1

Analyzing the Genetics of a Mutant gene abrupt in Drosophila

Melanogaster through Classical Crosses, PCR, and BLAST

Analysis

Thao Tran

College of Natural Sciences and MathematicsDepartment of Biology and Biochemistry

University of Houston

Semester Project ManuscriptBIOL 3311 Fall 2012

Date Submitted: 12/10/2012

Lab TA Instructor: Deepika Kumar

Lab Section: 16891/ Wednesday 1

Drawer Group Number: 30

Unknown Mutant Code: 333

Group members:Scott Moncrieff, Amsale Derese, Lorraine Velasquez, Linh

Nguyen

2

ABSTRACT

Expression of the gene, ab, is an important key factor for

developmental processes in Drosophila melanogaster. Muscle

attachment, sensory organ development, synaptic target

recognition, and transcriptional processes are some features

involved with the protein Abrupt. D. melanogaster flies with

the mutant phenotype exhibited a disrupted connection or

loss of the L5 wing vein. We observed the mutant phenotype

and attempted to map the gene relative to marker genes. The

chromosomal and allelic inheritance from the parents to

progeny are described by using known marker genes for two

discriminant genetic cross that were set at two distinct

temperatures. It is determined that the ab gene is inherited

recessively from parent to F1 progeny. This recessive

3

pattern is visible because of the marker phenotypes used.

The effect of the temperature in expression is determined to

have a moderate effect. Mutant male progeny in the second

discriminant cross did not have markers on the second

chromosome. It is concluded that the gene is on chromosome

2. PCR and BLAST analysis of ab in D. melanogaster verified the

identification of the unknown gene in a DNA sequence.

Protein BLAST highlighted the highly conserved domain, BTB,

of D. melanogaster in Homo sapiens. When we understand the

chromosomal inheritance and molecular genetics of the ab

gene, we could grasp some of the mechanisms and interactions

the gene had on the biological processes of development.

(Abstract=228)

INTRODUCTION

Drosophila melanogaster is the model organism for genetic

research and other fields because of the valuable

information it has to offer in many fields. Specific

4

physical and biological features that allow it to be

manipulated genetically are: small size, short life cycle,

high proliferation, and small genome. Genetic,

embryological, and biochemical methods are skillfully done

because of the capability to apply these techniques to

Drosophila. Continuous usage of embryological and genetic

methods in Drosophila leads towards an increased knowledge of

the many functions and development of the nervous system

(Rubin, 1988). Further questions can be researched and

answered through analyzing some of the significant roles

Drosophila melanogaster has in these studies.

With a similar human genome, Drosophila has signaling

pathways that are able to be analyzed in relation to human

cancer studies (Tickoo and Russell, 2002). Because of these

signaling pathways, the roles of targeted molecules can be

observed and analyzed for important physiological effects

which could lead to a new drug discovery. In neurological

studies, Drosophila’s single copy gene labels it a model

organism because one Drosophila gene corresponds to various

5

human genes; simplified gene interaction in the model aids

in understanding particular functions of the more complex

human nervous system. The genes of Drosophila correlate to

some more physiological effects in humans therefore the

organism continues to aid in our understanding of metabolic

and endocrine disorders (Tickoo and Russell, 2002).

Vein pattern formation systems help us understand more about

developmental genetics as well as cell signaling pathways.

Understanding how cells differentiate from each other in a

spatial formation has been hypothesized in various past

studies. Long cell signaling and short cell signaling can

lead to the tissue-level effects seen and lead to

understanding of organ patterning. Studying wing vein

arrangement can lead to more clear understanding of these

various patterns with molecular context. Many wing vein

mutations have been described advantageous because of the

ability to dissect a wing vein and easily induce and

quantify minor changes in vein expression (Thompson, 1980).

6

MATERIALS AND METHODS

Classical Crosses

In a clear polystyrene vial, cultured flies from Bloomington

Stock Center at Indiana University are maintained with

distilled water mixed in cornmeal-based formula of 4-24 blue

dye food for careful observations. In order to anesthetize

the flies, CO2 is delivered through the flow gun and

FlowBuddyTM pad. Under the pad, a stereomicroscope of 8-50X

magnification, swan neck lamp, and an artist brush are used

to inspect the phenotypes of the mutant flies in comparison

with wild-type flies. In the first genetic cross, 5 female

mutant virgins and 3 males with marker genes Curly/Plum;

Diachete/Stubble were placed in 2 vials at a temperature of 25

degrees Celsius and another vial at 19 degrees Celsius. When

dark brown pupas appeared, parents were separated and placed

in a fresh new vial. The F1 progeny’s phenotypes were scored

in comparison to a wild-type fly. Diachete marker flies had

the alulae missing and halters pointing down, Stubble had

7

shorter scutellar bristles, Curly had wings curled upwards,

and Plum had a lighter brown eye color. The mutant

phenotypes were searched for in the flies along with the

marker phenotypes. In the second genetic cross, 5 female

mutant virgins and 3 F1 Plum/Stubble males were crossed in 2

cross vials at 25 degrees Celsius. The progeny were scored

according to 4 phenotypic classes: mutant only, mutant and

Stubble, Plum only, and Plum and Stubble together. In

statistical analysis of the results, a null and alternative

hypothesis was proposed. Expected number or progeny were

calculated according to each specific discriminant or

mapping cross. The chi-square number was calculated through

the chi-square formula and compared to the chi- square

critical value.

PCR and Agarose Gel Electrophoresis

In using polymerase chain reaction to amplify DNA, DNA

template, buffer, potassium chloride, primers, dNTPs, Taq

DNA polymerase, and magnesium chloride were added in our

8

standard PCR product. A temperature cycle consisted of

denaturing the DNA at 94 degrees Celsius, annealing, at 45-

48 degrees, and elongation at 64 degrees Celsius. Using 1.5

gm/100 ml agarose gel and an electric field with a cathode

and anode, a purified and unpurified PCR product was loaded

on to an agarose gel by careful placement of micropipette

into a loading buffer above the gel well. Other gel lanes

consisted of positive control, negative control, and a base

pair ladder.

BLAST Analysis

DNA sequence amplified by primers and protein amino acid

sequence were analyzed. Forward and primers used were

agccacaaaagaaggagcaa and gctgttctccaaagcctgtc, respectively.

Searches were performed using BLAST and pBLAST. The forward

primers were BLASTed first to find the raw DNA sequence,

then the complement of the reverse primer were used to find

the area in between primers where the DNA sequence was

amplified. The highest scoring value was analyzed to match

our query search to the Drosophila genome. A GBrowse was

9

observed to find specific details of exons, introns, and

regulatory regions in the gene. The transcripts were also

analyzed below the gene for any significance information. In

the protein BLAST, Flybase was used to find the amino acid

sequence of the Abrupt protein. A protein BLAST was done

against the Homo sapiens database. The initial search matched

conserved domains that were found located in the proteins of

Homo sapiens. Lastly, a low E value in addition with high

matching score values was used for a protein that that was

closely matched to Drosophila melanogaster.

RESULTS

Figure 1 illustrates an overall layout of the project.

Figure 1. Experimental Design. The overall steps taken in analyzing themutant ab.

Discriminant Cross

Mapping Cross

Polymerase Chain Reaction Analysis

BLAST Analysis of DNA and Protein Sequence

10

Discriminant Cross

In forward genetics, we define the phenotype in order to

find the mutant gene associated with the phenotype .The

mutant phenotype was visually compared side by side with a

wild-type phenotype. Some noticeable observations in mutant

flies were the subtle absence or the shortening of L5 wing

vein (Fig. 2) (Cook et. al, 2004).

al, 2004).

Figure 2. A) Wild-type wing. The L5 vein is present on thewing. B) ab1 mutant wing. Shortened L5 wing vein is illustrated.

11

To test the expressivity of the mutant phenotype under the

influence of different temperature, we observed two vials of

wild-type and mutant flies each under 25/26 or 19/20 degrees

Celsius. After dark brown pupa was seen and parents were

subculture, at two different temperatures, we closely

examined phenotypes of wild-type to wild-type, mutant to

mutant, and wild-type to mutant. For wild-type to wild-type,

no distinctive changes in phenotype occurred at a lower

temperature, but development of pupa was slower. For mutant

to mutant, the vein lining were thinner under a lower

temperature compared to a 25 degrees temperature (Jang et.

al, 2009). For a wild-type to mutant, the expression of the

vein mutation changed significantly for mutant compared to

wild-type.

In order to determine the mode of chromosomal inheritance

and the chromosomal location of the mutant gene, we

performed two classical genetic crosses that are named

discriminant cross 1 and 2, respectively. Virgin female

12

mutant were collected to mate with males that had marker

genes of Curly, Plum, Diachete, and Stubble. Progeny flies were

scored in males and females, and the progeny number of each

phenotypic category was quantified in table 1. In the

chromosomal drawings of figure 3, the 4 phenotypic classes

in females and males are Curly; Diachete, Curly; Stubble, Plum; Diachete,

Plum; Stubble.

There were a total of 515 progeny collected for discriminant

cross 1 at two temperatures of 25/16 and 19/20 degrees

Celsius. About 100 of the progeny showed the marker

phenotypes of Curly; Diachete, Curly; Stubble, Plum; Diachete, Plum; Stubble.

None of the progeny exhibited mutant phenotypes with the

exception of two cases. We did a chi-square analysis of the

observed results against the expected number for a recessive

mutation. In table 2, the expected result was used to

compare a significant difference in the observed data

through the chi-square analysis. The results show a chi-

square of 8.03 greater than the critical of 7.82.

13

Class Phenotypes Females Males1 Cy;D 59 51

Figure 3. Possible chromosomal outcomes. un represents theunknown mutant gene assuming that it is recessive and on chromosome 2. The marker genes are Curly, Diachete, Stubble, Plum. The four phenotypic classes will appear in the

14

2 Cy;Sb 67 593 Pm;D 59 644 Pm;S 76 78

Totals: 261 252

Class Phenotypes ObservedExpected O - E(O -E)2

(O -E)2/E

1 Cy;D 110 128 -18 324 2.53

2 Cy;Sb 126 128 -2 4 .0313 Pm;D 123 128 -5 25 .195

4 Pm;S 154 128 26 676 5.28

Total X2 = 8.036

Table 1. Quantitative Results of Discriminant Cross 1. The number of progeny scored for each phenotypic classes are categorized by gender. The

Table 2. Chi-square analysis for Discriminant Cross 1. In order to test if we can accept our hypothesis, a chi-squareanalysis of the observed results against the quantity expected was measured. A total chi-square value of 8.036

15

In discriminant cross 2, we performed a cross with virgin

mutant female and F1 male progeny with the phenotypic class

of Pm;Sb. In figure 4, the chromosomal drawing allows us to

predict the outcomes of 4 phenotypic classes when a virgin

mutant female and F1 male progeny are cross. The 4

phenotypic classes observed in the chromosomal drawings are

when the mutant gene is on chromosome 2. From the

chromosomal drawings with minor changes (Pm;Sb was used

instead of Pm;D), the four phenotypic classes are un, un;Sb,

Pm, Pm;Sb. In table 1, the phenotypic classes observed in the

progeny are mutant females and males in a 1:1 ratio. In DC2,

there was 225 progeny scored. Out of 225 progeny, a total of

68 progeny had Plum;Stubble, 30 had unknown;Stubble, 50 had Plum,

and 29 had unknown. In table 4, chi-square analysis was

completed to test for a significant difference in observed

and expected. The calculated chi-square is 23.46. There were

three exceptional cases when 1 progeny of Plum with unknown,

19 Stubble progeny, and 28 wild-type progeny.

16

Class Phenotypes ObservedExpected O - E(O -E)2

(O -E)2/E

1 un 29 44 -15 225 5.11

2 un;Sb 30 44 -14 196 4.453 Pm 50 44 6 36 .8181

Figure 4. Possible phenotypic outcomes for Discriminant Cross 2 progeny. If a virgin mutant female is crossed with a male progeny from Discriminant Cross 1, we will observe four phenotypic classes illustrated above. In our

Table 3. Discriminant Cross 2 Progeny Results. Thephenotypes of the progeny scored in discriminant cross 2 were totaled up accordingly to female or male. The total progeny observed altogether were

Class Phenotypes Females Males1 un 16 132 un;Sb 18 123 Pm 24 264 Pm;Sb 31 37

Totals: 89 88

17

4 Pm;Sb 68 44 24 576 13.09

Total X2 = 23.46

Mapping Cross

In order to determine the mapping location of the mutant

gene, we performed the first mapping cross between

heterozygous mutant virgin female and marker males with

Briste (Bl) or Lobe (L). Since recombination only occurred in

heterozygous female, the first mapping cross (MC1) was done

in order to create mutant virgin females that could be cross

with homozygous flies (Fig. 5).

Table 4. Chi-square Analysis of Discriminant Cross 2. The observed results were analyzed against the expected resultsto test if we could accept our hypothesis. The total calculated chi-square value was calculated according to the

18

After collecting the progeny of heterozygous females

containing marker genes, we created a mapping cross with the

heterozygous virgin females from MC1 as the parental females

and homozygous recessive mutant males as the parental males.

We predicted the possible recombination outcomes through

chromosomal drawings: mutant phenotype, Bl phenotype only,

or L phenotype only.(Fig. 6).

un

un

Figure 5. Chromosomal Drawing for Mapping Cross 1. In order to calculate the recombination frequency, heterozygous females were produced from a cross between female mutant and dominant marker males. The possible

19

In the laboratory, we observed 858 wild-type phenotypes out

of a total of 1418 progeny eclosed from mapping cross 2. The

second largest phenotypic class observed in the progeny was

Bl and L together; the total amounts observed were 231

Figure 6. Chromosomal Drawing for Mapping Cross 2. A)The possible phenotypic classes are shown when crossing the heterozygous females (MC1) with the recessive mutant males. A Bl heterozygous female and an recessive mutant male produces a progeny that could exhibit mutant phenotypes or Bl/L phenotype. B) Single recombinants phenotypes are shown on the far left and right. Double

A

B

20

progeny. Close to that amount is the phenotypic class of Bl

only which had 220 progeny observed. 73 progeny belonged to

the phenotypic class of L only. Table 5 list the number of

progeny observed in each of the phenotypic outcomes of the

cross. To test if our observed outcomes were close to what

we expected and hypothesized, we analyzed our results

quantitatively through chi-square formula (Table 6).

Class Phenotypes ObservedExpected O - E(O -E)2

(O -E)2/E

1 +/Bl/L 231 128 103 10609 84

2 ab/+/+ 26 591 -565 319225 5393 ab/Bl/L 5 17.8 -12.8 163.84 9

4 +/+/+ 858 264 594 352836 13375 +/Bl/+ 220 187 33 1089 6

6 ab/+/L 1 78.1 77.1 5944 767 ab/Bl/+ 4 22.4 -18.4 338 15

8 +/+/L 73 131 -58 3364 26

Total X2 = 2092.7

Table 5. Mapping Cross 2 Phenotypic Class Progeny Total. The total amount of each phenotypic class observed in the laboratory were scored and totaled upin order to calculate the recombination frequency.

Table 6. Mapping Cross 2 Chi-Square Analysis. The observed and expected results were calculated to determine if the observed results and predictions can be accepted. The chi-square value totaled to be 2092.7 when calculated according

Class Phenotypes Total1 +/Bl/L 2312 ab/+/+ 263 ab/Bl/L 54 +/+/+ 8585 +/Bl/+ 2206 ab/+/L 17 ab/Bl/+ 48 +/+/L 4

Totals: 1418

21

In a computer simulation of the proposed mapping cross two,

2420 progeny were produced with the amount of phenotypic

class shown in Table 7. Seven phenotypic classes were

produced in the progeny from the cross. Recombination

frequency was calculated using the simulated data, and

calculations are shown in table 8. Parental recombinants

show the phenotypic class ab/+/+ and +/Bl/L. Single

recombinants show the phenotypic class +/Bl/+ , +/+/+,

ab/Bl/L, ab/Bl/+. Lastly, the double recombinants show the

phenotypic class ab/+/L and no double recombinants of the

phenotypic class +/+/L were produced. Bl and L are

approximately 13.9 map units apart, Bl and ab are

approximately 9.7 map units apart, L and ab are

approximately 23.5 map units apart (Table 8).

22

Class Bl and L Bl and ab L and ab1 - -

-2 - -

-3 208 - 2084 128 - 1285 - 128

1286 - 106

1067 1 1

-8 0 0

-Total 337 238

570% RF 13.9

9.7 23.5

Class Phenotypes ObservedExpected O - E(O -E)2

(O -E)2/E

Table 7. Computer Simulation of Mapping Cross 2. Seven phenotypic classes were produced from the cross. A total of 2420 progeny were produced

Table 8. Recombinants of 3 Genes. Recombination frequencieswere calculated by summing up the total recombinants of twogenes and dividing by the total progeny and multiplying by 100. 1% recombination frequency equals to 1 map unit. Therefore, the recombination frequency above represents the

Class Phenotypes Total1 +/Bl/L 9252 ab/+/+ 9243 +/Bl/+ 2084 +/+/+ 1285 ab/Bl/L 1286 ab/Bl/+ 1067 ab/+/L 18 +/+/L 0

Totals: 2420

23

1 +/Bl/L 925 926 -1 1 0

2 ab/+/+ 924 926 -2 4 03 ab/Bl/L 128 133 -5 25 .18

4 +/+/+ 128 133 -5 25 .185 +/Bl/+ 208 284 -76 5776 20

6 ab/+/L 1 0 -1 2 07 ab/Bl/+ 106 133 -27 3249 24

8 +/+/L 0 0 0 0 0

Total X2 = 44.36

Polymerase Chain Reaction Analysis

In previous molecular studies of the ab gene, Hu and

colleagues applied inverse PCR in order to isolate the ab

transcription unit that is about 5.1 kb. (Hu et. al, 1995).

Before manipulation of DNA can be done, an estimation of DNA

amount is confirmed for further analysis. After the

extraction of genomic DNA and purification of the amplified

PCR product, we quantified the DNA sample using agarose gel

Table 9. Chi-square analysis of the simulation mapping cross. The observed data was calculated against the expecteddata to determine if the hypothesis should be accepted. A total chi-square value of 209.01 was calculated according to

24

electrophoresis with ethidium bromide. DNA fragments were

separated by an electrical field that moved the shorter or

compact DNA faster through the gel matrix (Fig.7). Under

ultraviolet light with wavelength of 280 nanometers, the

absorbance was measured by the intensity of the fluorescence

in the banding patterns. A 1kb standard base pair lader was

used as a comparison to estimate the amount of DNA in base

pairs. With a 1.5 % agarose gel, the banding pattern reveals

that an approximate 1600 base pairs comprise our DNA

molecule.

BLAST Analysis of DNA and Protein Sequence

1 kb

Figure 7. DNA banding intensity of loaded sample DNA. The standardbase pair ladder is shown in 1 kb interval. In the scale, the numbers in base pairs increased from bottom totop. The first well indicates the 1 kb ladder. The second well is the sample of

250 bp

500 bp

750 bp

1000 bp

1500 bp

25

In analyzing the DNA sequence, we used the Basic Local

Alignment Search Tool, and BLASTed the forward primer

sequence against the genomic Drosophila Melanogaster sequence in

order to obtain a raw DNA sequence. After we BLASTed with

the bases between the forward and reverse primer sequences

(including primer sequence), we obtain a sequence match

score of 1511.05 bits and found that the sequence is on the

plus strand of DNA. The allele identified to be associated

with our mutant gene is ab and it is confirmed by the high

matching score for our sequence. Indicated by the red line,

our sequence is located relatively around 11M to 12 M on the

second chromosome (Fig.8 ). The ab gene has four

transcripts: ab-RA, ab-RB, ab-RD, and ab-RE. We confirmed

with previous studies that abrupt has identical

alternatively spliced transcripts with non-encoding exons

(Grieder et al, 2006). The non-encoding exons are indicated

in a grey box beside the coding sequence in tan color. The

amount of bases for our PCR product sequence was obtained by

word count, and the results was 1684 bases which is in the

range of our agarose gel results (Fig.9 ).

26

Figure 8. GBrowse View of Sequence Relative to Chromosome Length. Relative location of the PCR sequence highlighted in grey. Alternative spliced transcripts are almost identical. The non-encoding sequence is located in the grey box besides the lighter tan

Figure 9. DNA sequence of the amplified PCR product with primer sequences. The forward primer sequence is indicated in red and capitalized in the beginning of the sequence. The sequence contains 1684 bases which was confirmed in the estimated agarose gel results .

27

Previous studies categorized the Ab protein as part of a

family of BTB-ZF (broad-complex, tramtrack and bric-à-brac -

zinc finger). The BTB domain is a highly conserved 115 amino

acid region in combination with the ZF that are DNA-binding

domains acting as transcription factors. (Hu et. al, 1995).

When we protein BLASTed the 904 amino acid sequence, ab-PA,

against Homo sapiens, the BTB/ POZ was the specific conserved

domain listed (Fig. 10). In the superfamily domain is the

protein motif cl02518 with the domain BTB/ POZ domain. The

non-specific domain hit was the smart00225 protein motif

with the POZ (pox virus and zinc finger) domain. Three

multi-domains that are conserved were matched: PHA03098

(provisional domain), C2H2 type zinc-finger domain (pfam

12756), and PHAO02713 (provisional domain). In Homo sapiens,

a 264 amino acid protein aligned with that of Drosophila

Melanogaster at a high scoring match of 69.3 bits. The kelch-

like 12 protein contains the pfam00651 protein motif that is

28

again associated with BTB domain. In addition the pfam07707

protein motif of the kelch-like protein contains the BACK

domain that lies next to the BTB domain.

A

29

DISCUSSION

Discriminant Cross

In the experimental study, we confirmed that ab was the

mutant gene (shortened L5 vein) by crossing the mutant flies

with known marker flies in order to determine the

Figure 10. BLAST Analysis of Amino Acid Sequence. A) Drosophila Melanogaster’s 904 amino acid sequence of the protein encoding gene ab-PA taken from Flybase. B) Conserved domains of Drosophila melanogaster in Homo sapiens.C) Homo sapiens kelch-like 12 protein of 264 amino acid

B

C

30

chromosomal inheritance and location relative to the marker

genes. In our first discriminant cross, the two of the

phenotypic classes, Pm;Sb and Cy;D, observed were slightly

higher and varied compared to the other phenotypes. These

quantity lead to a higher chi-square value (8.03) that is

greater than the chi-square critical value (7.82). Variation

could lead to the genetic competence of one phenotypic class

over another which lead to higher distribution of a certain

phenotype. Despite the variation, our mutation did not

significantly appear in any of the phenotypic classes. The

information obtained from physical observations revealed

that our mutant gene was inherited as a recessive allele. In

other studies, muscle defects phenotypes were observed in

order to determine levels of expressivity in the ab allele.

The ab recessive viable mutation was combined with other

allele to observe the phenotypes effects of the mutant (Hu

et. al, 1995).

Despite the observed quantity of phenotypic classes

differing from the expected amount, the phenotypic class

31

data lead us to infer that the ab mutant gene is on

chromosome 2. The abrupt mutant gene was not physically

combined with any of the phenotypes of the chromosome 2

markers. Chromosomal drawings show the possible phenotypic

outcomes that result if the gene was on chromosome 2. The

observations matched with the predicted phenotypic classes.

In an experiment with P-element insertions, the P element in

line B2149 shown to be inserted upstream of abrupt which is

mapped genetically on chromosome 2 (Grieder et. al, 2006).

Through polytene chromosome in situ hybridization, insertion

elements were mapped to chromosome 2 interval (Hu et. al,

1995). The classical genetic approach does not take into

account the various loci and pleiotropic alleles that alter

the phenotypic expression of veins. Possible changes would

be to study genes specific in being involved in a

development directed to the final pattern.

With the temperature variable, phenotypes were only recorded

visually. In another study testing the effects of

temperature on vein expression, quantification of vein

32

intervals were done to test certain interruptions in

specific parts of a vein. The study took into account

gender, genotype, and temperature effects and interactions

on vein intervals, and the results quantify the vein pattern

changes that occurred (Carlson, 1970). Our study lacked the

ability to have done so.

Mapping Cross

Mapping cross depended on the recombination of heterozygous

female and chromosomal linkage. So, if heterozygous female

were not properly obtained, recombination was unlikely to

have occurred. A majority of our observations had wild-type

phenotypes. We suspected that that the marker genes of Bl

and L were not a balanced stock that needed to be maintained

as a heterozygous stock. Plus, a previous study show how

vein mutant could exhibit vein pattern compensation due to

tissue-level mechanisms that can respond to developmental

process that code for particular cell products (Thompson,

1980). Although the laboratory data was insufficient to

33

produce any mapping data, we obtained computer simulation

data that was able to sufficiently provide where the mutant

allele was relative to the marker genes. Two single

recombinants differ from the expected value leading to a

relatively high chi-square value. Despite the chi-square

value, both of the marker genes reveal the relative map

units of the marker genes to the mutant genes. In computer

simulation, various factors can affect the values of the

data produced. Usually, multiple mapping crosses are done to

produce values confirmable with statistical data. The

mapping location of the mutant gene ab was determined by

recombination frequency and is located closer to the marker

gene Bl by 9.7 map units. To further confirm our results, a

search on Flybase verifies that the mapping location of ab

is at 2-44.

Mapping a gene to a human autosome was a significant

contribution done by Donahue et. al who described the results

of mapping a blood group gene to chromosome 1. In his

results, he described the marker chromosome region. Physical

34

changes in chromosome structure combined with a pedigree

analysis can be used to map specific gene to a chromosome

(Donahue et. al, 1968).

Genetic mapping of sex-linked chromosome involves many other

effective factors including non-recombinant sex chromosomes,

sex ratio in D. melanogaster, or segregation issues at a

locus. After applying sex-linked markers, applying the

genetic linkage map will differ from autosomal mapping.

Records of sex will be recorded in addition to the linkage

groups derived from marker segregation in females or males

(Smerikov et. al, 2003).

PCR estimates DNA length range

Observation data from the agarose gel electrophoresis of our

amplified PCR product suggest that our ab mutant gene had a

1600 range of base pairs. The levels of band intensity were

thicker due to fluorescence absorbance of the ultraviolet

wavelength. The estimation of the DNA quantity was seen

35

after the electrical current was applied which allowed the

attraction of DNA towards the positive anode current. The

ability of the gene to move towards the positive current was

significantly slower because of the DNA length.

BLAST Analysis

In further analyzing the mutant DNA sequence, a BLAST

analysis of our sequence reveals a region of our gene that

contains coding and non-coding sequences. The four

transcripts below the gene are alternative splicing

transcripts, and the transcriptional region codes for the

protein Ab (Hu et. al, 1995). Limitations to this analysis

are found in studies where activation and repression of vein

genes affect the level of expressivity (Jang et. al, 2009).

ab gene is able to down regulate other genes, but regulatory

region of the DNA analysis is not observed in the results.

In our protein BLAST analysis of the amino acid sequence, we

found the conserved region that Ab encodes for is the

36

transcription factor BTB/POZ domain that is expressed during

embryogenesis (Li et. al, 2004). There are certain cases

where Drosophila melanogaster do not have the homologs for

certain Homo sapiens proteins. As our results show, there

is a possibility that varieties of protein domains have

different extensions along a protein and occupy different

areas of a protein.

The ab-PA consisting of 904 amino acids belong to a family

of BTB domain that has been defined as the evolutionary

conserved domain in Drosophila melanogaster. The role involved

in developmental regulation provides a comparable analysis

of the protein product towards Homo sapiens. BTB domain plays

important roles in transcriptional regulation with the zinc-

finger motif. In addition, the protein-protein interaction

has been associated with the BTB family other proteins

(Zolman et. al, 1994).

37

The BTB domain is located near the N-terminus of the zinc

finger and in kelch protein family. In kelch-like 12 (D.

melanogaster), isoform CRA_d (Homo sapiens), the kelch-like

protein were found to be autoantigens. These autoantigens

were applied efficiently as serological markers for clinical

diagnosis of Sjogren’s syndrome (Uchida et. al, 2005). In

other studies comparing the kelch-like protein of D.

melanogaster with Homo sapiens the formation of how the protein

is structured allows for further comparative analysis. The

D. melanogaster’s kelch-like protein forms a ring-like canal

during oocyte development. The ring-like structure was

observed in mammalian cells suggesting the importance of the

kelch homologue in interactions with localization of other

proteins (Mai et. al, 2004).

Mutation at the Molecular Level

In studies where genetic screens were done to determine the

molecular functions of vein genes, two factors that were

significant in representing the vein function is signaling

molecules and transcription factors. Many other

38

developmental processes are factors that can affect vein

formation (Molnar et. al, 2006).

The ab transcript encodes for the Ab protein that has been

shown to act as a DNA binding transcriptional regulatory

protein. Combination of ab gene and transcription factors

plays a role in the mutation seen at the phenotypic level;

transcription factor can send or respond to local signals

resulting in organization of a wing vein in a specific

location. In other molecular analysis where the mutant gene

was experimented for specific deficiency, primers that

failed to amplify a certain portion of the DNA reveals that

there is a deletion of a portion of bases in the DNA. The

deletion removed coding sequences and the starting site for

transcription which lead to a null function (Hu. et, al,

1995).

Other applications and similar genes in other organisms

Mammalian neuronal cells stem cells differentiate into

different types of neurons during the course of development.

In D. melanogaster, the transcription factor Ab is targeted by

39

microRNA to regulate the timing of neuronal development in

flies (Kucherenko et. al, 2012). The information suggests

the role of microRNA in contributing to developmental

signaling and learning impairment.

The gene ortholog of a non-Drosophila organism is AGAP008032

of the common malaria mosquito, Anopheles gambiae. The gene has

only one transcript with the location on the forward strand.

The gene belongs to the novel protein coding category, and

one of the domain of the protein is zinc-finger C2H2-like

similar to that of the Drosophila. The protein sequence has

been found to have regions of low complexity in the

different residual types present (Wooton et. Al, 1993).

In conclusion, we determine the mapping of the recessive

allele and the possible mutations in the 1600 base pair DNA

sequence that is associated with the genetic transmission of

a shortened or absence of the L5 wing vein. Usage of BLAST

reveals the highly evolutionary conserved domain BTB and the

importance of the domain in transcription regulation when it

is involved in DNA-binding or protein-protein interactions.

40

What is unclear is the when abrupt first appear in the

evolutionary origin between invertebrates and vertebrates.

Since there are similarities between the human genome and

Drosophila genome, we want to isolate the important genetic

forms and variations that arise in studying developmental

roles. Simple molecular analysis and classical genetic cross

does not tell us further about any further interactions that

can create subtle vein effects and affect other biological

processes with other genes.

REFERENCES

Benjumea, , and Bellido. "Genetic analysis of the wing vein

pattern of Drosophila." Developmental Biology . (1990): n.

page. Print.

Carlson, , , .et al " Genetics of an L2 Vein Mutant in

Drosophila Melanogaster.” The Ohio Journal of Science (1970): n.

page. Print.

41

Cook, , , et al. “brinker and optomotor-blind act coordinately to initiate

development of the L5 wing vein primordium in

Drosophila.”131.Development (2004): 2119-2124. Print.

Donahue, , , et al. “probable assignment of the duffy blood

group locus to chromosome 1 in man”. 61. Genetics.(1968):

n. page. Print.

Grieder, , , et al. “Misexpression Screen in Drosophila

melanogaster Aiming to Reveal Novel Factors Involved in

Formation of Body Parts.” 175. Genetics (2007): n. page.

Print.

Hu, , , et al. “Drosophila abrupt gene encodes a BTB-zinc

finger regulatory protein that controls the specificity

of neuromuscular connections.” 9. Genes and Development.

(1995): 2936-2948. Print.

Jang, , , et al. “Border-cell migration requires integration

of spatial and temporal signals by the BTB protein

Abrupt.” 131. Nature. (2009): 2119-2124. Print.

42

Kucherenko, , , et al. “Steroid-induced microRNA let-7 acts

as a spatio-temporal code for neuronal cell fate in the

developing Drosophila brain.” EMBO. (2012): n. page.

Print.

Li, , , et al. “BTB/POZ-Zinc Finger Protein Abrupt

Suppresses Dendritic Branching in a Neuronal Subtype-

Specific and Dosage-Dependent Manner.” 23.EMBO .

(2004): 823-834. Print.

Mai, , , et al. “hDKIR, a human homologue of the Drosophila

kelch protein, involved in a ring-like structure.” 300.

Exp. Cell. Res. (2004): n. page. Print.

Molnar, , , et al. “Gain-of-Function Screen Identifying

Genes Required for Vein Formation in the Drosophila

melanogaster Wing”. 174.Genetics (2006): n. page. Print.

Rubin, Gerald. “Drosophila melanogaster as an Experimental

Organism.” 240. Science (1988): 1453-1459. Print.

Smerikov, , , et al. “Genetic mapping of sex-linked markers

in Salix viminalis L.” 91. (2003): n. page. Print.

43

Thompson, , , et al. “Pattern Compensation in Drosophila

Wing Vein Development.” Heredity (1980): n. page. Print.

Tickoo, Sanjay, and Steven Russell. . “Drosophila

melanogaster as a model system for drug discovery and

pathway screening. 2. Current Opinion in Pharmacology (2002):

555-560. Print.

Uchida, , , et al. “Identification of specific autoantigens

in Sjögren's syndrome by SEREX.”. 116. Immunology. 

(2006): n. page. Print.

Wooton, , , et al. “Statistics of local complexity in amino

acid sequences and sequence databases .” 17. Computers

and Chemistry. (1993): n. page. Print.

Zolman, , , et al. “BTB domain, found primarily in zinc

finger proteins, defines an evolutionarily conserved

family that includes several developmentally regulated

genes in Drosophila.” 91. Developmental Biology. (1994): n.

page. Print.