The ESCRT machinery is not required for humancytomegalovirus envelopment

Alberto Fraile-Ramos,1*Annegret Pelchen-Matthews,2 Cristina Risco,3

María T. Rejas,4 Vincent C. Emery,5

Aycan F. Hassan-Walker,5 Mariano Esteban1 andMark Marsh2

Departments of 1Molecular and Cell Biology, and3Structure of Macromolecules, Centro Nacional deBiotecnología, Consejo Superior de InvestigacionesCientíficas, Campus Universidad Autonoma, Madrid28049, Spain.2Cell Biology Unit, MRC Laboratory for Molecular CellBiology and Department of Biochemistry and MolecularBiology, University College London, Gower Street,London WC1E 6BT, UK.4Sevicio de Microscopía Electrónica, Centro de BiologíaMolecular Severo Ochoa, Consejo Superior deInvestigaciones Científicas, Campus UniversidadAutonoma, Madrid 28049, Spain.5Department of Virology, Hampstead Campus, RoyalFree and University College Medical School, RowlandHill Street, London NW3 2QG, UK.

Summary

The human cytomegalovirus (HCMV) has been pro-posed to complete its final envelopment on cytoplas-mic membranes prior to its release to the extracellularmedium. The nature of these membranes and themechanisms involved in virus envelopment andrelease are poorly understood. Here we show byimmunogold-labelling and electron microscopy thatCD63, a marker of multivesicular bodies (MVBs), isincorporated into the viral envelope, supporting thenotion that HCMV uses endocytic membranes for itsenvelopment. We therefore investigated a possiblerole for the cellular endosomal sorting complexrequired for transport (ESCRT) machinery in HCMVenvelopment. Depletion of tumour suppressor gene101 and ALIX/AIP1 with small interfering RNAs(siRNAs) in HCMV-infected cells did not affect virusproduction. In contrast, siRNAs against the vacuolarprotein sorting 4 (VPS4) proteins silenced the expres-

sion of VPS4A and VPS4B, inhibited the sorting ofepidermal growth factor to lysosomes, the formationof HIV Gag-derived virus-like particles and vesicularstomatitis virus infection, but enhanced the numberof HCMV viral particles produced. Treatment of in-fected cells with protease inhibitors also increasedviral production. These studies indicate that, in con-trast to some enveloped RNA viruses, HCMV does notrequire the cellular ESCRT machinery to complete itsenvelopment.

Introduction

The betaherpesvirus human cytomegalovirus (HCMV) isresponsible for many diseases, including retinitis, gas-trointestinal disease, pneumonitis, and both peripheraland central nervous system malfunction in immunocom-promised individuals (Pass, 2001). Like all herpesviruses,HCMV consists of a capsid containing the double-stranded DNA genome surrounded by a protein-aceous tegument and a lipid envelope with embeddedglycoproteins. While HCMV has been widely studied, thefinal events in particle envelopment are still poorlyunderstood. Nucleocapsids assemble within the infectedcell nucleus and are proposed to enter the cytoplasm byan envelopment/de-envelopment process at the inner andouter nuclear membranes (Gibson, 1996; Mocarski andCourcelle, 2001). In the cytoplasm, the capsids acquire alayer of tegument proteins and undergo a final envelop-ment by wrapping into membranes before they arereleased to the extracellular space.

In HCMV-infected cells, the majority of the virus par-ticles wrap into small, crescent-shaped membranecisternae associated with virus factories – large accu-mulations of viral components in the perinuclear region(reviewed in Novoa et al., 2005), although the nature ofthese membranes has not been completely defined.Some alphaherpesviruses, including Varicella-zostervirus and pseudorabies virus, are believed to derive theirenvelope from the trans-Golgi network (TGN) or TGN-derived vesicles (reviewed in Mettenleiter, 2004), and ithas been suggested that HCMV may also be envelopedat this site (Sanchez et al., 2000; Homman-Loudiyi et al.,2003). Other studies have proposed a role for endocyticmembranes in HCMV envelopment (Tooze et al., 1993;Radsak et al., 1996; Fraile-Ramos et al., 2002). We

Received 18 April, 2007; revised 31 May, 2007; accepted 6 June,2007. *For correspondence. E-mail alberto.fraile@cnb.uam.es; Tel.(+34) 91 585 4560; Fax (+34) 91 585 4506.

Cellular Microbiology (2007) 9(12), 2955–2967 doi:10.1111/j.1462-5822.2007.01024.xFirst published online 29 August 2007

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd

have previously shown by immunofluorescence andimmunogold-labelling electron microscopy (EM) thatthe HCMV glycoproteins gB and gH, and the HCMVchemokine receptor-like proteins UL33, US27 andUS28, are mainly located in endocytic vesicles, in par-ticular late endosomes/multivesicular bodies (MVBs),and that the UL33 and US27 proteins can be incorpo-rated into viral membranes (Fraile-Ramos et al., 2001;2002). Most virus particles wrap into short membranecisternae of unknown origin, although some particlescould be seen budding into MVBs or accumulated asmature enveloped viruses within these organelles(Fraile-Ramos et al., 2002).

Human cytomegalovirus is not the only virus for whichMVBs have been implicated in envelopment. Thebudding of a number of enveloped RNA viruses requiresthe interaction of viral proteins with components of thecellular machinery involved in the sorting of proteinsto MVBs, the so-called endosomal sorting complexrequired for transport (ESCRT) machinery (reviewed inMorita and Sundquist, 2004; Pelchen-Matthews et al.,2004). The ESCRT-I, -II and -III protein complexes, inconcert with ALIX/AIP1, have been implicated in the for-mation of the intralumenal vesicles of MVBs and thesorting of proteins destined for lysosomal degradation tothese vesicles. In addition, the AAA-ATPase vacuolarprotein sorting (VPS) 4 protein mediates the recycling ofESCRT complexes (reviewed in Babst, 2005; Hurley andEmr, 2006). Retroviral Gag proteins contain at leastthree types of sequence motif, termed late domains(L-domains), which are required for ESCRT recruitment;the P(T/S)AP, the PPxY and the YxxL motifs (reviewedin Morita and Sundquist, 2004). These L-domains inter-act with either tumour suppressor gene 101 (Tsg101), acomponent of the ESCRT-I complex, ALIX/AIP1 or ubiq-uitin ligases of the Nedd4 family. Depletion of Tsg101and ALIX by small interfering RNAs (siRNAs) andmutants of Nedd4 inhibit retrovirus budding, anddominant-negative mutant VPS4 proteins disrupt virusassembly mediated through all of the L-domains (vonSchwedler et al., 2003). L-domains have also been iden-tified in other RNA viruses, such as filoviruses, rhabdovi-ruses and arenaviruses, and also in ortho- andparamyxoviruses (reviewed in Pornillos et al., 2002).

Here we investigated whether components of theESCRT machinery may be involved in HCMV assembly.We observed that the membranes used by HCMV forenvelopment contain the MVB marker CD63 and can beaccessed by the endocytosed fluid phase tracer horse-radish peroxidase (HRP). Furthermore, inspection of theHCMV proteome revealed a number of sequence motifswith homology to retroviral L-domains in various HCMVproteins. However, siRNA depletion of Tsg101, ALIX/AIP1or VPS4 in HCMV-infected cells did not inhibit the produc-

tion of infectious virus, suggesting that the ESCRTmachinery is not required for HCMV envelopment.

Results and discussion

Localization of the MVB marker CD63 inHCMV-infected cells

We have previously found evidence for newly envelopedHCMV associated with MVBs, although most of the viralparticles acquired their final envelope by wrapping intosmall crescent-shaped cisternae (Fraile-Ramos et al.,2002). To investigate the nature of these small cisternae,we labelled HCMV-infected cells with antibodies againstCD63, a well-defined marker of MVBs. Human foreskinfibroblasts infected with the Towne strain of HCMV werefixed and prepared for cryosection immunolabelling. Asexpected, specific labelling for CD63 was seen overMVBs (Fraile-Ramos et al., 2001), some of which alsocontained HCMV particles (Fig. 1A). In addition, CD63labelled membranes in virus factories, where viral par-ticles and dense bodies (accumulations of tegument pro-teins) appeared to be undergoing envelopment (Fig. 1B).Some CD63 labelling was also seen on mature extra-cellular virus particles and enveloped dense bodies(Fig. 1C). Similar results were obtained in retinal pig-mented epithelial (RPE1) cells infected with the AD169strain of HCMV: again CD63 labelling was seen overwrapping virus particles and dense bodies (Fig. 1D), andon extracellular enveloped HCMV (Fig. 1E).

These results support the notion that HCMV derives itsfinal envelope from endocytic membranes or membranesin transit to and/or from endocytic organelles, and thatCD63 can be incorporated into the viral envelope. Thiswas further confirmed by the observation that the fluidphase marker HRP, when fed to HCMV-infected RPE1cells for 2 h at 37°C, reached not only MVBs but also thecrescent-shaped membranes wrapping HCMV (Fig. S1).These results agree with the studies of Tooze and col-leagues (1993) and further support the notion that theHCMV assembly compartment is part of, or intersectswith, the endocytic pathway. Indeed, a recent analysis ofHCMV-infected cells by cell fractionation found the tegu-ment protein pp28, which is essential for the envelopmentof infectious virus, in the same fraction as CD63 (Seo andBritt, 2006). Nonetheless, other studies have suggestedthat the TGN may serve as a site for HCMV envelopment(Sanchez et al., 2000; Homman-Loudiyi et al., 2003), andit is possible that the CD63-containing membranes weobserve are trafficking to or from the TGN, or that the virusmight generate a novel membrane compartment contain-ing CD63 and markers for the TGN. Work is in progress tofurther characterize the nature of the membranes whereHCMV assembles with the use of other cellular markerproteins.

2956 A. Fraile-Ramos et al.

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Cellular Microbiology, 9, 2955–2967

Role of the ESCRT-associated proteins Tsg101 andALIX/AIP1 in HCMV assembly

The association of HCMV budding with the MVB markerCD63 prompted us to investigate whether, as for retrovi-ruses, the ESCRT MVB sorting machinery might beinvolved in HCMV assembly. We first examined whethersequences with homology to L-domain motifs are present

in HCMV proteins that are expected to direct the finalsteps of envelopment such as the tegument proteinsand/or the cytoplasmic domains of the viral glycoproteins.We identified sequences with homology to: (i) P(T/S)APmotif in the tegument protein UL32; (ii) YxxL motifs in thetegument proteins UL25, UL26, UL32, UL43, UL48, UL82,67 kDa phosphorylated protein, US23, US24 and in theglycoproteins gp48, UL22A, gB, gH, gL, gO and gM; and

Fig. 1. EM immunolocalization of CD63 on HCMV-infected cells. Cryosections of HCMV-infected human foreskin fibroblasts (A, B, C) or RPE1cells (D, E) were labelled for CD63 with 10 nm protein A-gold. Gold particles were seen over MVBs (A), as well as over the crescent-shapedcytoplasmic membranes enveloping virions and dense bodies (B, D), and over extracellular particles (C, E). V, selected HCMV particles; N, anon-infectious enveloped particle; DB, dense bodies; T, a cytoplasmic tegument accumulation. Arrows in C and E point to small vesiclesresembling exosomes. Scale bars = 200 nm.

HCMV infection in ESCRT and VPS4-depleted cells 2957

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Cellular Microbiology, 9, 2955–2967

(iii) PPxY motifs in the tegument protein UL48 and in gB(Fig. 2).

P(T/S)AP motifs, found for example in HIV-1 Gag, havebeen shown to bind the ESCRT-I component Tsg101, andsilencing of Tsg101 by siRNA inhibits HIV budding (Garruset al., 2001; VerPlank et al., 2001).As the HCMV tegumentprotein UL32 contains this sequence, we tested whetherTsg101 is required for HCMV envelopment. RPE1 cellswere infected with RCMV288, a recombinant strain ofHCMV AD169 expressing green fluorescent protein (GFP)under the control of an HCMV early promoter, which pro-vides a convenient reporter system to monitor infection(McSharry et al., 2001). Infected RPE1 cells were subse-quently transfected with control siRNAs or with siRNAsagainst Tsg101 and 5 days post infection (i.e. 4 days posttransfection), supernatants and cells were harvested foranalysis. Western blotting of the cell lysates showed thatthe RCMV288-infected and Tsg101 siRNA-transfectedRPE1 cells had a >90% reduction in Tsg101 levels.

However, when infectious RCMV288 viruses released intosupernatant were assayed on RPE1 cells by GFP expres-sion and FACS analysis, similar numbers of infectious virusparticles were found to be released from Tsg101-depletedcells compared with untransfected or control siRNA-transfected cells (Fig. 3B). This suggests that Tsg101 doesnot play a role in the final envelopment of HCMV.

It has been shown that the YxxL motif, found forexample in equine infectious anaemia virus Gag, and theYPLTSL motif, found in HIV Gag, bind ALIX/AIP1, anddepletion of ALIX by siRNA inhibits the budding of severalretroviruses ( Martin-Serrano et al., 2003; Strack et al.,2003; Vincent et al., 2003; von Schwedler et al., 2003;Fisher et al., 2007; Lee et al., 2007). Because numerousYxxL-type motifs were found in HCMV tegumentproteins and glycoproteins (Fig. 2), we also testedwhether silencing of ALIX/AIP1 affected the production ofinfectious HCMV. RCMV288-infected RPE1 cells weretransfected with control siRNAs or with siRNAs against

PPxY

PTAP

UL32

67kDa

gB

gH

gL

gM

gp48

UL22A

UL48

gO

UL82

US23

US24

UL43

UL25

UL26

TEGUMENT PROTEINS

GLYCOPROTEINS

YxxL

Fig. 2. Sequences with homology to late-domain motifs in the HCMV proteome. These sequences were identified in the laboratory strainAD169 of HCMV with the use of ScanProsite program (http://www.expasy.org/tools/scanprosite/), and they were conserved in the wild-typestrain Merlin of HCMV, whose complete genome has also been sequenced. It remains to be determined whether the common YxxL motifsfunction as either L-domains or endocytosis signals. In addition, not all of these YxxL sequences are conserved in the corresponding proteinsof other species of cytomegalovirus, such as the rhesus and chimpanzee cytomegaloviruses. Nevertheless, the P(T/S)AP and PPxY motifswere identified in the corresponding proteins of these cytomegalovirus species except the P(T/S)AP-like motif, which was not conserved in theUL32 tegument protein of rhesus cytomegalovirus.

2958 A. Fraile-Ramos et al.

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Cellular Microbiology, 9, 2955–2967

ALIX (Matsuo et al., 2004) and analysed as describedabove for Tsg101. Western blot analysis showed thatsiRNAs against ALIX caused a reduction of ~70% in theprotein levels (Fig. 3A), but depletion of ALIX did not affectvirus release (Fig. 3B). Furthermore, co-transfection ofsiRNAs against Tsg101 and ALIX also had no effect onHCMV particle production (data not shown). Therefore, aswith Tsg101, these results suggest that ALIX is notrequired for the final envelopment of HCMV.

Inhibition of MVB sorting, HIV virus-like particle(VLP) formation and VSV infection in cells depleted ofVPS4 proteins

The lack of an effect of Tsg101 and ALIX depletion onHCMV budding may be due to redundancy between thepotential L-domains in several viral proteins (Fig. 2).However, for other virus systems it has been shown thatdominant-negative mutants of VPS4 inhibit the function of

all of the L-domains (von Schwedler et al., 2003). We wereunable to test whether dominant-negative mutants ofVPS4 affect HCMV budding, because the transfectionefficiency of RPE1 cells with cDNAs expressing thesemutants was very low. Instead, we developed an experi-mental system to knock down the expression of VPS4 bysiRNAs.

It has previously been shown that dominant-negativemutants of VPS4 inhibit MVB sorting and protein degra-dation in lysosomes (Yoshimori et al., 2000). To determinewhether siRNAs can be used to silence the expression ofVPS4 proteins and inhibit MVB sorting in RPE1 cells, weused siRNAs against the two mammalian isoforms ofVPS4, VPS4A and VPS4B. The levels of expression ofVPS4 proteins were analysed by Western blot 72 h aftertransfection. RPE1 cells co-transfected with the VPS4A/BsiRNAs showed a reduction of ~70% and 80% in VPS4Aand VPS4B expression respectively (Fig. 4A). Althoughwe observed that, in the VPS4A/B siRNA-transfected cul-

A

B

untra

nsfe

cted

VPS4A+B

siR

NAs

ALIX s

iRNA

Tsg10

1 siRNA

cont

rol s

iRNA

0

5x104

IP m

l–1

10x104

15x104***

clathrin

cont

rol s

iRNA

Tsg10

1 siRNA

Tsg101 ALIX

actin

cont

rol s

iRNA

ALIX s

iRNA

VPS4A

clathrin

cont

rol s

iRNA

VPS4A+B

siR

NAs

VPS4B

clathrin

cont

rol s

iRNA

VPS4A+B

siR

NAs

Fig. 3. HCMV infection in Tsg101, ALIX and VPS4A/B siRNA-treated cells. RPE1 cells were infected with RCMV288 at a moi of 1, and after24 and 48 h post infection, some cells were transfected twice with Alexa555-labelled control siRNAs against GFP or with siRNAs againstTsg101, ALIX or VPS4A/B. At 96 h post infection, the cells were washed and incubated in fresh medium until 120 h post infection, whenviruses released into the supernatant were harvested and the cells lysed for Western blotting.A. Western blots for Tsg101, ALIX, VPS4A and VPS4B. Cell lysates were separated by SDS-PAGE, and transferred to nitrocellulosemembranes. The membranes were cut, the upper parts incubated with antibodies against ALIX or clathrin, and the lower parts incubated withantibodies against Tsg101, VPS4A, VPS4B or actin (clathrin and actin blots were included as a control for protein loading). Levels of Tsg101,ALIX, VPS4A and VPS4B were reproducibly reduced by comparison with control siRNA-transfected cells.B. Infectious viruses released from Tsg101, ALIX and VPS4A/B siRNA-treated cells. The number of infectious viruses present in supernatantsharvested from untreated cells or cells treated with siRNAs was determined on fresh RPE1 cells as described in Experimental procedures.siRNA for Tsg101 or ALIX did not affect the release of infectious viruses, but the supernatants from VPS4A/B siRNA-treated cells containedsignificantly more infectious particles (IP) than untransfected or control siRNA-treated cells. All data points show means and standarddeviations for quadruplicate samples from a representative experiment. Number of experiments 3. We observed an increase in infectiousviruses release in VPS4-depleted cells in a further eight experiments. ***P < 0.001.

HCMV infection in ESCRT and VPS4-depleted cells 2959

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Cellular Microbiology, 9, 2955–2967

tures, cell viability was compromised at longer times, 96 hprovides a sufficient time window to study the requirementfor these proteins in HCMV envelopment.

We next investigated whether MVB sorting was inhibitedin VPS4A/B-depleted cells. As the epidermal growth factor(EGF) is internalized and transported via MVBs to lysos-omes for degradation, we tested whether degradation ofEGF was affected in VPS4A/B siRNA-treated cultures.Cells transfected with control siRNAs or siRNAs againstVPS4A/B were incubated on ice withAlexa488-labelled EGF(488EGF), washed to remove unbound ligand and warmedto 37°C for 30 min or 3 h to allow uptake of the 488EGF. Cellswere then fixed, permeabilized with saponin and stainedwith anti-CD63 antibodies. It has been shown that expres-sion of VPS4 mutant proteins induces the enlargement oflate endosomes resembling the ‘Class E’ compartment inyeast (Bishop and Woodman, 2000). We did not observean enlargement of CD63-labelled endosomes in RPE1cells transfected with siRNAs against VPS4A/B, althoughCD63 staining was slightly more clumped than the pattern

observed in RPE1 cells transfected with control siRNAs(Fig. 4B). In RPE1 cells transfected with control siRNAs,488EGF was located in intracellular vesicles after 30 min,but the staining was lost in cells warmed for 3 h, indicatingthat the 488EGF was degraded (Fig. 4B). By contrast, wefound that 70% of the cells treated with VPS4A/B siRNAsretained a substantial amount of 488EGF in intracellularvesicles at 3 h, suggesting that EGF degradation wasinhibited or delayed. Together these results indicate thatsiRNA can be used to silence the expression of VPS4proteins, and that this silencing affects MVB function byinhibiting protein sorting to lysosomes.

As an alternative test of the functional effect of knockingdown VPS4A/B, we analysed the production of HIV VLPs.It has been shown that the ability of the PTAP andYPLTSL motifs of the HIV-1 Gag p6 domain to promoteHIV release is disrupted by dominant-negative mutants ofVPS4 (von Schwedler et al., 2003). RPE1 cells and cellstransfected with control siRNAs or siRNAs againstVPS4A/B were infected with a recombinant vaccinia virus

A

B

VPS4A

actin

cont

rol s

iRNA

VPS4A+B

siR

NAs

VPS4B

actin

cont

rol s

iRNA

VPS4A+B

siR

NAs

control siRNA VPS4A+B siRNAs control siRNA VPS4A+B siRNAs

30 min

an

ti-C

D6

3

3 h

48

8-E

GF

Fig. 4. EGF degradation in VPS4A/B siRNA-treated cells. RPE1 cells were transfected twice with Alexa647-labelled control siRNAs or withsiRNAs against VPS4A/B and analysed 72 h after the first transfection.A. Western blotting demonstrated that VPS4A/B levels were reproducibly reduced by > 70% compared with control siRNA-transfected cells.Blots for actin are included as a control for protein loading.B. EGF degradation and CD63 staining. Control or VPS4A/B siRNA-transfected RPE1 cells were cooled on ice and labelled with 488EGF. Cellswere washed with cold medium and warmed to 37°C for 30 min to allow internalization of 488EGF, or for 3 h to allow its degradation. Cellswere cooled on ice, fixed, permeabilized and stained with anti-CD63 antibodies. Confocal micrographs were produced using identical scansettings for the control and VPS4A/B siRNA-transfected cells to allow comparison of the fluorescence intensities. Z-series projections of foursingle 0.5 mm optical sections are shown. Scale bars = 10 mm. Number of experiments 2.

2960 A. Fraile-Ramos et al.

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Cellular Microbiology, 9, 2955–2967

expressing HIV-1 Gag (Rodriguez et al., 1989). As acontrol for the inhibition of VLP production, siRNAsagainst Tsg101 were also used (Garrus et al., 2001). After10 h, VLP production was measured and the cells werelysed, and the expression of vaccinia virus or HIV-1 Gagproteins was analysed by Western blot. The levels ofTsg101 and VPS4 proteins in siRNA-treated RPE1 cellswere reduced to the levels observed in earlier experi-ments (data not shown). The expression of vaccinia virusproteins and HIV-1 Gag was not significantly altered bysiRNA treatment, indicating that depletion of these cellularcomponents did not affect vaccinia virus entry and theexpression of either vaccinia proteins or HIV-1 Gag(Fig. 5A). The HIV Gag-expressing recombinant vacciniavirus also encodes the HIV protease (Rodriguez et al.,1989). Accordingly, cell lysates from the recombinant vac-cinia virus-infected RPE1 cultures contained bands cor-responding to the Gag precursor Pr55Gag, processed p42,and p24 polypeptides, although detection of p24 wasunexpectedly stronger in RPE1 cells treated with controlsiRNAs, the expression of Pr55Gag and p42 was similarbetween infected cultures (Fig. 5A). We quantified VLPproduction by Western blot analysis (Fig. 5B), and the p24band was compared with Pr55Gag + p42 + p24 bands onthe cellular lysate blot. We found a reduction of ~70% inVLPs produced in RPE1 Tsg101 siRNA-treated cultures,while VLP production was reduced by ~90% in RPE1 cells

transfected with VPS4A/B siRNAs. These results demon-strate that depletion of VPS4 proteins by siRNAs inhibitsHIV-1 Gag VLP production.

We next tested whether infection by vesicular stomatitisvirus (VSV), previously reported to be dependent ontransport of internalized virus to MVBs (Le Blanc et al.,2005), was affected in VPS4A/B-depleted cells. RPE1cells, and RPE1 cells transfected with control siRNAs orsiRNAs against VPS4A/B, were infected with VSV. After10 h, the viruses released into the supernatants weretitred by plaque assay, while the cells were lysed and theexpression of VPS4A/B and the VSV glycoprotein G(VSV-G) was analysed by Western blot. Again, thesiRNAs reduced the expression of the VPS4 proteins by~70% (data not shown). Western blotting also showed areduction of ~25% in VSV-G expression in RPE1VPS4A/B siRNA-transfected cells infected with VSV(Fig. 6A). In addition, the titres of VSV released from theVPS4A/B siRNA-transfected cultures were significantlyreduced compared with untransfected (P = 0.02) orcontrol siRNA-transfected (P = 0.01) cultures (Fig. 6B).

These results show that VSV infection was inhibited inVPS4-depleted cells. The 25% reduction in the levels ofVSV-G expression might suggest an inhibition in the earlystages of infection, supporting the notion that functionalMVBs are needed for VSV to initiate infection (Le Blancet al., 2005). While this 25% reduction is less than that

Cell lysates

anti-VV

97

45

220

66

30

untra

nsfe

cted

VPS4A+B

siR

NAs

moc

k

Tsg10

1 siRNA

cont

rol s

iRNA

VV HIV-1 Gag

97

45

220

30

untra

nsfe

cted

VPS4A+B

siR

NAs

moc

k

Tsg10

1 siRNA

cont

rol s

iRNA

VV HIV-1 Gag

Cell lysates

anti-Gag

A B

VLPs

anti-Gag

VV HIV-1 Gag

untra

nsfe

cted

VPS4A+B

siR

NAs

moc

k

Tsg10

1 siRNA

cont

rol s

iRNA

97

45

30

220

Fig. 5. HIV-1 Gag VLP production in VPS4A/B siRNA-treated cells. RPE1 cells were untransfected or transfected with Alexa555-labelled controlsiRNAs against GFP or with siRNAs against Tsg101 or VPS4A/B. After 56 h, the cells were either mock infected or infected with arecombinant vaccinia virus expressing HIV-1 Gag. After a further 10 h, HIV-1 Gag VLPs released into the supernatant were harvested and thecells lysed.A. Cell lysates were analysed by Western blotting with anti-vaccinia virus or anti-Gag sera. Vaccinia virus proteins and HIV-1 Gag levels weresimilar for untreated cells or cells treated with control, Tsg101 or VPS4A/B siRNAs, except the processed p24 Gag polypeptide, which wasstronger in the control siRNA-treated cells.B. HIV-1 Gag VLPs released into the supernatants were purified by sedimentation and ultracentrifugation through a 20% sucrose cushion andanalysed by Western blotting with anti-Gag serum. The amount of p24 in VLPs was normalized to the Pr55Gag + p42 + p24 expression levels incell lysates. Compared with untreated or control siRNA-treated cells, HIV-1 Gag VLP production was reduced by 70% and 90% in Tsg101 andVPS4A/B siRNA-treated cells respectively. Number of experiments 2.

HCMV infection in ESCRT and VPS4-depleted cells 2961

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Cellular Microbiology, 9, 2955–2967

seen by Le Blanc and colleagues, these differences arelikely to be cell type-specific. We observed a 10-fold reduc-tion in VSV release, suggesting that VPS4 proteins mayalso play a role in VSV envelopment. Interestingly, latedomains have been identified in the VSV matrix protein(Jayakar et al., 2000), although a dominant-negativeVPS4Amutant was reported not to affect VSV budding (Irieet al., 2004). The lack of effect on VSV budding observed inthe study by Irie and colleagues may be due to the fact that

functional VPS4B protein was still present in the cells. Inour experiments both VPS4 proteins were depleted.

Together these data show that depletion of VPS4 pro-teins by siRNAs provides a reliable system to investigatethe role of these proteins in cellular trafficking pathwaysthrough MVBs and the involvement of the ESCRTmachinery in virus budding.

Human cytomegalovirus (HCMV) envelopment is notinhibited in VPS4-depleted cells

To investigate whether VPS4 depletion affected HCMVenvelopment, we analysed virus release from RCMV288-infected RPE1 cells treated with siRNAs against VPS4A/Bor control siRNAs. Five days post infection, Western blotanalysis showed a reduction of ~70% in the levels ofexpression of the target proteins (Fig. 3A). Surprisingly,the amount of infectious virus released from VPS4A/B-depleted cells was significantly increased compared withuntransfected cells (P = 0.00009) or cells treated withcontrol siRNAs (P = 0.0009) (Fig. 3B).

To distinguish whether in infected cells VPS4A/BsiRNAs increased the number of HCMV particlesreleased, or whether they enhanced the infectivity of theviral particles, we determined the viral load in the super-natants by real-time polymerase chain reaction (PCR).We found that the viral load in the supernatants fromVPS4A/B-depleted cells was significantly increased com-pared with untransfected cells (P = 0.005) or cells treatedwith control siRNAs (P = 0.02) (Table 1). These data,together with the quantification of infectious viruses,showed that the ratio of infectious virus per viral particlereleased in untransfected and control siRNAs-transfectedRPE1 cells infected with RCMV288 was ~1:170 000, andthat this ratio was not significantly different in VPS4-depleted cells (ratio 1:150 000).

In addition, we investigated whether depletion ofVPS4 affected the production of cell-associated HCMV.RCMV288-infected RPE1 cells transfected with controlsiRNAs or siRNAs against VPS4A/B were harvested5 days post infection to analyse both the levels of VPS4knockdown and the amounts of cell-associated infectious

A

B

untra

nsfe

cted

VPS4A+B

siRNAs

cont

rol s

iRNA

108

106

107

PF

U m

l–1

VSV-G

actin

VSV

untra

nsfe

cted

VPS4A+B

siRNAs

moc

kco

ntro

l siR

NA

*

Fig. 6. VSV infection in VPS4A/B siRNA-treated cells. RPE1 cellswere untransfected or transfected with Alexa555-labelled controlsiRNAs against GFP or with siRNAs against VPS4A/B. After 56 h,the cells were either mock infected or infected with VSV at a moi of1. After a further 10 h, viruses released into the supernatant wereharvested and the cells lysed.A. Cell lysates were separated by SDS-PAGE blotted with anantibody against VSV glycoprotein G, while blotting with anti-actinserved to control for protein loading. VSV-G levels were reduced inVPS4A/B siRNA-treated cultures compared with untreated orcontrol siRNA-treated cultures.B. The amount of infectious VSV released into the supernatantswas determined in a plaque assay on BHK-21 cells. Virus titreswere significantly reduced in VPS4A/B siRNA-treated cellscompared with untreated or control siRNA-treated cells. All datapoints show means and standard deviations for quadruplicatesamples from a representative experiment. Number of experiments4. *P < 0.05. PFU, plaque-forming units.

Table 1. Viral genomes released from VPS4A/B siRNA-treated cells.

Viral genomes ml-1

Untransfected 1.1 ¥ 1010 � 1.3 ¥ 109

Control siRNA 1.2 ¥ 1010 � 2.4 ¥ 109

VPS4A + B siRNAs 1.8 ¥ 1010 � 3.3 ¥ 109

At 120 h post infection, supernatants were harvested and the numberof viral genomes analysed by real-time PCR. There was an increasein the number of viral genomes released in RPE1 VPS4-depletedcells. All data points show means and standard deviations forquadruplicate samples from a representative experiment. Numberof experiments 3.

2962 A. Fraile-Ramos et al.

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Cellular Microbiology, 9, 2955–2967

HCMV, while supernatants were collected to quantifyinfectious viruses released. As observed for extracellularviruses, we found a significant increase in cell-associatedHCMV from VPS4A/B siRNA-transfected cultures com-pared with untransfected (P = 0.0005) or control siRNA-transfected (P = 0.001) cultures (Table 2). Together theseresults indicate that HCMV envelopment is not inhibited incells treated with VPS4A/B siRNAs, and that VPS4 deple-tion increased both the number of cell-associated infec-tious viruses and virus particle release.

Enhanced production of HCMV particles in cells treatedwith protease inhibitors

To assess whether HCMV particles may be degraded byendo-lysosomal proteases, we analysed virus productionin infected cells treated with a combination of leupeptinand E64 (inhibitors of certain serine proteases and manythiol proteases, and cysteine proteases respectively),which inhibit endo-lysosomal proteolysis (Bush et al.,1997). RPE1 cells were infected with RCMV288 and,4 days after, were exposed to leupeptin and E-64, or leftuntreated. After a further 24 h, the numbers of cell-associated and extracellular viruses were quantified byinfection of fresh RPE1 cells. We observed a significantincrease in the number of cell-associated viruses (P =0.002), as well as in the infectious viruses released(P = 8 ¥ 10-7), from protease inhibitor-treated cells com-pared with untreated cells (Fig. 7). These results suggestthat when degradation by the endo-lysosomal proteasesis inhibited, viral production is increased, and that a frac-tion of the virus that is assembled in these cells undernormal conditions is subject to degradation in the endo-lysosomal system.

The HCMV assembly pathway therefore appears tointersect the endocytic pathway in multiple ways. HCMVparticles acquire their final envelope from a set of cyto-plasmic membranes that contain CD63 and are acces-sible to the fluid phase endocytosis marker HRP, andfeeding of endo-lysosomal protease inhibitors canincrease virus production. We therefore investigatedwhether HCMV envelopment might also be dependent oncomponents of the ESCRT pathway. However, siRNAdepletion of Tsg101 or ALIX/AIP1, or of these two proteinsin combination, did not show any effect on HCMVenvelopment. Similarly, knockdown of the two VPS4 pro-teins that are required for the completion of the ESCRTsorting reactions and recycling of ESCRT components didnot inhibit the production of infectious HCMV particles.Our studies therefore demonstrate that the ESCRTpathway is not required for HCMV envelopment.

Indeed, depletion of VPS4A/B increased the levels ofHCMV particles accumulating in cells and the amounts ofinfectious viruses released into the supernatant, although

Protease inhibitors

IP m

l–1

0

+_

5x105

10x105

15x105

**

Cell-associated virus

0

+_

2x104

4x104

6x104

Extracellular virus

***

Fig. 7. HCMV infection in protease inhibitor-treated cells. RPE1 cells were infected with RCMV288 at a moi of 1. After 96 h, the cells wereincubated in control medium or in medium containing 100 mM leupeptin and 2 mM E-64. Viruses released into the supernatant andcell-associated viruses were harvested at 120 h post infection, and assayed on RPE1 cells. The number of infectious viruses was significantlyincreased in cells and in supernatants from the protease inhibitor-treated cultures compared with untreated cultures. All data points showmeans and standard deviations for quadruplicate samples from a representative experiment. Number of experiments 2. **P < 0.01;***P < 0.001. IP, infectious particles.

Table 2. Cell-associated and extracellular viruses from VPS4A/BsiRNA-treated cells.

Cell-associated virus(IP per cell)

Extracellular virus(IP per cell)

Untransfected 0.99 � 0.13 0.08 � 0.02Control siRNA 0.93 � 0.32 0.06 � 0.01VPS4A + B siRNAs 2.56 � 0.45 0.22 � 0.03

At 120 h post infection, supernatants and cells from RPE1-untreatedcultures or cultures treated with VPS4A + B siRNAs were harvested,and viruses were added to fresh RPE1 cells. There was an increasein cell-associated and extracellular viruses in VPS4-depleted cells. Alldata points show means and standard deviations for quadruplicatesamples from a representative experiment. Number of experiments 4.IP, infectious particle.

HCMV infection in ESCRT and VPS4-depleted cells 2963

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Cellular Microbiology, 9, 2955–2967

the mechanism by which VPS4 depletion enhances virusproduction is not clear. As it has recently been shown thatsome ESCRT components and VPS4 are locatedthroughout the endocytic pathway and appear to beenriched on tubular-vesicular endosome-associatedmembranes rather than on MVBs (Welsch et al., 2006), itis tempting to speculate that these endosomal mem-branes might be related to the short cisternae whereHCMV undergoes envelopment. Depletion of VPS4 mayaffect the trafficking to or from these endosome-associated vesicles or lead to their accumulation, allowinglarger numbers of viruses to wrap into these membranes.Alternatively, HCMV particles or enveloped dense bodieshave been seen within, and budding into, MVBs (Fig. 1and Fraile-Ramos et al., 2002). While these particles maybe targeted to lysosomes for degradation, they could alsorepresent a source of infectious viruses because MVBscan, in some circumstances, fuse with the plasma mem-brane and release their content, as seen for the intralu-menal vesicles called exosomes (Stinchcombe et al.,2004; Raposo et al., 1996). In support of this notion, wehave seen CD63-labelled small vesicles that might corre-spond to exosomes together with extracellular viruses(Fig. 1C and E). However, the observation that treatmentof HCMV-infected RPE1 cells with inhibitors of lysosomalproteases increased virus production suggests that a frac-tion of the viruses assembling into MVBs are normallysent to lysosomes and degraded. Because depletion ofVPS4 inhibits the recycling of the ESCRT machinery andsorting to lysosomes, it may also inhibit virus degradation.

Although a large number of HCMV proteins containsequences resembling the ESCRT-interacting L-domainsof retroviruses, some of which are conserved in the enve-lope and tegument proteins of other herpesviruses, itremains to be determined whether these motifs interactwith cellular factors required for the final virus envelopmentsuch as components of the ESCRT machinery. Our studieshere indicate that HCMV does not require ESCRT compo-nents to complete its envelopment, but rather that the MVBmachinery may be involved in HCMV degradation.

Experimental procedures

Reagents

Tissue culture reagents and Nunc tissue culture plastic were fromLabClinics S.A. (Barcelona, Spain), and chemicals were fromSigma Aldrich (Madrid, Spain), unless otherwise indicated. EGFlabelled with Alexa488 (488EGF) was from Molecular ProbesEurope BV (Leiden, the Netherlands).

Antibodies

Antibodies used in this study were as follows: anti-CD63, 1B5(Fraile-Ramos et al., 2001), was described previously; rabbit anti-

bodies against VPS4A and VPS4B (von Schwedler et al., 2003)and against ALIX/AIP1 (Cabezas et al., 2005) were provided byW. Sundquist (University of Utah, UT) and H. Stenmark (theNorwegian Radium Hospital, Oslo, Norway) respectively; anti-b-actin clone AC-15 was purchased from Sigma Aldrich (Madrid,Spain), anti-Tsg101 clone 4A10 from GeneTex (San Antonio, TX),and anti-clathrin heavy chain, TD.1 from BD Bioscience (PaloAlto, CA); rabbit antibody against vaccinia virus wild-type strainWestern Reserve (Risco et al., 1999) was prepared in house;rabbit anti-HIV-1 Gag antiserum raised against the p24 portion ofGag, ARP432, was obtained from the AIDS Reagent Project ofthe United Kingdom Medical Research Council (Potters Bar, UK);anti-VSV G-protein, P5D4, was originally obtained from T. Kreis(University of Geneva, Geneva, Switzerland); anti-HRP was pur-chased from Jackson ImmunoResearch (supplied by Vitro S.A.,Madrid, Spain). Goat anti-mouse antibody labelled with Alexa594

was from Molecular Probes Europe BV. HRP-conjugated secondantibody reagents were from Pierce (supplied by Cultek S.L.,Madrid, Spain).

Small interfering RNA

Small interfering RNAs used in this study were as follows:anti-VPS4A targeted region AAGGCCAAGGAGAGCATTCGA(Ambion siRNA ID # 20167), anti-VPS4B targeted region AAGGCTGGGAACTACGAAGAA (Ambion siRNA ID # 15440), anti-Tsg101 targeted region AACCTCCAGTCTTCTCTCGTC (Garruset al., 2001) and anti-ALIX targeted region AAGCCGCTGGTGAAGTTCATC (Matsuo et al., 2004) were purchased fromAmbion (Europe) (supplied by Bionova Científica S.L., Madrid,Spain); control siRNAs targeted region AATTCTCCGAACGTGTCACGT (catalogue # 1027100) labelled with Alexa647 and againstGFP targeted region AACGTCTATATCATGGCCGAC labelledwith Alexa555 were purchased from Qiagen (supplied by IzasaS.A., Barcelona, Spain). The siRNA duplexes with symmetric 2 nt3′ (2′-deoxy) thymidine overhangs were chemically synthesizedand HPLC purified as described by the manufacturers.

Cells and viruses

Human foreskin fibroblasts (HFF) were grown in Dulbecco’smodified Eagle’s medium (DMEM) containing 10% NU-serum Iculture supplement (Becton Dickinson, Bedford, MA, USA),100 U ml-1 penicillin and 0.1 mg ml-1 streptomycin (PenStrep).RPE1 cells were purchased from Clontech (California, USA) andmaintained in DMEM:F-12 containing 10% fetal calf serum(FCS), 2 mM L-glutamine, 0.35% sodium bicarbonate and Pen-Strep as above. 3T3 cells and African green monkey kidney cells(BSC40) were maintained in DMEM containing 10% FCS, 4 mML-glutamine and PenStrep as above.

The Towne strain of HCMV was propagated and titred on HFF.A recombinant strain of HCMV AD169 expressing GFP (McSharryet al., 2001), RCMV288, was propagated and titred on RPE1 cells.RPE1 cells were infected in duplicate with 10-fold dilutions of anRCMV288 virus stock, and 10 days post infection, fluorescentgreen plaques were counted with a Zeiss Axiovert 135 invertedfluorescence microscope. A recombinant strain of vaccinia virusexpressing the HIV-1 Gag and protease proteins (Rodriguez et al.,1989) was propagated and titred in BSC40 cells by a standardplaque assay. The Indiana strain of VSV was propagated and titredon 3T3 cells as indicated for the recombinant vaccinia virus.

2964 A. Fraile-Ramos et al.

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Cellular Microbiology, 9, 2955–2967

Human cytomegalovirus (HCMV) infection in siRNA- orprotease inhibitor-treated cells

For the HCMV infection assays in siRNA-treated cells, 3 ¥ 105

RPE1 cells grown in 35 mm wells in six-well plates were infectedwith RCMV288 at a multiplicity of infection (moi) of 1 infectiousparticle per cell by spinoculation (cells were centrifuged at 1200 gfor 30 min at 25°C, followed by 1 h incubation at 37°C at normalgravity). Subsequently, cells were detached, pooled and seededat 1.5 ¥ 105 cells per well in six-well plates. Infected cells weretransfected twice, within a 24 h interval, with 1.4 mg siRNAduplexes using Oligofectamine according to the manufacturer’sinstructions (Invitrogen, supplied by Izasa S.A., Barcelona,Spain). At 96 h post infection, cells were washed and freshmedium was added to collect viruses released into thesupernatants. At day 5 post infection, supernatants were har-vested and infectious RCMV288 assayed on RPE1 cells, whilethe cells were lysed and the levels of cellular proteins analysedby Western blot. To analyse cell-associated viruses, infected cellswere harvested by scraping in medium containing 20% FCS,disrupted by a freeze-thaw cycle at -80°C, followed by sonica-tion, clarified by low-speed centrifugation, and infectiousRCMV288 were assayed as indicated above. In these assays56 h post infection, cells were fixed, analysed by flow cytometry,and the number of infected cells, i.e. number of infectious virusparticles, was assessed by GFP expression.

For some experiments, RPE1 cells infected with RCMV288 for96 h were washed and incubated with medium containing100 mM leupeptin and 2 mM E-64. At day 5 post infection, cell-associated and extracellular infectious RCMV288 were assayedon RPE1 cells by flow cytometry as described above.

Vesicular stomatitis virus (VSV) infection insiRNA-treated cells

For VSV infection assays, 1.5 ¥ 105 RPE1 cells in six-well plateswere transfected twice, within a 24 h interval, with 1.4 mg siRNAduplex using Oligofectamine. At 56 h after transfection, cellswere mock infected or infected with VSV at a moi of 1 infectiousparticle per cell. After 10 h, supernatants were harvested and thelevels of infectious VSV were determined by a standard plaqueassay on BHK-21 cells, while the infected RPE1 cells were lysedand the levels of cellular proteins and VSV-G were analysed byWestern blot.

HIV-1 Gag VLP production

For HIV-1 Gag VLP production assays, 1.5 ¥ 105 RPE1 cells insix-well plates were transfected twice, within a 24 h interval, with1.4 mg siRNA duplex using Oligofectamine. At 56 h after trans-fection, cells were mock infected or infected with a recombinantvaccinia virus expressing HIV-1 Gag and protease proteins(Rodriguez et al., 1989) at a moi of 5 infectious particles per cell.After 10 h, supernatants were harvested, centrifuged twice at1200 g for 10 min at 4°C to remove cell debris, and then layeredonto 20% sucrose cushions and centrifuged at 100 000 g for90 min at 4°C to purify the released VLPs. Cell lysates and theVLP pellets were analysed for viral and cellular proteins byWestern blot.

Western blotting

Retinal pigmented epithelial (RPE1) cells growing in 35 mm wellswere lysed in 100 ml non-reducing SDS-PAGE sample buffer,separated on 10% SDS-PAGE gels and transferred to nitrocellu-lose membranes. Blots were analysed as described (Fraile-Ramos et al., 2001). Autoradiography films were scanned and thebands were quantified with the use of the public domain ImageJ1.33 program (developed at the US National Institute of Health andavailable on the Internet at http://rsb.info.nih.gov/ij/). Protein load-ing was normalized to either clathrin heavy chain or actin expres-sion levels for siRNAexperiments. HIV-1 Gag VLP production wasnormalized to Pr55Gag + p42 + p24 expression levels in cell lysatesfrom recombinant vaccinia virus HIV-1 Gag-infected cultures.

Epidermal growth factor (EGF) degradation andimmunofluorescence microscopy

Retinal pigmented epithelial (RPE1) cells transfected twice,within a 24 h interval, with control or VPS4A/B siRNAs weretransferred to glass coverslips 30 h after the first transfection.After a further 42 h, the cells were cooled on ice, washed in coldbinding medium (BM: DMEM, containing 0.2% BSA, 10 mMHepes, and adjusted to pH 7.4) and labelled for 30 min at 4°Cwith 250 ml of 0.1 mg ml-1 488EGF in BM. Subsequently, the cellswere washed in BM to remove free ligand, and then incubated inBM for 30 min or 3 h at 37°C. The cells were then fixed with 3%paraformaldehyde in PBS, quenched with NH4Cl, permeabilizedand stained with anti-CD63 and Alexa594-conjugated goat anti-mouse antibodies in the presence of 0.05% saponin, essentiallyas described (Fraile-Ramos et al., 2001). Following staining, cov-erslips were mounted in Moviol and analysed using a ZeissAxiovert 200 microscope equipped with a Radiance Bio-Rad1200 confocal laser scanning system. Digital images were trans-ferred to Adobe Photoshop and adjusted, so that intensity valuesextended over the full measurable range (0–255 grey levels).

Immunolabelling of cryosections for EM

Human foreskin fibroblasts and RPE1 cells were infected with theTowne or AD169 strains of HCMV respectively, at a moi of 5infectious particles per cell and cultured for 96 h. Some infectedRPE1 cells were fed with 10 mg ml-1 HRP type II for 2 h at 37°C.Cells were then fixed by adding an equal volume of pre-warmeddouble-strength fixative (8% paraformaldehyde in 0.1 M sodiumphosphate buffer, pH 7.4) directly into the culture medium. After10 min, the medium was replaced with single-strength fixative (4%paraformaldehyde in 0.1 M sodium phosphate buffer, pH 7.4) andthe fixation continued for 1.5 h. Fixed cells were washed in PBScontaining 20 mM glycine and embedded in 12% gelatin, infiltratedwith 2.3 M sucrose and frozen in liquid nitrogen as described(Raposo et al., 1997). Cryosections (approximately 50 nm thick)were stained with anti-CD63, followed by a rabbit anti-mouse IgGbridging antibody (Dako, Ely, UK), or with a rabbit anti-HRPantiserum, and antibodies were detected with 10 nm proteinA-gold (EM Lab, Utrecht University, the Netherlands). Sectionswere examined with an EM420 transmission electron microscope(Phillips, Eindhoven, the Netherlands). Cryosections of RPE1-infected cells were labelled with 10 nm protein A-gold (BritishBioCell, Cardiff, UK) and examined with an JEM1010 transmission

HCMV infection in ESCRT and VPS4-depleted cells 2965

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Cellular Microbiology, 9, 2955–2967

EM (Jeol, Tokyo, Japan) in the Servicio de Microscopía Elec-trónica at the Centro de Biología Molecular Severo Ochoa, Madrid.

Human cytomegalovirus (HCMV) real-timePCR amplification

Human cytomegalovirus (HCMV) PCR was performed with aTaqMan (ABI)-based method using an adapted protocol from apreviously described method (Fox et al., 1995). Culture superna-tants from the infectivity assays were diluted 1:100 and 5 ml usedfor real-time amplification of HCMV DNA, using primers specific forgB as described elsewhere (Fox et al., 1992) (5′-GAGGACAACGAAATCCTGTTGGGCA-3′ [gB1] and 5′-TCGACGGTGGAGATACTGCTGAGG-3′ [gB2]). The 150 bp product was detected in realtime using a 29-mer TaqMan probe (5′-CAATCATGCGTTTGAAGAGGTAGTCCACG-3′[gB-P3]), labelled with 6-FAM at the 5′ endand with TAMRA at the 3′ end. Each PCR amplification reactioncontained 2.5 ml of 1¥ PCR buffer (containing 1.5 mM MgCl2, 5 mlof 25 mM MgCl2, 7.5 ml of dNTPs (6.25 mmol l-1 each nucleotide),1 ml each of gB1 and gB2 (15 pmol ml-1), 1 ml of gB-P3(5 pmol ml-1), and 0.25 ml of HotStarTaq polymerase (0.25 IU ml-1;ABI), made up to a final volume of 20 ml with sterile water. Finally,5 ml of diluted culture supernatant was added to each reaction.Reactions were set up using a 96-well plate format. In addition,each TaqMan PCR run consisted of a dilution series of 1 to 1 ¥ 104

genomes of cloned HCMV gB DNA, in triplicate (Temperton et al.,2003). The following PCR cycling parameters were used: 2 min at50°C, 10 min at 95°C, and 60 cycles of 15 s at 95°C and 15 s at60°C.All supernatant samples were amplified in duplicate, and theaverage HCMV load was calculated by using the software pro-vided for the ABI 7700 platform, with a standard curve createdusing the amplified cloned gB control DNA.

Acknowledgements

We thank colleagues who have supported this work, in particular,Dr J.L. Carrascosa for reading the manuscript, Drs W. Sundquistand H. Stenmark for providing the anti-VPS4A, anti-VPS4B andanti-ALIX sera respectively, the NIBSC Centralised Facility forAIDS Reagents, Potters Bar, UK, for the anti-HIV Gag antiserum,Professor G. Wilkinson for providing the recombinant HCMVAD169 expressing GFP, and Dr T. Kledal for carrying out theHCMV infections in HFF. We specially thank Sylvia Gutierrez fortechnical assistance with the confocal microscope and FACSanalysis, and Milagros Guerra for help with the immunolabellingEM studies in Madrid. We are grateful to all members of theEsteban and Risco laboratories for practical help and advice.A.F.-R. was supported by a Ramon y Cajal contract and by GrantsBFU2006-14379/BMC from the MEC of Spain and 200620M034from the ComunidadAutonoma de Madrid/CSIC.A.P.-M., M.M andV.C.E. were supported by the UK Medical Research Council.V.C.E. was also supported by the Wellcome Trust.

References

Babst, M. (2005) A protein’s final ESCRT. Traffic 6: 2–9.Bishop, N., and Woodman, P. (2000) ATPase-defective

mammalian VPS4 localizes to aberrant endosomes andimpairs cholesterol trafficking. Mol Biol Cell 11: 227–239.

Bush, K.T., Goldberg, A.L., and Nigam, S.K. (1997) Protea-

some inhibition leads to a heat-shock response, inductionof endoplasmic reticulum chaperones, and thermoto-lerance. J Biol Chem 272: 9086–9092.

Cabezas, A., Bache, K.G., Brech, A., and Stenmark, H.(2005) Alix regulates cortical actin and the spatial distribu-tion of endosomes. J Cell Sci 118: 2625–2635.

Fisher, R.D., Chung, H.Y., Zhai, Q., Robinson, H., Sundquist,W.I., and Hill, C.P. (2007) Structural and biochemicalstudies of ALIX/AIP1 and its role in retrovirus budding. Cell128: 841–852.

Fox, J.C., Griffiths, P.D., and Emery, V.C. (1992) Quantifica-tion of human cytomegalovirus DNA using the polymerasechain reaction. J General Virol 73: 2405–2408.

Fox, J.C., Kidd, I.M., Griffiths, P.D., Sweny, P., and Emery,V.C. (1995) Longitudinal analysis of cytomegalovirus loadin renal transplant recipients using a quantitative poly-merase chain reaction: correlation with disease. J GeneralVirol 76: 309–319.

Fraile-Ramos, A., Kledal, T.N., Pelchen-Matthews, A.,Bowers, K., Schwartz, T.W., and Marsh, M. (2001) Thehuman cytomegalovirus US28 protein is located inendocytic vesicles and undergoes constitutive endocytosisand recycling. Mol Biol Cell 12: 1737–1749.

Fraile-Ramos, A., Pelchen-Matthews, A., Kledal, T.N.,Browne, H., Schwartz, T.W., and Marsh, M. (2002) Local-ization of HCMV UL33 and US27 in endocytic compart-ments and viral membranes. Traffic 3: 218–232.

Garrus, J.E., von Schwedler, U.K., Pornillos, O.W., Morham,S.G., Zavitz, K.H., Wang, H.E., et al. (2001) Tsg101 andthe vacuolar protein sorting pathway are essential for HIV-1budding. Cell 107: 55–65.

Gibson, W. (1996) Structure and assembly of the virion.Intervirology 39: 389–400.

Homman-Loudiyi, M., Hultenby, K., Britt, W., and Soderberg-Naucler, C. (2003) Envelopment of human cytomegalovi-rus occurs by budding into Golgi-derived vacuolecompartments positive for gB, Rab 3, trans-golgi network46, and mannosidase II. J Virol 77: 3191–3203.

Hurley, J.H., and Emr, S.D. (2006) The ESCRT complexes:structure and mechanism of a membrane-traffickingnetwork. Annu Rev Biophys Biomol Struct 35: 277–298.

Irie, T., Licata, J.M., McGettigan, J.P., Schnell, M.J., andHarty, R.N. (2004) Budding of PPxY-containing rhabdovi-ruses is not dependent on host proteins TGS101 andVPS4A. J Virol 78: 2657–2665.

Jayakar, H.R., Murti, K.G., and Whitt, M.A. (2000) Mutationsin the PPPY motif of vesicular stomatitis virus matrixprotein reduce virus budding by inhibiting a late step invirion release. J Virol 74: 9818–9827.

Le Blanc, I., Luyet, P.P., Pons, V., Ferguson, C., Emans, N.,Petiot, A., et al. (2005) Endosome-to-cytosol transport ofviral nucleocapsids. Nat Cell Biol 7: 653–664.

Lee, S., Joshi, A., Nagashima, K., Freed, E.O., and Hurley,J.H. (2007) Structural basis for viral late-domain binding toAlix. Nat Struct Mol Biol 14: 194–199.

McSharry, B.P., Jones, C.J., Skinner, J.W., Kipling, D., andWilkinson, G.W. (2001) Human telomerase reversetranscriptase-immortalized MRC-5 and HCA2 human fibro-blasts are fully permissive for human cytomegalovirus.J General Virol 82: 855–863.

Martin-Serrano, J., Yarovoy, A., Perez-Caballero, D., and

2966 A. Fraile-Ramos et al.

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Cellular Microbiology, 9, 2955–2967

Bieniasz, P.D. (2003) Divergent retroviral late-buddingdomains recruit vacuolar protein sorting factors by usingalternative adaptor proteins. Proc Natl Acad Sci USA 100:12414–12419.

Matsuo, H., Chevallier, J., Mayran, N., Le Blanc, I., Ferguson,C., Faure, J., et al. (2004) Role of LBPA and Alix in multi-vesicular liposome formation and endosome organization.Science 303: 531–534.

Mettenleiter, T.C. (2004) Budding events in herpesvirusmorphogenesis. Virus Res 106: 167–180.

Mocarski, E.S. and Courcelle, C.T. (2001) Cytomegalovi-ruses and their replication. In Fields virology, 4th ed. Knipe,D.M., Howley, P.M., Griffin, D.E., Lamb, R.A., Martin, M.A.,Roizman, B., and Strauss, S.E. (eds). Philadelphia, PA:Lippincott-Raven Publishers, pp. 2629–2673.

Morita, E., and Sundquist, W.I. (2004) Retrovirus budding.Annu Rev Cell Dev Biol 20: 395–425.

Novoa, R.R., Calderita, G., Arranz, R. Fontana, J., Granzow,H. and Risco, C. (2005) Virus factories: associations of cellorganelles for viral replication and morphogenesis. BiolCell 97: 147–172.

Pass, R.F. (2001) Cytomegalovirus. In Fields virology, 4thed.Knipe, D.M., Howley, P.M., Griffin, D.E., Lamb, R.A.,Martin, M.A., Roizman, B., and Strauss, S.E. (eds).Philadelphia, PA: Lippincott-Raven Publishers, pp. 2675–2705.

Pelchen-Matthews, A., Raposo, G., and Marsh, M. (2004)Endosomes, exosomes and Trojan viruses. Trends Micro-biol 12: 310–316.

Pornillos, O., Garrus, J.E., and Sundquist, W.I. (2002)Mechanisms of enveloped RNA virus budding. Trends CellBiol 12: 569–579.

Radsak, K., Eickmann, M., Mockenhaupt, T., Bogner, E.,Kern, H., Eis-Hubinger, A., and Reschke, M. (1996)Retrieval of human cytomegalovirus glycoprotein B fromthe infected cell surface for virus envelopment. Arch Virol141: 557–572.

Raposo, G., Kleijmeer, M.J., Posthuma, G., Slot, J.W., andGeuze, H.J. (1997) Immunogold labeling of ultrathin cryo-sections: Application in immunology. In Handbook ofExperimental Immunology. Herzenberg, L.A., Weir, D.M.,Herzenberg, L.A and Blackwell, C, (eds). Oxford, UK:Blackwell Science, pp. 201–211.

Raposo, G., Nijman, H.W., Stoorvogel, W., Liejendekker, R.,Harding, C.V., Melief, C.J., and Geuze, H.J. (1996) B lym-phocytes secrete antigen-presenting vesicles. J Exp Med183: 1161–1172.

Risco, C., Rodriguez, J.R., Demkowicz, W., Heljasvaara, R.,Carrascosa, J.L., Esteban, M., and Rodriguez, D. (1999)The vaccinia virus 39-kDa protein forms a stable complexwith the p4a/4a major core protein early in morphogenesis.Virology 265: 375–386.

Rodriguez, D., Rodriguez, J.R., Rodriguez, J.F., Trauber, D.,and Esteban, M. (1989) Highly attenuated vaccinia virusmutants for the generation of safe recombinant viruses.Proc Natl Acad Sci USA 86: 1287–1291.

Sanchez, V., Greis, K.D., Sztul, E., and Britt, W.J. (2000)Accumulation of virion tegument and envelope proteins in astable cytoplasmic compartment during human cytomega-lovirus replication: characterization of a potential site ofvirus assembly. J Virol 74: 975–986.

von Schwedler, U.K., Stuchell, M., Muller, B., Ward, D.M.,Chung, H.Y., Morita, E., et al. (2003) The protein networkof HIV budding. Cell 114: 701–713.

Seo, J.Y., and Britt, W.J. (2006) Sequence requirements forlocalization of human cytomegalovirus tegument proteinpp28 to the virus assembly compartment and for assemblyof infectious virus. J Virol 80: 5611–5626.

Stinchcombe, J., Bossi, G., and Griffiths, G.M. (2004) Linkingalbinism and immunity: the secrets of secretory lysosomes.Science 305: 55–59.

Strack, B., Calistri, A., Craig, S., Popova, E., and Gottlinger,H.G. (2003) AIP1/ALIX is a binding partner for HIV-1 p6 andEIAV p9 functioning in virus budding. Cell 114: 689–699.

Temperton, N.J., Quenelle, D.C., Lawson, K.M., Zuckerman,J.N., Kern, E.R., Griffiths, P.D., and Emery, V.C. (2003)Enhancement of humoral immune responses to a humancytomegalovirus DNA vaccine: adjuvant effects of alumi-num phosphate and CpG oligodeoxynucleotides. J MedVirol 70: 86–90.

Tooze, J., Hollinshead, M., Reis, B., Radsak, K., and Kern, H.(1993) Progeny vaccinia and human cytomegalovirus par-ticles utilize early endosomal cisternae for their envelopes.Eur J Cell Biol 60: 163–178.

VerPlank, L., Bouamr, F., LaGrassa, T.J., Agresta, B.,Kikonyogo, A., Leis, J., and Carter, C.A. (2001) Tsg101, ahomologue of ubiquitin-conjugating (E2) enzymes, bindsthe L domain in HIV type 1 Pr55 (Gag). Proc Natl Acad SciUSA 98: 7724–7729.

Vincent, O., Rainbow, L., Tilburn, J., Arst, H.N. Jr andPenalva, M.A. (2003) YPXL/I is a protein interaction motifrecognized by aspergillus PalA and its human homologue,AIP1/Alix. Mol Cell Biol 23: 1647–1655.

Welsch, S., Habermann, A., Jager, S., Muller, B., Krijnse-Locker, J., and Krausslich, H.G. (2006) Ultrastructuralanalysis of ESCRT proteins suggests a role for endosome-associated tubular-vesicular membranes in ESCRTfunction. Traffic 7: 1551–1566.

Yoshimori, T., Yamagata, F., Yamamoto, A., Mizushima, N.,Kabeya, Y., Nara, A., et al. (2000) The mouse SKD1, ahomologue of yeast Vps4p, is required for normal endoso-mal trafficking and morphology in mammalian cells. MolBiol Cell 11: 747–763.

Supplementary material

The following supplementary material is available for this articleonline:Fig. S1. EM immunolocalization of endocytosed HRP on HCMV-infected cells. HCMV-infected RPE1 cells were incubated withHRP for 2 h at 37°C, processed for cryosectioning and labelledwith a rabbit anti-HRP antibody and 10 nm protein A-gold. Spe-cific labelling was observed over MVBs (A) as well as over themembranes wrapping viral particles (B). Scale bars = 200 nm.

This material is available as part of the online article from:http://www.blackwell-synergy.com/doi/abs/10.1111/j.1462-5822.2007.01024.x

Please note: Blackwell Publishing is not responsible for thecontent or functionality of any supplementary materials suppliedby the authors. Any queries (other than missing material) shouldbe directed to the corresponding author for the article.

HCMV infection in ESCRT and VPS4-depleted cells 2967

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Cellular Microbiology, 9, 2955–2967