Suppression subtractive hybridization identifies genes correlated to symbiotic and

This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

http://www.elsevier.com/copyright

Author's personal copy

Suppression subtractive hybridization identifies genes correlated to symbiotic andaposymbiotic sea anemone associated with dinoflagellate

Jimmy Kuo a,b, Zeng-Chin Liang c, Chorng-Horng Lin c,⁎a Department of Planning and Research, National Museum of Marine Biology and Aquarium, Pintung, 944, Taiwan, ROCb Institute of Marine Biotechnology, National Dong Hwa University, Pintung, 944, Taiwan, ROCc Department of Bioresources, DaYeh University, Changhua, 515, Taiwan, ROC

a b s t r a c ta r t i c l e i n f o

Article history:Received 16 November 2009Received in revised form 24 March 2010Accepted 24 March 2010

Keywords:Aiptasia pulchellaAposymbioticSuppression subtractive hybridizationSymbiotic

Cnidarian-dinoflagellate symbioses are mutualistic endosymbioses in which the algae live in the cells of hostorganisms, providing nutrients to the host while the host supplies a protective environment or livingexpenses to the algae. The molecules involved in the initiation, establishment, and maintenance of theseendosymbioses remain largely unexplored. Suppression subtractive hybridization (SSH) was applied toidentify genes in the sea anemone, Aiptasia pulchella Carlgren 1943, that are differentially expressed inspecimens with or without symbionts. Eleven candidate transcripts were isolated, seven of which wereconfirmed unique and differentially expressed. Two genes were further analyzed to complete the full-lengthcDNAs. Phylogenetic analysis suggested the full-length 1A6 cDNA, which is upregulated in anemonescontaining the symbiont, codes for the sea anemone Niemann-Pick type C2 homologue that is involved inlysosomal cholesterol transport. The predicted secondary structure and folding analysis of the deducedamino acid of 2C7 cDNA, which is upregulated in anemones without the symbiont, suggested that Mlc1p, acalmodulin-like myosin light chain from the budding yeast Saccharomyces cerevisiae, is closely associated.Using SSH, we demonstrated that A. pulchella differentially expresses transcripts under symbiotic oraposymbiotic conditions.

© 2010 Elsevier B.V. All rights reserved.

1. Introduction

Symbiotic associations between two or more unrelated organismsare widespread on Earth. Symbiotic associations can be mutualistic orparasitic and intracellular or extracellular. Examples of such associa-tions include the symbiosis between Rhizobium bacteria andleguminous plants, bacteria and the mammalian intestine, and Vibriofischeri and the light-producing organ of the squid Euprymna scolopes(Goebel and Gross, 2001; Hooper et al., 1998; McFall-Ngai and Ruby,2000; Spaink, 2000).

Dinoflagellate endosymbionts of the genus Symbiodinium havebeen found in a wide range of marine invertebrates, such as corals, seaanemones, radiolarians, foraminiferans, sponges, and jellyfish. In thismutualistic endosymbiosis, the dinoflagellate provides reduced

organic carbon to the host via photosynthesis, and the host providesinorganic nutrients, nitrogen, and carbon sources, as well as aprotective environment, to the algae (Battery, 1992). Coral bleaching,which is caused by the loss of the dinoflagellate from coral cells or theloss of pigments in algae, has endangered the coral reef ecosystem(Muller-Parker and D'Elia, 1997).

The microscale genetic processes for the development of intracel-lular symbiosis are likely to involve the initiation of the signaltransduction cascade at the time of the symbiont's entrance, the shut-down of the host's defense mechanisms, and the maintenance ofsymbiotic associations (McFall-Ngai and Ruby, 2000).Two-dimen-sional polyacrylamide gel electrophoresis (2D-PAGE) analysis hasbeen used to investigate the differential protein profiles of symbioticand aposymbiotic anemones. Two proteins have been found to beunique to symbiotic animals (Weis and Levine, 1996). Furtheridentification and characterization of one 32 kDa protein with anisoelectric point (PI) of 7.9 (named sym32) revealed it to behomologous to the fasciclin I (Fas I) family of homophilic celladhesion proteins, suggesting that it might function in cell–cellinteractions (Reynolds et al., 2000). Study of the expression ofcarbonic anhydrase (CA) in the sea anemone Anthopleura elegantis-sima showed that CA expression and synthesis are enhanced by thepresence of dinoflagellates (Weis and Reynolds, 1999). The CAenzyme, which catalyzes the interconversion of CO2 and HCO3

−, is

Journal of Experimental Marine Biology and Ecology 388 (2010) 11–19

Abbreviations: ap, Aiptasia pulchella; apo, aposymbiotic; BLAST, Basic LocalAlignment Search Tool; DIG, digoxigenin; 2D-PAGE, two-dimensional polyacrylamidegel electrophoresis; cDNA, DNA complementary to RNA; EST, expressed sequence tag;Fas I, fasciclin I; PI, isoelectric point; ML domain, MD-2-related lipid recognitiondomain; NPC, Niemann-Pick type C; RACE, rapid amplification of cDNA ends; SSH,suppression subtractive hybridization; sym, symbiotic; UTR, untranslated region.⁎ Corresponding author. Department of Bioresources, DaYeh University, 168

University Rd., Changhwa 515, Taiwan, ROC. Tel.: +886 4 8511888; fax: +886 48511326.

E-mail address: [email protected] (C.-H. Lin).

0022-0981/$ – see front matter © 2010 Elsevier B.V. All rights reserved.doi:10.1016/j.jembe.2010.03.011

Contents lists available at ScienceDirect

Journal of Experimental Marine Biology and Ecology

j ourna l homepage: www.e lsev ie r.com/ locate / jembe


key for supplying CO2, suggesting that CA is important for inorganiccarbon transport in cnidarian/algal symbioses. Global gene expressionin symbiotic and aposymbiotic Aiptasia pulchella has been examinedusing expressed sequence tag (EST) analysis, providing a usefuldatabase for studies of algal-cnidarian symbiosis (Kuo et al., 2004).The molecules involved in the initiation, establishment, and mainte-nance of these endosymbioses in symbionts and host should beunraveled by further studies.

To investigate the mechanisms that regulate symbiosis in theanemone A. pulchella, suppression subtractive hybridization (SSH)(Diatchenko et al., 1996) was applied to identify the genes that aredifferentially expressed under symbiotic and aposymbiotic condi-tions. The expression patterns of the identified cDNAs were analyzedby northern blots to examine the differential profiles. Among theisolated cDNAs, a homologue of Niemann-Pick type C2 (NPC2) wasupregulated in anemones with symbionts and a potential calciumbinding protein with two EF-hands was upregulated in aposymbioticanemones. The possible physiological roles of these two genes arediscussed.

2. Materials and methods

2.1. Maintenance of experimental organisms

Aiptasia pulchella were maintained indoor in a tank (44.5×11.5×29.5 cm) in ambient sunlight at room temperature (25 °C to28 °C). The animals were fed frozen brine shrimp once a week. Theaposymbiotic anemoneweregenerated by cold shockat 4 °C for 3 h, andkept in darkness for several weeks. During these periods, the animalswere grown in filtered seawater (0.45 μm) at room temperature.

2.2. Total RNA preparation

Total RNA was isolated from A. pulchella using TRIZOL® reagent(Invitrogen, Life Technologies, Carlsbad, CA, USA). One or two of theanimals were washed with filterized sea water twice, homogenized in1 ml of Trizol reagent with tissue homogenizer (HSIANGTAI, HG-2800,Taipei, Taiwan). The homogenates were purified according to themanufacturer's instructions.

2.3. Suppression subtraction hybridization (SSH)

A Clontech PCR-Select cDNA Subtraction Kit (BD Biosciences,Clontech, Palo Alto, CA, USA) was used for constructing SSH librariesaccording to the manufacturer's instructions. The forward symbioticlibrary was made by hybridizing cDNAs from symbiotic anemone asthe tester in the presence of cDNAs from aposymbiotic anemone asthe driver. The reverse aposymbiotic library was made withaposymbiotic cDNAs as the tester and symbiotic cDNAs as the driver.After the second PCR amplification, the subtracted cDNAswere clonedinto the TOPO10 vector using a TA cloning Kit (Invitrogen).

2.4. Differential screening using reverse northern

Fifty-seven clones from the subtracted symbiotic library and 59clones from the aposymbiotic library were randomly selected,checked, and amplified by PCR using T7 and T3 primers (94 °C for5 min, followed by 30 cycles of 94 °C for 1 min, 55 °C for 1 min, and72 °C for 1 min, with a final 10-min extension at 72 °C). Each of the 48PCR products was denatured with 0.6 M NaOH and spotted onto aHybond N+ membrane (Amersham pharmacia, Biotech, Piscataway,NJ, USA). The DNAswere UV cross-linked to membrane at 120 mJ/cm2

(Spectrolinker XL-1000, Spectronics, Westbury, NY, USA). The cDNAprobes from symbiotic- and aposymbiotic anemones were synthe-sized using the First-strand cDNA synthesis of a Clontech PCR-SelectcDNA Subtraction Kit (BD Biosciences) with 10 μg of total RNAs in the

presence of digoxigenin (DIG)-11-dUTP (Roche, Mannheim,Germany). Prehybridization and hybridization were done followingthe protocols of DIG high prime DNA labeling and detection starter kitII (Roche).

2.5. Northern blot analysis

Total cellular RNAs (10 μg/lane) were separated on a 1.5%formaldehyde–agarose gel and transferred using upward capillarytransfer to a Hybond N+membrane (Amersham pharmacia) with 10XSSC. The DIG-11-dUTP labeled DNA probes were prepared with PCRamplification in a final volume of 50 μl containing 5U of Advantage 2PolymeraseMix (BD Biosciences), 10 mMTris–HCl pH 8.3, 50 mMKCl,1.5 mM MgCl2, 2 mM dATP, 2 mM dCTP, 2 mM dGTP, 1.3 mM dTTP,0.7 mM alkali-labile DIG-11-dUTP, 0.5 μM of forward- and reverseprimers, CTGAGTAACAACAGTGCTGC and CTAATTTATACGACACTTCC(1A6-1C8-1D7), ACGAAGGAAATTGAGTTGCG and TCAAGTTGTG-CAACCGTGCC (1C3), CATCATCCCAGGGTTTTACG and GTCTTTG-AGTCTATGAGTGG (1D4), CAAAATGGCGCAGTGGAACC andTTGAGCGACTTGAACAAGTG (1E1), GCTAAGAATGAGTCAGTTCC andTTAAGATCGAGTGTAGAGTG (2C5), ACGACAAGAACAAGGATGGC andGTCAATTGACGTCATCATCG (2C7-2D1-2E11), AGGTTATCTGATCGG-TAGCC and TGCACTGTTTGCTTTCCTGG (2C11). PCR conditions were94 °C for 3 min, followed by30 cycles of 94 °C for 30 s, 55 °C for 30 s, and72 °C for 1 min, with a final 10-min extension at 72 °C. The templateused was cDNAs from oligo(dT)30 primered reverse transcription. TheImage J program (available at http://rsbweb.nih.gov/ij/index.html) wasapplied to analyze the expression levels on northern blots.

2.6. Isolation of full-length 2C7-2D1-2E11 cDNA

5′ Rapid amplification of cDNA ends (RACE) was used to obtain thefull-length cDNA. 2 μg of total RNAs from aposymbiotic anemonewereused with 5′ RACE Kit (Roche) following the user manual. The primersused for the extension were 5′-TGATACTGGTGGAAGTGTCG-3′ and 5′-AGAAAACTTGTTGGTCAGCG-3′. The cDNA was cloned into theTOPO10 vector using a TA cloning Kit (Invitrogen).

2.7. Structural- and phylogenetic analyses of sequences

The nucleotide sequences and deduced amino acid sequences ofthe clones were compared to those in databases using the Basic LocalAlignment Search Tool (BLAST) algorithm (Altschul et al., 1990). Theconserved domain was analyzed by Conserved Domains Server(Marchler-Bauer and Bryant, 2004) to Conserved Domain Database(Marchler-Bauer et al., 2005). Protein localization was predicted withWoLF PSORT server (Horton et al., 2007). Secondary structureprediction and comparison were analyzed by Protein StructurePrediction Server (PSIPRED) (McGuffin et al., 2000) and (m)GenTHREADER Server (McGuffin and Jones, 2003), respectively.Multiple sequence alignment was analyzed with the program fromMEGA4 (Tamura et al., 2007) using the Clustal W method.Phylogenetic analyses were conducted in MEGA4 (Tamura et al.,2007) using the Neighbor-Joining method (Saitou and Nei, 1987). Thebootstrap consensus tree inferred from 1000 replicates was per-formed to provide confidence estimates for tree topologies.

3. Results

3.1. Identification of differentially expressed genes

In an attempt to identify differentially expressed genes insymbiotic or aposymbiotic A. pulchella, 2 subtracted cDNA librarieswere constructed with SSH. According to the BLAST result, thehomologues for 11 candidate cDNAs were selected (Table 1). The lowE-value suggests that the clones have a high probability of sharing

12 J. Kuo et al. / Journal of Experimental Marine Biology and Ecology 388 (2010) 11–19


true homologies to the matched sequences. 1A6, 1C8, 1D7, 1C3, 1D4,and 1E1 represent the clones identified from symbiotic animals.Among them, 1A6, 1C8, and 1D7 corresponded to the same gene,NPC2. 2C5, 2C7, 2D1, 2E11, and 2C11 represent the clones identifiedfrom aposymbiotic animals. Among them, 2C7, 2D1, and 2E11corresponded to a novel EF-hand protein. The expression levels of1A6-1C8-1D7, 1C3, 1D4, and 1E1 were higher in symbiotic animalsthan in aposymbiotic animals, confirming that they are differentiallyexpressed in animals containing symbionts (Fig. 1). However, theexpression levels of these clones analyzed with Image J program onNorthern blots were only 1.4-, 1.1-, 1.2-, and 1.5-fold higher,respectively, in symbiotic animals compared to aposymbiotic ones.Rodriguez-Lanetty et al. (Rodriguez-Lanetty et al., 2006) previouslyreported that in cnidarian-dinoflagellate symbiosis, the differences inhost gene expression between those with and without symbiontsmaximally ranged between 1 and 2 fold higher. If the gastrodermaltissue—where the symbionts reside in symbiotic animals—is used forcomparison rather than the whole animal, a greater difference in theexpression levels might be observed. The expression levels of 2C5,2C7-2D1-2E11, and 2C11 from aposymbiotic animals exhibited 3.5-,8.9-, and 3.3-fold higher expression compared to symbiotic animals.

The full-length cDNAs of 1A6-1C8-1D7, renamed as A. pulchellaNPC2 (apNPC2), and 2C7-2D1-2E11, renamed as apEF, were analyzedfurther to determine their physiological functions in anemones, basedon the following consideration. First, multiple clones (1A6-1C8-1D7)from the anemones with symbionts matched to the gene NPC2, andmultiple clones (2C7-2D1-2E11) from the aposymbiotic anemonesmatched to the gene for a novel EF-hand protein. Second, Niemann-Pick C (NPC) disease is an inherited autosomal recessive disordercharacterized by lysosomal accumulation of cholesterol within theneuron cells of patients (Ory, 2000). The protein coded by NPC2,which is responsible for the minority (5%) of NPC patients, could bindcholesterol from lysosomal membranes and thus be involved in thepost-lysosomal export of cholesterol (Vanier and Millat, 2004). It alsomight be involved in the metabolism of symbiosomes or in lipidtransport. Third, the expression pattern of the apobymbiotic 2C7-2D1-2E11 clone was up to 8.9-fold higher than that found in symbioticanimals.

3.2. Sequence and phylogenetic analysis of apNPC2

DNA sequence alignment of 1C8, 1A6, and 1D7 cDNAs andprevious blast results showed that the 1C8 sequence contained the5′ coding region, sequences 1A6 and 1D7 contained the 3′ codingregion, and there were overlapping regions among these cDNAs. Thereorganized sequence revealed an open reading frame of 152 aminoacids, with the first in-frame ATG at nucleotide position 39 and a stopcodon TAA at position 495 (Genbank accession no. EU984092) (Fig. 2).An NCBI blast and conserved domain search suggested that thededuced amino acid sequence was an NPC2 homologue, apNPC2,which contains the ML domain (MD-2-related lipid recognitiondomain) and functions in lipid recognition, particularly in therecognition of pathogen-related products (Inohara and Nunez, 2002).

A phylogenetic tree was generated based on the alignment ofmultiple sequences (Fig. 3). The phylogenetic position of apNPC2 wasbetween vertebrates and invertebrates (fly and nematode homo-logues), and more closely related to vertebrates. The phylogeneticanalysis supported the premise that the clone identified in A. pulchellawas an NPC2 homologue. The alignment of the deduced amino acidsequence with NPC2 of model organisms showed that the sixcysteines of apNPC2, C1, C2, C3, C4, C5, and C6 were identical tothose of other species (Fig. 4) and could form three disulfide-linkedbonds in a 1-6, 2-3, and 4-5 pattern (Larsen et al., 1997). Amino acidsubstitution mutation on phenylalanine (F), valine (V), and tyrosine(Y), (F66A, V96F, and Y100A) has been shown to abolish thecholesterol binding of NPC2 (Ko et al., 2003). The alignment resultsfor apNPC2 showed that phenylalanine and tyrosine were conserved,

Fig. 1. Expression levels of the selected clones of A. pulchella in symbiotic (sym) and aposymbiotic (apo) states. 10 μg of total RNA were analyzed by electrophoresis. The blot wasprobed with a DIG-dUTP-labeled cDNA probe. Bottom panel: an ethidium bromide stained gel shows the amount of total RNA that was loaded into each lane.

Table 1Identified sea anemone cDNAs showed differential expression.

Clone cDNA size(bp)

Accession no. Putative product E-value

SymbioticNiemann-Pick disease, type C2

1A6 454 (Homo sapiens; BC002532) 5e−18

1C8 408 (Bos taurus; BT021533) 3e−09

1D7 371 (Macaca mulatta; XM001094066) 8e−11

1C3 282 EU984089 α-1 type XI collagen (Gallus gallus;M88593)

2e−28

1D4 550 EU984090 Elongation factor 1 β subunit(Mus musculus; AF029844)

2e−18

1E1 533 EU984091 DUF614 protein, unknown function(Branchiostoma belcheri tsingtauense;AY608892)

3e−21

Aposymbiotic2C5 303 EU984093 Cytochrome c oxidase subunit I

(Archips Georgiana; AF441275)6e−32

2C7 373 CnidEF mRNA, EF-Hand Homolog 9e−63

2D1 343 (Aiptasia pallida; DQ363989) 5e−62

2E11 416 3e−81

2C11 270 EU984094 Secretory (zymogen) granulemembrane glycoprotein GP2(Rattus norvegicus; X53935)

1e−04

13J. Kuo et al. / Journal of Experimental Marine Biology and Ecology 388 (2010) 11–19


whereas isoleucine replaced valine (Fig. 4). Three asparagines of NPC2are considered to be potential N-linked glycosylation sites (i.e., N1,N2, and N3); while N2 is essential to proper targeting and functioningof the protein, N3 can be utilized variably, and N1 is not used (Chikh etal., 2004; Liou et al., 2006). For apNPC2, the amino acids on theconserved location were glutamate (E), lysine (K), and glycine (G)(Fig. 4). Glycosylation on the lysine residue has been shown to occurin collagen biosynthesis in tendon and cartilage cells (Harwood et al.,1975). Overall, apNPC2 shared similar conserved motifs with othermodel organisms, suggesting that apNPC2 could also function inregulating cholesterol traffic.

3.3. Molecular cloning, sequence analysis, and multiple alignmentof apEF

The alignment organized 2C7-2D1-2E11 sequence contained a 3′untranslated region (UTR), therefore, only 5′ RACE PCR was carriedout. The resultant sequence of apEF contained an open reading frameencoding 171 amino acid residues, with the first in-frame ATG atnucleotide position 67 and a stop codon TGA at position 580 (Genbankaccession no. EU984095) (Fig. 5). An NCBI blast and conserveddomain search revealed that the deduced amino acid sequencepossessed a single pair of EF-hand structural motifs on the C-terminalbut no homologue on the N-terminal, suggesting that apEF mightbelong to a diverse family of calcium sensors and calcium signalmodulators (Kawasaki et al., 1998).

To understand the physiological function of apEF, the primary andsecondary structures were analyzed further. In terms of cellularlocalization, apEF could be secreted as an extracellular protein, aspredicted by the WoLF PSORT server (Horton et al., 2007). Thesecondary structure as predicted by the PSIPRED server (McGuffin et

Fig. 2. Nucleotide sequences of the apNPC2 gene. The start codon (ATG) and stop codon (TAA) are shown in bold. The sequence contains 152 amino acids and has a calculatedmolecular weight of 18 kDa. The underlined region represents the ML doman (MD-2 related lipid recognition domain) analyzed from the conserved domains of NCBI.

Fig. 3. Neighbor-joining tree showing thephylogenetic position of the apNPC2 protein. TheNPC2 deduced amino acid sequences from A. pulchellawere compared with the sequencesof other species retrieved from Genbank databases. The Clustal W method (MEGA4) wasapplied to conduct the sequence alignment and phylogenetic tree analyses. Bootstrapvalues are shown fornodes that hadN50% support in a bootstrap analysisof 1000 replicates.



Fig.

4.Co

mpa

risonof

thede

ducedam

inoacid

sequ

encesof

apNPC

2.Multiplealignm

entof

theA.p

ulch

ella

NPC

2proteinwithselected

NPC

2relative

s.Th

eblan

kregion

represen

tstheresidu

esco

nserve

dto

themajority.

Residu

esC1

toC6

indicate

thesixcy

steine

swiththreedisu

lfide

bond

s.F(P

heny

lalanine

),V(valine),and

Y(tyrosine)

represen

tcon

served

residu

esim

portan

tfor

cholesterolb

inding

.N1,

N2,

andN3represen

tthe

threeco

nserve

daspa

ragine

sas

thepo

tentialN

-lin

kedglyc

osylationsites.Th

eGen

bank

accessionnu

mbe

rsfortheselected

NPC

2relative

saresh

ownin

Fig.

3.



al., 2000) is shown in Fig. 5. The first EF-hand exhibits the expectedEF-hand structure, with a helix-coil loop-helix and a small β-strandlocated in front of the second helix. However, the small β-strand ismissing in the second EF-hand. The amino acids of the EF-hand motifson apEF were multiple aligned with other EF-hands from variousspecies (Fig. 6). The EF-hands selected for comparison were from twosources: (1) the NCBI conserved domain search and (2) the predictedstructure of apEF based on other known crystal structures determinedusing the (m)GenTHREADER server (McGuffin and Jones, 2003). Thecomparison revealed that the amino acids responsible for calciumbinding are highly conserved. According to the comparison of thesecondary structure by the (m)GenTHREADER server, the closesthomologue to apEF was yeast myosin light chain Mlc1p. Mlc1p isknown to interact with class V myosin Myo2p to mediate the vesiclepolarization processes during cytokinesis (Stevens and Davis, 1998;Wagner et al., 2002).

4. Discussion

In this study, we used SSH to isolate genes that are differentiallyexpressed by the anemone A. pulchella with and without symbioticdinoflagellates. For anemones containing symbionts, the best matchesof differentially expressed transcripts are alpha-1 type XI collagen, theEF 1 beta subunit, aDUF614protein (containing a cysteine-rich domain)

with unknown function, and NPC2. Alpha-1 type XI collagen formsfibrillar collagens with type I, II, III, and V collagens in most connectivetissues and might be important for development and wound healing(Fichard et al., 1995; van der Rest and Garrone, 1991). EF1 beta (alsoknown as EF1B or EF Ts) functions as the nucleotide-exchange factor forthe recycling of EF1A (EF Tu), and the GTP-bound EF1A deliversaminoacyl-tRNAs to the A site of an elongating ribosome (Andersen etal., 2003). NPC2, a soluble glycoprotein, binds cholesterol from internallysosomal membranes for cholesterol export (Vanier and Millat, 2004).

For the aposymbiotic-related cDNAs, the best matches are cyto-chrome c oxidase subunit 1, secretory (zymogen) granule membraneglycoprotein GP2, and a novel EF-hand homologue. Cytochrome coxidase, which is located on the mitochondrial respiratory chain,functions in the energy production of aerobic cells, and cytochrome coxidase subunit 1, which is mitochondrially encoded, seems to beimportant in the assembly of the cytochrome c oxidase complex(Fontanesi et al., 2008). GP2 is a phosphatidylinositol-glycan-linkedmembrane protein that is cleaved and secreted into the pancreatic ductalong with other digestive enzymes (Fukuoka et al., 1991; Hoops andRindler, 1991).

It is likely that the transcripts identified in this study are associatedwith the maintenance of the symbiotic association (e.g., withprocesses such as nutrient transport and energy metabolism).Alpha-1 type XI collagen, EF1 beta, cytochrome oxidase subunit I,

Fig. 5. Nucleotide and deduced amino acid sequences of apEF. The start codon (ATG) and stop codon (TGA) are shown in bold. The sequence contains 171 amino acids and has acalculated molecular weight of 24 kDa. The two EF-handmotifs are underlined. Locations of the predicted secondary structural elements (helix, coil, and strands) are depicted belowthe amino acids.



Fig.

6.Co

mpa

risonof

thede

ducedam

inoacid

sequ

encesof

apEF

.The

Gen

bank

accessionnu

mbe

rsof

theselected

EF-h

ands

arein

bold

andun

derlined

.The

numbe

rsne

xtto

theaccessionnu

mbe

rsrepresen

tthe

aminoacid

residu

esof

selected

EF-h

ands

.Residue

sco

nserve

din

mostmem

bers

aresh

ownon

ablackba

ckgrou

nd.#

indicatestheCa

2+

bind

ingresidu

es.



and GP2 seem to be involved in either the extracellularmatrix, proteinproduction, energy metabolism, or digestive vesicle secretion.Interestingly, global gene analyses of cnidarian-dinoflagellate symbi-osis from random cDNA clones using expression sequence tag analysis(Kuo et al., 2004) and cDNA microarray (Rodriguez-Lanetty et al.,2006) suggested that genes related to protein synthesis areupregulated in host containing symbionts; in contrast, genes relatedto cell signaling and communication were downregulated in symbi-osis. Because in this study the isolated transcript contained anincomplete coding sequence, the physiological function of the isolatedtranscript should be further investigated.

Multiple sequence alignment andphylogenetic analysis for apNPC2(Figs. 3 and 4) strongly suggest that the symbiotic-related transcript inA. pulchella is an NPC2 homologue. Rescue of NPC2mutated fibroblastswith recombinant NPC2 protein reduced lysosomal accumulation oflowdensity lipoprotein-derived cholesterol (Naureckiene et al., 2000).A loss-of-function study showed the cellular accumulation of lipids,including cholesterol, phospholipids, gangliosides, and neural glyco-lipids (Sleat et al., 2004). A second gene, NPC1, encodes a transmem-brane late endosomal protein, and mutations in this gene account for95% of NPC disease patients. NPC1 functions in the delivery oflysosomal cholesterol to the endoplasmic reticulum and to the plasmamembrane (Ory, 2000). Using isolated late endosome to investigatethe relationship betweenNPC1 andNPC2, researchers found that NPC2transiently resided in the late endosome, and late endosome withmutated NPC1 recruited larger amounts of Rab7 GTPase compared tolate endosome with wild type NPC1; moreover, late endosome withmutated NPC1 contained an abnormally glycosylated form of NPC2,and the solubility and localization of NPC2 were altered (Chen et al.,2005a). The delivery of endocytosed material takes place from earlyendosome to late endosome, and then it fuses to lysosomes or is routedto the trans Golgi network (Luzio et al., 2000). Rab GTPases regulatevesicular transport in endocytosis and exocytosis; for example, Rab5mediates endocytotic internalization and early endosome fusion, Rab7is present on late endosome and on lysosomes, and Rab11 functions inthe recycling compartment in Golgi and recycling endosomes (Jordenset al., 2005; Somsel Rodman andWandinger-Ness, 2000). Interesting-ly, Rab5 has been shown to maintain active symbiosome retention(Chen et al., 2004), Rab7 is excluded from symbiosomes containingalgal symbionts (Chen et al., 2003), and Rab11 functions in symbio-somematuration (Chen et al., 2005b). It is possible that dinoflagellatesin symbiosomes are functionally lost and that apNPC2 regulates thefusion of the symbiosome to the lysosome for symbiont degradation. Italso is possible that lipid metabolism is heavily utilized duringendosymbiotic associations while apNPC2 functions in lipid transport.

The full-length cDNAwas completed for the apEF transcript, but nohomologue on the N-terminal was found. A novel EF-hand homo-logue, CnidEF, from the sea anemone A. elegantissima, and found to beclose to apEF, has been isolated and characterized by Hauck et al.(Hauck et al., 2007). Predicted structure and folding analysissuggested that CnidEF is related to other cnidarian bioluminescentproteins, but its function remains unclear. Similar analyses for apEFrevealed that a close match for the predicted structure is yeast myosinlight chain Mlc1p, which interacts with class V myosin Myo2p tomediate vesicle polarization processes during cytokinesis (Stevensand Davis, 1998; Wagner et al., 2002). More than 200 EF-handproteins have been classified into 45 distinct subfamilies, and theyserve as Ca2+ sensors and buffers in eukaryotes (Kawasaki et al.,1998). The cellular function of apEF, however, remains unclear andrequires further study.

Acknowledgements

This work was supported by intramural funding from the NationalMuseum of Marine Biology and Aquarium and DaYeh University(ORD-9331). [SS]

References

Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignmentsearch tool. J. Mol. Biol. 215, 403–410.

Andersen, G.R., Nissen, P., Nyborg, J., 2003. Elongation factors in protein biosynthesis.Trends Biochem. Sci. 28, 434–441.

Battery, J.F., 1992. Carbon metabolism in zooxanthellae-coelenterate symbioses. In:Reisser, W. (Ed.), Algae and Symbioses. Biopress Limited, pp. 153–187.

Chen, M.C., Cheng, Y.M., Sung, P.J., Kuo, C.E., Fang, L.S., 2003. Molecular identification ofRab7 (ApRab7) in Aiptasia pulchella and its exclusion from phagosomes harboringzooxanthellae. Biochem. Biophys. Res. Commun. 308, 586–595.

Chen, M.C., Cheng, Y.M., Hong, M.C., Fang, L.S., 2004. Molecular cloning of Rab5(ApRab5) in Aiptasia pulchella and its retention in phagosomes harboring livezooxanthellae. Biochem. Biophys. Res. Commun. 324, 1024–1033.

Chen, F.W., Gordon, R.E., Ioannou, Y.A., 2005a. NPC1 late endosomes contain elevatedlevels of non-esterified (‘free’) fatty acids and an abnormally glycosylated form ofthe NPC2 protein. Biochem. J. 390, 549–561.

Chen, M.C., Hong, M.C., Huang, Y.S., Liu, M.C., Cheng, Y.M., Fang, L.S., 2005b. ApRab11, acnidarian homologue of the recycling regulatory protein Rab11, is involved in theestablishment and maintenance of the Aiptasia-Symbiodinium endosymbiosis.Biochem. Biophys. Res. Commun. 338, 1607–1616.

Chikh, K., Vey, S., Simonot, C., Vanier, M.T., Millat, G., 2004. Niemann-Pick type Cdisease: importance of N-glycosylation sites for function and cellular location of theNPC2 protein. Mol. Genet. Metab. 83, 220–230.

Diatchenko, L., Lau, Y.F., Campbell, A.P., Chenchik, A., Moqadam, F., Huang, B., Lukyanov, S.,Lukyanov, K., Gurskaya, N., Sverdlov, E.D., Siebert, P.D., 1996. Suppression subtractivehybridization: amethod for generatingdifferentially regulatedor tissue-specific cDNAprobes and libraries. Proc. Natl. Acad. Sci. U. S. A. 93, 6025–6030.

Fichard, A., Kleman, J.P., Ruggiero, F., 1995. Another look at collagen V and XI molecules.Matrix Biol. 14, 515–531.

Fontanesi, F., Soto, I.C., Barrientos, A., 2008. Cytochrome c oxidase biogenesis: newlevels of regulation. IUBMB Life 60, 557–568.

Fukuoka, S., Freedman, S.D., Scheele, G.A., 1991. A single gene encodes membrane-bound and free forms of GP-2, the major glycoprotein in pancreatic secretory(zymogen) granule membranes. Proc. Natl. Acad. Sci. U. S. A. 88, 2898–2902.

Goebel, W., Gross, R., 2001. Intracellular survival strategies of mutualistic and parasiticprokaryotes. Trends Microbiol. 9, 267–273.

Harwood, R., Grant, M.E., Jackson, D.S., 1975. Studies on the glycosylation ofhydroxylysine residues during collagen biosynthesis and the subcellular localiza-tion of collagen galactosyltransferase and collagen glucosyltransferase in tendonand cartilage cells. Biochem. J. 152, 291–302.

Hauck, L.L., Phillips, W.S., Weis, V.M., 2007. Characterization of a novel EF-handhomologue, CnidEF, in the sea anemone Anthopleura elegantissima. Comp. Biochem.Physiol. B Biochem. Mol. Biol. 146, 551–559.

Hooper, L.V., Bry, L., Falk, P.G., Gordon, J.I., 1998. Host-microbial symbiosis in themammalian intestine: exploring an internal ecosystem. Bioessays 20, 336–343.

Hoops, T.C., Rindler, M.J., 1991. Isolation of the cDNA encoding glycoprotein-2 (GP-2),the major zymogen granule membrane protein. Homology to uromodulin/Tamm-Horsfall protein. J. Biol. Chem. 266, 4257–4263.

Horton, P., Park, K.J., Obayashi, T., Fujita, N., Harada, H., Adams-Collier, C.J., Nakai, K.,2007. WoLF PSORT: protein localization predictor. Nucleic Acids Res. 35,W585–W587.

Inohara, N., Nunez, G., 2002. ML — a conserved domain involved in innate immunityand lipid metabolism. Trends Biochem. Sci. 27, 219–221.

Jordens, I., Marsman, M., Kuijl, C., Neefjes, J., 2005. Rab proteins, connecting transportand vesicle fusion. Traffic 6, 1070–1077.

Kawasaki, H., Nakayama, S., Kretsinger, R.H., 1998. Classification and evolution of EF-hand proteins. Biometals 11, 277–295.

Ko, D.C., Binkley, J., Sidow, A., Scott, M.P., 2003. The integrity of a cholesterol-bindingpocket in Niemann-Pick C2 protein is necessary to control lysosome cholesterollevels. Proc. Natl. Acad. Sci. U. S. A. 100, 2518–2525.

Kuo, J., Chen, M.C., Lin, C.H., Fang, L.S., 2004. Comparative gene expression in thesymbiotic and aposymbiotic Aiptasia pulchella by expressed sequence tag analysis.Biochem. Biophys. Res. Commun. 318, 176–186.

Larsen, L.B., Ravn, P., Boisen, A., Berglund, L., Petersen, T.E., 1997. Primary structure ofEPV20, a secretory glycoprotein containing a previously uncharacterized type ofdomain. Eur. J. Biochem. 243, 437–441.

Liou, H.L., Dixit, S.S., Xu, S., Tint, G.S., Stock, A.M., Lobel, P., 2006. NPC2, the proteindeficient in Niemann-Pick C2 disease, consists of multiple glycoforms that bind avariety of sterols. J. Biol. Chem. 281, 36,710–36,723.

Luzio, J.P., Rous, B.A., Bright, N.A., Pryor, P.R., Mullock, B.M., Piper, R.C., 2000. Lysosome–endosome fusion and lysosome biogenesis. J. Cell Sci. 113 (Pt 9), 1515–1524.

Marchler-Bauer, A., Bryant, S.H., 2004. CD-Search: protein domain annotations on thefly. Nucleic Acids Res. 32, W327–W331.

Marchler-Bauer, A., Anderson, J.B., Cherukuri, P.F., DeWeese-Scott, C., Geer, L.Y., Gwadz,M., He, S., Hurwitz, D.I., Jackson, J.D., Ke, Z., Lanczycki, C.J., Liebert, C.A., Liu, C., Lu, F.,Marchler, G.H., Mullokandov, M., Shoemaker, B.A., Simonyan, V., Song, J.S.,Thiessen, P.A., Yamashita, R.A., Yin, J.J., Zhang, D., Bryant, S.H., 2005. CDD: aConserved Domain Database for protein classification. Nucleic Acids Res. 33,D192–D196.

McFall-Ngai, M.J., Ruby, E.G., 2000. Developmental biology in marine invertebratesymbioses. Curr. Opin. Microbiol. 3, 603–607.

McGuffin, L.J., Jones, D.T., 2003. Improvement of the GenTHREADER method forgenomic fold recognition. Bioinformatics 19, 874–881.

McGuffin, L.J., Bryson, K., Jones, D.T., 2000. The PSIPRED protein structure predictionserver. Bioinformatics 16, 404–405.



Muller-Parker, G., D'Elia, C.F., 1997. Interactions between corals and their symbiotic algae.In: Birkeland, C. (Ed.), Life and Death of Coral Reefs. Chapman & Hall, pp. 96–113.

Naureckiene, S., Sleat, D.E., Lackland, H., Fensom, A., Vanier, M.T., Wattiaux, R., Jadot, M.,Lobel, P., 2000. Identification of HE1 as the second gene of Niemann-Pick C disease.Science 290, 2298–2301.

Ory, D.S., 2000. Niemann-Pick type C: a disorder of cellular cholesterol trafficking.Biochim. Biophys. Acta 1529, 331–339.

Reynolds, W.S., Schwarz, J.A., Weis, V.M., 2000. Symbiosis-enhanced gene expression incnidarian-algal associations: cloning and characterization of a cDNA, sym32,encoding a possible cell adhesion protein. Comp. Biochem. Physiol. A Mol. Integr.Physiol. 126, 33–44.

Rodriguez-Lanetty, M., Phillips, W.S., Weis, V.M., 2006. Transcriptome analysis of acnidarian-dinoflagellate mutualism reveals complex modulation of host geneexpression. BMC Genomics 7, 23.

Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstruct-ing phylogenetic trees. Mol. Biol. Evol. 4, 406–425.

Sleat, D.E., Wiseman, J.A., El-Banna, M., Price, S.M., Verot, L., Shen, M.M., Tint, G.S.,Vanier, M.T., Walkley, S.U., Lobel, P., 2004. Genetic evidence for nonredundantfunctional cooperativity between NPC1 and NPC2 in lipid transport. Proc. Natl.Acad. Sci. U. S. A. 101, 5886–5891.

Somsel Rodman, J., Wandinger-Ness, A., 2000. Rab GTPases coordinate endocytosis. J.Cell Sci. 113 (Pt 2), 183–192.

Spaink, H.P., 2000. Root nodulation and infection factors produced by rhizobial bacteria.Annu. Rev. Microbiol. 54, 257–288.

Stevens, R.C., Davis, T.N., 1998. Mlc1p is a light chain for the unconventional myosinMyo2p in Saccharomyces cerevisiae. J. Cell Biol. 142, 711–722.

Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular EvolutionaryGenetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599.

van der Rest, M., Garrone, R., 1991. Collagen family of proteins. FASEB J. 5, 2814–2823.Vanier, M.T., Millat, G., 2004. Structure and function of the NPC2 protein. Biochim.

Biophys. Acta 1685, 14–21.Wagner, W., Bielli, P., Wacha, S., Ragnini-Wilson, A., 2002. Mlc1p promotes septum

closure during cytokinesis via the IQmotifs of the vesicle motor Myo2p. EMBO J. 21,6397–6408.

Weis, V.M., Levine, R., 1996. Differential protein profiles reflect the different lifestyles ofsymbiotic and aposymbiotic Anthopleura elegantissima, a sea anemone fromtemperate waters. J. Exp. Biol. 199, 883–892.

Weis, V.M., Reynolds, W.S., 1999. Carbonic anhydrase expression and synthesis in thesea anemone Anthopleura elegantissima are enhanced by the presence ofdinoflagellate symbionts. Physiol. Biochem. Zool. 72, 307–316.


Suppression subtractive hybridization identifies genes correlated to symbiotic and

Documents

Transcript of Suppression subtractive hybridization identifies genes correlated to symbiotic and