Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part A

j ourna l homepage: www.e lsev ie r.com/ locate /cbpa

The clock gene Period3 in the nocturnal flatfish Solea senegalensis: Molecular cloning,tissue expression and daily rhythms in central areas

Águeda J. Martín-Robles a,b,e, Esther Isorna a,c, David Whitmore d,José A. Muñoz-Cueto a,e,⁎, Carlos Pendón b,⁎⁎

a Departamento de Biología, Facultad de Ciencias del Mar y Ambientales, Universidad de Cádiz, E-11510, Puerto Real, Spainb Departamento de Biomedicina, Biotecnología y Salud Pública, Facultad de Ciencias, Universidad de Cádiz, E-11510, Puerto Real, Spainc Departamento de Fisiología (Fisiología Animal II), Facultad de Biología, Universidad Complutense de Madrid, E-28040, Madrid, Spaind Department of Cell and Developmental Biology, Centre for Cell and Molecular Dynamics, University College London, London WC1E 6DE, United Kingdome CACYTMAR, Institutos de Investigación, Campus Universitario de Puerto Real, E-11510, Puerto Real, Spain

⁎ Corresponding author. Tel.: +34 956016023; fax:⁎⁎ Corresponding author. Tel.: +34 956016391; fax +

E-mail addresses: munoz.cueto@uca.es (J.A. Muñoz(C. Pendón).

1095-6433/$ – see front matter © 2011 Elsevier Inc. Aldoi:10.1016/j.cbpa.2011.01.015

a b s t r a c t

a r t i c l e i n f o

Article history:Received 28 September 2010Received in revised form 13 January 2011Accepted 13 January 2011Available online 31 January 2011

Keywords:Circadian rhythmsClock genesDaily expressionFlatfishLightPeriod3

Clock genes are responsible for generating and sustaining most rhythmic daily functions in vertebrates. Theirexpression is endogenously driven, although they are entrained by external cues such as light, temperatureand nutrient availability. In the present study, a full-length coding region of Solea senegalensis clock genePeriod3 (Per3) has been isolated from sole brain as a first step in understanding themolecular basis underlyingcircadian rhythms in this nocturnal species. The complete cDNA is 4141 base pairs (bp) in length, including anORF of 3804 bp, a 5′UTR of 247 bp and a 3′UTR of 90 bp. It encodes a putative PERIOD3 protein (PER3) of 1267amino acids which shares the main functional domains conserved between transcription factors regulatingthe circadian clock pathway. Sole PER3 displays high identity with PER3 proteins from teleost species (61–77%) and lower identity (39–46%) with other vertebrate PER3 sequences. This gene is expressed in allexamined tissues, being mRNA expression particularly evident in retina, cerebellum, diencephalon, optictectum, liver and ovary. Per3 exhibits a significant daily oscillation in retina and optic tectum but not indiencephalon and cerebellum. Our results suggest an important role of Per3 in the circadian clockworkmachinery of visually-related areas of sole.

+34 956016019.34 956016119.

-Cueto), carlos.pendon@uca.es

l rights reserved.

© 2011 Elsevier Inc. All rights reserved.

1. Introduction

The existence of circadian rhythms in biochemical, physiological andbehavioral processes is a shared characteristic of all living organismsfrom prokaryotes to humans. The genetic and molecular bases of theserhythms are known to be highly conserved along the phylogenetic scaleand are sustained by autoregulatory transcriptional–translationalmechanisms that involve a set of so-called clock genes (Bell-Pedersenet al., 2005). In the last few years, many clock genes (as for exampleClock, Per1, Per2, Per3, Bmal1, Cryptochrome1, Cryptochrome2, caseinkinase 1epsilon and 1delta) have been cloned and characterized inmammals (Reppert and Weaver, 2001, Okamura, 2004), revealing theexistence of two interlocked positive (represented by CLOCK andBMAL1) and negative (represented by PERIOD and CRYPTOCHROME)feedback loops (Hastings, 2000; Shearman et al., 2000). These genes are

expressed in a circadian manner, not only in the classical pacemakerstructures (the hypothalamic suprachiasmatic nucleus ofmammals andthe retina and pineal gland of non-mammalian vertebrates) but also in avariety of peripheral tissues and cell types (Balsalobre, 2002; Okamura,2004; Green and Besharse, 2004). Altogether, this evidence suggeststhat the vertebrate circadian system may be highly distributed insteadof being restricted to “master” clocks, and this fact is especially true inteleosts, where peripheral tissues appear to be also directly lightresponsive (Whitmore et al., 2000a).

Teleost clock genes have received relatively little attention, with theexception of detailed studies performed in the zebrafish, Danio rerio(Whitmore et al., 1998a, 2000b; Tamai et al., 2005). Nevertheless, thereis a growing interest for the study of teleost circadian systems and theirmolecular control, since zebrafish cannot really represent all of this largeand diverse class of vertebrates (Cahill, 2002). Thus, recent studies havebeen carried out in other diurnal species such as the rainbow troutOncorhynchus mykiss (Mazurais et al., 2000), the reef fish Siganusguttatus (Park et al. 2007; Sugama et al., 2008; Takemura et al., 2010),and the goldfish Carassius auratus (Velarde et al., 2009), and on diurnal/nocturnal switching species such as the Atlantic salmon Salmo salar(Davie et al., 2009) and the European sea bass Dicentrarchus labrax

Fig. 1. Schematic representation of the sole brain (sagittal view) that depicts dissectionsused in the present study to carry out the Per3 expression studies in the sole brain.1: Olfactory bulbs; 2: Telencephalon; 3: Optic tectum-tegmentum; 4: Diencephalon;5: Pituitary; 6: Cerebellum-vestibulolateral lobe; and 7: Medulla oblongata-spinal cord.Bar scale: 1 mm.

8 Á.J. Martín-Robles et al. / Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15

(Sánchez et al., 2010). However, to the best of our knowledge, there areno studies of clock genes in nocturnal fish species as the sole.

The Senegalese sole, Solea senegalensis, is a flatfish species with agreat commercial interest in Southern Europe for marine aquaculture(Dinis et al., 1999). This metamorphic species is also acquiring animportant relevance in chronobiological studies as the number ofpublished works focused on the sole circadian system has increased inthe last few years. Recent studies have shown that adult sole displaysnocturnal locomotor activity and feeding habits (Bayarri et al., 2004;Boluda-Navarro et al., 2009). The sole also exhibits daily (nocturnal),lunar and annual reproductive rhythms (Anguis and Cañavate, 2005;García-López et al., 2007;Guzmán et al., 2008;Oliveira et al., 2009). Dailyrhythms in plasmamelatonin (Bayarri et al., 2004; Vera et al., 2007) andmelatonin receptors (Oliveira et al., 2008; Confente et al., 2010) havealso been reported in sole, with lower levels during the day and higherlevels during the night. These rhythms are established at earlydevelopmental stages as revealed by the existence of daily variationson the expression of the melatonin biosynthesis enzyme AANAT2 from2 days post-fertilization (Isorna et al., 2009). However, molecularmechanisms underlying sole circadian rhythms remain unexplored.

Consequently, we have focused our efforts in characterizing themolecular clockwork machinery sustaining circadian rhythms in thisnocturnalflatfish. In afirst step, the clock gene Per3was chosen because isthe only Period gene that shows mRNA rhythms in constant conditionsand has been proposed as the most important gene for the control ofactivity rhythms infish (Pandoet al., 2001;Kanekoet al., 2006).Moreover,Per3 mRNA has been shown to oscillate rhythmically in embryos, itstranscript cycles starting on day 1 post-fertilization with or without anyentraining signals (Delaunay et al., 2000). In addition, ambient temper-ature also affected the developmental profile, the levels and cyclingamplitudes of Per3mRNA in zebrafish embryos (KanekoandCahill, 2005).

Fig. 2. Schematic diagram of the sole Per3 cDNA. Cloning strategy including primer pair locrectangles) are numbered as I, II, III, IV and V, following the sequential order of cloning. Primprimers used for the cloning of long overlapping fragments and italic numbers indicate thincluded in the BD SMART™ RACE cDNA amplification kit.

The present work conducted in sole was aimed at obtaining moleculartools to analyze the tissue distribution and daily expression pattern ofPer3, one of themain components of the endogenous clock in vertebrates.

2. Material and methods

2.1. Animals and sampling

Adult vitellogenic female sole specimens (S. senegalensis) from 200 to300 g in bodymasswere housed in the “Laboratorio de CultivosMarinos”(University of Cadiz, Puerto Real, Spain). Animals were kept in runningseawater at a constant temperature and salinity of 19±1 °C and 39 ppt,respectively, in indoor facilities receivingnatural environmental light. Fishwere fed by automatic feeders with commercial 2 mm dry pellets(Skretting España S.A, Burgos, Spain) to apparent satiety. This resulted in adaily ration of about 1% body weight. Fish were fasted for 24 h beforesampling. Theywere anaesthetized inMS-222 (Sigma, St Louis,MO; 100–200 mg/L of water) before sacrifice. Experimental animals were treatedaccording to the European Union Directive (EEC, 1986) for the protectionof animals used for experimental and other scientific purposes.

For cloning experiments, Northern blot and tissue distribution studies,sole specimens were sacrificed in March during daytime betweenZeitgeber Time (ZT) 3 andZT5, andneural (olfactory bulbs, telencephalon,optic tectum-tegmentum, diencephalon, cerebellum-vestibulolaterallobe, medulla, and retina, see Fig. 1 and Rodríguez-Gómez et al., 2000)and peripheral tissues (pituitary, gills, heart, liver, kidney, intestine andovary) were collected.

To determine daily variations in Per3mRNA expression, a total of 36animals from the same broodstock were anaesthetized, killed bydecapitation in March, and the brain was immediately removed at sixdifferent ZT points (n=6 at each point) during a 24 h cycle: ZT0, ZT4,ZT8, ZT12, ZT16 and ZT20 (sunrise 07:28; sunset, 19:20). Retina, optictectum, diencephalon and cerebellum were dissected as previouslyreported (Fig. 1). At night, sampling was performed under a dim redlight. All samples were frozen immediately in liquid nitrogen and storedat −80 °C until used.

2.2. Molecular cloning

Genewalking based strategy and 5′–3′ rapid amplification of cDNAends (RACE) were used to obtain the full-length coding region of solePer3 cDNA (Fig. 2). Total RNA was extracted from adult frozen brainusing TRIsure Reagent® (Bioline, London, UK) according to themanufacturer's instructions. RNA was digested with DNase I (USB,Cerdanyola, Spain) to remove genomic DNA and it was reversetranscribed using SMARTTM RACE cDNA kit (BD Bioscience, Clontech,Palo Alto, CA, USA). This cDNA was used as a template in polymerasechain reactions (PCR) with the Advantage II polymerase PCR kit (BDBioscience), which permitted us to obtain five overlapping sole Per3

ations for PCR and product sizes is shown. The five Per3 overlapping fragments (blackers are represented by arrowheads (see Table 1, for details). Bold numbers indicate thee primers used for nested and seminested PCR reactions. 5′ and 3′ RACE primers are

Table 1Sequences of primers used. Primers starting with P3 are degenerated and primersstarting with SS are specific of Solea senegalensis Per3 sequence.

Primer name Sequence (5′–3′)

Sole Per3 cloning1 (P3Z900F) AAYCTGCTGCAGGARGAGCTG2 (P3Z900F2) TCCAGCTCTCGCTCMAGTTC3 (P3Z7F) CAGCCCMTSCAGCCYTGGTTC4 (P3Z5F) GTSATGWTGAVTACCAGAT5 (P3Z5R) ATCTGGTABGTCAWCATSAC6 (P3Z800R) TGAGGRAGGTAKCCKAGCAA7 (P3Z1900F) TACAGCAGCACCATYGTCCA8 (SSPER3R1) AGCTCACTTGATGTAGATTGGG9 (P3Z2000F) CACACWCAGAAGGAGGAGCA10 (SSPER3R2) GAGGTTGTGCCAGTGTTGC11 (P3Z1000F) CCAGCTGGTCCAGCTTYRTCAAC12 (SSPER3R3) CAGAGACGGGAGCAGCATCAGCC13 (SSPER3R4) GACTCAGGTTGCGGCACGTGGAC14 (SSPER3R5) CATTGTTGTGAACCGGCT15 (SSPER3R6) ACTCGTCCTGACTTTGTGCC16 (SSPER3R7) CGACGCTGATGTAATGCTCG17 (SSPER3R8) CTCGTCCTGACTTTGTGCCGTCC18 (SSPER3R9) TGTGCCGTCCAATGATGAAGG19 (SSPER3R10) CGGAGAGACGCCACTGTTTGTT20 (SSPER3R13) GGCTTCCATCGGACAAACGCAGC21 (SSPER3R11) GCCTTACACTACGCACTCAA22 (SSPER3R12) ACAGAGGGCGACAGAAGACAGAA

Northern blot and tissue distributionP3Z900F AAYCTGCTGCAGGARGAGCTGSSPER3R1 AGCTCACTTGATGTAGATTGGGSSPER3pcrF2 TGCCCAATCTACATCAAGTGSSPER3pcrR2 CTGCTCCTGACTGAACCAAGSSACTINF GACATGGAGAAGATCTGGCATCASSACTINR GGCAGCTCATAGCTCTTCTCC

Real time quantitative PCRSSPER3qpcrF3 GCTCAGGGGCAAGAGTTTCSSPER3qpcrR3 GTTCATTGGGAGGTGGTTTCSSACTB2F AATCGTGACCTCTGCTTCCCCCTGTSSACTB2R TCTGGCACCCCATGTTACCCCATCSSRPS4F GTGAAGAAGCTCCTTGTCGGCACCASSRPS4R AGGGGGTCGGGGTAGCGGATG

9Á.J. Martín-Robles et al. / Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15

fragments (Fig. 2). Degenerated forward primers were designed fromPer3 sequences available in the public databases and specific reverseprimers were designed from the partial sequences obtained (Table 1)using the Oligo Explorer v 1.2 software.

The cDNA fragments I, II and III were amplified from the 3′-RACE-Ready cDNA and cDNA fragments IV and V were obtained using the 5′-RACE-Ready cDNA library (Fig. 2). First (I) and second (II) fragmentswereamplified under the following PCR conditions: 94 °C for 2 min and 35cycles of 94 °C for 30 s, 60 °C for 30 s and 72 °C for 90 s. The PCR to obtainthe next fragment (III) was carried out as follows: 94 °C for 2 min and 30cycles of 94 °C for 30 s, 68 °C for 30 s and 72 °C for 1 min. The fourthfragment (IV)was achieved byusing the following PCRprotocol: 94 °C for2 min and 35 cycles of 94 °C for 30 s, 58 °C for 30 s and 72 °C for 2 min.Finally, the last fragment (V) including the5′UTRwasobtainedby5′RACEPCR as follows: 94 °C for 2 min, 30 cycles of 94 °C for 30 s, 68 °C for 30 sand 72 °C for 3 min. In addition, nested or seminested reactions wereperformedduring the cloning as indicated in Fig. 2, to confirm the identityof sole Per3 sequence.

All amplified products were purified with GeneClean® Turbo Kit(Qbiogene, Pacisa-Giralt, Alcobendas, Spain), subcloned into TOPO-TAcloning vector (Invitrogen, Barcelona, Spain) and at least five clonesper fragment were sequenced by using the BigDye® Terminator v3.0Ready Reaction Cycle Sequencing Kit in the ABI PRISM 3100 GeneticAnalyzer (Applied Biosystems, Carlsbad, CA, USA). Different frag-ments obtained were overlapped to firmly determine the consensusnucleotide sequence of the sole Per3 cDNA obtained.

2.3. Sequence analysis

The nucleotide and deduced amino acid sequences were analyzedwith the BLAST software. Multiple alignments for primer design andphylogenetic analysis were carried out using the ClustalW algorithm.Conserved domains and motifs were identified by the NCBI ConservedDomain Database and several tools of the ExPASy Proteomics Server.The phylogenetic tree was constructed using the neighbour-joiningmethod with the Phylo_win 2.0 software (Galtier et al., 1996) andbootstrap analysis with 1000 replicationswas used to test the strictnessof the tree (Felsenstein, 1985).

2.4. Northern blot

Northern blot analysis was carried out as is described previously byGonzález-Rovira et al. (2009). Briefly, total RNA was extracted from theretina, brain and ovary of animals sacrificed during daytime using TRIsurereagent (Bioline). Thirty micrograms of RNA was separated on a 1%formaldehyde-agarose gel and transferred to a positively charged nylonmembrane (Pall Corporation, FL, USA) using 10x SSC (Sodium Chloride3 M, tri-Sodium citrate dehydrate 300 mM, pH 7.0). RNAwas fixed to themembrane by UV-crosslinking (120 mJ) and blocked for 2–3 h at 57 °C inChurch mix containing sodium phosphate buffer 0.25 M, pH 7.2, EDTA1.0 mM, 1% BSA and 7% SDS. Sole Per3 and β-actin (Genbank accessionnumberDQ485686) fragments of 1199 bp and 515 bp, respectively,wereused as probes in two different membranes. They were amplified by PCRusing primers P3Z1900F and SSPER3R1 for sole Per3 and SSACTINF andSSACTINR for sole β-actin (Table 1) and purified with GeneClean® TurboKit (Qbiogene). Radioactive labelling was performed by using the Ready-To-Go DNA Labelling Beads (Amersham, Biosciences, Uppsala, Sweden)and [α-32P]-dCTP (Hartmann Analytic, Grupo Taper, Madrid, Spain). Themembranes were hybridized in Churchmix for 14 h at 57 °C andwashedat the same temperature two times in 5x SSC-0.1% SDS for 20 min, twotimes in 2x SSC-0.1% SDS for 20 min and once with 1x SSC-0.1% SDS for15 min. Blotsweredetectedbyexposing themembranes toCurixRP2film(Agfa, Barcelona, Spain) at −80 °C for 3 days (Per3 probe) or overnight(β-actin probe), using an intensifying screen (Amersham).

2.5. Tissue expression analysis by Reverse Transcription (RT)-PCR

Total RNA was extracted from sole neural and peripheral tissues asdescribed above and 100 ng of DNase I-treated RNA was retro-transcribed using the iScript cDNA synthesis kit (Bio-Rad, Alcobendas,Spain). PCR reactions were carried out using a set of specific forwardand reverse primers designed from the cloned Per3 sequence(Table 1), and the following conditions: 94 °C for 5 min and 30 cyclesof 94 °C for 30 s, 58 °C for 30 s and 72 °C for 1 min. Sole β-actin wasused as internal control gene. Amplified products were resolved in 1%agarose gel ethidium bromide stained, purified and sequenced toverify that they corresponded to sole Per3 sequence.

2.6. Real time quantitative PCR expression analysis

Total RNA was extracted from retina, optic tectum, diencephalonand cerebellum, and retro-transcribed using the Quantitec® ReverseTranscription Kit (Qiagen, Hilden, Germany), which includes aprevious DNase treatment to remove genomic DNA. Real time geneexpression analysis of Per3was performed in a Chromo 4™ Four-ColorReal-Time System (Bio-Rad) using sole β-actin and rps4 (Genbankaccession number AB291557) for normalization. PCR reactions weredeveloped in a 20 μL volume containing cDNA, iTaqTM SYBR® GreenSupermix with ROX (Bio-Rad) and specific primers (Table 1). PCRconditions for sole Per3 were: initial denaturation 2 min at 95 °C and40 cycles of 10 s at 95 °C and 35 s at 57.7 °C. PCR conditions forreference genes were almost similar but the annealing–extension stepwas 30 s at 66 °C (β-actin) or 64.2 °C (rps4). Duplicates of each sample

10 Á.J. Martín-Robles et al. / Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15

were analyzed in the same assay. Standard curves were generated foreach gene with 10-fold serial dilutions of cDNA and all calibrationcurves exhibited slopes close to −3.32 and efficiencies around 100%.Melting curves were performed for each sample in order to confirmthat a single product was amplified. Non template control and nonretro-transcribed total RNA sample were used as negative controls.The ΔΔCt method (Livak and Schmittgen, 2001) was used todetermine the relative mRNA expression.

2.7. Data analysis

Daily statistical differences among groups were determined using aone way ANOVA followed by a multiple contrast of range test (LSD). Ifnecessary, values were transformed (logarithmic or square roottransformations) to get normal distribution and homogeneity ofvariances. In all cases, statistical significance was accepted at pb0.05.All statistical tests were made using Statgraphics Plus 5.1 software.Rhythm analyses were performed by the cosinor method (Nelson et al.,

Fig. 3. Deduced amino acid sequence (1267 aa) and conserved regions of Senegalese sole Pdomains are shaded and sequencemotifs Nuclear Export Signal (NES), Nuclear Localization Sglycine repeat region (SG) is boxed.

1979), using the softwaredevelopedbyProf.A. DíezNoguera (Universityof Barcelona) and they were considered significant when pb0.05.

3. Results

3.1. Cloning of sole Per3 cDNA

The cloning strategy described above has allowed us to obtain a4141 bp cDNA sequence (SsPer3, GenBank accession numberFM177703). This sequence consists of a full-length 3804 bp openreading frame (ORF), flanked by a 247 bp 5′untranslated region (5′UTR) and a short 90 bp 3′untranslated region (3′UTR). The poly-adenylation signal (AATGAA) was located 30 nucleotides upstream ofthe poly A tail. The putative sole PER3 protein has 1267 amino acidsand an estimated molecular mass of 137.9 kDa. Predicted proteinanalysis revealed the existence of highly conserved PER-ARNT-SIM(PAS) binding domains PAS A (residues 174 to 240) and PAS B(residues 314 to 380) and a cytoplasmic localization domain (CLD,residues 389 to 432). In addition, one putative nuclear localization

er3. Numbers on the left indicate the amino acid positions. The PAS A, PAS B and CLDignal (NLS) and CKIɛ phosphorylation sites (CKIɛ site) are underlined. Serine/threonine–

Fig. 4. Phylogenetic tree showing the relationship of sole PER3 with other vertebratePER proteins. A consensus tree to corresponding 1000 bootstrap replications wasobtained by the neighbour-joining method. The length of the branches is proportionalto the phylogenetic distance. Solea senegalensis PER3 position is shaded in thecorresponding PER3 branch. Cf, Canis familiaris; Cj, Coturnix japonica; Cp, Cynopspyrrhogaster; Dr, Danio rerio; Ga, Gasterosteus aculeatus; Gg, Gallus gallus; Hs, Homosapiens; Mm, Mus musculus; Ol, Oryzias latipes; Ps, Podarcis sicula; Sg, Siganus guttatus;Ss, Solea senegalensis; Tn, Tetraodon nigroviridis; Tr, Takifugu rubripes; Xl, Xenopus laevis;and Xt, Xenopus tropicalis. Protein accession numbers and Ensembl protein IDs used forphylogenetic analysis were: ENSCAFP00000025009, ENSCAFP00000018297,XP_850317 (Canis familiaris PER1, PER2, PER3); BAB03455, BAB03456 (Coturnixjaponica PER2, PER3); BAC98490 (Cynops pyrrhogaster PER1); NP_001025354,NP_997604, NP_878277, NP_571659 (Danio rerio PER1a, PER1b, PER2, PER3);ENSGACP00000025523, ENSGACP00000017830, ENSGACP00000007489 (Gasterosteusaculeatus PER1b, PER2a, PER2b); NP_989593, XP_417528 (Gallus gallus PER2, PER3);NP_002607, NP_073728, NP_058515 (Homo sapiens PER1, PER2, PER3); NP_001152839,NP_035196, NP_035197 (Mus musculus PER1, PER2, PER3); NP_001129992,ENSORLP00000020793, ENSORLP00000019352, ENSORLP00000019968 (Oryzias latipesPER1b, PER2a, PER2b, PER3); CAI43981 (Podarcis sicula PER2); ABM97610 (Siganusguttatus PER2); FM177703 (Solea senegalensis PER3); GSTENP00013830001,GSTENP00028368001, GSTENP00026769001, GSTENP00013979001 (Tetraodon nigro-viridis PER1, PER2a, PER2b, PER3); SINFRUP00000170087, SINFRUP00000147284,SINFRUP00000174412, SINFRUP00000175673 (Takifugu rubripes PER1b, PER2a,PER2b, PER3); NP_001079172, NP_001081098, (Xenopus laevis PER1, PER2); andNP_001072696 (Xenopus tropicalis PER3).

Fig. 5. Northern blot analysis of Senegalese sole Per3. Thirty micrograms of total RNAfrom adult retina (A), brain (B) and ovary (C) was analyzed using radioactive-labelledPer3 and β-actin probes. Transcript sizes estimated were 6.4 kb and 3.9 kb for Per3 and2.6 kb for β-actin. Sole Per3 transcripts are indicated by black arrowheads. RiboLadderLong RNA molecular weight marker sizes are represented on the right.

11Á.J. Martín-Robles et al. / Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15

signal (NLS), one putative nuclear export signal (NES), two putativecasein kinase 1epsilon (CKIɛ) phosphorylation sites and one terminalserine/threonine–glycine (SG) repeat were also identified (Fig. 3).Sole PER3 shares 61–77 % identity with PER3 proteins from otherteleost fish and 39–46 % with other PER3 vertebrate sequences. This

result was consistent with the phylogenetic tree that clearlypositioned sole PER3 within the corresponding fish PER3 branch,showing more divergence with PER3 proteins from other vertebratespecies. Moreover, higher divergence was found with regard to PER1and PER2 branches (Fig. 4).

3.2. Northern blot analysis

To identify the size of sole Per3 gene transcript, Northern blotanalysis was performed using total RNA from sole retina, brain andovary and specific probes. Under high stringency conditions, anintense signal with an estimated size of 6.4 kb was detected in allassayed tissues, particularly in retina. A less prominent labelling wasdetected in retina and ovary with an estimated size of 3.9 kb (Fig. 5).Regarding sole β-actin, a single band was also revealed with anapproximated size of 2.6 kb.

3.3. Tissue expression pattern of sole Per3

Per3 expression was detected by RT-PCR in all neural and peripheraltissues tested in the present study (Fig. 6). In neural tissues, theexpression was remarkable in retina, cerebellum, diencephalon andoptic tectum, and less apparent in telencephalon, olfactory bulbs andmedulla. The pituitary also exhibited a perceptible band. In someperipheral tissues, Per3 expression was more evident than in neuraltissues. A prominent expression was observed in liver and ovary,followed by gills, heart, intestine and kidney (Fig. 6).

3.4. Daily variations of Per3 mRNA in central tissues

Real time quantitative PCR was carried out in the retina, optictectum, diencephalon and cerebellum during a 24 h light–dark cycle.These tissues were selected because they exhibited the highest Per3expression in RT-PCR analysis, they have been implicated in the

Fig. 6. RT-PCR expression of Per3 in neural and peripheral tissues of sole. The RT-PCR conditions were as described in Materials and methods. A 430 bp specific Per3 product wasdetected in all tissues tested (upper panel). β-actin expression was used for normalization and products obtained in the assayed tissues (515 bp in size) are shown below.Abbreviations: MW, molecular weight marker (100-bp Dominion, Córdoba, Spain); OB, olfactory bulbs; TEL, telencephalon; OT, optic tectum; DIE, diencephalon; PIT, pituitary; CE,cerebellum; ME, medulla; RET, retina; GI, gills; HE, heart; LI, liver; KI, kidney; INT, intestine; and OV, ovary.

Table 2Cosinor analysis of Per3 gene expression rhythms in central tissues of sole.

Retina Optic tectum Diencephalon Cerebellum

Mesor (relative expression) 3.28 (Lim 2.62–3.96) 0.70 (Lim 0.54–0.86) 0.83 (Lim 0.68–0.98) 1.30 (Lim 1.16–1.45)Amplitude (relative expression) 3.30 (Lim 2.33–4.26) 0.44 (Lim 0.22–0.66) 0.19 (Lim −0.02–0.40) 0.20 Lim (0.00–0.41)Acrophase (ZT hours) 21.10 (Lim 19.5–22.2) 23.20 (Lim 20.5–1.5) 2.00 (Lim 20.27–7.33) 12.35 Lim (6.40–18.31)p-value * * N.S. N.S

Numeric values of mesor, amplitude and acrophase, as well as the significance of the rhythm (p-value) are presented. The fiducial limits of these parameters are also indicated.*pb0.00001; N.S. Non significant rhythm.

12 Á.J. Martín-Robles et al. / Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15

processing of visual/light information and they contain melatoninbinding sites and express melatonin receptors in sole (Oliveira et al.,2008; Confente et al., 2010). Statistical analysis including cosinor andANOVA revealed significant daily variations of Per3 in retina and optictectum (Table 2, Fig. 7A and B). In contrast, Per3 expression indiencephalon and cerebellum did not exhibit significant daily rhythmby cosinor analysis (Table 2) or differences by one-way ANOVA(Fig. 7C and D). In retina and optic tectum, Per3 expression peaked atthe dark-to-light transition, showing their acrophases at night (ZT21.1 and 23.2, respectively) and the minimum expression aroundsunset (Table 2, Fig. 7A and B).

A

C

Fig. 7. Daily expression of sole Per3 in central tissues: (A) Retina, (B) Optic tectum, (C) DiencEach value represents the mean±SEM of six different specimens (n=6). Samples were takebars indicate day-time sampling points (ZT0, ZT4, and ZT8) and black bars represent nighsignificant differences between mean values (pb0.05).

4. Discussion

In this work, we have reported the cloning of a Per3 cDNA in anocturnal flatfish species, the Senegalese sole, which is expressed incentral and peripheral tissues and displays significant daily oscillationsin retina and optic tectum, but not in diencephalon and cerebellum.

Predicted sole PER protein obtained has 1267 amino acids. Sequenceidentity, structural and phylogenetic analyses confirmed that the PERprotein identified is closely related to PER3 vertebrate proteins, inparticular, to Takifugu rubripes and Tetraodon nigroviridis PER3.Evolution of clock genes reflects the existence of several gene

B

D

ephalon, and (D) Cerebellum. Per3mRNA was measured by real time quantitative PCR.n every 4 h and relative expression was normalized using β-actin and rps4 genes. Whitet-time sampling points (ZT12, ZT16, and ZT20). Different letters indicate statistically

13Á.J. Martín-Robles et al. / Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15

duplication events since they are present in a single copy in insects andadditional copies are present in vertebrates (Tauber et al., 2004).Northern blot analysis performed in retina, brain and ovary suggeststhat a main Per3 transcript of 6.4 kb exists in sole, as occurred inzebrafish, fugu, tetraodon and medaka, which is orthologous tomammalian Per3 (Wang, 2008). However, the presence of an additionalband of 3.9 kb in retina and ovary could reflect that more than one Per3transcript is present in this species, at least in some tissues.

Structural analysis showed that sole PER3 contains the mainfunctional regions shared between transcription factors regulating thecircadian clock. These include two tandemly organized PAS domains(PASA–PASB) in theN-terminal part of theprotein and aCLDdomain C-terminal to the PAS domains. In the biological timing context, PASdomains function as dimerization domains required for PER–PERassociations to control their post-translational regulation and subcellu-lar distribution (Ponting and Aravind 1997; Whitmore et al., 1998a, b).The cytoplasmic localization domain confers cytoplasmic localization tothemonomeric forms of PER and it is functional inmammalian PER3 butnot in PER1 and PER2 (Yagita et al., 2000, 2002; Vielhaber et al., 2001).CLD domains also seem to contribute to the proper structure of the PASdomain and protein folding (Ponting and Aravind, 1997).

Similar to other vertebrate PER proteins, sole PER3 exhibits aputative nuclear localization signal (NLS), a putative nuclear exportsignal (NES), two putative CKIɛ phosphorylation sites and a terminalserine/threonine–glycine repeat region. A NLS is a short basic aminoacid sequence which is required for the translocation of PER3heterodimers from the cytoplasm to the nucleus (Kaffman and O'Shea1999; Yagita et al., 2000, 2002). CKI epsilon/delta phosphorylationsites are serine/threonine enriched clusters that serve as keyregulators of PER activity and contribute to establish and maintaincircadian rhythms (Lee et al., 2004). Cellular trafficking of clockproteins is also determined by sequence motifs that allow activetransport of the protein back to the cytoplasm as the NES signal, whichis rich in large hydrophobic amino acids, particularly leucine orisoleucine (Gerace, 1995). The presence of NLS, CKIɛ phosphorylationsites and NES in sole PER3 suggests that this protein could be shuttlingcontinuously between the cytoplasm and the nucleus, as has beenproposed for mammalian PER1 and PER2 (Vielhaber et al., 2001;Yagita et al., 2002).

Clock gene expression is not restricted to central pacemakerstructures and exhibits a wide tissue distribution in all species studiedfrom insects to mammals, suggesting a high distribution of circadianoscillators throughout the animal body (Plautz et al., 1997; Yamazakiet al., 2000; Yoshimura et al., 2000; Kaneko et al., 2006; Vallone et al.,2007; Velarde et al., 2009). Our tissue expression results determinedby RT-PCR agree with these findings since we have detected Per3expression in all neural and peripheral tissues examined in sole,demonstrating that also in this species, clockgenes arewidely expressedoutside the brain.

Expression analysis during a 24 h period showed that Per3 exhibitsa significant daily oscillation in visually-related neural tissues as theretina and optic tectum of sole. Per3 is able to anticipate dawn becausethe expression of this gene is up-regulated before sunrise, showing itsacrophase at the end of the night (3 h and 1 h before dawn for retinaand optic tectum, respectively). This expression is significantlydecreased to basal levels by the end of the light phase or earlynight, with minimum values at ZT8 for the retina and ZT12 for theoptic tectum. These results are consistent to those found in zebrafish,goldfish or Japanese quail (Delaunay et al., 2000; Pando et al., 2001;Velarde et al., 2009; Yoshimura et al., 2000) but differ to that reportedin mammals (Zylka et al., 1998; Kamphuis et al., 2005; Peirson et al.,2006). Although these rhythms are quite similar in timing in bothtissues, there is a significant difference in their amplitudes, beingconsiderably higher in the photoreceptive retina in relation to theoptic tectum. These differences may be caused by the endogenousproperties of their oscillators, differences in photosensitivity and/or

phototransduction, in the coupling among cells or the presence ofcells with variable periods, phases and amplitudes.

The absence of a significant Per3 rhythmic expression in thediencephalon of sole is interesting since this area includes the retino-recipient suprachiasmatic nucleus (SCN) of fish (Springer andMednick, 1984; Yáñez et al., 2009). This nucleus represents the“master” pacemaker in mammals and exhibits high amplituderhythms of clock gene expression (Klein et al., 1991). In addition, allbrain regions examined to date in zebrafish have been shown to berhythmic (Whitmore et al 1998b). It should be noted that a brain areawith similar pacemaker properties as mammalian SCN has not beenyet found in fish brain and, in fact, it is not clear if the retino-recipientSCN reported in fish represents the real homologue of mammalianSCN. In mammals, different SCN regions appear functionally distinctwith only some regions exhibiting rhythmic clock gene expression(Hamada et al., 2001; Silver and Schwartz, 2005). Therefore, it is alsopossible that a pacemaker structure exists in the sole hypothalamus,but it remains masked when this region is processed as a whole.Moreover, the absence of rhythmic Per3 expression in the dienceph-alon of sole does not mean that this area lacks pacemaker activitybecause other Period and/or clock genes exhibiting daily differences intheir transcript levels could sustain its rhythmicity.

In our RT-PCR study, we have detected a high Per3 expression inthe cerebellum of sole but this brain area lacks a significant dailyrhythm in Per3 mRNA levels. It has been considered that theteleostean cerebellum serves visual, motor learning and coordinationfunctions (Finger, 1983;Wullimann, 1998). Moreover, the cerebellumexpresses melatonin receptors in sole (Confente et al., 2010) andexhibits significant day/night differences in the density of melatoninbinding sites (Oliveira et al., 2008). Nevertheless, the possible role ofthe cerebellum in the circadian organization has been poorly studied,and although the hindbrain appears to be rhythmic in zebrafish(Whitmore et al., 1998b), there are no more available data in fish tocompare our results. It is interesting to note that Per1 and Per2rhythmic daily expression has been detected in the cerebellum ofmammals (Sun et al., 1997; Akiyama et al., 1999; Farnell et al., 2008;Mendoza et al., 2010). Therefore, we cannot rule out the existence ofdaily rhythms in the expression of other genes from the Period familyin this central area.

In fish, circadian clock gene expression has been analyzed only indiurnal (Whitmore et al., 1998a, 2000b; Mazurais et al., 2000; Tamaiet al., 2005; Park et al. 2007; Sugama et al., 2008; Velarde et al., 2009;Takemura et al., 2010) and diurnal/nocturnal switching (Davie et al.,2009; Sánchez et al., 2010) species. In this way, our study in solerepresents the first approach to analyze the clockwork machinery in anocturnal fish. The molecular timing of Per3 from sole looksremarkably similar to those from zebrafish (Delaunay et al. 2000)and goldfish (Velarde et al., 2009), two diurnal species. Hence, theexpression pattern for at least one core clock component does notappear to be altered in diurnal versus nocturnal fish species. Thissituation resembles what happens in mammals, where the temporalprofile of clock gene expression in both chronotypes is similar(Challet, 2007). Taken together, these data reinforce that the mostbasic difference between diurnal and nocturnal animals arises frommechanisms operating downstream of neural oscillators.

In conclusion, we have cloned a full-length coding region of solePer3 and demonstrated that Per3mRNA exhibits a wide distribution incentral and peripheral tissues, as well as significant daily variations invisually-related structures as the retina and the optic tectum. Inaddition, the absence of a significant Per3 rhythmic expression in thediencephalon and the cerebellum of sole could reflect that other brainstructures and/or clock genes might sustain the circadian machineryin this species. Our results are also consistent with the conservation oftranscriptional mechanisms in the circadian clock of diurnal andnocturnal fish species, at least for Per3. Ongoing studies are focused onthe isolation of other core clock components and the analysis of their

14 Á.J. Martín-Robles et al. / Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15

spatiotemporal expression patterns. This information, together withbehavioral studies could contribute to a better understanding of themolecular clockwork machinery sustaining circadian rhythms in thisnocturnal species and might provide useful information of practicalinterest for sole aquaculture.

Acknowledgments

This work was supported by grants from the Spanish MICINN(AGL2007-66507-C02-01) and Junta de Andalucía (P06-AGR-01939) toJosé A. Muñoz-Cueto, and a predoctoral fellow of the Spanish MICINN(BES-2005-8629) to Águeda J. Martín-Robles. We thank FrancescaConfente for her help in sampling. We also thank all staff from the“Planta de CultivosMarinos” (University of Cádiz) for themaintaining ofanimals used in these studies. Sequencing analyses were performed inServicio Central de Ciencia y Tecnología (University of Cádiz).

References

Akiyama, M., Kirihara, T., Takahashi, S., Minami, Y., Yoshinobu, Y., Moriya, T., Shibata, S.,1999. Modulation of mPer1 gene expression by anxiolytic drugs in mousecerebellum. Br. J. Pharmacol. 128, 1616–1622.

Anguis, V., Cañavate, J.P., 2005. Spawning of captive Senegal sole (Solea senegalensis)under a naturally fluctuating temperature regime. Aquaculture 243, 133–145.

Balsalobre, A., 2002. Clock genes in mammalian peripheral tissues. Cell Tissue Res. 309,193–199.

Bayarri, M.J., Muñoz-Cueto, J.A., López-Olmeda, J.F., Vera, L.M., Rol de Lama, M.A.,Madrid, J.A., Sánchez-Vázquez, F.J., 2004. Daily locomotor activity and melatoninrhythms in Senegal sole (Solea senegalensis). Physiol. Behav. 81, 577–583.

Bell-Pedersen, D., Cassone, V.M., Earnest, D.J., Golden, S.S., Hardin, P.E., Thomas, T.L.,Zoran, M.J., 2005. Circadian rhythms frommultiple oscillators: lessons from diverseorganisms. Nat. Rev. Genet. 6, 544–556.

Boluda-Navarro, D., Rubio, V.C., Luz, R.K., Madrid, J.A., Sánchez-Vázquez, F.J., 2009. Dailyfeeding rhythms of Senegalese sole under laboratory and farming conditions usingself-feeding systems. Aquaculture 291, 130–135.

Cahill, G.M., 2002. Clock mechanisms in zebrafish. Cell Tissue Res. 309, 27–34.Challet, E., 2007. Entrainment of the suprachiasmatic clockwork in diurnal and

nocturnal mammals. Endocrinology 148, 5648–5655.Confente, F., Rendón, M.C., Besseau, L., Falcón, J., Muñoz-Cueto, J.A., 2010. Melatonin

receptors in a pleuronectiform species, Solea senegalensis: cloning, tissueexpression, day-night and seasonal variations. Gen. Comp. Endocrinol. 167,202–214.

Davie, D., Minghetti, M., Migaud, H., 2009. Seasonal variations in clock-gene expressionin Atlantic salmon (Salmo salar). Chronobiol. Int. 26, 379–395.

Delaunay, F., Thisse, C., Marchand, O., Laudet, V., Thisse, B., 2000. An inherited functionalcircadian clock in zebrafish embryos. Science 289, 297–300.

Dinis, M.T., Ribeiro, L., Soares, F., Sarasquete, C., 1999. A review on the cultivationpotential of Solea senegalensis in Spain and in Portugal. Aquaculture 176, 27–38.

EEC, 1986. Council Directive 86/609 EEC for the protection of animals used forexperimental and other scientific purposes. Off. J. L358, 1–28 18/12/1986.

Farnell, Y.Z., Allen, G.C., Nahm, S.S., Neuendorff, N., West, J.R., Chen, W.J., Earnest, D.J.,2008. Neonatal alcohol exposure differentially alters clock gene oscillations withinthe suprachiasmatic nucleus, cerebellum, and liver of adult rats. Alcohol. Clin. Exp.Res. 32, 544–552.

Felsenstein, J., 1985. Confidence limits on phylogenensis: an approach suing thebootstrap. Evolution 39, 783–791.

Finger, T.E., 1983. Organization of the teleost cerebellum. In: Davis, R.E., Northcutt, R.G.(Eds.), Fish neurobiology. : Higher Brain Areas and Functions, 2. University ofMichigan Press, Ann Arbor, pp. 261–284.

Galtier, N., Gouy, M., Gautier, C., 1996. SEAVIEW and PHYLO_WIN: two graphic tools forsequence alignment and molecular phylogeny. Comput. Appl. Biosci. 12, 543–548.

García-López, A., Couto, E., Canario, A.V., Sarasquete, C., Martínez-Rodríguez, G., 2007.Ovarian development and plasma sex steroid levels in cultured female Senegalesesole Solea senegalensis. Comp. Biochem. Physiol. A 146, 342–354.

Gerace, L., 1995. Nuclear export signals and the fast track to the cytoplasm. Cell 82,341–344.

González-Rovira, A., Mourente, G., Zheng, X., Tocher, D.R., Pendón, C., 2009. Molecularand functional characterization and expression analysis of a Δ6 fatty acyldesaturase cDNA of European Sea Bass (Dicentrarchus labrax). Aquaculture 298,90–100.

Green, C.B., Besharse, J.C., 2004. Retinal circadian clocks and control of retinalphysiology. J. Biol. Rhythms 19, 91–102.

Guzmán, J.M., Norberg, B., Ramos, J., Mylonas, C.C., Mañanós, E.L., 2008. Vitellogenin,steroid plasma levels and spawning performance of cultured female Senegalesesole (Solea senegalensis). Gen. Comp. Endocrinol. 156, 285–297.

Hamada, T., LeSauter, J., Venuti, J.M., Silver, R., 2001. Expression of Period Genes:rhythmic and nonrhythmic compartments of the suprachiasmatic nucleuspacemaker. J. Neurosci. 21, 7742–7750.

Hastings, M.H., 2000. Circadian clockwork: two loops are better than one. Nat. Rev.Neurosci. 1, 143–146.

Isorna, E., El M'Rabet, A., Confente, F., Falcón, J., Muñoz-Cueto, J.A., 2009. Cloning andexpression of arylalkylamine N-acetyltranferase-2 during early development andmetamorphosis in the sole Solea Senegalensis. Gen. Comp. Endocrinol. 161, 97–102.

Kaffman, A., O'Shea, E.K., 1999. Regulation of nuclear localization: a key to a door. Annu.Rev. Cell Dev. Biol. 15, 291–339.

Kamphuis, W., Cailotto, C., Dijk, F., Bergen, A., Buijs, R.M., 2005. Circadian expression ofclock genes and clock controlled genes in the rat retina. Biochem. Biophys. Res.Commun. 330, 18–26.

Kaneko, M., Cahill, G.M., 2005. Light-dependent development of circadian geneexpression in transgenic zebrafish. PLoS Biol. 3, e34.

Kaneko, M., Hernandez-Borsetti, N., Cahill, G.M., 2006. Diversity of zebrafishperipheral oscillators revealed by luciferase reporting. Proc. Natl Acad. Sci. USA103, 14614–14619.

Klein, D.C., Moore, R.Y., Reppert, S.M., 1991. Suprachiasmatic Nucleus: TheMind's Clock.Oxford University Press, New York.

Lee, C., Weaver, D.R., Reppert, S.M., 2004. Direct association between mousePERIOD and CKIε is critical for a functioning circadian clock. Mol. Cell. Biol. 24,584–594.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−DDC(T)) Method. Methods 25, 402–408.

Mazurais, D., Le Dréan, G., Brierley, I., Anglade, I., Bromage, N., Williams, L.M., Kah, O.,2000. Expression of clock gene in the brain of rainbow trout: comparison with thedistribution of melatonin receptors. J. Comp. Neurol. 422, 612–620.

Mendoza, J., Pévet, P., Felder-Schmittbuhl, M.P., Bailly, Y., Challet, E., 2010. Thecerebellum harbors a circadian oscillator involved in food anticipation. J. Neurosci.30, 1894–1904.

Nelson, W., Tong, Y.L., Lee, J.K., Halberg, F., 1979. Methods for cosinor-rhythmometry.Chronobiologia 6, 305–323.

Okamura, H., 2004. Clock genes in cell clocks: roles, actions, and mysteries. J. Biol.Rhythms 19, 388–399.

Oliveira, C., López-Olmeda, J.F., Delgado, M.J., Alonso-Gómez, A.L., Sánchez-Vázquez, F.J.,2008. Melatonin binding sites in Senegal sole: day/night changes in density andlocation in different regions of the brain. Chronobiol. Int. 25, 645–652.

Oliveira, C., Dinis, M.T., Soares, F., Cabrita, E., Pousao-Ferreira, P., Sánchez-Vázquez, F.J.,2009. Lunar and daily spawning rhythms of Senegal sole Solea senegalensis. J. FishBiol. 75, 61–74.

Pando, M.P., Pinchak, A.B., Cermakian, N., Sassone-Corsi, P., 2001. A cell-based systemthat recapitulates the dynamic light-dependent regulation of the vertebrate clock.Proc. Natl Acad. Sci. USA 98, 10178–10183.

Park, J.G., Park, Y.J., Sugama, N., Kim, S.J., Takemura, A., 2007. Molecular cloning anddaily variations of the Period gene in a reef fish Siganus guttatus. J. Comp. Physiol. A193, 403–411.

Peirson, S.N., Butler, J.N., Duffield, G.E., Takher, S., Sharma, P., Foster, R.G., 2006.Comparison of clock gene expression in SCN, retina, heart, and liver of mice.Biochem. Biophys. Res. Commun. 351, 800–807.

Plautz, J.D., Kaneko, M., Hall, J.C., Kay, S.A., 1997. Independent photoreceptive circadianclocks throughout Drosophila. Science 278, 1632–1635.

Ponting, C.P., Aravind, L., 1997. PAS: a multifunctional domain family comes to light.Curr. Biol. 7, 674–677.

Reppert, S.M., Weaver, D.R., 2001. Molecular analysis of mammalian circadian rhythms.Annu. Rev. Physiol. 63, 647–676.

Rodríguez-Gómez, F.J., Sarasquete, M.C., Muñoz-Cueto, J.A., 2000. A morphologicalstudy of the brain of Solea senegalensis. I. The telencephalon. Histol. Histopathol. 15,355–364.

Sánchez, J.A., Madrid, J.M., Sánchez-Vázquez, F.J., 2010. Molecular cloning, tissuedistribution and daily rhythms of expression of per1 gene in European sea bass(Dicentrarchus labrax). Chronobiol. Int. 27, 19–33.

Shearman, L.P., Sriram, S., Weaver, D.R., Maywood, E.S., Chaves, I., Zheng, B., Kume, K.,Lee, C.C., van der Horst, G.T., Hastings, M.H., Reppert, S.M., 2000. Interactingmolecular loops in the mammalian circadian clock. Science 288, 1013–1019.

Silver, R., Schwartz, W.J., 2005. The suprachiasmatic nucleus is a functionallyheterogeneous timekeeping organ. Methods Enzymol. 393, 451–465.

Springer, A.D., Mednick, A.S., 1984. Selective innervation of the goldfish suprachiasmaticnucleus by ventral retinal ganglion cell axons. Brain Res. 323, 293–296.

Sugama, N., Park, J.G., Park, Y.J., Takeuchi, Y., Kim, S.J., Takemura, A., 2008. Moonlightaffects nocturnal Period2 transcript levels in the pineal gland of the reef fish Siganusguttatus. J. Pineal Res. 45, 133–141.

Sun, S., Alsbrecht, U., Zhuchenko, O., Bailey, J., Eichele, G., Lee, C., 1997. RIGUI, a putativemammalian ortholog of the Drosophila period gene. Cell 90, 1003–1011.

Takemura, A., Rahman, M.S., Park, Y.J., 2010. External and internal controls of lunar-related reproductive rhythms in fishes. J. Fish Biol. 76, 7–26.

Tamai, T.K., Carr, A.J., Whitmore, D., 2005. Zebrafish circadian clocks: cells that see thelight. Biochem. Soc. Trans. 33, 962–966.

Tauber, E., Last, K.S., Olive, P.J., Kyriacou, C.P., 2004. Clock gene evolution and functionaldivergence. J. Biol. Rhythms 19, 445–458.

Vallone, D., Frigato, E., Vernesi, C., Foa, A., Foulkes, N.S., Bertolucci, C., 2007.Hypothermia modulates circadian clock gene expression in lizard peripheraltissues. Am. J. Physiol. Regul. Integr. Comp. Physiol. 292, R160–R166.

Velarde, E., Haque, R., Iuvone, P.M., Azpeleta, C., Alonso-Gómez, A.L., Delgado, M.J., 2009.Circadian clock genes of goldfish, Carassius auratus: cDNA cloning and rhythmicexpression of Period and Cryptochrome transcripts in retina, liver, and gut. J. Biol.Rhythms 24, 104–113.

Vera, L.M., De Oliveira, C., López-Olmeda, J.F., Ramos, J., Mañanós, E., Madrid, J.A.,Sánchez-Vázquez, F.J., 2007. Seasonal and daily plasma melatonin rhythms andreproduction in Senegal sole kept under natural photoperiod and natural orcontrolled water temperature. J. Pineal Res. 43, 50–55.

15Á.J. Martín-Robles et al. / Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15

Vielhaber, E.L., Duricka, D., Ullman, K.S., Virshup, D.M., 2001. Nuclear export ofmammalian PERIOD proteins. J. Biol. Chem. 276, 45921–45927.

Wang, H., 2008. Comparative analysis of Period genes in teleost fish genomes. J. Mol.Evol. 67, 29–40.

Whitmore, D., Sassone-Corsi, P., Foulkes, N.S., 1998a. PASting together the mammalianclock. Curr. Opin. Neurobiol. 8, 635–641.

Whitmore, D., Foulkes, N.S., Strahle, U., Sassone-Corsi, P., 1998b. Zebrafish clockrhythmic expression reveals independent peripheral circadian oscillators. Nat.Neurosci. 1, 701–707.

Whitmore, D., Foulkes, N.S., Sassone-Corsi, P., 2000a. Light acts directly on organs andcells in culture to set the vertebrate circadian clock. Nature 404, 87–91.

Whitmore, D., Cermakian, N., Crosio, C., Foulkes, N.S., Pando, M.P., Travnickova, Z.,Sassone-Corsi, P., 2000b. A clockwork organ. Biol. Chem. 381, 793–800.

Wullimann, M.F., 1998. The central nervous system. In: Evans, D.H. (Ed.), ThePhysiology of Fishes. CRC Press, Boca Raton, pp. 245–282.

Yagita, K., Yamaguchi, S., Tamanini, F., van der Horst, G.T.J., Hoeijmakers, J.H.J., Yasui, A.,Loros, J.J., Dunlap, J.C., Okamura, H., 2000. Dimerization and nuclear entry of mPERproteins in mammalian cells. Genes Dev. 14, 1353–1363.

Yagita, K., Tamanini, F., Yasuda, M., Hoeijmakers, J.H.J., van der Horst, G.T.J., Okamura, H.,2002. Nucleocytoplasmic shuttling and mCRY-dependent inhibition of ubiquitylationof the mPER2 clock protein. EMBO J. 21, 1301–1314.

Yamazaki, S., Numano, R., Abe, M., Hida, A., Takahashi, R., Ueda, M., Block, G.D., Sakaki,Y., Menaker, M., Tei, H., 2000. Resetting central and peripheral circadian oscillatorsin transgenic rats. Science 288, 682–685.

Yáñez, J., Busch, J., Anadón, R., Meissl, H., 2009. Pineal projections in the zebrafish(Danio rerio): overlap with retinal and cerebellar projections. Neuroscience 164,1712–1720.

Yoshimura, T., Suzuki, Y., Makino, E., Suzuki, T., Kuroiwa, A., Matsuda, Y., Namikawa, T.,Ebihara, S., 2000. Molecular analysis of avian circadian clock genes. Brain Res. Mol.Brain Res. 78, 207–215.

Zylka, M.J., Shearman, L.P., Weaver, D.R., Reppert, S.M., 1998. Three period homologs inmammals: differential light responses in the suprachiasmatic circadian clock andoscillating transcripts outside of brain. Neuron 20, 1103–1110.