The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in Anti-HER2Antibody-induced G1 Cell Cycle Arrest and Tumor Growth Inhibition*

Received for publication, January 27, 2003, and in revised form, April 5, 2003Published, JBC Papers in Press, April 16, 2003, DOI 10.1074/jbc.M300848200

Xiao-Feng Le‡, Francois-Xavier Claret§, Amy Lammayot‡, Ling Tian§, Deepa Deshpande‡,Ruth LaPushin§, Ana M. Tari¶, and Robert C. Bast, Jr.‡�

From the Departments of ‡Experimental Therapeutics, §Molecular Therapeutics, and ¶Bioimmunnotherapy,The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030

Cyclin-dependent kinase (CDK) inhibitor p27Kip1

binds to the cyclin E�CDK2 complex and plays a majorrole in controlling cell cycle and cell growth. Our groupand others have reported that anti-HER2 monoclonalantibodies exert inhibitory effects on HER2-overex-pressing breast cancers through G1 cell cycle arrest as-sociated with induction of p27Kip1 and reduction ofCDK2. The role of p27Kip1 in anti-HER2 antibody-in-duced cell cycle arrest and growth inhibition is, how-ever, still uncertain. Here we have provided severallines of evidence supporting a critical role for p27Kip1 inthe anti-HER2 antibody-induced G1 cell cycle arrest andtumor growth inhibition. Induction of p27Kip1 and G1growth arrest by anti-HER2 antibody, murine 4D5, orhumanized trastuzumab (Herceptin�) are concentra-tion-dependent, time-dependent, irreversible, and long-lasting. The magnitude of G1 cell cycle arrest induced bytrastuzumab or 4D5 is well correlated with the level ofp27Kip1 protein induced. Up-regulation of p27Kip1 and G1growth arrest could no longer be removed with as littleas 14 h of treatment with trastuzumab. Anti-HER2 anti-body-induced p27Kip1 protein, G1 arrest, and growth in-hibition persist at least 5 days after a single treatment.The magnitude of growth inhibition of breast cancercells induced by anti-HER2 antibody closely parallelsthe level of p27Kip1 induced. Induced expression of ex-ogenous p27Kip1 results in a p27Kip1 level-dependent G1cell cycle arrest and growth inhibition similar to thatobtained with anti-HER2 antibodies. Reducing p27Kip1

expression using p27Kip1 small interfering RNA blocksanti-HER2 antibody-induced p27Kip1 up-regulation andG1 arrest. Treatment with anti-HER2 antibody signifi-cantly increases the half-life of p27Kip1 protein. Inhibi-tion of ubiquitin-proteasome pathway, but not inhibi-tion of calpain and caspase activities, up-regulatesp27Kip1 protein to a degree comparable with that ob-tained with anti-HER2 antibodies. We have further dem-onstrated that anti-HER2 antibody significantly de-creases threonine phosphorylation of p27Kip1 protein atposition 187 (Thr-187) and increases serine phosphoryl-

ation of p27Kip1 protein at position 10 (Ser-10). Expres-sion of S10A and T187A mutant p27Kip1 protein increasesthe fraction of cells in G1 and reduces a further anti-body-induced G1 arrest. Consequently, p27Kip1 plays animportant role in the anti-HER2 antibody-induced G1cell cycle arrest and tumor growth inhibition throughpost-translational regulation. Regulation of the phos-phorylation of p27Kip1 protein is one of the post-transla-tional mechanisms by which anti-HER2 antibody up-regulates the protein.

HER2 (human epidermal growth factor receptor 2; alsoknown as c-neu or ErbB-2) is a key member in the epidermalgrowth factor receptor family (1–4). HER2, as a preferred het-erodimer partner for other members in epidermal growth factorreceptor family, plays a critical role in epidermal growth factorreceptor family signaling that is linked to a variety of cellularresponses to growth factors in both normal and abnormal con-ditions (1–4). When HER2 is overexpressed in cells, normalsignaling pathways are altered, and growth control is deregu-lated. HER2 is overexpressed in a number of cancers, includingbreast, ovarian, gastric, colon, and non-small cell lung carcino-mas (4, 5). A humanized monoclonal antibody trastuzumab orHerceptin� has been developed from the murine anti-HER2monoclonal antibody 4D5. Trastuzumab has been successfullyused in clinics to treat patients with metastatic breast cancersthat overexpress HER2 (4, 5). Trastuzumab treatment canproduce a response rate of 10–15% as a single agent in heavilypre-treated patients with metastatic breast cancers that over-express HER2 (6). Trastuzumab treatment produces a re-sponse rate of 25% as a single agent in first-line managementof patients with HER2 positive metastatic breast cancer (7).Trastuzumab has further been shown to enhance significantlythe effectiveness of chemotherapy in patients whose tumorsoverexpress HER2 (4, 5). The combination of chemotherapyplus trastuzumab has a much higher rate of response thanchemotherapy alone (50 versus 32%) (8). The combination oftrastuzumab and chemotherapy also improve the time to dis-ease progression (7.4 versus 4.6 months) and the median re-sponse duration (9.1 versus 6.1 months) when compared withchemotherapy alone (8). The mechanisms by which trastu-zumab affects growth of cancer cells and response to chemo-therapy are not well understood.

One of the intracellular growth regulators that are affectedby trastuzumab is cyclin-dependent kinase (CDK)1 inhibitorp27Kip1. p27Kip1, as one of the most important CDK inhibitors

* This work was supported in part by NCI, National Institutes ofHealth Grant CA39930 (to R. C. B.), Grant IRG3721206 from the Uni-versity of Texas M. D. Anderson Cancer Center (to X.-F. L.), NCI, Na-tional Institutes of Health Grant 1R01CA90853-01A1 (to F.-X. C.), andUnited States Department of the Army Grant DAMD 17-02-1-0459 (toA. M. T.). The costs of publication of this article were defrayed in partby the payment of page charges. This article must therefore be herebymarked “advertisement” in accordance with 18 U.S.C. Section 1734solely to indicate this fact.

� To whom correspondence should be addressed: The University ofTexas M. D. Anderson Cancer Center, 1515 Holcombe Blvd., Box 355,Houston, TX 77030-4009. Tel.: 713-792-7743; Fax: 713-792-7864;E-mail: rbast@mdanderson.org.

1 The abbreviations used are: CDK, cyclin-dependent kinase; hIgG,human IgG1; PBS, phosphate-buffered saline; GFP, green fluorescentprotein; Adp27, adenovirus-p27Kip1; SiRNA, small interfering RNA.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 26, Issue of June 27, pp. 23441–23450, 2003© 2003 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

This paper is available on line at http://www.jbc.org 23441

by guest, on February 20, 2013

ww

w.jbc.org

Dow

nloaded from

during cell cycle G1 phase, binds to the cyclin E�CDK2 complexand plays a major role in controlling cell cycle (9). An increasein p27Kip1 protein causes proliferating cells to exit from the cellcycle, whereas a decrease in p27Kip1 protein promotes quies-cent cells to resume cell proliferation. p27Kip1 protein is pri-marily regulated post-transcriptionally at the level of bothprotein translation and protein stability, although transcrip-tional regulation and non-covalent sequestration may also oc-cur (9–11). Among the post-transcriptional mechanisms, ubiq-uitin-proteasome proteolysis is a major pathway for regulationof p27Kip1 protein (12). Phosphorylation of p27Kip1 protein onthreonine 187 (Thr-187) by CDK2 prepares p27Kip1 protein forbinding to ubiquitin ligase SCFSkp2 that leads to 26 S protea-some degradation (13–15). In contrast to the phosphorylation ofThr-187, the phosphorylation of p27Kip1 protein on serine 10(Ser-10) by human kinase interacting stathmin stabilizesp27Kip1 protein in G1 (16, 17). p27Kip1 protein has been reportedto interact with c-Jun co-activator Jab1 (also known as CSN5),and this interaction causes nuclear export of the p27Kip1 pro-tein (18) and modulates c-Jun-dependent transcription (19).

Because of the major impact of p27Kip1 in controlling cellcycle, the role of p27Kip1 protein in human carcinogenesis hasbeen indicated in a number of studies. Low expression ofp27Kip1 protein is associated with excessive cell proliferationand has been linked to many types of human tumors includingbreast cancer (10). Low expression of p27Kip1 protein is found tocorrelate reversibly with HER2 overexpression via HER2-facil-itated p27Kip1 degradation (20). Low levels of p27Kip1 proteincorrelates well with higher grade neoplasms and poor survivalrates (10). A striking correlation between the expression oftumor suppressor PTEN and the level of p27Kip1 protein isobserved in thyroid carcinoma (21). By down-regulatingp27Kip1 protein via proteasomal degradation, oncogenic fusionprotein Bcr-Abl forces fibroblasts and hematopoietic cells todivide under inappropriate conditions (22). Furthermore, tar-geted disruption of the p27Kip1 gene increases body size of mice,leads to striking enlargement of multiple organs and develop-ment of pituitary tumors (23, 24).

In the pre-clinical setting, our group and others (25–31) havedemonstrated that anti-HER2 monoclonal antibodies exert in-hibitory effects on HER2-overexpressing breast cancer throughinduction of G1 cell cycle arrest associated with induction ofp27Kip1 and reduction of CDK2. However, the role of p27Kip1 inanti-HER2 antibody-induced G1 cell cycle arrest and growthinhibition is still uncertain. Here we have provided severallines of evidence to support a critical role for p27Kip1 in theanti-HER2 antibody-induced G1 cell cycle arrest and tumorgrowth. We have further shown that regulation of the phospho-rylation of p27Kip1 protein is one of the post-translationalmechanisms by which anti-HER2 antibody up-regulates theprotein.

EXPERIMENTAL PROCEDURES

Cell Culture—Two human breast cancer cell lines, SKBr3 andBT474, were obtained from the American Type Culture Collection(ATCC, Manassas, VA). SKBr3 cells were grown in complete mediumcontaining RPMI 1640 medium (Invitrogen) supplemented with 10%fetal bovine serum (Sigma), 2 mM L-glutamine, 100 units/ml of penicil-lin, and 100 �g/ml streptomycin in humidified air with 5% CO2 at 37 °C.BT474 cells were grown in complete medium containing Dulbecco’smodified Eagle’s medium (Invitrogen) supplemented with 10% fetalbovine serum, 2 mM L-glutamine, 100 units/ml of penicillin, and 100�g/ml streptomycin. For all experiments, cells were detached with0.25% trypsin-0.02% EDTA. For cell culture, 2–6 � 105 exponentiallygrowing cells were plated into 100-mm tissue culture dishes or 3 � 103

into 96-well plates in complete medium. After culture overnight incomplete medium, cells were treated with antibodies at different con-centrations as indicated in each figure legend in complete medium at37 °C for the indicated time intervals.

Reagents—Antibodies reactive with phospho-Thr-187 p27Kip1, phos-pho-Ser-10 p27Kip1, and Jab1 were purchased from Zymed LaboratoriesInc. (South San Francisco, CA). An antibody to p27Kip1 was purchasedfrom BD Biosciences. An antibody to c-Myc was obtained from UpstateBiotechnology, Inc. (Lake Placid, NY). A monoclonal antibody to �-actinwas purchased from Sigma. Anti-HER2 murine monoclonal antibody4D5 and humanized monoclonal antibody trastuzumab (Herceptin�)were kindly provided by Genentech (South San Francisco, CA). HumanIgG1 (hIgG) purified from plasma of patients with myelomas was ob-tained from Calbiochem and dialyzed against sterile cold PBS to elim-inate sodium azide. Hybridoma cells specific for MOPC21, which wasobtained from the ATCC, Manassas, VA was used to produce ascitesfluid, and the immunoglobin was purified as reported previously (25). ATet-Off gene expression system was purchased from Clontech. Cyclo-heximide was purchased from Sigma. Wild-type p27Kip1 and its mu-tants (S10A and T187A) in pcDNA3.0 vector were kindly provided byDr. K. Nakayama (Departments of Molecular and Cellular Biology andMolecular Genetics, Medical Institute of Bioregulation, Kyushu Uni-versity, Fukuoka, Japan). A membrane-bound GFP expression vectorpEGFP-F was purchased from Clontech. Calpain inhibitor PD151746, abroad-caspase inhibitor II, and MG132 were obtained from Calbiochem.

Anchorage-dependent Growth—Two different methods have beenused to assess the anchorage-dependent growth in this study. The firstone was a 96-well microplate crystal violet mitogenic assay that wasmodified from previous reports (25, 32). Briefly, 3 � 103 of SKBr3 cellswere plated into 96-well tissue culture plates in triplicate. The cellswere treated with anti-HER2 antibody (trastuzumab or 4D5) or controlreagent (hIgG for trastuzumab; MOPC21 for 4D5). After incubation for3 days, the cells were washed with PBS, fixed in 1% glutaraldehyde inPBS, and stained with 0.5% crystal violet (Sigma) in methanol. The dyewas eluted with Sorenson’s buffer (0.9% sodium citrate, 0.02 N HCl, and45% ethanol), and the eluted dye was measured by a microplater readerVmax (Molecular Devices, Sunnyvalle, CA) at wavelength 540 nm. Asecond method, a low density long-term assay, was performed in100-mm cell culture dishes. Low cell density (BT474 cells at 1 � 105;SKBr3 cells at 1.5 � 104) was used when plating the cells. Afterovernight incubation, the cells were treated with single dose of anti-HER2 antibody (trastuzumab or 4D5) or control reagent (hIgG fortrastuzumab; MOPC21 for 4D5) in complete medium for up to 1 week.No medium was changed during the assay. Cells on day 3–7 aftertreatment were then harvested for enumeration of cells with a Coultercounter (Coulter Electronics LTD, Miami, FL), p27Kip1 protein detectionby Western blotting, and cell cycle analysis by flow cytometry.

Anchorage-independent Growth—To determine the anchorage-inde-pendent cell growth of SKBr3 cells, a colony-forming assay in soft agarwas used as reported in our previous studies (25).

Cell Cycle Analysis—Cell cycle distribution was analyzed by flowcytometry. Cells were trypsinized, washed once with PBS, and fixedovernight in 70% ethanol. Fixed cells were centrifuged at 300 � g for 10min and washed with PBS. Cell pellets were re-suspended in PBScontaining 50 �g/ml of RNase A and 50 �g/ml propidium iodide andincubated for 20 min at 37 °C with gentle shaking. Stained cells werefiltered through nylon mesh (41 �M) and analyzed on a Coulter flowcytometer XL-MCL (Coulter Corporation, Miami, FL) for relative DNAcontent based on red fluorescence levels. Doublets and cell debris wereexcluded from the DNA histograms. The percentages of sub-G1 cellpopulation were determined based on relative DNA content. The per-centages of cells in different cell cycle compartments were determinedusing the MULTICYCLE software program (Phoenix Flow Systems,San Diego, CA).

Preparation of Total Cell Lysate and Western Immunoblot Analysis—The procedures for preparation of total protein and Western immuno-blot analysis were performed as described previously (25).

Construction and Preparation of Inducible Adenovirus-p27Kip1

(Adp27)—A recombinant adenovirus vector expressing a doxycycline-regulated (Tet-Off) form of p27Kip1 has been constructed according tothe manufacturer’s recommendations (Clontech). Briefly, the humanfull-length p27Kip1 cDNA (obtained originally from PCR and verified byDNA sequencing) was cloned into pTRE-Shuttle2 vector. Recombinantadenoviral DNA containing myc-p27Kip1 (Ad-myc-p27Kip1) was createdthrough ligating pTRE-Shuttle2-myc-p27Kip1 to Adeno-X viral DNA(Clontech). Large-scale production of high-titer Ad-myc-p27Kip1 wasperformed by growing human embryonic kidney 293 cells on improvedminimum Eagle’s medium supplemented with 10% Tet-free fetal bovineserum (Clontech), 4 mM L-glutamine, 100 units/ml penicillin G sodium,100 �g/ml streptomycin. The virus was purified twice using cesium-chloride density gradient centrifugation. The viral vector was then

Role of p27Kip1 in Anti-tumor Effects of Anti-HER2 Antibody23442

by guest, on February 20, 2013

ww

w.jbc.org

Dow

nloaded from

dialyzed for 8 h at 4 °C against a buffer containing 10 mM Tris-HCl (pH7.5), 1 mM MgCl2, and 10% glycerol and was stored at �80 °C.

Infection with Adp27—2 � 105 of SKBr3 cells were seeded in 100-mmcell culture dishes and incubated at 37 °C overnight. Cells were thencoinfected with a 1:1 ratio of an adeno-X Tet-Off regulatory virus(Clontech) and Ad-myc-p27Kip1 virus (created as described above) atdifferent multiplicities of infection (m.o.i.) or at an m.o.i. of 20. The cellswere cultured with 10% Tet-free fetal bovine serum in presence (�) ofabsence (�) of doxycycline (1 �g/ml). When applicable, doxycycline wasre-added every 48 h. After 48–72 h, cells were harvested for enumera-tion with a Coulter counter, Western blot analysis, and cell cycleanalysis.

Small Interfering RNA (SiRNA)—To silence p27Kip1 gene expression,a single transfection of SiRNA duplex was performed using Oligo-fectamine reagent (Invitrogen) according to the manufacturer’s proto-col. Two double-stranded RNAs with 21-mers and d(TT) overhang wereselected for the ability to silence p27Kip1 expression. p27Kip1 SiRNA 1corresponds to nucleotides 217 to 238 of the human p27Kip1 codingregion (AAGTACGAGTGGCAAGAGGTG). p27Kip1 SiRNA 2 corre-sponds to nucleotides 139 to 160 of the human p27Kip1 coding region(AAGCACTGCAGAGACATGGAA). The SiRNAs were synthesized athigh-peformance purity by Qiagen-Xeragon (Germantown, MD). A non-related control SiRNA, which targeted DNA sequence AATTCTC-CGAACGTGTCACGT with no significant match in the complete humangenome, was purchased from Qiagen-Xeragon that had been purifiedunder similar condition (catalog number 80-11310).

p27Kip1 Mutants and GFP Co-transfection—SKBr3 cells grown in60-mm dishes were transfected with the 3.2 �g of appropriate expres-sion plasmids (wild-type p27Kip1, S10A p27Kip1, or T187A p27Kip1) plus0.8 �g of pEGFP-F vector using 7 �l of LipofectAMINE-2000 (Invitro-gen) according to manufacturer’s instructions. Cells were trypsinizedand re-seeded in two identical dishes after 24 h of transfection. One dishwas treated with anti-HER2 antibody 4D5, and the other was treatedwith diluent. After incubation for another 24 h, cells were collected andsubjected to cell cycle analysis or used to prepare protein. For cell cycleanalysis, cells were first fixed in 0.25% paraformaldehyde for 1.5 h onice and then stained with PI solution as described above. Only theGFP-positive population was gated, and its cell cycle distribution wasassessed. The GFP positive rate in empty vector pcDNA3.0 was used tonormalize other plasmids’ different transfection efficiency.

Statistical Analysis—The two-tailed Student’s t test was used tocompare two different groups. Values with p � 0.05 were consideredsignificant.

RESULTS

Anti-HER2 Antibody Induces a Concentration-dependent Ac-cumulation of p27Kip1 Protein and a Corresponding Concentra-tion-dependent G1 Cell Cycle Arrest—In previous studies, wehave shown that the anti-HER2 antibody ID5 induced G1 cellcycle arrest through inhibition of CDK2 and induction ofp27Kip1 (25). In this study, we have employed the clinicallyapproved anti-HER2 antibody trastuzumab and its mouse pre-cursor 4D5. Two breast cancer cell lines that overexpress HER2protein, SKBr3 and BT474, were used in our experiments.SKBr3 cells were treated for 24 h with anti-HER2 antibody4D5 at different concentrations or control mouse antibodyMOPC21 at 10 �g/ml. Cells were then divided into two por-tions: one for cell cycle analysis and the other for total proteinextraction and Western immunoblot analysis. As shown in Fig.1A, 4D5 induced a dramatic and concentration-dependent in-crease in the fraction of cells in G1 phase of the cell cycle. ThisG1 arrest was associated with a dramatic and concentration-dependent decrease of cells in S phase. The decrease of cells inG2/M phase was also concentration-dependent but less impres-sive. The control antibody MOPC21, as expected, did not causeG1 arrest (Fig. 1A). Importantly, G1 arrest induced by 4D5correlated closely with the induction of p27Kip1 in the samedose-dependent manner (Fig. 1B). No p27Kip1 induction wasobserved in cells treated with control antibody MOPC21 (Fig.1B), which correlated well with no G1 arrest observed in Fig.1A. These results were further confirmed in another HER2-overexpressing breast cell line, BT474. As shown in Fig. 1, Cand D, 4D5 treatment resulted in a concentration-dependentincrease in the fraction of cells in G1 and a concentration-de-pendent induction of p27Kip1 protein. The control antibodyMOPC21 elicited no p27Kip1 protein and did not cause any G1

arrest (Fig. 1, C and D). These data demonstrate that anti-HER2 antibody induces a concentration-dependent p27Kip1 ac-cumulation and a corresponding G1 cell cycle arrest, suggesting

FIG. 1.Anti-HER2antibodyinducesaconcentration-dependentaccumulationofp27Kip1 proteinandacorrespondingconcentration-dependent G1 cell cycle arrest. SKBr3 cells (panels A and B) were treated for 24 h with anti-HER2 antibody 4D5 at indicated concentrationsor control mouse antibody MOPC21 at 10 �g/ml. Cells were then divided into two portions: one for measurement of cell cycle distribution by flowcytometry (A) and the other for total protein extraction and quantitation of p27Kip1 protein by Western blotting (B). Similarly, BT474 cells (panelsC and D) were treated for 48 h with anti-HER2 antibody 4D5 at indicated concentrations or control antibody MOPC21 at 10 �g/ml. Cells were thendivided into two portions: one for measurement of cell cycle distribution by flow cytometry (C) and another for total protein extraction and detectionof p27Kip1 protein by Western blotting (D). Results in this figure are representative of three replicate experiments. For the protein loading control,the same blot was stripped and re-probed with an anti-�-actin antibody.

Role of p27Kip1 in Anti-tumor Effects of Anti-HER2 Antibody 23443

by guest, on February 20, 2013

ww

w.jbc.org

Dow

nloaded from

a role of p27Kip1 protein in anti-HER2 antibody-induced G1

arrest.Anti-HER2 Antibody Induces a Time-dependent Accumula-

tion of p27Kip1 Protein and a Corresponding Time-dependent G1

Cell Cycle Arrest—We next test whether the induction ofp27Kip1 protein and G1 arrest by anti-HER2 antibody alsobehaves in a similarly time-dependent manner. BT474 cellswere treated with the anti-HER2 antibody trastuzumab at 10�g/ml or control hIgG for different time intervals. Cells werethen divided into two portions: one for cell cycle analysis andthe other for total protein extraction and Western immunoblotanalysis. As shown in Fig. 2A, in BT474 cells trastuzumabinduced a dramatic and time-dependent increase of cells in G1

phase within 48 h. This G1 arrest accompanied a dramatic andconcentration-dependent decrease of S phase cells. In BT474cells, the G1 arrest induced by trastuzumab peaked around48 h. The control hIgG, as expected, did not cause any G1 arrest(Fig. 2A). Similar to the results in Fig. 1, the trastuzumab-induced G1 arrest correlated closely with the induction ofp27Kip1 in the same time-dependent manner (Fig. 2B). Trastu-zumab-induced p27Kip1 protein peaked at 48 h in BT474 cells(Fig. 2B), which was in agreement with the G1 cell cycle arrestobserved in Fig. 2A. No p27Kip1 induction was observed in cellstreated with control hIgG (Fig. 2B), which correlated well withthe level of G1 arrest observed in Fig. 2A. These results werefurther confirmed in the 4D5-treated SKBr3 cells. As shown inFig. 2, C and D, 4D5 treatment resulted in a time-dependentincrease in the G1 fraction of cells and a time-dependent induc-tion of p27Kip1 protein. In SKBr3 cells, both p27Kip1 level andG1 arrest induced by 4D5 peaked around 24 h. The controlantibody MOPC21 elicited no p27Kip1 protein nor did it causeany G1 arrest (Fig. 2, C and D). These data demonstrate thatanti-HER2 antibody induces a time-dependent p27Kip1 accu-mulation and a corresponding G1 cell cycle arrest, furthersuggesting a role of p27Kip1 protein in anti-HER2 antibody-induced G1 arrest.

Anti-HER2 Antibody Induces an Irreversible Increase inp27Kip1 Protein and a Corresponding G1 Cell Cycle Arrest—Todetermine whether anti-HER2 antibody-induced p27Kip1 pro-

tein and G1 cell cycle arrest are reversible or irreversible,BT474 cells were treated for different intervals with or without10 �g/ml trastuzumab. At the different intervals, cells werewashed with media that lacked anti-HER2 antibody and werethen replenished with normal media that contained no anti-body as illustrated in Fig. 3A. After 48 h, cells were harvestedfor measurement of p27Kip1 protein by Western immunoblotand of cell cycle distribution by flow cytometry. Our prelimi-nary data and published data (25) have revealed the following:1) that anti-HER2 antibody does not induce significant p27Kip1

protein and G1 arrest within 8 h upon antibody treatment, and2) that the earliest time interval for the anti-HER2 antibody toinduce significant p27Kip1 protein and G1 arrest is around 16 hafter treatment. Therefore, we have focused the time intervalsbetween 8 and 16 h after antibody treatment. As shown in Fig.3B, trastuzumab, as expected, induced a dramatic expression ofp27Kip1 protein and G1 arrest (84.9%) after 48 h treatmentcompared with the untreated control. Treatment with trastu-zumab for 8 h induced little p27Kip1 protein and G1 arrest.Treatment with trastuzumab for 10 and 12 h induced greaterp27Kip1 protein and G1 arrest, which, however, did not differstatistically from untreated control. At 14 h trastuzumab in-duced significant p27Kip1 protein and statistically significantG1 arrest (80.4%) when compared with the untreated control(67.1%). These data indicate that statistically significant G1

cell cycle arrest and elevation of p27Kip1 protein level inducedby trastuzumab could no longer be removed after 14 h of treat-ment with antibody. Data in Fig. 3B have also illustrated theclose correlation of the degree of G1 arrest with the level ofp27Kip1 protein induced by anti-HER2 antibody.

Growth Inhibition Induced by Anti-HER2 Antibody Corre-lates with the Induced Level of p27Kip1 Protein—To investigatewhether the level of p27Kip1 protein induced by anti-HER2antibody correlates the magnitude of growth inhibition, wehave carried out two experiments. First, a microplate growthassay has been used to test the correlation between p27Kip1

protein and anchorage-dependent growth as reported previ-ously (32) (see “Experimental Procedures” for details). Forp27Kip1 protein detection, BT474 cells at similar cell density to

FIG. 2. Anti-HER2 antibody induces a time-dependent accumulation of p27Kip1 protein and a corresponding time-dependent G1cell cycle arrest. BT474 cells (panels A and B) were treated for 72 h with anti-HER2 antibody trastuzumab at 10 �g/ml for the indicated timeintervals or with hIgG as a control at 10 �g/ml. Cells were then divided into two portions: one for cell cycle analysis and the other for total proteinextraction and Western blot analysis. A, measurement of cell cycle distribution by flow cytometry. B, quantitation of p27Kip1 protein by Westernblotting. SKBr3 cells (panels C and D) were treated for 48 h with anti-HER2 antibody 4D5 at 3 �g/ml for the indicated time intervals or controlMOPC21 at 3 �g/ml. C, detection of cell cycle distribution by flow cytometry. D, detection of p27Kip1 protein by Western blotting. Results in thisfigure are representative of three replicate experiments. For the protein loading control, the same blot was stripped and re-probed with ananti-�-actin antibody.

Role of p27Kip1 in Anti-tumor Effects of Anti-HER2 Antibody23444

by guest, on February 20, 2013

ww

w.jbc.org

Dow

nloaded from

the microplate growth assay were plated into 100-mm culturedishes and treated for 48 h with 4D5 and control antibody atdifferent concentrations. As shown in Fig. 4, 4D5 induced aconcentration-dependent and anchorage-dependent growth in-hibition (Fig. 4A) and a concentration-dependent p27Kip1 accu-mulation in BT474 cells (Fig. 4B). Under the same conditions,control antibody MOPC21 did not induce p27Kip1 protein at thehighest concentration (Fig. 4B) and any growth inhibition (Fig.4A). Second, an anchorage-independent assay has been em-ployed to test the correlation between p27Kip1 protein andgrowth in soft agar as reported previously (25). Again, forp27Kip1 protein determination, BT474 cells were plated into100-mm culture dishes under similar conditions to the growthassay and treated for 48 h with 4D5 and control antibody atdifferent concentrations. Anti-HER2 antibody 4D5 was foundto induce concentration-dependent and anchorage-independentgrowth inhibition of BT474 cells (Fig. 4C), whereas 4D5 in-duced a concentration-dependent increase in p27Kip1 protein(Fig. 4D). Control antibody MOPC21 did not induce p27Kip1

protein at the highest concentration (Fig. 4D) nor did it in-crease growth inhibition (Fig. 4C). Taken together, these re-sults suggest that growth inhibition induced by anti-HER2antibody correlates closely with the induced level of p27Kip1

protein in a concentration-dependent manner.Anti-HER2 Antibody Induces a Long-lasting Up-regulation

of p27Kip1 Protein, G1 Cell Cycle Arrest, and Growth Inhibi-tion—As described above and shown in Fig. 2, anti-HER2 an-tibodies, trastuzumab and 4D5, induced time-dependentp27Kip1 accumulation and a corresponding G1 cell cycle arrestup to 72 h in BT474 cells and 48 h in SKBr3 cells. To determinehow long these anti-HER2 antibody’s effects would last, wehave investigated the effect of anti-HER2 antibody on p27Kip1

protein, G1 cell cycle arrest, and cell growth over a prolongedperiod of time. To limit cell growth to less than 75% confluency,low cell densities of cells were plated (BT474 cells at 1 � 105;SKBr3 cells at 1.5 � 104 in a 100-mm culture dish). Afterincubation overnight, the cells were treated with a single doseof anti-HER2 antibody (trastuzumab or 4D5) or control reagent

(hIgG for trastuzumab; MOPC21 for 4D5) up to 1 week. Cellson day 3–7 after treatment were then harvested for enumera-tion of cells with a Coulter counter, p27Kip1 protein detection byWestern immunoblot, and cell cycle analysis by flow cytometry.As shown in Fig. 5A, trastuzumab induced an increase inp27Kip1 protein, which was above control level on day 3 and day5 in BT474 cells. Beyond 5 days, the levels of p27Kip1 protein oftrastuzumab- and control hIgG-treated cells were similar (datanot shown). Accordingly, treatment with trastuzumab pro-duced an average of 84.8% of BT474 cells in cell cycle G1

fraction on day 3 and 81.3% on day 5, whereas treatment withcontrol hIgG produced an average of 67.4% of cells in the G1

fraction on day 3 and 68.9% on day 5 (Fig. 5B). Beyond 5 days,the percentage of G1 fraction from trastuzumab- and controlhIgG-treated cells was not significantly different (data notshown). As the result of the p27Kip1 up-regulation and G1

arrest, trastuzumab produced 50% anchorage-dependentgrowth inhibition on day 3 and day 5 compared with a hIgGcontrol (Fig. 5C). Significant growth inhibition by trastuzumabwas seen on day 6 and day 7 (data not shown).

Similarly, 4D5 induced an increase in p27Kip1 protein, whichwas above the control level on day 3 and day 5 in SKBr3 cells(Fig. 5D). Beyond 5 days, the levels of p27Kip1 protein in 4D5-and control MOPC21-treated cells were not distinguishable(data not shown). Accordingly, 4D5 treatment resulted in anaverage of 71.2% of SKBr3 cells in the G1 phase of cell cycle onday 3 and 68.3% on day 5, whereas control MOPC21 generatedan average of 56.2% of cells in G1 fraction on day 3 and 58.1%on day 5 (Fig. 5E). Beyond 5 days, the percentage of cells in G1

after treatment with 4D5 and with control MOPC21 was notsignificantly different (data not shown). As the result of thep27Kip1 up-regulation and G1 arrest, 4D5 generated about 34%anchorage-dependent growth inhibition on day 3 and 50% onday 5 compared with MOPC21 control (Fig. 5F). Comparedwith control, significant growth inhibition by 4D5 lasted on day6 and day 7 (data not shown). Taken together, these datademonstrate that a single dose treatment of anti-HER2 anti-body induces a long-lasting p27Kip1 up-regulation, G1 cell cyclearrest, and growth inhibition in HER2-overexpressing breastcancer cells. These data reiterate the correlation of G1 arrestinduced by anti-HER2 antibody with the level of p27Kip1 pro-tein. Above data also indicate, however, that there is no time-dependent correlation of growth inhibition induced by anti-HER2 antibody with the level of p27Kip1 protein.

Induced Expression of p27Kip1 Produces G1 Cell Cycle Arrestand Growth Inhibition Similar to That Observed with Anti-HER2 Antibody—To demonstrate the important role of p27Kip1

protein in anti-HER2 antibody-induced G1 cell cycle arrest andgrowth inhibition, a recombinant adenovirus vector expressinga doxycycline-controlled human p27Kip1 (Adp27, Tet-Off form)has been created. Based on our previous experience (33), wehave first tested the Adp27 in SKBr3 breast cancer cells thatoverexpress HER2 protein. As expected, Adp27 did not expressinduced p27Kip1 protein that was tagged with c-Myc in thepresence of doxycycline (Fig. 6A), suggesting there was noleakage of this inducible system at indicated m.o.i. values. Inthe absence of doxycycline, Adp27 was induced to expressp27Kip1 protein in an m.o.i.-dependent manner (Fig. 6A), sug-gesting effective control of p27Kip1 in this adenovirus system.Accordingly, induced Adp27 produced an average of 59.6% cellsin G1 phase at an m.o.i. of 2 and 79.8% at an m.o.i. of 20,whereas uninduced Adp27 produced an average of 47.0% in G1

phase at 2 m.o.i. and 48.3% at 20 m.o.i. (Fig. 6B). As shown inFig. 6C, induced Adp27 at 2 m.o.i. resulted in an average of 16%anchorage-dependent growth inhibition compared with unin-duced Adp27, whereas induced Adp27 at 20 m.o.i. resulted in

FIG. 3. Anti-HER2 antibody induces an irreversible increase inp27Kip1 protein and a corresponding G1 cell cycle arrest. A,schematic illustration of the experimental design. BT474 cells weretreated with or without trastuzumab at 10 �g/ml. B, measurement ofp27Kip1 protein by Western blotting and of cell cycle distribution by flowcytometry. Results in this figure are representative of three replicateexperiments. For the protein loading control, the same blot wasstripped and re-probed with an anti-�-actin antibody. The asterisk (*)indicates a statistically significant difference compared with the un-treated control.

Role of p27Kip1 in Anti-tumor Effects of Anti-HER2 Antibody 23445

by guest, on February 20, 2013

ww

w.jbc.org

Dow

nloaded from

an average of 40% anchorage-dependent growth inhibitioncompared with uninduced Adp27. In addition to SKBr3 cells,we have also tested Adp27 in another HER2-overexpressingbreast cancer cell line, BT474, and obtained similar results(data not shown). These observations clearly illustrated that

expression of p27Kip1 protein resulted in p27Kip1 level-depend-ent G1 cell cycle arrest and growth inhibition. Thus, these datastrongly indicate the importance of p27Kip1 protein in anti-HER2 antibody-induced G1 cell cycle arrest and growthinhibition.

FIG. 4. Growth inhibition induced by anti-HER2 antibody correlates with the induced level of p27Kip1 protein. BT474 cells weretreated with 4D5 at the concentrations indicated. A, anchorage-dependent growth assay was performed in 96-well microplates as described under“Experimental Procedures.” B, measurement of p27Kip1 protein by Western blot analysis. BT474 cells at similar cell density to the microplategrowth assay were plated into 100-mm culture dishes and treated for 48 h with 4D5 or control antibody at similar conditions. C, anchorage-independent growth assay was measured by clonogenic growth in soft agar as described under “Experimental Procedures.” D, measurement ofp27Kip1 protein by Western blot analysis. BT474 cells at similar cell density to the colony-formation assay were plated into 100-mm culture dishesand treated with 4D5 or control antibody at similar concentrations for 48 h. Results in this figure are representative of three replicate experiments.

FIG. 5. Anti-HER2 antibody induces a long-lasting up-regulation of p27Kip1 protein, G1 cell cycle arrest, and growth inhibition.BT474 cells (panels A–C) at cell density of 1 � 105 per 100-mm cell culture dish were treated with a single dose of trastuzumab or control hIgGfor different time intervals. Cells on day 3 and day 5 after treatment were then harvested and enumerated with a Coulter counter, p27Kip1 proteinwas measured, and cell cycle was analyzed. A, detection of p27Kip1 by Western blot analysis. For the protein loading control, the same blot wasstripped and re-probed with an anti-�-actin antibody. B, cell cycle distribution by flow cytometry. C, cell growth measured with a Coulter counter.*, p � 0.012 compared with day 3 hIgG control; **, p � 0.001 compared with day 5 hIgG control. HCT, Herceptin�, represents trastuzumab. SKBr3cells (1.5 � 104 in a 100-mm culture dish) (panels D–F) were treated with a single dose of 4D5 or control MOPC21 as described above. D, detectionof p27Kip1 by Western blot analysis. For the protein loading control, the same blot was stripped and re-probed with an anti-�-actin antibody. E, cellcycle distribution by flow cytometry. F, cell growth measured with a Coulter counter. The dagger (†) indicates a statistically significant differencefrom day 3 MOPC21 control (p � 0.04); the double dagger (‡) denotes a statistically significant difference from day 5 MOPC21 control (p � 0.009).Results in this figure are representative of three replicate experiments.

Role of p27Kip1 in Anti-tumor Effects of Anti-HER2 Antibody23446

by guest, on February 20, 2013

ww

w.jbc.org

Dow

nloaded from

Silencing Expression of p27Kip1 Blocks Anti-HER2 Antibody-mediated Induction of p27Kip1 Protein and G1 Arrest—To fur-ther demonstrate the important role of p27Kip1 protein in anti-HER2 antibody-induced G1 cell cycle arrest, we have employedthe p27Kip1 SiRNA approach to silence the expression ofp27Kip1. If p27Kip1 expression is critical to anti-HER2 antibody-induced G1 cell cycle arrest, the effect of anti-HER2 antibody onG1 arrest should be dramatically decreased when p27Kip1 ex-pression is impaired. Two p27Kip1 SiRNAs (1 and 2) that wehave selected in this study were capable of effectively silencingp27Kip1 expression in SKBr3 cells after 48 h of transfection asshown in Fig. 7A. 4D5-induced p27Kip1 protein was completelyblocked in cells treated with p27Kip1 SiRNA 1, whereas 4D5-induced p27Kip1 protein was not significantly affected in cellstreated with control SiRNA (Fig. 7B). A similar effect on 4D5-induced p27Kip1 protein was observed with p27Kip1 SiRNA 2(data not shown). In agreement with the level of p27Kip1 pro-tein, 4D5-induced G1 arrest was also completely prevented incells treated with p27Kip1 SiRNA 1, whereas 4D5-inducedp27Kip1 protein was not significantly affected in cells treatedwith control SiRNA (Fig. 7C). Thus, the important role ofp27Kip1 protein in anti-HER2 antibody-induced G1 cell cyclearrest is further confirmed.

Anti-HER2 Antibody Significantly Increases the Half-life ofp27Kip1 Protein—Our preliminary data obtained from Northernblots and reverse transcription-PCR suggested that anti-HER2antibody did not increase the amount of p27Kip1 mRNA (datanot shown). Thus, anti-HER2 antibody may up-regulatep27Kip1 protein primarily through post-translational mecha-nisms. To confirm that anti-HER2 antibody-induced p27Kip1

protein is because of post-translational events, we have meas-ured the half-life of p27Kip1 protein. BT474 cells were treatedwith trastuzumab for 48 h and then treated with an inhibitor of

protein synthesis, cycloheximide, at 5 �g/ml, for different timeintervals as indicated in Fig. 8A. Cells were harvested forWestern blot analysis to check the level of p27Kip1 protein. Asshown in Fig. 8A, the level of p27Kip1 protein in trastuzumab-treated cells declined gradually with time but at a much slowerrate than in hIgG-treated cells. After normalization of p27Kip1

expression with the loading control (�-actin), the half-life ofp27Kip1 protein in trastuzumab-treated cells was about 5.0 h,whereas the half-life of p27Kip1 protein in hIgG-treated cellswas about 1.8 h (Fig. 8B). The prolonged half-life of p27Kip1

protein in anti-HER2 antibody-treated cells was also confirmedby the 35S-labeled pulse-chase experiments (data not shown).Therefore, these results illustrate that anti-HER2 antibodysignificantly increases the half-life of p27Kip1 protein and sug-gest the accumulation of p27Kip1 protein induced by anti-HER2antibody results from post-translational mechanisms.

Anti-HER2 Antibody Significantly Decreases ThreoninePhosphorylation of p27Kip1 Protein at Position 187 and In-creases Serine Phosphorylation of p27Kip1 Protein at Position10—The results described above support the idea that anti-HER2 antibody induces p27Kip1 expression through post-trans-lational regulation. Ubiquitin-proteasome proteolysis plays amajor role in regulating p27Kip1 protein (12). We have testedthe importance of this mechanism in SKBr3 cells using anubiquitin-proteasome inhibitor MG132. As shown in Fig. 9A,treatment with MG132 significantly increased the level ofp27Kip1 protein, whereas the inhibition of calpain or caspaseactivity did not alter p27Kip1 expression. These data supportthe important role of ubiquitin-proteasome proteolysis in reg-ulation of p27Kip1 protein in SKBr3 cells. Phosphorylation ofp27Kip1 protein has been widely recognized to be one of themajor post-translational mechanisms that regulate the abun-dance of this protein (10, 12–15). Phosphorylation of p27Kip1

FIG. 6. Induced expression of p27Kip1 protein produces G1 cell cycle arrest and growth inhibition similar to that observed withanti-HER2 antibody. SKBr3 cells (2 � 105) were seeded in 100-mm cell culture dishes and incubated overnight at 37 °C. Cells were thencoinfected with a regulatory virus (adeno-X Tet-Off) and Ad-Myc-p27Kip1 virus at different m.o.i. values or at an m.o.i. of 20 in presence (�) ofabsence (�) of doxycycline. After 72 h, cells were harvested for enumeration with a Coulter counter, Western blot analysis, and cell cycle analysis.A, detection of Myc-p27Kip1 by Western blot analysis with an anti-Myc antibody. For the protein loading control, the same blot was stripped andre-probed with an anti-�-actin antibody. B, effect of induced Myc-p27Kip1 on cell cycle distribution. The dagger (†) indicates a statisticallysignificant difference from the uninduced group with an m.o.i. of 2; the double dagger (‡) denotes a statistically significant difference from theuninduced group with an m.o.i. of 20. C, effect of induced Myc-p27Kip1 on growth inhibition. The asterisk (*) indicates a statistically significantdifference from the uninduced group with an m.o.i. of 20. Results in this figure are representative of three replicate experiments.

Role of p27Kip1 in Anti-tumor Effects of Anti-HER2 Antibody 23447

by guest, on February 20, 2013

ww

w.jbc.org

Dow

nloaded from

protein at Threonine 187 (Thr-187) by CDK2 results in therecognition by E3 proteasome complex for protein degradation(13–15). Phosphorylation of p27Kip1 protein at Serine 10 (Ser-10) has been shown to dramatically increase the expression ofthis protein (16, 17). Consequently, we have investigated thephosphorylation status at these two common sites of p27Kip1

protein using site- and phospho-specific antibodies againstphosphorylated p27Kip1 protein. As shown in Fig. 9B, anti-HER2 antibody 4D5 considerably decreased the T187 phospho-rylation of p27Kip1 protein in SKBr3 cells. At the same time,4D5 considerably increased the Ser-10 phosphorylation ofp27Kip1 protein (Fig. 9B). The level of Jab1, a regulator ofp27Kip1 expression (18, 19), decreased only slightly. Similarly,anti-HER2 antibody trastuzumab decreased Thr-187 phospho-rylation and increased Ser-10 phosphorylation of p27Kip1 pro-tein in another breast cancer cell line, BT474 (Fig. 9C). Theeffect of Ser-10 phosphorylation and Thr-187 phosphorylationon anti-HER2 antibody-induced G1 cell cycle arrest was furtherinvestigated using p27 mutants (12) and pGFP co-transfectionas described under “Experimental Procedures” and in Fig. 10A.The GFP transfection efficiency for vectors expressing wild-type p27, S10A p27 (serine 10 was converted to alanine 10), andT187A p27 (threonine 187 was converted to alanine 187)ranged from 34 to 50%. Because the ratio of individual geneexpression vector to GFP vector used in the transfection was4:1, GFP-positive cells were considered to simultaneously ex-press the individual gene of interest. As shown in Fig. 10B,S10A p27 expression increased the fraction of cells in G1 andrendered the cells much less sensitive to 4D5-induced G1 arrestthan was observed after transfection of a control vector orwild-type p27. These results confirm Ser-10 phosphorylation is

important to anti-HER2 antibody-induced G1 arrest. Cells ex-pressing T187A p27 also showed less sensitivity to 4D5-in-duced G1 arrest (Fig. 10B). As anti-HER2 antibody decreasesThr-187 phosphorylation, the T187A mutant p27Kip1 proteinalready lacks phosphorylation and should not respond to anti-body. Taken together, these results showed that regulation ofthe phosphorylation of p27Kip1 protein might present one of thepost-translational mechanisms by which anti-HER2 antibodyup-regulates the protein. The data strongly suggest the differ-ent role of Thr-187 and Ser-10 phosphorylation in regulation ofp27Kip1 protein, in which phosphorylation of p27Kip1 protein atThr-187 promotes protein degradation, whereas phosphoryla-tion of p27Kip1 protein at Ser-10 stabilizes the protein.

DISCUSSION

Our data demonstrate that p27Kip1 plays a critical role in theanti-HER2 antibody-induced G1 cell cycle arrest and tumorgrowth inhibition. p27Kip1 up-regulation and corresponding G1

cell cycle arrest induced by anti-HER2 antibody are not onlyconcentration-dependent but also time-dependent. The magni-tude of G1 cell cycle arrest induced by anti-HER2 antibody iscorrelated well with the level of p27Kip1 protein induced. Themagnitude of growth inhibition of breast cancer cells treatedwith anti-HER2 antibody parallels closely the level of p27Kip1

induced. Induced expression of exogenous p27Kip1 with an in-ducible system results in a similar G1 cell cycle arrest andgrowth inhibition to that obtained with anti-HER2 antibody.Inhibition of p27Kip1expression by p27Kip1 antisense cDNA sig-nificantly impairs, but does not completely eliminate, anti-HER2 antibody-induced p27Kip1 protein, G1 arrest, and growthinhibition. Our data also illustrate that the majority of G1

arrest induced by anti-HER2 antibody can no longer be re-moved after 14 h of treatment. Anti-HER2 antibody-inducedp27Kip1 protein, G1 arrest, and growth inhibition last at least 5

FIG. 7. Silencing expression of p27Kip1 blocks anti-HER2 anti-body-mediated induction of p27Kip1 protein and G1 arrest. SKBr3cells seeded on six-well plate were transfected with p27 SiRNA duplexor with control SiRNA using Oligofectamine reagent according to themanufacturer’s protocol. A, both p27 SiRNA 1 and 2 diminished thelevel of p27Kip1 protein after 48 h of transfection. A representativeWestern blot of p27Kip1 expression was shown. For the protein loadingcontrol, the same blot was stripped and re-probed with an anti-�-actinantibody. B, p27 SiRNA blocked 4D5-induced p27Kip1 expression.SKBr3 cells were transfected with SiRNA for 36 h and then treatedwith 4D5 (3 �g/ml) for another 24 h. Cells were collected for proteinblotting and cell cycle analysis. C, p27 SiRNA blocked 4D5-induced G1arrest. SKBr3 cells were treated as described in B. Cell cycle distribu-tion was determined by flow cytometry. Results are representative oftwo replicate analyses.

FIG. 8. Anti-HER2 antibody significantly increases the half-life of p27Kip1 protein. BT474 cells at a density of 6 � 105 per 100-mmcell culture dish were treated with 10 �g/ml of trastuzumab or hIgG for48 h. Cells were then washed and treated with 5 �g/ml of cycloheximide(CHX) for the indicated time intervals. Cells were harvested and sub-jected to total protein preparation and Western blot analysis withanti-p27Kip1 and anti-�-actin antibodies. A, a Western blot is shownthat is representative of three replicate analyses. B, semi-quantitationof p27Kip1 expression shown in A. Results were normalized according tothe level of �-actin control. The p27Kip1 expression of both trastuzumaband hIgG group at the 0-h interval was set as 1 unit.

Role of p27Kip1 in Anti-tumor Effects of Anti-HER2 Antibody23448

by guest, on February 20, 2013

ww

w.jbc.org

Dow

nloaded from

days after a single treatment. Our data further demonstratethat anti-HER2 antibody increases the half-life of p27Kip1 pro-tein. Anti-HER2 antibody is able to decrease threonine phos-phorylation of p27Kip1 protein at position 187 and increaseserine phosphorylation of p27Kip1 protein at position 10. There-fore, up-regulation of p27Kip1 by anti-HER2 antibody occurs

primarily through post-translational mechanisms. Regulationof the phosphorylation of p27Kip1 protein is identified as one ofthe post-translational mechanisms by which anti-HER2 anti-body up-regulates the protein.

Defining the role of p27Kip1 in the anti-HER2 antibody-in-duced G1 cell cycle arrest and tumor growth inhibition is im-

FIG. 9. Anti-HER2 antibody significantly decreases threonine phosphorylation of p27Kip1 protein at position 187 and increasesserine phosphorylation of p27Kip1 protein at position 10. A, only the inhibitor of proteasome degradation pathway up-regulated p27Kip1

expression. SKBr3 cells were treated with a proteasome inhibitor MG132 (5 �M), a broad inhibitor of caspases (60 �M), or a calpain inhibitor,PD151746 (5 �M), for 24 h. Total protein was then prepared for Western blot analysis. B, 4D5 decreased Thr-187 phosphorylation and increasedSer-10 phosphorylation of p27Kip1 protein in SKBr3 cells. SKBr3 cells were treated for 24 h with 4D5 at different concentrations or with diluent,and total proteins were prepared as described under “Experimental Procedures.” Western blot analysis was performed to detect different proteins.Filters were first blotted with an anti-phospho-Thr-187 p27Kip1 antibody and then stripped and re-probed with different antibodies in the followingorder: phospho-Ser-10 p27Kip1, Jab1, �-actin, and total p27Kip1. These results were representative of two independent experiments. C, trastuzumabdecreased Thr-187 phosphorylation and increased Ser-10 phosphorylation of p27Kip1 protein in BT474 cells. BT474 cells were treated with orwithout trastuzumab (10 �g/ml) for 48 h. Total protein was prepared for Western blot analysis using different antibodies in the following order:phospho-Ser-10 p27Kip1, phospho-Thr-187 p27Kip1, and total p27Kip1.

FIG. 10. Expression of p27Kip1 mu-tants causes G1 arrest and decreasessensitivity to anti-HER2 antibody-in-duced G1 arrest. A, flow cytometricanalysis of GFP-positive cells. SKBr3cells were transiently transfected withthe appropriate expression plasmids(p27Kip1 wild-type, p27Kip1 S10A, orp27Kip1 T187A) plus pEGFP-F vector us-ing LipofectAMINE-2000. Cells were col-lected after 48 h of transfection and fixedin 0.25% paraformaldehyde for 1.5 h andthen stained with propidium iodide solu-tion. The GFP-positive population wasgated. The numbers shown as an inset inthe histogram were a percentage of GFP-positive cells. B, p27Kip1 S10A and p27Kip1

T187A mutants caused less sensitivity toanti-HER2 antibody-induced G1 arrestthan p27Kip1 wild-type and control vector.SKBr3 cells were treated as describedin A. Cells on individual dish weretrypsinized and re-seeded in two identicaldishes after 24 h of transfection. One dishwas treated with anti-HER2 antibody4D5, and the other was treated with dil-uent for another 24 h. Cells were thensubjected to cell cycle analysis. The cellcycle distribution of the GFP-positive pop-ulation was determined. The GFP-posi-tive rate in empty vector pcDNA3.0 wasused to normalize other plasmids’ differ-ent transfection efficiencies. Representa-tive data were shown from two separateexperiments.

Role of p27Kip1 in Anti-tumor Effects of Anti-HER2 Antibody 23449

by guest, on February 20, 2013

ww

w.jbc.org

Dow

nloaded from

portant. p27Kip1 protein appears to be a critical downstreamtarget of signaling through HER2 molecule. Elucidation of therole p27Kip1 in the anti-HER2 antibody-induced tumor growthinhibition also indicates that any factors that affect p27Kip1

level might also influence anti-HER2 antibody-induced tumorgrowth inhibition. Modulation of p27Kip1 protein by multiplepathways might be exploited in the treatment of cancer inanimal models and ultimately in clinical trials that includetrastuzumab. At a minimum, levels of p27Kip1 protein observedafter trastuzumab therapy might be an intermediate biomar-ker for response to the antibody alone.

Expression of p27Kip1 protein is a short event as the proteingenerally has short half-life as shown in Fig. 8. However,growth inhibition of HER2-overexpressing cancer cells inducedby the antibody is a long-lasting event as the effect is cumula-tive. Therefore, the time-dependent correlation betweengrowth and the level of p27Kip1 protein could not be established.Recently, Yakes et al. (31) reported that antisense oligodeoxyri-bonucleotide of p27Kip1 prevented trastuzumab-induced reduc-tion of cells in S phase and induction of cells in G1 phase,confirming our observation shown in Fig. 7.

In this study, we provide data to indicate that anti-HER2antibody needs at least 14 h to exhibit its anti-tumor effects onG1 arrest and p27Kip1 up-regulation. After 14 h, 90% of theanti-tumor effect of anti-HER2 antibody can no longer be re-moved. Our data also indicate that a single dose of anti-HER2antibody produces a long-lasting p27Kip1 up-regulation and G1

cell cycle arrest for at least 5 days and inhibits cancer cellgrowth for at least a week. These results are consistent withthe administration of trastuzumab to patients on a weeklybasis in clinic. In a severe combined immunodeficient micemodel, Tokuda et al. (34) also showed that a single dose oftrastuzumab inhibited about 50% tumor growth of HER2-over-expressing 4–1ST human gastric carcinoma.

Our data support the notion that p27Kip1 up-regulation byanti-HER2 antibody is through a post-translational mecha-nism. Regulation of p27Kip1 phosphorylation by anti-HER2 an-tibody is one of the mechanisms leading to stabilization andaccumulation of the protein. Recent reports have shown thatdifferent phosphorylation patterns of p27Kip1 determine itsbinding to cyclin D1 or to cyclin E (35). Thr-187 and Ser-10 aretwo major sites for p27Kip1 phosphorylation that regulate itsabundance in the cell (13–17). Degradation of p27Kip1 proteindepends on phosphorylation of Thr-187 by cyclin E�CDK2 com-plex, transportation form the nucleus to the cytoplasm andthen ubiquitination mediated by SCFSkp2, and finally proteol-ysis by the 26 S proteasome (10–15). How phosphorylation ofSer-10 increases the stability of p27Kip1 protein is still un-known. Two new phosphorylation sites on p27Kip1 have beenidentified recently. Three independent groups (36–38) havereported that Threonine 157 of p27Kip1 can be phosphorylatedby protein kinase B/AKT. Fujita et al. (39) found that Threo-nine 198 of p27Kip1 could also be phosphorylated by proteinkinase B/AKT. Threonine 157 and 198 phosphorylation havebeen linked to regulate the cellular localization of p27Kip1, inthat phosphorylation of these two sites blocks nuclear import ofp27Kip1 (16, 17, 36–39). Thus, different phosphorylation eventscan affect not only the levels of p27Kip1 protein but also itssubcellular localization. It will be worthwhile to investigate theimpact of trastuzumab treatment on Threonine 157 and 198phosphorylation of p27Kip1 protein.

Acknowledgments—We sincerely thank Genentech Corp. (South SanFrancisco, CA) for providing trastuzumab (Herceptin®) and 4D5 mono-clonal antibodies against HER2; Dr. K. Nakayama, Departments ofMolecular and Cellular Biology and Molecular Genetics, Medical Insti-tute of Bioregulation, Kyushu University, Fukuoka, Japan for provid-ing the p27Kip1 wild-type and mutant constructs; and Karen Ramirez,Flow Cytometry Core Laboratory (Smith Research Building), M. D.Anderson Cancer Center, Houston, TX for expert assistance with flowcytometry analysis.

REFERENCES

1. Harari, D., and Yarden, Y. (2000) Oncogene 19, 6102–61142. Stern, D. F. (2000) Breast Cancer Res. 2, 176–1833. Yarden, Y., and Sliwkowski, M. X. (2001) Nat. Rev. Mol. Cell. Biol. 2, 127–1374. Mendelsohn, J., and Baselga, J. (2000) Oncogene 19, 6550–65655. Pegram, M. D., and Slamon, D. J. (2000) Cancer Treat. Res. 103, 57–756. Cobleigh, M., Vogel, C., Tripathy, D., Robert, N. J., Scholl, S., Fehrenbacher,

L., Wolter, J. M., Paton, V., Shak, S., Lieberman, G., and Slamon, D. J.(1999) J. Clin. Oncol. 17, 2639–2648

7. Vogel, C., Cobleigh, M., Tripathy, D., Gutheil, J. C., Harris, L. N.,Fehrenbacher, L., Slamon, D. J., Murphy, M., Novotny, W. F., Burchmore,M., Shak, S., Stewart, S. J., and Press, M. (2002) J. Clin. Oncol. 20, 719–726

8. Slamon, D., Leyland-Jon, B., Shak, S., Fuchs, H., Paton, V., Bajamonde, A.,Fleming, T., Eiermann, W., Wolter, J., Pagrem, M., Baselga, J., and Norton,L. (2001) N. Engl. J. Med. 344, 783–792

9. Sherr, C. J., and Roberts, J. M. (1999) Genes Dev. 13, 1501–151210. Philipp-Staheli, J., Payne, S. R., and Kemp, C. J. (2001) Exp. Cell Res. 264,

148–16811. Hengst, L., and Reed, S. I. (1996) Science 271, 1861–186412. Pagano, M., Tam, S. W., Theodoras, A. M., Beer-Romero, P., Del Sal, G., Chau,

V., Yew, P. R., Draetta, G. F., and Rolfe, M. (1995) Science 269, 682–68513. Vlach, J., Hennecke, S., and Amati, B. (1997) EMBO J. 16, 5334–534414. Harper, J. W. (2001) Curr. Biol. 11, R431-R-43515. DeSalle, L. M., and Pagano, M. (2001) FEBS Lett. 490, 179–18916. Ishida, N., Kitagawa, M., Hatakeyama, S., and Nakayama, K. (2000) J. Biol.

Chem. 275, 25146–2515417. Boehm, M., Yoshimoto, T., Crook, M. F., Nallamshetty, S., True, A., Nabel,

G. J., and Nabel, E. G. (2002) EMBO J. 21, 3390–340118. Tomoda, K., Kubota, Y., and Kato, J. (1999) Nature 398, 160–16519. Chopra, S., Fernandez, D., Mattos, S., Lam, E. W., and Mann, D. J. (2002)

J. Biol. Chem. 277, 32413–3241620. Yang, H. Y., Zhou, B. P., Hung, M. C., and Lee, M. H. (2000) J. Biol. Chem. 275,

24735–2473921. Bruni, P., Boccia, A., Baldassarre, G., Trapasso, F., Santoro, M., Chiappetta,

G., Fusco, A., and Viglietto, G. (2000) Oncogene 19, 3146–531522. Jonuleit, T., van der Kuip, H., Miething, C., Michels, H., Hallek, M., Duyster,

J., and Aulitzky, W. E. (2000) Blood 96, 1933–193Y923. Nakayama, K., Ishida, N., Shirane, M., Inomata, A., Inoue, T., Shishido, N.,

Horii, I., Loh, D. Y., and Nakayama, K. (1996) Cell 85, 707–72024. Fero, M. L., Rivkin, M., Tasch, M., Porter, P., Carow, C. E., Firpo, E., Polyak,

K., Tsai, L. H., Broudy, V., Perlmutter, R. M., Kaushansky, K., and Roberts,J. M. (1996) Cell 85, 733–744

25. Le, X.-F., McWatters, A., Wiener, J., Mills, G. B., and Bast, R. C., Jr. (2000)Clin. Cancer Res. 6, 260–270

26. Neve, R. M., Sutterluty, H., Pullen, N., Lane, H. A., Daly, J. M., Krek, W., andHynes, N. E. (2000) Oncogene 19, 1647–5166

27. Pietras, R. J., Poen, J. C., Gallardo, D., Wongvipat, P. N., Lee, H. J., andSlamon, D. J. (1999) Cancer Res. 59, 1347–1355

28. Ye, D. W., Fan, Z., and Mendelsohn, J. (1999) Oncogene 18, 731–73829. Sliwkowski, M. X., Lofgren, J. A., Lewis, G. D., Hotaling, T. E., Fendly, B. M.,

and Fox, J. A. (1999) Semin. Oncol. 26, Suppl. 12, 60–7030. Lane, H. A., Beuvink, I., Motoyama, A. B., Daly, J. M., Neve, R. M., and Hynes,

N. E. (2000) Mol. Cell. Biol. 20, 3210–322331. Yakes, F. M., Chinratanalab, W., Ritter, C. A., King, W., Seelig, S., and

Arteaga, C. L. (2002) Cancer Res. 62, 4132–414132. Pegram, M. D., Finn, R. S., Arzoo, K., Beryt, M., Pietras, R. J., and Slamon,

D. J. (1997) Oncogene 15, 537–54733. Le, X.-F., Marcelli, M., McWatters, A., Nan, B., Mills, G. B., O’Brian, C. A., and

Bast, R. C., Jr. (2001) Oncogene 20, 8258–826934. Tokuda, Y., Ohnishi, Y., Shimamura, K., Iwasawa, M., Yoshimura, M.,

Ueyama, Y., Tamaoki, N., Tajima, T., and Mitomi, T. (1996) Br. J. Cancer73, 1362–1365

35. Ciarallo, S., Subramaniam, V., Hung, W., Lee, J. H., Kotchetkov, R., Sandhu,C., Milic, A., and Slingerland, J. M. (2002) Mol. Cell. Biol. 22, 2993–3002

36. Liang, J., Zubovitz, J., Petrocelli, T., Kotchetkov, R., Connor, M. K., Han, K.,Lee, J. H., Ciarallo, S., Catzavelos, C., Beniston, R., Franssen, E., andSlingerland, J. M. (2002) Nat. Med. 8, 1153–1160

37. Shin, I., Yakes, F. M., Rojo, F., Shin, N. Y., Bakin, A. V., Baselga, J., andArteaga, C. L. (2002) Nat. Med. 8, 1145–1152

38. Viglietto, G., Motti, M. L., Bruni, P., Melillo, R. M., D’Alessio, A., Califano, D.,Vinci, F., Chiappetta, G., Tsichlis, P., Bellacosa, A., Fusco, A., and Santoro,M. (2002) Nat. Med. 8, 1136–1144

39. Fujita, N., Sato, S., Katayama, K., and Tsuruo, T. (2002) J. Biol. Chem. 277,28706–28713

Role of p27Kip1 in Anti-tumor Effects of Anti-HER2 Antibody23450

by guest, on February 20, 2013

ww

w.jbc.org

Dow

nloaded from