c

hile,

, Peru

mid,

all

mbrane

Research in Microbiology 156 (2005) 472–477

www.elsevier.com/locate/resmi

The product of theqacCgene ofStaphylococcus epidermidisCHmediates resistance toβ-lactam antibiotics in Gram-positive and

Gram-negative bacteria

Derie E. Fuentesa, Claudio A. Navarroa, Juan C. Tantaleánb, Manuel A. Arayaa,Claudia P. Saavedrac, José M. Péreza, Iván L. Calderóna, Phil A. Youderiand, Guido C. Morac,

Claudio C. Vásqueza,∗

a Laboratorio de Microbiología Molecular, Departamento de Ciencias Biológicas, Facultad de Química y Biología, Universidad de Santiago de CCasilla 40, Correo 33, Santiago, Chile

b Universidad San Luis Gonzaga de Ica, Facultad de Ciencias, Laboratorio de Microbiología Industrial y Biotecnología, Av. Los Maestros s/n, Icac Departamento de Ciencias Biológicas, Universidad Andrés Bello, República 237, Santiago, Chile

d Department of Biology, Texas A&M University, College Station, TX, USA

Received 20 September 2004; accepted 3 January 2005

Available online 26 January 2005

Abstract

We have characterized a natural isolate ofStaphylococcus epidermidisresistant to heavy metals that carries a small 2391-bp plaspSepCH, encoding theqacCgene. TheS. epidermidis qacCgene confers resistance to a number ofβ-lactam antibiotics and to ethidiumbromide in its natural host and inEscherichia coliK12 andSalmonella entericasv. Typhimurium. This is the first communication of a smmultidrug resistance (SMR) pump involved in resistance toβ-lactam antibiotics. Experiments usingtolC, ompWandompDmutant strainsof S. Typhimurium demonstrated that theβ-lactam antibiotic resistance conferred by this pump does not depend on these outer meproteins. 2005 Elsevier SAS. All rights reserved.

Keywords: qacC; Multidrug resistance;Staphylococcus epidermidis; β-Lactam resistance; Ethidium bromide; SMR

m-ds,tics.y offfluxrter,tes.ple,id to

nce

psheseex-ll-cid

tiveare

tive-ellu-

1. Introduction

Both prokaryotic and eukaryotic cells have integral mebrane proteins that mediate the efflux of toxic compounand thereby confer a basal level of resistance to antibioThese efflux transporters exhibit an extraordinary varietspectra of substrate specificities. A subset of these epumps, including the classical TetA tetracycline transpoexports only a small group of structurally related substraIn contrast, other exporters confer resistance to multistructurally unrelated classes of compounds, and are sa

* Corresponding author.

E-mail address:cvasquez@lauca.usach.cl (C.C. Vásquez).

0923-2508/$ – see front matter 2005 Elsevier SAS. All rights reserved.doi:10.1016/j.resmic.2005.01.002

be multidrug transporters, and confer multidrug resista(MDR) [6,9].

To date, five major phylogenetic families of MDR pumhave been recognized in eubacteria [4,11,16]. One of tfamilies, the small multidrug resistance (SMR) proteins,hibit only four transmembraneα-helices and are the smaest of the MDR transporters, typically 100–120 amino aresidues long.

The structure of the Gram-positive and Gram-negabacterial membranes in which these MDR transportersembedded are fundamentally different. Most Gram-posibacteria, includingStaphylococcusspp., lack an outer membrane and the abundant porins characteristic of this subc

lar compartment. Thus, the majority of MDR efflux pumps

D.E. Fuentes et al. / Research in Microbiology 156 (2005) 472–477 473

gralm-no

ro-ter

asua-an-the

-ef-e toBr)

linecef-osts

of

sted

illinryse-e-er-

-nda

r

y

n

andM

sitiveo-ery-n-NA

o-

e

las-ri-ique

re-s-ide

has

-

BAr the1%vors

e

fers

s

in Gram-positive bacteria depend only on a single intemembrane protein. In contrast, MDR efflux pumps in Granegative bacteria may be multicomponent, and dependonly upon the function of an integral inner membrane ptein, but also on the function of periplasmic and/or oumembrane proteins [3,13].

Historically, the SMR pumps have been recognizedmediators of the extrusion of a number of ammonium qternary compounds (QACs), including commonly usedtiseptics and detergents [8]. In this work we report thatsingle-component, SMR pump, QacC ofS. epidermidisCH,mediates low-level resistance toβ-lactam antibiotics including oxacillin, cephaloridine, cefazoline, cephadroxil and ctazidine, and is also responsible for marginal resistancseveral QACs and dyes including ethidium bromide (Etin its natural host. However, the staphylococcalqacCgeneconfers a higher level of resistance to oxacillin, cefazoand cephaloridine and, to a lesser extent, cephadroxil,tazidine and EtBr, when expressed in Gram-negative has Escherichia coliand Salmonella entericaserovar Ty-phimurium. To our knowledge this is the first reporta SMR pump involved in resistance toβ-lactam antibi-otics.

2. Materials and methods

2.1. Strains and growth conditions

Bacterial strains and plasmids used in this study are liin Table 1. Cells were grown in Luria broth [14] at 37◦Cwith shaking. Solid media contained 2% agar and ampicat 100 µg/ml was added when required. Minimal inhibitoconcentration (MIC) determinations were performed byrial dilutions in liquid media after 24 h of growth as prviously described [2]. Growth inhibition zones were detmined in solid media as described [12].

Staphylococcus epidermidisCH was isolated from an effluent sample of a copper mining company in the Segu

Table 1Plasmids and strains used in this study

Strain or plasmid Relevant characteristic(s) Source oreference

PlasmidspBluescript-SK (pBS) General cloning vector NovagenpSepCH Natural plasmid in This study

S. epidermidisCHpBS::pSepCH pSepCH cloned into pBS This stud

StrainsE. coli JM109 General cloning host PromegaS. epidermidisCH Wild type This studyS. epidermidisCH, cured No pSepCH This studyS. Typhimurium 14028s Wild type P. Youderia14028s/�ompD ompD::Tet G. Mora14028s/�ompW ompW::Kan This study14028s/�tolC tolC::Kan G. Mora

t

region of Chile. This isolate is resistant to heavy metals,has minimal inhibitory concentrations (MICs) of 1–5 mfor the ions Co2+, CrO2−

4 , Cu2+, Ni2+, SeO2−3 and Zn2+,

and MICs of 0.05–0.5 mM for Ag+, Cd2+, Hg2+, andTeO2−

3 . The original isolate was classified asS. epidermidisby several classical microbiological criteria.S. epidermidisCH stains as Gram-positive, produces catalase, is sento lysostaphin, penicillin G, ampicillin, tetracycline, chlramphenicol and gentamicin sulfate, and is resistant tothromycin, oxacillin, and trimethoprim. To confirm the idetity of this isolate, the sequence of a portion of its 16S rDwas determined after amplification of template chromsomal DNA with primers AGAGTTTGATCCTGGCTCAGand ACGGCTACCTTGTTACGACTT, and was found to bidentical to that ofS. epidermidis.

2.2. Isolation, identification and curingof theS. epidermidisCH plasmid, pSepCH

Analysis of total DNA preparations fromS. epidermidisCH revealed that this strain carries a small multi-copy pmid, pSepCH, which was purified and digested with vaous restriction endonucleases, and found to have a unPstI site. pSepCH was digested withPstI and ligated topBluescript-SK (pBS; Stratagene), and subclones werecovered inE. coli JM109. Hereafter the recombinant plamid will be referred to as pBS::pSepCH. The nucleotsequence of the 2391 bp pSepCH was determined andbeen assigned GenBank accession no. AY092027.

To cureS. epidermidisfrom pSepCH, cultures were inoculated with an initial concentration of 100 cells/ml, grownfor four generations (∼5 h) in LB medium with 0.1 µg/mlof the DNA gyrase inhibitor novobiocin, then plated on Lplates without novobiocin [15]. After this enrichment, DNwas prepared from single colonies, and then screened fopresence of pSepCH by gel electrophoresis of DNA inagarose gels, PCR and RT-PCR. About 4% of the surviwere found to be missing the plasmid.

2.3. Construction of anompWmutant strainof S.Typhimurium

A S. Typhimurium derivative that was deficient in thporin OmpW was obtained by substituting theompWgeneby a kanamycin resistance cassette using primersOMP1,ATGGAGCGGGTATGAAAAAATTTACAGTGGGGCAC-TGGCTGTAGGCTGGAGCTGCTTCG andOMP2, TTAG-AAACGATAGCCTGCCGAGAACATAAATACCCATGG-GCATATGAATATCCTCCTTAG. The precise insertion othe antibiotic cassette was determined by PCR using primompwf, TGCTCAAAGCGATGGCAGAAAGAAC andom-pwr, ACCTTAGCCAGCCTTTATCGCCAGG essentially a

described previously [12].

474 D.E. Fuentes et al. / Research in Microbiology 156 (2005) 472–477

.5%)

4)CH.

ingred.5the

ofmesmino

ved

testvedis-

tural

n 2

sis-ter-ryn inere

ev-Oxes

rom

lates.ced7

r

are

es a

tazi-of

edef-

lium),

e,m-

Fig. 1. Curing of plasmid pSepCH. Shown are the results of agarose (1gel electrophoresis of PCR products obtained using total DNA fromS. epi-dermidisCH wild type (lane 2) or from cured derivatives (lanes 3 andas templates. In lane 5, the template DNA was purified plasmid pSepLanes 1 and 6 contain molecular weight standards (a mixture of aHindIIIdigest ofλ phage DNA plus aHaeIII digest of �X174 phage RF DNA).DNA fragments were amplified by PCR in a total volume of 100 µl usas template 2–5 ng of pSepCH or total DNA from the wild-type or custrains ofS. epidermidisCH, 200 µM dNTPs, 1 µM of each primer and 2units of Taq polymerase (Perkin–Elmer, USA). Primers used to amplifyqacC gene were 5′-GGAATTCCATATGCCTTATATTTATTTAATAATAand ACCCAAGCTTTTAATGCGATGTTCCGAAAAT.

3. Results

3.1. Characterization of the pSepCH plasmid

BLAST analysis [1] of the nucleotide sequencepSepCH showed that it included three open reading fra(ORFs) predicted to encode products greater than 100 aacids in length. Two ORFs,cop and rep, were predictedto encode products of 116 and 281 amino acids involin plasmid replication, and the third ORF,qacC, was pre-dicted to make a small multidrug resistance protein. Towhether the QacC protein encoded by pSepCH behalike its S. aureuscounterpart, we determined the drug restance phenotype conferred by plasmid pSepCH in its nahost. To do this, we isolated derivatives ofS. epidermidisCH cured of plasmid pSepCH as described in Sectio(Fig. 1).

Otherwise isogenic derivatives ofS. epidermidisCH withand without plasmid pSepCH were tested for their retance to a variety of toxic compounds and ions, by demining growth inhibition zones and the minimal inhibitoconcentrations (MICs) of these agents with each straiLB medium at 37◦C. As shown in Table 2, a derivativof S. epidermidisCH cured of plasmid pSepCH was mosensitive to theβ-lactam, oxacillin (Ox) and to ethidiumbromide (EtBr, Fig. 2). Similar results, although lessident, were determined as growth inhibition halos toand to cephaloridine (CefD) in solid media. No differencwere seen with cephazoline (CefZ, Table 3). Results f

identical experiments carried out in the presence of the

Fig. 2. Growth inhibition zones ofS. epidermidisCH andE. coli in thepresence of EtBr. Lawns of the indicated strains were seeded onto LB pAfter drying, sterile paper disks charged with 100 µg of EtBr were plain the centers of the plates, and plates were incubated overnight at 3◦C.See Section 2 for additional details.

Table 2Minimal inhibitory concentrations (µg/ml) of β-lactam antibiotics and EtBto S. epidermidis, E. coli andS. Typhimurium

Bacteria Plasmid CefD Ox EtBr

S. epidermidisCH pSepCH <2 32 64Cured <2 4 16

E. coli JM 109 pBS 16 512 128pBS::pSepCH 512 >4096 1024

S. Typhimurium pBS 64 1024 204814028s pBS::pSepCH >1024 4096 >2048S. Typhimurium pBS 8 <2 12814028s/�tolC pBS::pSepCH 4096 >4096 2048

Ox, oxacillin; EtBr, ethidium bromide; CefD, cephaloridine. Numbersthe mean of four independent trials.

protonophore carbonyl cyanidem-chlorophenylhydrazon(CCCP) indicated that QacC was actually functioning apump inStaphylococcus(Table 3).

Other cephalosporines such as cephadroxil and cephdine were tested with wild-type and cured derivativesS. epidermidisCH. In both cases the wild-type strain showhigher resistance than the cured strain, while only minorfects were observed with other toxics such as tetrazoblue chloride (TZ), acriflavine (AC), malachite green (MGmethyl viologen (MV), cetyltrimethylammonium bromidtetradecyltrimethylammonium bromide and tetramethyla

monium bromide (not shown).

D.E. Fuentes et al. / Research in Microbiology 156 (2005) 472–477 475

e placed in

Table 3Growth inhibition zones (area, cm2) of β-lactam antibiotics and EtBr toS. epidermidisandE. coli

Bacteria/plasmid Ox Ox+ CCCP CefD CefD+ CCCP CefZa EtBr EtBr+ CCCP

E. coli JM 109 0.84± 0.05 1.13± 0.05 9.62± 0.2 9.89± 0.05 4.63± 0.1 1± 0.05 1.84± 0.15E. coli JM109/pBS::pSepCH 0 0.73± 0.15 2.2± 0.38 3.3± 0.05 2.73± 0.3 0.58± 0.15 2.83± 0.1S. epidermidis,wild type 19.11± 0.28 22.34± 0.05 22.82± 0.15 29.86± 0.15 13.85± 0.23 3.3± 0.1 5.04± 0.05S. epidermidis, cured 20.16± 0.25 24.63± 0.1 25.22± 0.15 33.18± 0.2 13.59± 0.27 4.3± 0.05 7.87± 0.05

Lawns of each strain were seeded onto LB plates. After drying, sterile paper disks charged with Ox, CefD and EtBr (100 µg) and CefZ (30 µg) werthe centers of the plates, and plates were incubated overnight at 37◦C. CCCP was used at 100 µM.

a Cephazoline.

sCHin

ns-us

sis-as2,at

CP

ases-nd

aryrent

contheCH

in-id

ofno-ainmidn-atedd in

f a

las-ost

weceostr re-ow

e

ctedThisthe

n-ngt iner-oresed,e in-CP

yingpro-

m-an-

3.2. Expression of qacC inE. coli K12 confers increasedresistance to a broader spectrum of antibiotics

To test whether theS. epidermidis qacCgene also conferMDR in Gram-negative hosts, we cloned plasmid pSepinto plasmid vector pBluescript-SK (pBS) as describedSection 2, electroporated the hybrid plasmid intoE. colistrain JM109, and compared the sensitivity of strains traformed with plasmids pBS and pBS::pSepCH to varioantibacterials. As seen in Table 2, a derivative ofE. coliJM109 with plasmid pBS::pSepCH showed increased retance to theβ-lactams oxacillin and cephaloridine as wellto EtBr, results that were confirmed in solid media (Fig.Table 3). Using the growth inhibition halo test we found thpBS::pSepCH also conferred resistance to CefZ inE. coli(Table 3). Experiments carried out in the presence of CCconfirmed that QacC fromS. epidermidisCH functions as anMDR pump in this Gram-negative bacterium. As in the cof S. epidermidisthe expression of the pBS::pSepCH plamid also mediated low-level resistance to TZ, AC, MG, aMV in E. coliJM109. These levels of resistance did not vwhen plasmid pBS::pSepCH was transferred to a diffeE. coli genetic background (not shown).

3.3. QacC fromS. epidermidisCH mediatesTolC-independent antibiotic resistance inS. Typhimurium

To test whether the observed antibacterial resistanceferred by QacC in Gram-negative hosts is dependent onouter membrane protein TolC, we transferred pBS::pSepboth, to wild-type and to atolC mutant ofS.Typhimurium.

By determining MICs as well as the area of growthhibition zones in solid media we observed that plasmpBS::pSepCH conferred resistance to theβ-lactams Ox andCefD and to EtBr inSalmonella. As shown in Tables 2and 4, atolC mutation severely lowered the resistanceS. Typhimurium to all these three compounds. A phetype nearly identical to that shown by the wild-type strcarrying pBS::pSepCH was observed when this plaswas expressed in thetolC mutant background. In additioto showing that theS. epidermidisCH QacC pump conferred antibiotic resistance, our results also demonstrthat the outer membrane channel TolC was not involve

this process. Similar conclusions were withdrawn when ex-

-

periments were carried out in anompW(Table 4) or in anompDmutant background (results not shown).

4. Discussion

4.1. QacC is a proton gradient-dependent pump

In this work we communicate the characterization osmall plasmid present in an environmental strain ofS. epi-dermidis. The nucleotide sequence of both strands of pmid pSepCH was determined and was found to be almidentical to that of plasmid pSK89 ofS. aureus[7].

The QacC efflux pump coded by theS. aureusplasmidpSK89 confers resistance to a variety of QACs [8]. Hereshow that theS. epidermidispSepCH also confers resistanto a number of antibacterial agents, both in its natural hand in Gram-negative heterologous hosts. In addition, ousults extend those of Littlejohn and coworkers [8] and shthat QacC fromS. epidermidisCH is involved in resistancto β-lactam antibiotics which was not tested in theS. aureussystem.

To test whether QacC functions as a pump we conduexperiments in the presence of the protonophore CCCP.compound uncouples the proton gradient needed forfunctioning of certain pumps like MDR transporters. Atibiotic resistance was diminished in all the trials includiCCCP, indicating the participation of the proton gradienthis process. This effect was particularly evident in expiments with EtBr (Table 3). Since the CCCP protonophwas present at sublethal concentrations for all strains uthe observed effect represents a real measurement of thactivation of these pumps. In this context, the effect of CCwas even more evident in the case of derivatives carrpSepCH. These results indicate that QacC functions as aton gradient-dependent pump.

4.2. QacC confers resistance toβ-lactam antibiotics andto EtBr inS. epidermidisand in Gram-negative hosts

Given the differences between the cytoplasmic mebranes of Gram-positive and Gram-negative microorgisms, it is surprising that the expression ofqacC in E. coliandS. Typhimurium confers resistance toβ-lactam antibi-

otics. In general, the efflux of toxic substances from the

476 D.E. Fuentes et al. / Research in Microbiology 156 (2005) 472–477

Table 4Growth inhibition zones (area, cm2) of β-lactam antibiotics and EtBr toS.Typhimurium

Strain/plasmid Ox Ox+ CCCP CefD CefD+ CCCP CefZ EtBr EtBr+ CCCP

S.Typhimurium 14028s 0.73± 0.05 0.78± 0.05 5.51± 0.15 8.04± 0.1 5.3± 0.1 0.73± 0.05 0.73± 0.05S.Typhimurium 14028s/pBS::pSepCH 0 0.54± 0.05 0.83± 0.15 0.81± 0.12 0.81± 0.12 0.38± 0.05 1.54± 0.114028s�tolC 10.75± 0.1 7.71± 0.05 7.79± 0.13 8.21± 0.15 6.75± 0.15 5.17± 0.15 6.15± 0.114028s�tolC/pBS::pSepCH 0 0.54± 0.05 0.65± 0.07 0.81± 0.12 0.83± 0.15 0.73± 0.15 0.73± 0.1514028s�ompW 0.7 nd 3.5 nd nd 0.9 nd14028s�ompW/pBS::pSepCH 0 nd 0.8 nd nd 0.7 nd

See legend to Table 3 for details. nd, not determined.

ps;tein.endina-

pslsotiv-

red

r

is,

tBr-Tab

d toab-lC-the

inved(not

ses,ffluxul-

rnalher

nglytha

cannce,

di-H-

tentorpW.cil-

uousto

sed

er-g.ndiston-

al

otas-)

he)

fam-

a,ro-ac-

i-

ay,fec-

es,an-

Gram-positive cytoplasm relies mainly on simple pummost of these consist of a single, integral membrane proIn contrast, in Gram-negative bacteria, efflux may depon simple pumps, multi-component pumps, or a combtion of the two. InE. coli, the efficient export ofβ-lactamantibiotics and of EtBr depends on multi-component pumthat require not only an inner membrane protein but athe outer membrane channel protein, TolC, for their acity [3,10].

AcrAB seems to be the most active RND pump requifor the efficient efflux of EtBr inE. coli. The activity ofthis pump depends on three genes,acrB, which includesan integral inner membrane protein,acrA, which encodesa periplasmic linker protein, andtolC. Mutations inacrA,acrB or tolC confer sensitivity toβ-lactams and to EtB[3,10]. In this context we tested whether QacC fromS. epi-dermidisCH required TolC to function as a pump. To do thwe transferred pSepCH totolC mutants ofS. Typhimuriumand we tested the susceptibility of these derivatives to Eand toβ-lactam antibiotics. Although TolC function contributes to resistance to these compounds (Table 2 andle 4), the presence of the plasmid pBS::pSepCH in thetolCmutant background increases the resistance to EtBr anβ-lactams about 20 and over 500 times, respectively (Tle 2). These results indicate that QacC functions in a Toindependent manner. Similar results were obtained whenexpression of the pSepCH plasmid was analyzed in anompWmutant background (Table 4). In addition, previous workour laboratory has shown that the porin OmpD was involneither in QacC-mediated resistance to Ox nor to EtBrshown).

4.3. QacC does not need TolC, OmpW or OmpD outermembrane proteins to function as a pump

Lee and coworkers [5] have found that, for several cathe simultaneous expression of a single-component epump that exports antibiotics into the periplasm with a mticomponent pump that exports antibiotics into the extemedium, the observed antibiotic resistance is much higthan that conferred by each of the pumps expressed siOn the basis of these and other results, they postulatedsingle-component and multicomponent efflux pumpsfunction in series to have a synergistic effect on resista

whereas pumps of the same type (either single-componen

-

.t

or multicomponent) function in parallel to have only adtive effects on resistance [5]. In this context, the pSepCencoded pump characterized in this work is not consiswith Lee’s postulate, since it does not work with TolC, nwith other outer membrane porins such as OmpD or Om

Finally, the fact that pSepCH confers resistance to oxalin and to cephalosporines suggests that the promiscqacC gene may contribute to multifactorial resistancethese antibiotics, used clinically to treat infections cauby pathogenicStaphylococcusspp.

Acknowledgements

The authors thank Le Phung and Simon Silver (Univsity of Chicago) for helping with 16S rDNA sequencinD.E.F. and J.M.P. received fellowships from MECESUP aC.A.N. and I.L.C. received fellowships from Conicyt. Thwork was supported by FONDECYT grants 1030234C.C.V. and 1020485 to G.C.M., and by NIH Fogarty Ceter Senior International Fellowship TW05645 to P.Y.

References

[1] S. Altschul, W. Gish, W. Miller, E. Myers, D. Lipman, Basic localignment search tool, J. Mol. Biol. 215 (1990) 403–410.

[2] M. Chiong, R. Barra, E. González, C. Vásquez, Resistance to psium tellurite inThermusspp., Appl. Environ. Microbiol. 54 (1988610–612.

[3] J. Fralick, Evidence that TolC is required for functioning of tMar/AcrAB efflux pump ofEscherichia coli, J. Bacteriol. 178 (19965803–5805.

[4] D. Jack, N. Yang, M. Saier, The drug/metabolite transporter superily, Eur. J. Biochem. 268 (2001) 3620–3639.

[5] A. Lee, W. Mao, M. Warren, A. Mistry, K. Hoshino, R. OkumurH. Ishida, O. Lomovskaya, Interplay between efflux pumps may pvide either additive or multiplicative effects on drug resistance, J. Bteriol. 182 (2000) 3142–3150.

[6] S. Levy, Active efflux mechanisms for antibiotic resistance, Antimcrob. Agents Chemother. 36 (1992) 695–703.

[7] T. Littlejohn, D. Dibernardino, L. Messeroti, S. Spiers, R. SkurrStructure and evolution of a family encoding antiseptic and disintant resistance inStaphylococcus aureus, Gene 101 (1991) 59–66.

[8] T. Littlejohn, I. Paulsen, M. Gillespie, J. Tennent, M. Midgley, I. JonA. Purewal, R. Skurray, Substrate specificity and energetics oftiseptic and disinfectant resistance inStaphylococcus aureus, FEMS

t Microbiol. Lett. 74 (1992) 259–265.

D.E. Fuentes et al. / Research in Microbiology 156 (2005) 472–477 477

bility

les

0–

ac-0)

ul-

.A.

6

ra-old

rug.

[9] H. Nikaido, Prevention of drug access to bacterial targets: Permeabarriers and active efflux, Science 264 (1994) 382–388.

[10] K. Nishino, J. Yamada, H. Hirakawa, T. Hirata, A. Yamaguchi, Roof TolC-dependent multidrug transporters ofEscherichia coliin resis-tance toβ-lactams, Antimicrob. Agents Chemother. 47 (2003) 3033033.

[11] M. Putman, H. van Veen, W. Konings, Molecular properties of bterial multidrugs transporters, Microbiol. Mol. Biol. Rev. 64 (200672–693.

[12] D.M. Rojas, C.C. Vásquez, Sensitivity to potassium tellurite ofEs-cherichia colicells deficient in CSD, CsdB and IscS cysteine desfurases, Res. Microbiol. (2005), in press.

[13] C.A. Santiviago, J.A. Fuentes, S.M. Bueno, A.N. Trombert, AHidalgo, L.T. Socías, P. Youderian, G.C. Mora, TheSalmonella en-terica sv. TyphimuriumsmvA, yddG and ompD (porin), genes arerequired for the efficient efflux of methyl viologen, Mol. Microbiol. 4(2002) 687–698.

[14] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Labotory Manual, second ed., Cold Spring Harbor Laboratory Press, CSpring Harbor, NY, 1989.

[15] C. Vásquez, J. Villanueva, R. Vicuña, Plasmid curing inThermus ther-mophilusandThermus flavus, FEBS Lett. 158 (1983) 339–342.

[16] H. Zgurskaya, H. Nikaido, Multidrug resistance mechanisms: Defflux across two membranes, Mol. Microbiol. 37 (2000) 219–225