‘anoxic’ conditions, hence mapping the ‘age’ of lamination onset provides a measure of whether the extent of bottom water anoxia is expanding or contracting. The sediments provide a baseline record of changes in the export of Corg, i.e. upwelling intensity. Determining the pattern or trend in benthic oxygen vs. time as it relates to near-surface oxygen vs. time is the primary goal of this project. We plan to a) determine the extent and depth of lamination in sediment cores collected from transects across Santa Monica Basin, b) Measure bomb-produced Cs-137 in sediment cores in order to establish the sedimentation history since 1970, c) archive and/or process cores in a way compatible with future study of live-dead faunal assemblages which help in identifying benthic ecosystem changes. In addition, we plan to determine concentrations of reduced iron, phosphate, and other chemical species in the porewater and supernatant water of sediment cores to estimate their production rates and benthic fluxes into the water column. Sediments underlying OMZs are characterized by benthic release of reduced chemical species, some of which can create positive feedback to OMZ development by enhancing surface productivity and carbon export. METHODOLOGY: Sediment cores will be obtained with a multi-coring device deployed off the Southern California Marine Institution vessel R/V Yellowfin. Sediment lamination will be studied in split cores using a Faxitron HP434805N x-radiography instrument. Sediment age will be studied following depth distribution of Cs-137 and Pb-210 in sectioned core samples using a gamma counter (Ortec). One core from each deployment will be archived and/or sampled for faunal analysis via sieving and preserving specimen. Sediment porewater will be gained through centrifugation of sediment samples under anoxic conditions. PO42-, Fe2+, NH4+, total sulfide, total alkalinity, and SO42- concentrations will be analyzed in the porewater and supernatant water of cores following standard analytical procedures. RATIONALE: The proposed sediment work provides both a longer view on changes to the Urban Ocean, but we also have the opportunity to measure changes that have occurred over the last 35 years, which is the period when the basin sediments were last surveyed. Changing oceanic conditions will leave a signature on the sea floor; hence our collection of cores will act as a repository for measuring the impact of hypoxia as it encroaches upon benthic communities. This work makes for an easy discussion topic with various stakeholders. The public is aware of ‘stinky water’, the public is aware of ‘hypoxia kills’ and the public is well aware of global change. Our goal is to provide geological, geochemical, and biological evidence of change to the benthic environment. This has an impact on local ocean stakeholders and our outreach and communication efforts will be so directed.

Page 21

Projected Work Schedule Project Title: EXPANSION OF OXYGEN DEFICIENCY IN SANTA MONICA BASIN

Activities 2016-2017 F M A M J J A S O N D J Field Trip Preparations

X X X X X

Field Trips Main Coring

X

Analyses Main Coring

X X X X X X

Data Processing Main Coring

X X X X

Activities 2017-2018

F M A M J J A S O N D J Field Trip Preparations

Field Trip Public Outreach Coring

Analyses Main Coring

X X X X X X X

Data Processing Main Coring

X X X X X X X X X X

Time-Lapse Experiment

X X

Preparation of Public Outreach Exhibition

X X

Public Outreach Exhibition

X X X X

Preparation of Publication

X X X X X X

Scientific Meetings

X X

Page 22

OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: University of California, Los Angeles GRANT/PROJECT NO.:

DURATION (months):02/01/2016 - 01/31/2017

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: (Current Salary $122,000/9 months) 1 academic month 1 1.00 0 13,556 (PI salary is based on the current salary with a 3% cost living increase.)b. Associates (Faculty or Staff):

Sub Total: 1 1.00 0 13,556

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students: (GSR IV - Current Salary $3,775/mo) 1.5 summer months at 100% 1 1.5 5,662 5,663 (Grad Student salary is based on the current salary.)d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians:h. Other:

Total Salaries and Wages: 2 2.5 5,662 19,219

B. FRINGE BENEFITS - Principal Investigator: 35.0% 0 4,745 FRINGE BENEFITS - Grad Student: 3.0% 170 170

Total Personnel (A and B): 5,832 24,133

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT:

E. TRAVEL:1. Domestic2. International

Total Travel: 0 0

F. PUBLICATION AND DOCUMENTATION COSTS:

G. OTHER COSTS:1. Technology Infrastructure Fee @34.46/mo/FTE 52 522. RV "Yellowfin" charter and mobilization (1.5 days) 3,0003. Mini-MUC core tubes 2,0004. Consumables and reagents for porewater analyzes 6,000567

Total Other Costs: 11,052 52

TOTAL DIRECT COST (A through G): 16,884 24,185

INDIRECT COST (On campus 54% ): 920.97417 9,117 0INDIRECT COST (Off campus % of $ ):

Total Indirect Cost: 9,117 0

TOTAL COSTS: 26,001 24,185

PRINCIPAL INVESTIGATOR: Tina Treude

BRIEF TITLE: Expansion of oxygen deficiency in Santa Monica Basin?

OMB Control No. 0648-0362

Expiration Date 1/31/2018

SEA GRANT BUDGET FORM 90-4

GRANTEE: University of California, Los Angeles GRANT/PROJECT NO.:

DURATION (months):02/01/2017 - 01/31/2018

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator: (Current Salary $122,000/9 months) 1 academic month 1 1.00 0 13,556 (PI salary is based on the current salary with a 3% cost living increase.)b. Associates (Faculty or Staff):

Sub Total: 1 1.00 0 13,556

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students: (GSR IV - Current Salary $3,775/mo) 1.5 summer months at 100% 1 1.5 5,946 5,946 (Grad Student salary is based on the current salary with a 5% increase.)d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians:h. Other:

Total Salaries and Wages: 2 2.5 5,946 19,502

B. FRINGE BENEFITS - Principal Investigator: 35.0% 0 4,745 FRINGE BENEFITS - Grad Student: 3.0% 178 178

Total Personnel (A and B): 6,124 24,425

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT:

E. TRAVEL:1. Domestic 3,0002. International

Total Travel: 3,000 0

F. PUBLICATION AND DOCUMENTATION COSTS: 2,000

G. OTHER COSTS:1. Technology Infrastructure Fee @34.46/mo/FTE 52 522. RV "Yellowfin" charter and mobilization (1 day) 2,0003. Outreach equipment and consumables 3,7004567

Total Other Costs: 5,752 52

TOTAL DIRECT COST (A through G): 16,876 24,477

INDIRECT COST (On campus 54% ): 479.3075 9,113 0INDIRECT COST (Off campus % of $ ):

Total Indirect Cost: 9,113 0

TOTAL COSTS: 25,989 24,477

BRIEF TITLE: Expansion of oxygen deficiency in Santa Monica Basin?

PRINCIPAL INVESTIGATOR: Tina Treude

OMB Control No. 0648-0362

Expiration Date 7/31/2015

SEA GRANT BUDGET FORM 90-4

GRANTEE: GRANT/PROJECT NO.:

DURATION (months):February 1, 2016 - January 31, 2017

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator:W. Berelson 1 0.2 2,970 14,845b. Associates (Faculty or Staff):

Sub Total: 1 0.2 2,970 14,845

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians: N.Rollins 1 1.2 5,200h. Other:

Total Salaries and Wages: 2 1.4 8,170 14,845

B. FRINGE BENEFITS: (31.1%) 0.3 2,680 4,869Total Personnel (A and B): 10,850 19,714

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT: 3,500

E. TRAVEL:1. Domestic 7702. International

Total Travel: 770 0

F. PUBLICATION AND DOCUMENTATION COSTS: 0

G. OTHER COSTS:1 1.5 days R/V Yellowfin @ $2000/day 3,000234567

Total Other Costs: 3,000 0

TOTAL DIRECT COST (A through G): 18,120 19,71412,120

INDIRECT COST (5 mos. @ 65%): 250 7,878 12,775INDIRECT COST (Off campus 26% of $ ):

Total Indirect Cost: 7,878 12,775

TOTAL COSTS: 25,998 32,489

Will BerelsonPRINCIPAL INVESTIGATOR:Expansion of oxygen minima in Santa Monica BasinBRIEF TITLE:

OMB Control No. 0648-0362

Expiration Date 7/31/2015

SEA GRANT BUDGET FORM 90-4

GRANTEE: GRANT/PROJECT NO.:

DURATION (months):February 1, 2017 - January 31, 2018

12 months 1 Yr.A. SALARIES AND WAGES: man-months

1. Senior PersonnelNo. of People

Amount of Effort Sea Grant Funds Matching Funds

a. (Co) Principal Investigator:W. Berelson 1 0.2 3,000 14,845b. Associates (Faculty or Staff):

Sub Total: 1 0.2 3,000 14,845

2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians: N.Rollins 1 1.2 5,400h. Other:

Total Salaries and Wages: 2 1.4 8,400 14,845

B. FRINGE BENEFITS: (31.1%) 0.3 2,755 4,869Total Personnel (A and B): 11,155 19,714

C. PERMANENT EQUIPMENT:

D. EXPENDABLE SUPPLIES AND EQUIPMENT: 3,965

E. TRAVEL:1. Domestic 1,0002. International

Total Travel: 1,000 0

F. PUBLICATION AND DOCUMENTATION COSTS: 2,000

G. OTHER COSTS:1234567

Total Other Costs: 0 0

TOTAL DIRECT COST (A through G): 18,120 19,71412,120

INDIRECT COST (5 mos. @ 65%): 0 7,878 12,775INDIRECT COST (Off campus 26% of $ ):

Total Indirect Cost: 7,878 12,775

TOTAL COSTS: 25,998 32,489

Will Berelson

BRIEF TITLE:Expansion of oxygen minima in Santa Monica BasinPRINCIPAL INVESTIGATOR:

1600 Ocean Front Walk Tel (310) 393-6149 aquarium@healthebay.org Santa Monica, CA 90401 Fax (310) 393-4839 www.healthebay.org/SMPA

29 June 2015 William M. Berelson Professor of Earth Sciences University of Southern California Tina Treude Associate Professor of Marine Geomicrobiology University of Calfiornia, Los Angeles Professor Berelson, Professor Treude It has been a pleasure speaking with you about your Sea Grant proposal. I discussed this with my team and I am writing to you in support of your project to study the spreading of the oxygen deficiency in the Santa Monica Basin. I support the project plan for public outreach regarding the ecological and economic consequences of oxygen deficiency in the basin. Your project will complement the work we do at Heal the Bay, as we educate the nearly 100,000 students and general public visitors that visit our facility annually. Heal the Bay’s Santa Monica Pier Aquarium, which is located on the historic Santa Monica Pier, serves as an educational resource for the Greater Los Angeles area. Since Heal the Bay acquired the Aquarium in 2003 from UCLA, more than 732,000 visitors have been welcomed during public visiting hours and approximately 160,000 students have participated in the Youth Environmental Education Program. For many, participation in the field trip marks the students' first experience exploring environmental science and witnessing marine life in person. I  look  forward  to  collaborating  on  this  project.  I  look  If  I  can  be  of  any  assistance  please  do  not  hesitate  to  ask.      Thank  you    

 José  Bacallao  Operations  Manager  jbacallao@healthebay.org  310-­‐872-­‐8316   cc: Tina Treude, Heather Doyle

COUNTY SANITATION DISTRICTS OF L OS ANGELES COUNTY

1955 Workman Mill Road , Whitt ier, CA 90601-1400 Mailing Address : P.O . Box 4998 , Whittier, CA 90607 -4998 Telephone : (562 ) 699-7411, FAX : (562 ) 699-5422 www.lacsd .org

GRACE ROB IN SO N HYDE Ch ief Engineer and General Manager

July 28, 2015

William Berelson, Professor, University Southern California Chair, Department of Earth Sciences (ZHS 227) University of Southern California 3651 Trousdale Parkway Los Angeles, CA 90089-0740

Dear Dr. Berelson:

Sanitation Districts' Support for Expansion of Oxygen Deficiency in Santa Monica Basin

The County Sanitation Districts of Los Angeles County (Sanitation Districts) are pleased to provide this letter of support for your research proposal entitled "Expansion of Oxygen Deficiency in Santa Monica Basin" . This research will examine potential consequences of an upward expansion (shallowing) of the oxygen minimum zone (OMZ) in the southern California bight, and in particular how the flux potential of nutrients (phosphate, iron) from shelf and slope sediments may respond if overlying water oxygen levels decline.

Your proposed studies are directly relevant to the Sanitation Districts. Analyses of sediments and sediment biota have been a core part of the Joint Water Pollution Control Plant (JWPCP) coastal ocean receiving water monitoring program for more than four decades. In addition, changes in regional distribution patterns and levels of oxygen are a concern of the Sanitation Districts as are non-discharge related sources and levels of nutrients in local receiving waters. While previous regional studies estimated the nutrient loading from runoff, aerial deposition, and upwelling, your proposed study will investigate another possible significant source of nutrients, specifically the flux of P and Fe from sediments to the overlying water, in response to changing oxygen levels, and will also measure ammonium in sediments and bottom waters. The Sanitation Districts analysis of CalCOFI data, done in support of SMBRC assessment of the SMB pelagic habitat, found a multi-decadal widespread increase in levels of nutrients in ocean waters near the coast. Your study of sediment fluxes is timely in as much as it could explain this increase.

Since your proposed study is premised on the expansion and shoaling of the OMZ, the Sanitation Districts notes that we sample water quality quarterly, and recently reviewed oxygen data for our surveys through May 2015. Preliminary examination suggests the declines in oxygen

Document Number: 3365592 ..... Recycled Po per t..l

Dr. William Berelson 2 July 28, 2015

may have leveled after 2010, and since 2012 it appears that oxygen may be returning to levels seen in the late 1990s. We encourage you as part of this project, to review USC/SPOTS data to explore whether oxygen changes may be cyclic, and if so, to look for an oceanic-scale explanation for the observed pattern.

The knowledge gained through this research will contribute to the understanding of how regional scale changes in oxygen levels may alter other physico-chemical properties in receiving waters as well as local benthic communities. The potential changes in fluxes will contribute greater understanding of another potentially significant nutrient source, and allow it to be compared against anthropogenic nutrient discharges to assess relative contributions on productivity of local waters. The Sanitation Districts believe that such information is essential to making well-informed management decisions regarding anthropogenic discharges to the coastal environment, and are therefore supportive of the proposed research.

AS:PLF:dm

cc: Joe Gully Alex Steele Phyllis Grifman, USC Sea Grant Ruth Dudas (by email to rdudas@usc.edu)

Very truly yours,

Grace Robinson Hyde

Philip L. Friess Department Head Technical Services