METHODOLOGY COMMUNICATIONS

0892-6638/93/0007-0971/$01.50. © FASEB971

Synthetic retrotii nsposon vectors for gene therapyASIT IL CHAKRABI RTY, MARY ANN ZINE, BRUCE M. BOMAN, AND CLAGUE P. HODGSON’

Creighton Cancer Ccii a-/Dept. of Biomedical Sciences, Creighton School of Medicine, Omaha, Nebraska 68178,

USA

ABSTRACT New gene therapy methods are rapidlybeing developed to permit the expression of tumor sup-pressor genes, cytotoxins, anticancer antigens, and im-munoregulatory proteins in the treatment of cancer.Large-scale testing in humans has been delayed by ques-tions concerning the safety and effectiveness of preferredretroviral vectors and helper cells. These vector systemsare limited by their ability to undergo homologous recom-bination with endogenous retroviruses or helper-viral se-quences, resulting in release of replication-competentretrovirus (RCR). In addition, transcriptional inactiva-tion of the retroviral promoter often occurs, caused inpart by methylation of CpG islands in the retroviral longterminal repeats (LTRs). We report the production ofhighly specific retrovectors using gene amplificationtogether with oligonucleotide building blocks. The syn-thetic vectors were based on mouse VL3O retrotransposonNVL3, and lacked homology to retroviral helper gene se-quences. Three of four constructs made by gene amplifi-cation yielded biologically active vectors. These con-structs efficiently transmitted and stably inserted a neo-mycin resistance marker gene into the genome of recipientcells, expressing an abundant RNA species of the expectedsize in the absence of detectable replication competentretrovirus. The vectors and techniques described enablewidely applicable expression modes using generic helpercells, and require only 1.3 kb of cis-acting vector RNAsequences for faithful transfer and expression of geneticmaterial.-Chakraborty, A. K., Zink, M. A., Boman,B. M., Hodgson, C. P. Synthetic retrotransposon vectorsfor gene therapy. FASEBJ. 7: 971-977; 1993.

Key Words: gene therapy retrovirus vector retrotransposonVL3O#{149}PCR

GENE THERAPY IN HUMANS IS A PROMISING new medical tech-nology, which in the last 3 years has advanced to the stageof clinical testing. By the end of 1992, 37 clinical trials hadbeen approved, of which 28 were related to markers or treat-ment for cancer (1). Strategies for cancer gene therapy arevaried (2-4), involving the tumor suppressor genes as well assuicide genes (such as the HSVI thymidine kinase gene, con-ferring sensitivity to gancyclovir), toxins, multiple drugresistance genes, antisense RNA, ribozymes, or a host ofmechanisms involving immuno-gene therapy. The lattercategory includes the use of MHC class 1 molecules as wellas immunoregulatosy genes such as interleukins, interferons,tumor necrosis factor-alpha (TNF-cr),2 and others, inserted(as immunopotentiating agents) into tumor cells or killercells, such as tumor infiltrating lymphocytes (TIL). Recentresults of the first human gene therapy trials by Rosenbergand colleagues (5) demonstrated complete tumor regressionin two cases of advanced metastatic melanoma after TNF-crgene transfer using TIL to express TNF locally in the tumor

site.Other workers have recently reported progress in using

similar approaches in animal model systems, and manyhuman studies are currently awaiting approval. A significanttechnical problem is that retroviral sequences are often tran-scriptionally silenced in vivo or during embryonic develop-ment (6-8), due in part to methylation of CpG residues inthe viral LTR (9).

Despite some early successes of gene therapy to date, andthe apparent absence of toxicity, only 54 patients had beentreated by the end of 1992 (1). For gene therapy to be im-plemented on a broad scale, improvements in gene transfertechnology are needed. To date, the majority of protocolshave involved the use of retroviral vectors to deliver the genesto target cells. However, there are safety problems associatedwith the use of retroviral vectors and the helper cells used toproduce them (reviewed in ref 10). First, the currentlypreferred retroviral vectors were derived from Moloneymurine leukemia virus (M0MLV), an oncogenic virus ofmice associated with the development of lymphomas andleukemias. Occasionally, cis-acting portions of the vectorundergo homologous recombination with trans-acting viralgenes provided by the helper cell, resulting in the release ofreplication-competent retrovirus (RCR). In addition, thehelper cells that make the virus are themselves derived frommurine (NIH3T3) cells, and contain at least two sources ofviral contamination (mink cell focus forming virus and axenotropic MLV provirus), plus many murine VL3O retro-transposons, which are transmitted during gene therapy (11).Despite the deaths of a million Americans each year fromcancer alone, problems such as those described above havedelayed the implementation of gene therapy. Recently,workers at the National Institutes of Health reported the

deaths of several monkeys undergoing gene therapy, result-ing from RCR-associated lymphomas after replication-competent retrovirus was transmitted (12). This has led toreconsideration by the Recombinant Advisory Committee(RAC) of the methods for detecting RCR. Meanwhile, polit-ical and administrative pressure within government has ledto implementation of a “compassionate plea” basis for admin-istrative approval of gene therapy trials apart from the RACreview process.3 Thus, there is a need for improved vectorsand helper cell lines that will enable safe but rapid im-plementation of emerging genetic technology.

1To whom correspondence should be sent, at: Creighton CancerCenter, 2500 California Plaza, Omaha, Nebraska 68178, USA.

2Abbreviations: MCS, multiple cloning site; RCR, replicationcompetent retrovirus; MoMLV, Moloney murine leukemia virus;

VL3O, mouse VL3O retrotransposon with long terminal repeats;TIL, tumor infiltrating lymphocytes; CpG, methylation site, C fol-lowed by G; IFU, infectious units; TNF-a, tumor necrosis factor-a;RAC, Recombinant Advisory Committee.

3Federal Register, vol. 58, pp. 8500-8502, 1993.

TE*4PIATE

INTACT \‘I.30

(1 PBS

LJLii

Peel’ Atoll

1) PCR2) gel Igolale3) NaIl41 gel I..I.t.

6)110.10

)4) PBS

_-

b.

C.

cnd LTR ,., (-)-PBs

1 nvI3 TCTTTCATTTGGlv TCTTTCA TT TGG

(.)-PBs 3-LTR

nvI3 AGAAGAAGTGGGGAA ITGAA2

.sIv AGAAu AAG gGGGGAA TGA.A

VL3O-M LVHomology

a.

972 Vol. 7 July 1993 The FASEB Journal CHAKRABORTY E AL.

Previously we reported the ability of intact murine VL3Oretrotransposons to serve as gene transfer vectors (13). In thisreport, we investigate the biological activity of highly specificsynthetic retrovectors designed for gene therapy. They wereconstructed by gene amplification using oligonucleotidesto bridge essential regions of the VL3O template and toprovide convenient cloning sites. The vectors lacked CpGislands in the LTR promoter region and had no significanthomology to viral sequences in the most advanced helpercell lines. Efficient transmission, stable integration, andabundant expression of foreign genes from the VL3O LTRwere observed, without production of RCR during trans-mission by helper cells.

MATERIALS AND METHODS

Cell lines and plasmids

The *‘2 cell line was obtained from R. Mulligan. Cell linesNIH 3T3, C3H1OT1/2, ‘4’2 BAG, and PA317 were obtainedfrom The American Type Culture Collection (ATCC), Rock-

ville, Md., and were grown in Dulbecco’s modified Eagle

medium (DMEM) containing 10% (vol/vol) calf serum. Themedium contains HT (20 FM hypoxanthine and 30 tM

thymidine) in the case of PA317 cells. Plasmids pSV2neo andpGEM3 were obtained from ATCC and Promega Biotech,Madison, Wis., respectively.Plasmid pNVL3 (14)was kindlyprovided by J. Norton.

Primers and amplification reactions

Oligonucleotide primers were made by Genosys Biotechnol-ogies, Inc., Houston, Texas. Gene amplification reactionswere performed in 100 F’ of 10 mM Tris.HC1, pH 8.3,50 mM KCI, 1.5 mM MgCI2, 200 FM of deoxyribonucleoside

triphosphate, 2.5 units of Amplitaq DNA polymerase(Perkin-Elmer/Cetus, Emeryville, Calif.), 10 ng plasmidpNVLOVHGH (containing the complete NVL3 genome),and I tg of each primer. Reactions proceeded through 35cycles of denaturation (94#{176}Cfor 1 mm), primer annealing

(56#{176}Cfor 2 mm), and primer extension (72#{176}Cfor 3 mm).

In most cases the annealing temperature was 5#{176}Cbelow thecalculated denaturing temperature. Sequences of theprimers were as follows (5-3”):

P1 5’-TCAGCAGATCTrGAAGAATAAAAAATTACTGGCCTCTTG-3’,

P5 5’-ACTGCGGCCGCATAGACrrCTGAAATTCTAAG

ATTA-3’,P6 5 ‘-GAAGATCTTGAAAGATTTTCGAATTCCCGGCCAATGC-3,

P7 5’ -AAGGCGGCCGCTTAATTAATCTAAGGCCGGCC

AATTGAGACC-3’,

N5 5 -GGTTAATTAATFAGATCTAGCATGATTGAACAAGATGGAT1UCAC-3’,

N3 5 ‘-TACrI’AATTAACCATGGATCCGTTAACTCCGAAGCCCAACCTTTCATAG-3’,

N3S 5-’TACTTAATTAACCATGGTCTAGTGGATCCGACCTTGGAGAGAGAGAGTCAGTGTTAACTCCGAAGCC

CAACCTTTCATAG-3’.

Primers designated with a P prefix were used to make theVL3O backbone portions as shown in Fig. 1, whereas thosewith an N prefix were used to make the neo gene inserts, 5’-

“IN’ N!F UI2Barn

6) UI? gel .oI.Ie7) Ug.. 10 Born HI dl..lsdB) el,.ng. P.c1 .5*. I. Born9) PcR ..o. Bgl2jBrnu HI

$a..

*&1Z 8,.u, M’

10) Ilgol. It Born HI -digeolod pVL.PPB

_______I

(SA)3.sHI N*iJ,VLPP8N

2.

SplicedRJ’1A______ _______VLJORNA -.

kb

&‘ region

nvl3 ‘GCGCTCCGAGAGGGAGTGCGGGGTGGATAI

&v GCGCc t aGAGA aGGAGTGa GGGc TGGATAA

Figure 1. VL3O vectors derived by gene amplification. A) Strategy

for gene amplification, B) Vector maps: 1) containing cis-acting se-quences, MCS, and encapsidation sequence (4’ +); 2) same as (1)above but with a neo gene transcribed from the LTR promoter, withsplice acceptor (SA) site (VLPPBNS) or without splice acceptor

(VLPPBN); Designation characters in vector names:

VL = VL3O-derived; PP = psi plus (extended packaging se-

quences); B = BamHI site replaces Pad site; ..L = splice donor;N = neo gene; SA = splice acceptor]. C) Regions of some sequencehomology between intact MoMLV and NVL3 vectors: 1) (- )-

strand primer binding site region; 2) (+ )-strand primer binding siteregion; 3) packaging hairpin region.

METHODOLOGY COMMUNICATIONS

GENE THERAPY VECTORS 973

and 3-primers designated respectively. N3S was used tomake the neo vector VLPPBNS, which had a splice acceptorsite at the 3-end to permit expression of a second gene (thisconstruct failed to function properly; see Results).

Subcloning of gene-amplified fragments

Gene-amplified fragments were run in a 1% agarose gel andeach DNA fragment was excised from the gel and purifiedusing Geneclean II kit (BlO 101 Inc., Lajolla, Calif.). TheDNA fragments P1/P7 and P5/P6 (Fig. la) were digestedwith restriction ennuclease NotI, run on 1% agarose gels,and further purified by the Geneclean II method. Ligationreactions (P1/P 7 and P5/P6) were performed (to join the twoNotl-digested fragments) in 10 1d vol containing 66 mMTris.HC1, pH 7.6, 10 mM MgCl2, 1 mM DTT, 1 mM ATPand 1-2 units of T4 DNA ligase (Boehringer MannheimBiochemicals, New York) at 4#{176}Cfor 16 h. The ligatedproducts were run 1% agarose gel, desired bands were ex-cised from the gel and purified by the Geneclean II method.Then the fragments were digested with BgIII, further

purified as above, ligated into pGEM3 vector (Promega,Inc., Madison, Wis.) at the BamHl site, transformed intoEscherichia coli SURE competent cells (Stratagene, La Jolla,Calif.) and selected in Luria broth ampicillin plates. Oneclone (pVLPP) was selected by restriction enzyme analysis(XhoI, NotI, XbaI, KpnI, and HindIII) (Fig. lb). A BamHIlinker (pCGGA’IIJCG) was introduced into the Pad site ofpVLPP after blunting the Pad overhanging ends with T4DNA polymerase, yielding pVLPPB. Then the(BamHI/BglH digested) neo amplified fragments N5/N3 (nosplice acceptor site) or N5/N3S (splice acceptor site) wereligated into the BamHI digested, calf intestinal, alkalinephosphatase-treated pVLPPB, yielding pVLPPBN. Theorientation of the neo-vector was determined by BamHI re-striction enzyme analysis.

Nucleic acid procedures

Total RNA was isolated from 80% confluent cells asdescribed (15). For RNA blots, 10 or 20 g of RNA was runon 1% formaldehyde-agarose gels and transferred onto Bio-Rad Zeta-probe GT membrane using the Semi-Dry Electro-phoretic transfer cell (Bio-Rad, Emeryville, Calif.). RNAblot hybridization was done in 5XSSC (lx SSC = 0.15 M

NaCl/15 mM sodium citrate, pH 7), 1 x Denhardt’s solution(0.02% w/v Ficoll/ 0.02% w/v polyvinyl pyrolidone/0.02%w/v acetylated bovine serum albumin), 20 mM sodiumphosphate, pH 6.8, 0.2% SDS, 5 mM EDTA, 10% dextran

sulfate, and 40% formamide at 42#{176}Cfor 16 h (5 Prime-3Prime, Inc., Philadelphia, Pa.). Blots were washed twice(15 mm each) in 2XSSC + 0.1% SDS at room temperatureand in 0.2XSSC + 0.1% SDS at 50#{176}C.For DNA blots, each10 tg of nuclear DNAs were digested with excess restrictionendonucleases (XhoI, BglII, StuI), and run on 1% agarosegels, transferred onto nylon membranes by the capillary blotmethod (16) after acid/alkali treatment. The membranes

were baked at 80#{176}Cfor 30 mm. Hybridizations were carriedout in SXSSC, 1 x Denhardt solution, 20 mM Sodium phos-phate, PH 6.8, 5 mM EDTA, 20 mg/ml denatured salmonsperm DNA, 10% dextran sulfate, and 40% formamide at42#{176}Cfor 20 h. The final stringent wash of the blots weredone in 0.1% XSSC, 0.5% SDS, at 65#{176}C,30 mm. Neo

(0.76 kb Pvu2 fragment of pSV2NEO) or VL3O (0.9kb Xholfragment of pVLPB) hybridization probes were made byNick Translation (N5000, Amersham, Arlington Heights,Ill.)

Transfection, infection, and determination of viral titers

Transfection of calcium phosphate/DNA coprecipitates, in-fection in the presence of 6 Fg/ml of polybrene, and titerdetermination were performed as described (17). Briefly,10 tg of supercoiled DNA as calcium phosphate precipitates

formed in HEPES buffer were transfected into 60% conflu-ent cells (6 cm plates). After 48 h the cells were divided 1:4and neo-resistant colonies were selected in 400 g/ml activegeneticin (Gibco BRL, Gaithersburg, Md.). Titers weredetermined on NIH3T3 cells seeded 2-4 x 106/10 cm dish,selected with 800 Fg/ml geneticin. After 12 days selection,cells were stained in methylene blue (0.02% v/v) after fixa-tion in 0.1% v/v glutaraldehyde, and drug-resistant colonieswere counted. Transduction titers were determined after

filtering the media through 0.45 F membrane filters.

RESULTS AND DISCUSSION

Design of VL3O vectors

The NVL3 transcriptional unit was selected as a templatefor vector construction because of its several advantages:1) the LTR transcriptional promoter constitutively expressesabundant RNA in most mouse cells and tissues as well as inhuman cells, 2) it lacks significant homology to MoMLVhelper sequences, 3) it lacks CpG methylation islands in theU3 LTR promoter.

The strategy for amplification of essential cis-actingregions comprising vectors is shown in Fig. la. Putativenonessential DNA was reduced to a minimum through the

use of selective gene amplification of only those regions sus-pected of playing an essential dis-acting role. The procedure

resulted in a 1.3 kb RNA vector (Fig. lb) containing all puta-tive sequences for transcription, replication, packaging, and

integration. A hypothetical advantage of the approach was topermit the maximum amount of foreign DNA to be insertedinto the multiple cloning site (MCS), which was encodedinto the oligonucleotide primers (retroviral packaging is

limited to 10-li kb total vector size). Homology betweenVL3O and intact MoMLV was restricted to 11 bp of directhomology at the left LTR/( - )-primer binding site junction;17/l9bp homology at the (+ )-primer binding site/right LTRboundary; and 24/3Obp homology in the encapsidation hair-pin region (Fig. ic). Thus, helper cell types that lack en-capsidation regions and 3’-LTR sequences have almost noconcerted homology with the vector sequences; those alsolacking 5’ -LTRs and primer binding sites should have none.

Because the exact boundaries of packaging sequences in

VL3O are not known, we used a region elongated to 611 bpbeyond the LTR (18) (Fig. la). The region was determineda priori by analogy to a packaging enhancer region (19, 20)of MoMLV, which extends well beyond the hypotheticalhairpin structure and into the retroviral gag gene, which en-hances packaging by at least 10-fold. The primary vector(pVLPP) was designed so that no favorable context(PuXXATG) translation initiation codon preceded the mul-tiple cloning site. This enables the insertion of the first suchATG with the gene of interest, and is fundamentally differentfrom MoMLV transcriptional units where translation is

often confounded by favorable AUG codons upstream fromthe cloning sites. Gene amplification primers included multi-ple cloning sites, and in one case a synthetic consensus spliceacceptor site (21). The template included a potential splicedonor site upstream near to the LTR (Fig. la). However, aspliced VL3O RNA has not been observed in nature, and the

a.12345 b.12345

d.123

0#{149}a

Figure 2. Hybridization of total cellular RNA to Iwo (a) or VL3O(b) probes. Lane 1, PA317 cells transfected with pSV2NEO; lane 2,PA317 cells (negative control); lanes 3-5, PA317 cells transfectedwith three different clones of VLPPBN (lanes 3-5 represent mass

cultures of cells). RNA from three clones of VLPPBN derived bytransduction of ‘2 cells, hybridized to neo probe (c), or to VL3O

Wit I IIUUUWUY UVMMUPiIUMI lUl

974 Vol. 7 July 1993 The FASEB Journal CHAKRABORTY Er AL.

functionality of the presumptive splice donor and synthetic

acceptor were unknown. For directional cloning and to re-move the TATA-like residues of the Pad cloning site, aBamHI linker was inserted at the Pad sites, generating

pVLPPB. Two secondary vectors were constructed that con-tained the amplified neo gene: (pVLPPBN and pVLPPBNS).The vector that contained the synthetic splice acceptor siteencoded into the oligonucleotide was denoted by S. Thisputative splice vector was intended to permit two types ofRNA to be expressed from the spliced and unspliced formsof the LTR transcript. The neo gene was expressed from the

first favorable (22) translational start codon (PuXXAUG)contained within the pVLPPBN vector RNA.

Expression of synthetic VL3O vectors

The neo vectors shown in Fig. lb were transfected into PA3I7retroviral helper cells (23) using the calcium phosphatemethod (24). pSV2NEO plasmid DNA was also transfected

into the helper cells as a positive control. Three of the four

transfections done with synthetic vector preparations pro-duced as many or more colonies than the pSV2NEO controlplasmid upon selection with the drug G418 (not shown). The

three transfections done with different ligations of VLPPBNall produced G418 drug-resistant colonies (neo phenotype),

whereas the one VLPPBNS experiment failed to produceany colonies. This result indicated that the neo gene was ex-pressed and that gene amplification methods were effectivein the majority of these cases in providing a biologically

active vector. In the case of VLPPBNS, it is possible that a

gene amplification or cloning error caused the negative

result. However, it is also possible that a splicing event medi-

-5kb-

a I. -2.4kb-

c.123

probe (d).

-5kb-

-2.4kb-

ated in part by the additional sequences in VLPPBNS mayhave played a role through the efficient elimination of un-processed neo sequences in messenger RNA, resulting in noselectability. Because the vector was nonfunctional, no

further analysis was attempted. RNA blot analysis (Fig. 2a)of PA3i7 cell mass cultures transfected by the three

VLPPBN preparations using a neo probe indicated an abun-dant RNA species of the expected size (2.4 kb). The neo-

containing RNA species was clearly visible in each case after

a 4-h film exposure. The abundance of VLPPBN vectorRNA was as great or greater than that of the SV4Opromoter-driven plasmid, pSV2NEO (Fig. 2a, lane 1). Thisblot was stripped and rehybridized to a VL3O probe madefrom intact vector DNA sequences (Fig. 2b). The 5 kb RNAspecies observed in all lanes is the expected size of en-dogenous VL3O transcripts. Vector RNA was visually esti-mated to represent 10-20% of the signal observed from en-dogenous VL3O expression. However, the proportion of

vector RNA was higher in virally transduced cells (Fig.

2c, d), comparable to the total endogenous VL3O expressionfrom multiple loci. Thus, transduced vector sequences wereexpressed at generally higher levels than transfected se-quences, and removal of >3 kb of internal VL3O sequencesduring vector construction did not appear to have a seriousnegative effect on steady-state RNA levels attained by thevectors (i.e., the single copy of the vector produced an RNAmolar amount comparable to the total RNA resulting fromall endogenous VL3O RNA expression in mouse). In trans-fected cells, expression of neo RNA was comparable to orgreater than that expressed from the SV4O promoter ofpSV2NEO transfected cells (Fig. 2a).

Integrated VL3O vector DNA sequences

VLPPBN-transduced ‘I”2 helper cell lines were cloned andexamined by DNA blotting in order to determine copynumber and integrity (Fig. 3a). Blots of genomic DNAdigested with Bg12 or Stul (which do not cut within the vectorsequences) indicated that one to three copies of vector DNAwere integrated at diverse loci, and that many clones con-tamed a single integrated copy (subject to methylation sensi-

tivity of these enzymes, which may cause band number and

intensity differences due to partial digestion). After Xhoidigestion (see map Fig. la), a single internal Xhol fragmentof the expected size was observed on DNA blots, indicating

that the sequences were structurally intact, and that Xholsites in the LTR (see Fig. 3b) were mostly unmethylated(some high molecular weight material was expected due to

LTR termini which remain embedded in genomic DNAafter release of the internal Xhol fragment; Xhol is a rare-

cutting enzyme which is sensitive to CpG methylation). No

internal rearrangements of the Xhoi fragment were observedamong 14 cloned cell lines or several mass cultures of cellswhich have been examined to date.

The vector LTRs contained only two CpG residues in theU3 promoter region, compared to 17 CpGs in MoMLV and

6 in avian leukosis virus (see comparison, Fig. 3d). UnlikeMoMLV which is transcriptionally inactivated during em-bryogenesis, the avian virus is often expressed at significantlevels in the tissues of adult and developing animals (25). It

has been suggested that cytosine methylation is primarily amechanism for neutralizing invading DNA (26). Lack of

methylation potential of VL3O sequences such as these may

therefore help to explain why a significant amount of VL3ORNA is expressed in mouse cells in vivo (27) while retroviral

sequences are often transcriptionally silenced.

(b) (c)

?C 12345 Cl 2345 Cl 2345

Ipsi,,,, ‘jig #{149}

:(d).

CpG sites in Long T.rniinal Repeats

CpO citec 11* 133

MIX 17

U3*1 U5 NVL3 2#{176}i. “ -cpo

u3u5I ALV(RAV-l) 6

Figure 3. Integrated VLPPBN vector sequences. Recipient 2 cells

containing transduced VLPPBN digested with: a) Xhol, b) Stul, ord) Bg12 (all three enzymes are sensitive to methylation). d) Positions

of individual CpG residues within the LTRs of MoMLV (MLV),

NVL3 (same as VLPPBN), or avian leukosis virus RAV1.U3 = promoter, R = repeat region, U5 = RNA originating at the

5-end of the genome.

Transmissibility of synthetic VL3O vectors

Filtered (0.45 FM) media from transfected PA3i7 helper

cells bearing the vectors was used to transfer the vectors to

0 ecotropic helper cells. After selection, media was againtransferred to PA317 cells and selected with G4i8. Finally,the transduced forms of ‘I’2 and PA317 helper cells werecocultured for 2 wk in a permissive Ping-Pong (28) experi-ment wherein vectors were transmitted back and forth be-tween the two compatible cell lines in order to amplify vectorcopy number. Titers of many mass cultures averaged 10 forecotropic and mixed helper cell types, and from 2-4 x i04 to1.2 x 10 for the amphotropic helper cells. Mostly lowertiters were obtained from individual helper cell lines, sug-gesting that a few cell lines may have contributed substan-tially to titer of mass cultures. Surprisingly, Ping-Pong ap-

peared not to amplify the titer beyond the initial level (105).

However, endogenous VL3O sequences may have been am-plified as much or more than the vector due to their abun-dance in cellular RNA (Fig. 2b) or the possible presence of

additional packaging sequences within the intact VL3Os.The significant amounts of endogenous VL3O RNA seenhere in PA317 cells (which are used in human gene therapy,see Fig. 3b) suggested that competition from endogenousVL3O could also have a negative effect on transmission ofretroviral vectors from helper cells. Finally, we note that thepresence of endogenous VL3O and other cryptic retro-elements (such as MCF virus) (29) in PA317 cells and othermurine helper cell lines is a safety factor that should be con-sidered during human gene therapy experiments.

We wished to know what variation of RNA expression

might be found between different clones of ‘2 cells trans-duced with the vectors. A 10-fold variation of steady-state

RNA levels was observed on RNA blots between differentclones (Fig. 4a). However, the neo vector expressed similarlevels of RNA variation compared to endogenous (control)VL3O expression in the same cells, suggesting that position

effects as well as gel loading or internal variations accounted

for the observed variability of expression. We next asked

whether differences of vector RNA expression by theseclones were manifested in the titer determined at the time theRNA samples were extracted. To do this, we extracted andhybridized RNA from many transduced clones, comparingexpression from the endogenous VL3Os (an internal stan-dard) to vector (neo) RNA. Allowing for severalfold variabil-ity in the estimation of titer, the relative RNA steady-statelevel alone was not an accurate indicator of viral titer from

0 cells (Fig. 4b), with a majority of clones contributing littleto overall titer of mass cultures. This result suggested that a

few higher titer clones may have produced a significantproportion of the virus present in mass cultures, and thatidentification of these clones by titering (but not by RNA ex-pression alone) could significantly enhance titer.

To ascertain the RCR potential of the present vectors, theywere transduced into ‘2 helper cells (which occasionallyproduce replication-competent virus), and into the PA317helper cell line. PA317 is used to generate stocks free ofreplication-competent virus for human gene therapy, but itcan still generate wild-type virus under permissive circum-

stances (30). Stocks of three VLPPBN vector preparations or

of a retroviral control BAG-virus vector (ATCC, #CRL9560) were transmitted via 10 ml (1056 IFU) of filtered

media to recipient NIH3T3 cells, and drug-resistant colonieswere selected by G418 treatment. Mass cultures of resistantcolonies were grown to near confluence, and culture media

from each were filtered and transmitted to a second plate ofNIH3T3 cells. None of the three VLPPBN vector prepara-tions produced drug-resistant (RCR) colonies upon secon-dary passage (<IIFU/lO ml) in either “4’2or PA317 cells.However, the control BAG retroviral vector resulted in -200

CFU/ml upon secondary passage of a stock that had testednegative for RCR two passages earlier (data not shown).Thus, replication-competent retrovirus detected in the BAGrecipient cells could have represented passive carryover of the

I’2 genome (31), or else recombination or endogenous

a.#{149}0

b.TITER VS. STEADY STATE RNA

150000

5000o

.0 0.5 1 1.5 2 2.5 3

RELATIVE RNA LEVEL

Figure 4. Transmission of VL3O vectors from individual ‘2 cellclones transduced by VLPPBN-transmitting helper cells. a) Com-posite autoradiogram of an RNA blot of total cellular RNA from

cell clones. Top band, vector VL3O hybridized to neo probe, super-imposed over bottom band, endogenous VL3O RNA hybridized toVL3O probe. b) Plot of relative amount of vector:endogenous VL3O

RNA quantitated densitometrically for individual clones in

a) above (X-axis) vs. titer of helper virus at the time of RNA extrac-tion (Y-axis).

METHODOLOGY COMMUNICATIONS

GENE THERAPY VECTORS 975

- . - U..... UWU#{149}%U UI

976 Vol. 7 July 1993 The FASEB Journal CHAKRABORTY Er AL.

retroviral transmission occurred, resulting in the production

of replication competent retrovirus. However, the VLPPBNfailed to produce replication-competent retrovirus even after2 wk coculture of 4’2 and PA317 cells.

Recently, several primates undergoing gene therapy trialsat NIH acquired fatal lymphomas associated with multipleintegrated copies of replication-competent murine leukemiavirus (12). This was surprising because of previous evidenceindicating that amphotropic MoMLV is not an acute patho-gen in primates (32, 33). Molecular clones of the virus indi-cated the presence of both vector-helper recombinants aswell as MCF-helper recombinant/contaminants. This prob-lem points to the need for improvements in both vectors andhelper cell lines, especially as considerable room for crossingover exists between helper sequences and the extensive gag

gene sequences found in popular retroviral vectors. In con-trast, the VL3O-derived vectors described here have limitedhomology to intact MoMLV sequences, and almost none tomodern helper sequences. They contain no gag gene se-quences, such as those implicated in the generation of RCRby MoMLV vectors (34). Although the present VL3O-derived vectors are designed to reduce opportunities forvector-helper homologous recombination to near zero, RCRcould also possibly be generated by nonhomologous recom-bination events. We know of no reports to date of VL3Orecombination leading to RCR in any helper cell line,despite the presence of large amounts of endogenous VL3ORNA in all murine helper cells, and the frequent observationof MoMLV recombination events in these cells. Such recom-bination would require two perfect, nonhomologous recom-bination events in older cell lines such as PA317, or two non-homologous events plus a partly homologous recombinationevent in helper cell lines with divided retroviral genomes. Inaddition, frequent stop codons were found in all readingframes in the VL3O genome, further reducing the risk ofRCR. Although modern helper cells with divided retroviralgenomes (35, 36) also reduce the chances of unlikely recom-bination events, it will still be necessary to develop non-murine helper cells that are free of endogenous MCF andxenotropic virus in order to eradicate RCR recombinants.Recently, fourth generation patented helper cell lines havebeen disclosed that use human or dog cells and eliminate5’-LTRs from helper sequences (reviewed in ref 10). Theseimprovements, used in conjunction with vectors such as

those described here, should further reduce chances forrecombination and release of infectious virus.

CONCLUSION

We have used the gene amplification process together withsynthetic oligonucleotides to obtain versatile vectors, reserv-ing a proportionately larger space to be occupied by thera-peutic genes (up to the 9-10 kb viral packaging limit). Thevectors allow use of the LTR transcriptional promoter, an in-ternal promoter, and/or an internal ribosome entry site. Weused a genomic mobile element (VL3O) template in place ofretroviral sequences. These procedures resulted in theremoval of oncogenic enhancers, methylation islands, andopportunities for homologous recombination associated withMoMLV vectors. The sequences were stable during passage,were efficiently transmitted in the absence of replication-competent retrovirus, and were expressed as abundant RNAfrom the LTR promoter.

Previously, difficulties were envisaged for the constructionof biologically active vectors using gene amplification tech-

nology because of the inherent error of enzymes such as taqDNA polymerase (37). However, three of four secondary neo

vector preparations constructed here entirely from amplifiedfragments resulted in biologically active transposons express-ing large amounts of selectable neo RNA from the LTRpromoter (for continuity, the neo gene was also an amplifica-tion product). We speculate that our success was due in partto the repeated purification of the desired product (fromgels), from the use of restriction enzymes to trim raggedends, and by careful monitoring of the reaction products.Therefore in addition to providing a vector suitable for genetherapy, the present work provides a basis for investigators touse the techniques and materials described here togetherwith the experience of numerous others regarding fidelity ofPCR reactions (for a review see ref 38) to make more precisevector constructions than were previously possible using con-ventional restriction enzyme-based cloning procedures.

The VL3O-derived vectors described here are the firstretrotransposon vectors known to us that are made suitablefor gene therapy research. They are compatible with retro-viral helper cells and provide a basis for comparing efficacyand safety with that of popular retroviral gene delivery sys-tems. The implementation of movable genetic elements forgene therapy is a natural extension of their evolutionary role,first described by McClintock (39, 40), and represents afundamental departure from the exclusive use of pathogenicagents for gene therapy vectors in the past.

We are grateful to J. Knezetic and E. Patterson for technical ad-vice, and to G. Schneider and M. Reilly for computer assistance.Supported by NIH grant 1R29GM41314-4 to CPH, and by grantsfrom The Anna and Charles Stern Foundation and The HealthFuture Foundation.

Note added in proof Recently we isolated a viable, transmis-sible clone of VLPPBNS expressing neo marker; however, no

spliced RNA was observed.

REFERENCES

I. Anderson, W. F. (1992) End of the year potpourri-1992. Hum. Gene Thee3, 617-618

2. Friedmann, T (1989) Progress toward human gene therapy. Science 244,12 75-1287

3. Anderson, W. F. (1992) Human gene therapy. Science 256, 808-813

4. Miller, A. D. (1992) Human gene therapy comes of age. Nature (London)357, 455-460

5. Rosenberg, S. A. (1992) Gene therapy for cancer. JAMA 268, 2416-24196. Jaenisch, R., Jahner, D., Nobis, P., Simon, I., Lohler,J., Harbers, K.,

and Grotkopp, D. (1981) Chromosomal position and activation of

retroviral genomes inserted into the germ line of mice. Cell 24, 519-524

7. Linney, E., Davis, B., Overhauser, J., Chao, E., and Fan, H. (1984)Non-function of a moloney murine leukemia virus regulatory sequencein F9 embryonal carcinoma cells. Nature (London) 308, 470-472

8. Jaenisch, R., Schnieke, A., and Harbers, K. (1985) Treatment of micewith 5-azacytidine efficiently activates silent retroviral genomes indifferent tissues. Proc. Nail. Acad. Sri. USA 82, 1451-1455

9. Hoeben, R. C., Migchielsen, A. A. J., van der Jagt, R. C. M., vanOrmondt, H., and van der Eb, A. J. (1991) Inactivation of the Moloneymurine leukemia virus long terminal repeat in murine fibroblast celllines is associated with methylation and dependent on its chromosomalposition. j Viral. 63, 904-912

10. Hodgson, C. P., Chakraborty, A. K., and Boman, B. M. (1993)Retroviral vectors for gene therapy and transgenics. Curr. Opin. Ther.Paknls 3, 223-235

11. Hatzoglou, M., Hodgson, C. P., Mularo, F., and Hanson, R. W. (1990)Transfer and expression of mouse VL3O retroelements in rat cells dur-

ing infection with recombinant MoMLV viruses. Hum. Gene Ther. 1,385-397

12. Donahue, R. E., Kessler, S. W., Bodine, D., McDonagh, K., Dunbar,C., Goodman, S., Agricola, B., Byrne, E., Raffeld, M., Moen, R.,Bacher, J., Zsebo, K. M., and Nienhuis, A. W. (1992) Helper virus-

induced T cell lymphoma in nonhuman primates after retroviral-

mediated gene transfer. J. Expil. Med. 176, 1125-1135

MODEL SYSTEMS FOR NEUROGENESIS

An FJ Theme Issue: July 1994

Coordinated by R. P. Bunge and P. Simpson

Research communications on this topic willalso appear in the July issue.

Deadline for submission ofmanuscripts is March 1, 1994.

METHODOLOGY COMMUNICATIONS

GENE THERAPY VECTORS 977

13.Cook, R. F.,Cook, S.J., and Hodgson, C. P. (1991) Retrotransposongene engineering. BioTechnology 9, 748-751

14. Carter, A. T, Norton, J. D., and Avery, R. J. (1983) A novel approach

to cloning transcriptionally active retrovirus-like genetic elements frommouse cells. Nucleic Acids Res. 11, 6243-6254

15. Chomczynski, P., and Sacchi, N. (1987) Single step method of RNA iso-

lation by acid guanidinium thiocyanate-phenol-chloroform extraction.AnaL Biochem. 162, 156-159

16. Jeifreys, A. J., and Flavell, R. A. (1977) A physical map of the DNAregions flanking the rabbit $-globin gene. Cell 12, 429-439

17. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Sendiman,

J. G., Smith, J. A., and Struhi, K. (1989) In Current Protocols in MolecularBiology. Greene Publishing Associates and Wiley-Interscience, NewYork

18. Adams, S. E., Rathjen, P. D., Stanway, C. A., Fulton, S. M., Malim,M. H., Wilson, W., Ogden, J., King, L., Kingsman, S. M., andKingsman, A. J. (1988) Complete nucleotide sequence of a mouse VL3Oretro-element. MoL Cell. Biol. 8, 2989-2998

19. Armentano D., Yu, S-F., Kantoff, P. W., von Ruden, T., Anderson,W. F., and Gilboa, E. (1987) Effect of internal viral sequences on theutility of retroviral vectors. j ViraL 61, 1647-1650

20. Bender, M. A., Palmer, T. D., Gelinas, R. E., and Miller, A. D. (1987)Evidence that the packaging signal of Moloney murine leukemia virusextends into the gag region. J. Viral. 61, 1639-1646

21. Darnell, J. E., Baltimore, D., and Lodish, H. F. (1986) In Molecular CellBiology, pp. 305-369, Scientific American Books, New York

22. Kozak, M. (1978) How do eukaryotic ribosomes select initiation regions

in messenger RNA. Cell 15, 1109-112323. Miller, A. D., and Buttimore, C. (1986) Redesign of retrovirus packag-

ing cell lines to avoid recombination leading to helper virus production.Mol. Cell. Biol. 6, 2895-2902

24. Graham, F. L., and van der Eb, A. J. (1973) A new technique for theassay of infectivity of human adenovirus 5 DNA. Virology 52,456-467

25. Cook, R. F., Cook, S. J, Savon, S., McGrane, M., Hartitz, M.,Hanson, R. W., and Hodgson, C. P. (1993) Liver-specific expression ingenetically modified chickens mediated by the rat cytosolic phospho-enolpyruvate carboxykinase promoter. j Poultry Sci. 72, 554-567

26. Bestor,T. H. (1990) DNA methylation: evolution of a bacterial immunefunction into a regulator of gene expression and genome structure inhigher eukaryotes. Philos. Trans. R. Soe. (London) See B 326, 179-187

27. Norton, J. D., and Hogan, B. L. (1988) Temporal and tissue-specific ex-pression of distinct retrovirus-like (VL3O) elements during mouse de-velopment. Dev. Biol. 125, 226-228

28. Bestwick, R. K., Kozak, S. L., and Kabat, D. (1988) Overcoming inter-ference to retroviral supennfection results in amplified expression and

transmission of cloned genes. Proc. Nail. Acad. Sci. USA 85, 5404-540829. Scadden, D. T., Fuller, B., and Cunningham, J. M. (1990) Human cells

infected with retrovirus vectors acquire an endogenous murine provi-

rus. j Viral. 64, 424-42730. Muenchau, D. D., Freeman, S. M., Cornetta, K., Zwiebel, J. A., and

Anderson, W. F. (1990) Analysis of retroviral packaging lines for genera-tion of replication-competent virus. Virology 176, 262-265

31. Mann, R., Mulligan, R. C., and Baltimore (1983) Construction of aretrovirus packaging mutant and its use to produce helper-free defectiveretrovirus. Cell 33, 153-159

32. Cornetta, K., Moen, R. C., Culver, K., Morgan, R. A., McLachlin,J. R., Sturrn, S., Selegue,J., London, W., Blaese, R. M., and Anderson,W. F. (1990) Amphotropic murine leukemia retrovil-us is not an acutepathogen for primates. Hum. Gene Thee 1, 15-30

33. Cornetta, K., Morgan, R. A., Gillio, A., Sturm, S., Baltrucki, L.,O’Reilly, R., and Anderson, W. F. (1991) No retroviremia or pathologyin long term follow-up of monkeys exposed to a murine amphotropicretrovirus. Hum. Gene Thee 2, 215-219

34. Anderson, W. F., McGarrity, G. J., and Moen, R. C. (1992) In Reportto the NIH Recombinant DNA Advisory Committee on Murine Replication-Competent Retrovirus (RCR) Assays, pp. 961-992, offprint, NIH/RAC, Tab

1541, Bethesda, Maryland

35. Markowitz, D., Goff, S., and Bank, A. (1988) Construction and use ofa safe and efficient amphotropic packaging cell line. Virology 167,400-406

36. Markowitz, D., Goff, S., and Bank, A. (1988) A safe packaging line forgene transfer: separating viral genes on two differentplasmids.J. Viral.62, 1120-1124

37. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R.,Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988) Primer-directedenzymatic amplification of DNA with thermostable DNA polymerase.

&ience 239,487-49138. Eckert, A. A., and Kunkel, T. A. (1991) DNA polymerase fidelity and

the polymerase chain reaction. In PCR Methods and Applications.pp. 17-24, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,New York

39. McClintock, B. (1952) Chromosome organization and genic expression.

Cold Spring Harbor Symp. Quant. BioL 16, 13-4740. McClintock, B. (1957) Controlling elements and the gene. Cold Spring

Harbor Symp. Quant. Biol. 21, 197-216

Received for publtcation March 15, 1993.Accepted for publication April 30, 1993.