Specialization of CDC27 function in the Arabidopsis thalianaanaphase-promoting complex (APC/C)

Jose M. Perez-Perez1,†, Olivier Serralbo1,‡, Marleen Vanstraelen2, Cristina Gonzalez1, Marie-Claire Criqui3, Pascal Genschik3,

Eva Kondorosi2 and Ben Scheres1,*

1Department of Molecular Genetics, Utrecht University, Padualaan 8, 3584 CH, Utrecht, The Netherlands,2Institut des Sciences du Vegetal, Centre National de la Recherche Scientifique, Unite Propre de Recherche 2355, Avenue de la

Terrasse, 91198 Gif-sur-Yvette, France, and3Institut de Biologie Moleculaire des Plantes du CNRS, 12, rue du General Zimmer, 67084 Strasbourg cedex, France

Received 4 July 2007; revised 24 August 2007; accepted 29 August 2007.*For correspondence (fax +31 0 30 253 2837; e-mail b.scheres@uu.nl).†Current address: Division de Genetica and Instituto de Bioingenierıa, Universidad Miguel Hernandez, Edificio Vinalopo, Avda. de la Universidad s/n,

03202 Elche (Alicante), Spain.‡Current address: Laboratoire de Genetique et de Physiologie du Developpement (LGPD), Developmental Biology Institute of Marseille (IBDM),

CNRS UMR6545, University Aix-Marseille II, 13288 Marseille cedex 09, France.

Summary

To investigate the specialization of the two Arabidopsis CDC27 subunits in the anaphase-promoting complex

(APC/C), we analyzed novel alleles of HBT/CDC27B and CDC27A, and characterized the expression of

complementing HOBBIT (HBT) protein fusions in plant meristems and during the cell cycle. In contrast to other

APC/C mutants, which are gametophytic lethal, phenotypes of weak and null hbt alleles indicate a primary role

in the control of post-embryonic cell division and cell elongation, whereas cdc27a nulls are phenotypically

indistinguishable from the wild type. However, cdc27a hbt double-mutant gametes are non-viable, indicating a

redundant requirement for both CDC27 subunits during gametogenesis. Yeast-two-hybrid and pulldown

studies with APC/C components suggest that the two Arabidopsis CDC27 subunits participate in several

complexes that are differentially required during plant development. Loss-of-function analysis, as well as

cyclin B reporter protein accumulation, indicates a conserved role for the plant APC/C in controlling mitotic

progression and cell differentiation during the entire life cycle.

Keywords: HOBBIT, cyclosome, root development, cell cycle, checkpoint.

Introduction

New cells for plant growth are continuously provided by

meristems, which contain mitotically active cells derived

from small stem cell populations (Weigel and Jurgens,

2002). A pivotal question is how cell division and patterning

are coordinated during organ growth (Jakoby and Schnitt-

ger, 2004). In the Arabidopsis root meristem (RM), the qui-

escent center (QC) maintains surrounding stem cells (van

den Berg et al., 1997). QC and stem cell specification

requires a combination of AP2-domain and GRAS tran-

scription factors (Aida et al., 2004; Di Laurenzio et al., 1996;

Heidstra et al., 2004; Helariutta et al., 2000; Sabatini et al.,

2003). Crosstalk between stem cell specification factors with

cell cycle and cell differentiation has been recently reported:

reduction of RETINOBLASTOMA-RELATED1 (RBR1) activity

in the RM increases the size of the stem cell pool

downstream of the SCARECROW patterning gene

(Wildwater et al., 2005). Although RBR1 and other members

of the G1/S checkpoint are beginning to be connected with

meristem maintenance factors (Dewitte et al., 2003;

Wyrzykowska et al., 2006), crosstalk is less obvious for other

cell cycle phases.

The anaphase-promoting complex (APC/C) is a multisub-

unit ubiquitin ligase that has a crucial role in cell cycle

progression and mitotic exit by inducing the proteolysis of

several cell cycle regulators, including mitotic cyclins.

Activation and substrate specificity of the APC/C during the

cell cycle are determined by two adaptor WD40-containing

activators: Cdc20/Fizzy and Cdh1/Fizzy-related (Castro et al.,

2005; Clute and Pines, 1999; Harper et al., 2002; Peters,

2002). All vertebrate APC/C subunits, Fizzy and Fizzy-related

ª 2007 The Authors 1Journal compilation ª 2007 Blackwell Publishing Ltd

The Plant Journal (2007) doi: 10.1111/j.1365-313X.2007.03312.x

proteins have counterparts in plants (Capron et al., 2003a;

Cebolla et al., 1999; Fulop et al., 2005; Tarayre et al., 2004).

Arabidopsis apc2 and nomega/cdc16 null mutants are

impaired in female gametogenesis and accumulate A- and

B-type cyclin reporter proteins, supporting an essential role

of the APC/C complex for cell division control during early

plant development (Capron et al., 2003b; Kwee and Sundar-

esan, 2003).

The HOBBIT (HBT) gene is required for post-embryonic

cell division and for the differentiation of distal tissues in the

root, and encodes an Arabidopsis homologue of the CDC27

subunit of the APC/C (Blilou et al., 2002; Willemsen et al.,

1998). HBT is unique among Arabidopsis core APC/C

encoding genes: (i) it is the only gene in which transcription

is cell cycle regulated (Blilou et al., 2002; Capron et al.,

2003b; Fulop et al., 2005); (ii) its function is required

predominantly post-embryonically for cell division and cell

differentiation (Blilou et al., 2002; Willemsen et al., 1998);

and (iii) a homologous gene, CDC27A, resides in the

Arabidopsis genome (Capron et al., 2003a). These observa-

tions lead us to pose the question of whether CDC27

proteins have specialized roles during plant development.

To address specialization of the two CDC27 homologues

we studied new hobbit (hbt) and cdc27a alleles, and the

expression of complementing HBT protein fusions. Further-

more, we demonstrate that HBT can bind to different APC/C

activators and show in vivo interactions of HBT and CDC27A

with APC2, a core component of the plant APC/C complex.

Our results reveal both redundancy and functional diver-

gence between CDC27A and HBT in Arabidopsis APC/C

function during different stages of development, and

indicate that different APC/C complexes have specialized

functions.

Results

Strong HOBBIT (CDC27B) and CDC27A alleles reveal

different functions during development

We screened available mutant collections to identify novel

loss-of-function alleles of the two Arabidopsis CDC27 genes:

CDC27A and HBT/CDC27B.

The hbt-11 allele obtained from the SIGNAL collection

(Alonso et al., 2003) carries a single T-DNA insertion in the

first intron of the HBT gene, 399-bp downstream of the HBT

(At2g20000) initiation codon (Figure 1a; Table 1). hbt-11

heterozygous plants appear as wild type (WT), and a quarter

of their progeny showed the strong phenotype described

(a)

(b) (c) (d)

(e)

(f) (g)

Figure 1. Isolation of novel HBT and CDC27

alleles.

(a) Diagram of HBT and CDC27A genomic

regions and molecular defects of the alleles used

(see Experimental procedures). Full boxes repre-

sent exons, open reading frames are depicted in

red with TRP domains in blue.

(b) Progeny of HBT/hbt-11 plants.

(c) Aniline blue staining of wild-type (WT) and

hbt-11 roots in mature embryos.

(d) RT-PCR using HBT and CDC27A specific

oligos. A and B represent CDC27A and HBT/

CDC27B WT alleles, whereas a and b represent

their mutant alleles. Amplification of the EF1agene was used as a reference.

(e, f) Genetic interaction between cdc27a and

hbt-1 during gamete development.

(e) Opened siliques with the arrowheads point-

ing to the aborted ovules.

(f) Microscopic magnification of the aborted

ovule from the inset with immature nuclei indi-

cated with asterisks.

(g) Genetic interaction hypothesis between

cdc27a and hbt-1. Same notation as in (d).

Presumptive gametic lethality is indicated by

the blue background. hbt homozygotes are

depicted in red. Scale bars: 2 mm (b, e) and

25 lm (c, f).

2 Jose M. Perez-Perez et al.

ª 2007 The AuthorsJournal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), doi: 10.1111/j.1365-313X.2007.03312.x

previously (Willemsen et al., 1998; Figure 1b; Table 1). RMs

in mature hbt-11 embryos have aberrant cell numbers, cell

morphology and irregular cell arrangements (Figure 1c).

Genotyping for the T-DNA insertion in the progeny of

hbts021513 heterozygotes with a WT phenotype suggests a

slight decrease in the transmission of the mutant allele

through the gametes (Table 1a), which was previously

observed in other strong hbt alleles (Willemsen et al.,

1998; V. Willemsen and B.S., unpubl. data). RT-PCR using

total RNA reveals a strong reduction of HBT expression in

hbt-11 homozygotes, but the upregulation in heterozygotes

might suggest compensatory regulation (Figure 1d). The

CDC27A transcript is upregulated in hbt-11 homozygotes,

and whether this is also a compensation effect is not clear.

Previously described hbt2311 mutants, encoding an HBT

protein lacking seven of the 10 TPR domains (Blilou et al.,

2002), have been renamed as hbt-1. hbt-1 and hbt-11

homozygotes are phenotypically indistinguishable, and

HBT expression is highly downregulated in hbt-11/hbt-11.

Thus, both alleles are likely to be null, indicating that HBT is

not essential for gametophytic development, in contrast

to core APC/C subunits (Capron et al., 2003b; Kwee and

Sundaresan, 2003).

Three T-DNA insertional mutants in CDC27A (At3g16320;

see Experimental procedures), cdc27a-1, cdc27a-2 and

cdc27a-3, disrupt the predicted coding region at 1028, 3024

and 3721 bp in the genomic DNA and downstream of the

initiation codon, respectively (Figure 1a). Homozygotes for

all of these alleles were indistinguishable from the WT in our

experimental conditions (Table 1a and data not shown).

CDC27A expression is strongly reduced in the cdc27a

homozygotes, suggesting that they are nulls (Figure 1d

and data not shown). To rule out subtle gametophytic

defects of the cdc27a-1 heterozygotes, the progenies of their

Table 1 Analysis of CDC27 alleles and theirinteractions. (a) Genetic analysis andtransmission of the novel cdc27a and hbtalleles. (b) Interaction between cdc27a andhbt-1 alleles during gametogenesis.Between 10 and 15 siliques from the maininflorescence stem of 5-week-old plantswere manually dissected and scoredfor aborted ovules. Data representaverages � SD. (c) Genetic interactionbetween cdc27a and hbt-1 alleles afterembryogenesis.

Female · Male

Genotype

TEaP value(hypothesis)bAA Aa aa

(a)HBT/hbt-11 selfed 133 240 106c 47.2 0.2176 (1:2:1)CDC27A/cdc27a-1 selfed 48 103 32 45.6 0.0581 (1:2:1)CDC27A/cdc27a-1 · WT 31 21 0 40.4 0.1659 (1:1)WT · CDC27A/cdc27a-1 21 14 0 40.0 0.2367 (1:1)

aTE, transmission efficiency of the mutant allele = number of mutant alleles/number of totalalleles, as determined by PCR.bTwo-tailed P-values represent the fit of the data to the expected 1:2:1 (AA:Aa:aa) or 1:1 (AA:Aa)segregations.cThe Hbt phenotype was genotyped for the hbt allele by pooling.

Genotype of the F1 parents Seeds per siliqueAborted ovulesper silique P-valuea

(b)CDC27A/CDC27A; HBT/HBT 46.3 � 5.0 1.8 � 0.8 0.0007CDC27A/CDC27A; HBT/hbt-1 45.2 � 6.2 2.1 � 1.9 0.0011CDC27A/cdc27a141413;HBT/HBT 42.0 � 6.3 1.3 � 1.3 0.0008CDC27A/cdc27a059166;HBT/HBT 44.7 � 6.7 1.2 � 1.9 0.0005CDC27A/cdc27a141413;HBT/hbt-1 30.8 � 7.5 12.8 � 3.4 0.5071CDC27A/cdc27a059166;HBT/hbt-1 33.2 � 2.9 10.9 � 3.1 1.0000

aTwo-tailed P values represent the fit of the data to an expected segregation of 3:1 wild type(WT) : aborted.

Genotype of the F1 parents WT HBT

P valuea

5:1 8:1

(c)CDC27A/cdc27a141413;HBT/hbt-1 162 18 0.0164 0.6315CDC27A/cdc27a059166;HBT/hbt-1 140 16 0.0316 0.7290

aTwo-tailed P values represent the fit of the data to expected segregations of 5:1 wild type(WT):HBT (if only the double mutant female gametes are lethal) or 8:1 WT:HBT (when both doublemutant gametes are lethal). The statistically significant P values are given in italics.

Functional characterization of plant CDC27s 3

ª 2007 The AuthorsJournal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), doi: 10.1111/j.1365-313X.2007.03312.x

crosses with WT were genotyped for the T-DNA insertion

(Table 1a). Similar results were obtained from crosses using

cdc27a-2 and cdc27a-3 heterozygotes (data not shown). Our

results indicate that gametic transmission of the cdc27a

alleles is 20% reduced (Table 1a).

As homozygotes for null mutations in single-copy subun-

its of the Arabidopsis APC/C display lethality, resulting from

an early arrest in cell division during gametogenesis (Capron

et al., 2003b; Kwee and Sundaresan, 2003), we wondered

whether HBT and CDC27A play redundant roles during

gametogenesis. Although the number of aborted ovules in

either CDC27A/cdc27a or HBT/hbt-1 siliques was not signi-

ficantly different from those found in the WT (Figure 1e;

Table 1b), 25% of the ovules from CDC27A/cdc27a;HBT/hbt-

1 plants are arrested in their growth (Figure 1e,f; Table 1b),

which is consistent with full lethality of the cdc27a hbt-1

female gametes. Arrested female gametophytes always

(n = 14) display fewer than eight nuclei (Figure 1f, asterisks),

indicating a reduction of the three mitotic division rounds

that occur in the WT. Both the segregation for hbt-1

seedlings (Table 1c), and the genotyping for the mutant

alleles (see Experimental procedures) in the viable progeny

of several CDC27A/cdc27a;HBT/hbt-1 double heterozygotes,

confirms the synergistic and lethal phenotype of the cdc27a

hbt-1 double mutants during female gametophyte develop-

ment (Figure 1g). Two additional evidences suggest that

male gametes are also affected by the reduction of CDC27

function. First, the proportion of cdc27a/cdc27a;HBT/hbt F2

plants was much lower than that expected considering

cdc27a;hbt gametes are fully viable (1/43 vs. 1/10,

P = 0.0937), and second, frequencies for CDC27A alleles

were biased towards the WT one (0.75 and 0.25 for CDC27A

and cdc27a alleles, respectively).

Taken together, our results reveal redundant roles

for HOBBIT and CDC27A genes during gametophyte devel-

opment, and a specialized role for HBT in post-embryonic

growth and cell division.

Hypomorphic hobbit alleles specifically affect

cell division and cell expansion

Previously described hbt mutant alleles affect maintenance

of cell specification, responses to the phytohormone auxin,

cell division and cell size (Blilou et al., 2002; Willemsen et al.,

1998). Analysis of hbt loss-of-function clones indicated that

changes in auxin response were not primary defects

(Serralbo et al., 2006). To further distinguish between

primary and secondary defects, we analyzed hypomorphs to

identify the processes most sensitive to HBT reduction. We

identifed weak recessive alleles from a collection of Ara-

bidopsis TILLING lines (Till et al., 2003; Figure 1a). hbt-12

and hbt-13 carry missense mutations in the central domain

of the HBT protein, between the first and the second TPR

domains (Figure 1a; see Experimental procedures). hbt-12

and hbt-13 homozygotes are phenotypically similar dwarfs

with small leaves and stunted growth (Figure 2a), and hbt-12

was further characterized. hbt-12 roots are significantly

shorter compared with the WT but continue to grow (data

not shown). The hbt-12 RM is smaller than in WT

(Figure 2b,c) and contains fewer cells (Figure 2d, top graph)

of normal size (Table 2). Columella stem cells are present

(Figure 2c, asterisk), but the one or two remaining tiers of

differentiated columella cells in hbt-12 are significantly

smaller than in WT (Figure 2d, middle graph; Table 2). hbt-

12 homozygotes have a smaller elongation zone (EZ) com-

pared with WT, as indicated by the location of maximally

expanded cells, and the onset of xylem and epidermal cell

differentiation (arrowhead in Figure 2c). Length of differen-

tiated epidermal cells along the main plant axis decreases

2.1-fold in hbt-12 mutants compared with WT (Figure 2d,

(a) (b) (c) (d)

(e)

Figure 2. Analysis of hypomorphic hbt alleles.

(a) Wild-type (WT) (top) and hbt-12 (bottom)

mature plants. Details of (b) WT and (c) hbt-12

roots: an arrowhead points to the first epidermal

differentiated cell, and an asterisk marks the

quiescent center.

(d) Meristem size and lengths (in lm) of the

differentiated epidermal and columella cells.

NoC: number of cortex cells in the meristem.

All measurements were taken 7 days after sow-

ing (7 das).

(e) Ploidy analysis of sorted nuclei from root tips

(WT, hbt-12). Pictures were taken 7 das for

seedlings and 28 das for mature plants and

siliques. See Experimental procedures for ploidy

and imaging analyses. Scale bars: 10 mm (a) and

25 lm (b).

4 Jose M. Perez-Perez et al.

ª 2007 The AuthorsJournal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), doi: 10.1111/j.1365-313X.2007.03312.x

bottom graph; Table 2), whereas mature root hair length is

not significantly altered (Figure 2c and data not shown).

Ploidy analyses on sorted nuclei from hbt-12 roots (Fig-

ure 2e) show a 3.6 � 2.1% reduction of 2C and a 10.0 � 2.1%

increase of 4C cells, suggesting either over-representation of

G2 cells during division or defective endoreduplication.

Interestingly, the proportion of nuclei with high ploidy levels

(8C and 16C) is reduced by 13.6 � 4.1%, which also indicates

defects during endoreduplication.

Taken together, our data indicate that the HBT reduction

primarily affects cell division and cell expansion in all plant

organs.

HOBBIT protein fusions localize to dividing and

elongating cells

HBT gene transcription is cell cycle regulated, unlike other

genes encoding APC/C subunits (Blilou et al., 2002; Fulop

et al., 2005), which prompted us to study its protein

accumulation. An HBTg-GUS protein fusion was used to

survey HBT expression in different tissues. Low HBT

expression was found in unfertilized ovules, although their

low levels preclude accurate localization (Figure 3a). In

young embryos, up to the globular stage, HBTg-GUS is

restricted to proliferative tissues of the chalazal bulb

(Figure 3b, inset). From the heart stage (Figure 3b) to the

early torpedo stage, HBTg-GUS is expressed ubiquitously,

but at later stages of embryogenesis it becomes restricted

to the shoot and root primordia, and variable cell patches

in cotyledons and hypocotyl (Figure 3c), consistent with

cell cycle control of HBT transcription. After germination,

HBTg-GUS localizes to dividing cells within the RM (Fig-

ure 3d), lateral root primordia (Figure 3e,e¢), leaf primordia

at the shoot apical meristem (Figure 3f) and flower pri-

mordia (Figure 3g and inset). In roots, HBTg-GUS is ex-

cluded from the differentiation zone (DZ) and

differentiated columella cells, and it accumulates in the QC

and columella stem cells at lower levels than that of the

meristem cells (Figure 3d and inset). In lateral root pri-

mordia, HBTg-GUS is expressed from stage III onwards

(Figure 3e,e¢) when periclinal divisions occur (Casimiro

et al., 2003). HBTg-GUS is absent in adult leaves (data not

shown) and mature flowers (Figure 3g), consistent with its

exclusion from differentiated tissues. Our data reveal a

strong correlation between mitotically active cells and

HBTg-GUS expression.

The HBTg-GFP protein completely rescues hbt-1

mutants, allowing detailed localization studies. HBTg-GFP

is, in contrast to HBT transcript, homogeneously distrib-

uted in the RM (Figure 3h). Similar to HBTg-GUS, HBTg-

GFP levels are significantly reduced in the differentiated

columella (Figure 3i, col), lateral root cap (Figure 3i¢, lrc)

and epidermal cells (Figure 3j). High HBT protein levels in

mitotically active cells gradually decrease when cells

cease division and pass through the EZ (Figure 3h).

Treatment of HBTg-GFP plants with the proteasome

inhibitor MG132, which blocks the 26S proteasome-med-

iated degradation of ubiquitin-targeted proteins (Callis and

Vierstra, 2000), elevates HBTg-GFP levels in epidermal

cells at EZ and DZ in the presence of the protein

biosynthesis inhibitor cycloheximide (Figure 3k). As

RT-PCR did not reveal differences in HBT mRNA levels

by this treatment (data not shown), the HBTg-GFP

increase appears to be the result of increased protein

stability. Our results indicate that athough HBT transcript

is only produced in dividing cells (Blilou et al., 2002),

proteolytic degradation regulates HBT and its persistence

in expanding cells.

During the interphase (Figure 3m) HBTg-GFP localizes

mainly to the nucleus (nu), and is excluded from the

nucleolus (nl; see Figure 3l for nuclear structure). At the

prophase (Figure 3n) HBTg-GFP associates with the pro-

phase spindle, and weakly stains the pre-prophase band

region (arrowheads in Figure 3n). After nuclear membrane

disintegration at the metaphase HBTg-GFP localization is

diffuse within the cell (Figure 30), and during the

anaphase the protein is particularly concentrated at the

mitotic spindle (Figure 3p). In the early telophase, HBTg-

GFP becomes restricted to the newly formed nuclei

(asterisks in Figure 3q) and to the cell plate (Figure 3q),

and during the late telophase its signal is again restricted

to the nucleus (asterisks in Figure 3r). The prominent

co-localization of HBTg-GFP with the mitotic spindle

contrasts with the lack of detectable spindle signal with

Table 2 Root morphometry of weak hbtalleles Wild type hbt-12

Number of meristematic cells 25.9 � 3.7 (12) 13.5 � 1.7 (15)Cell length in the root meristem (lm) 7.5 � 1.2 (170) 7.8 � 1.5 (108)Number of columella layers 5.1 � 0.2 (11) 3.4 � 0.5 (12)Cell length in distal columella (lm) 24.6 � 3.9 (18) 18.7 � 4.5 (20)Number of epidermal cells in the elongation zone 8.2 � 2.5 (14) 4.0 � 0.8 (10)Length of differentiated epidermal cells (lm) 130.4 � 22.5 (43) 55.2 � (65)

Measurements were taken from stored Nomarsky images of 7-day-old roots. The number ofsamples analyzed in each case is indicated between brackets.

Functional characterization of plant CDC27s 5

ª 2007 The AuthorsJournal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), doi: 10.1111/j.1365-313X.2007.03312.x

CDC27A antibodies in anaphase (Figure 3s; Capron et al.,

2003b).

Biochemical characterization of CDC27 subunits

of the APC/C complex

It has been established that APC/C activators form a complex

with CDC27A in Arabidopsis (Fulop et al., 2005). We assayed

whether HBT/CDC27B interacts with the Arabidopsis APC/C

activators by performing yeast two-hybrid assays with

Ccs52A1, Ccs52A2 and Ccs52B, and the five isoforms of

Cdc20 (Figure 4a).

The strongest binding of HBT occurs with Cdc20.1 and

Cdc20.2, followed by Ccs52A1, Ccs52B and Cdc20.5. Inter-

action of HBT with Cdc20.4 and Ccs52A2 is clear but

detectable only in the absence of the quantitative inhibitor

(see Experimental procedures). The interaction of HBT with

Cdc20.3 is at the background level. These results demon-

strate that HBT, similarly to CDC27A, is able to interact in

yeast with the APC/C activators with a preference for

Cdc20.1, Cdc20.2 and Ccs52A1.

Pairwise interactions with the APC/C activators do not

reveal whether HBT is included in the core APC/C complex.

In yeast two-hybrid assays both CDC27A and HBT interact

with APC10, suggesting their incorporation into the APC/C

complex (Figure 4b). CDC27 subunits can dimerize in other

eukaryotes (Passmore et al., 2005), which raised the possi-

bility for homo- and/or heterodimerization of CDC27A and

HBT. However, although HBT interacts with itself, neither

CDC27A homodimerization nor heterodimerization of

CDC27A with HBT was detected in yeast two-hybrid assays

(Figure 4b), indicating that the core Arabidopsis APC/C could

exist in two forms, one containing CDC27A and the other

containing HBT.

To substantiate the presence of distinct isoforms

in vivo, we used immunoaffinity purified antibodies

(a) (b) (c) (d)

(h) (i) (j)

(i´)

(m) (n) (o)

(p) (q) (r)

(k)

(e)

(f)

(g)

(l)

(s)

(e´)

Figure 3. HOBBIT (HBT) protein expression.

(a) HBTg-GUS protein fusion in the ovules.

(b, c) HBT is ubiquitously expressed during embryogenesis: (b) heart stage and (c) late torpedo stage (arrowheads point to meristem anlagens). Post-embryonically,

HBTg-GUS is expressed in the root meristem (d, inset shows stem cell area), lateral root primordia (e, stage III; e¢, stage VII), shoot apical meristem (f, asterisk),

young leaves (f) and flower primordia (g, bottom-right inset shows flower buds). HBTg-GFP (h–r) is expressed in meristematic cells (h) and is mostly absent from

columella (col, i) and lateral root (lrc, i¢) cap cells within the root tip. HBT-GFP is weakly expressed in epidermal differentiated cells (j) and becomes stabilized after

MG132 proteosome inhibitor treatment (k). (l) Detailed subcellular structure of an epidermal cell in which the nucleus (nu) and nucleolus (nl) are clearly

distinguishable. HBTg-GFP subcellular localization is dynamic during the cell cycle: (m) interphase, (n) prophase, (o) metaphase, (p) anaphase, (q) early telophase

and (r) cytokinesis. (s) aCDC27A (green), contrasted in the upper panel with a-tubulin (red), reveals the absence of CDC27A in the anaphase (third cell from left). Scale

bars: 10 lm (l–s), 25 lm (b–e¢ and h–k) and 100 lm (f, g).

6 Jose M. Perez-Perez et al.

ª 2007 The AuthorsJournal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), doi: 10.1111/j.1365-313X.2007.03312.x

against the Arabidopsis APC2 subunit (Capron et al.,

2003b) in order to pull down APC/C complexes from root

protein extracts (see Experimental procedures). APC2 and

APC11 are required to form the minimal ubiquitin-ligase

module of the human APC/C (Tang et al., 2001). Accord-

ingly, tagged versions of APC2 and APC11 co-immuno-

precipitate after their transient expression in Arabidopsis

protoplasts (Capron et al., 2003b).

We observed co-immunoprecipitation of functional he-

maglutinin (HA)-tagged HBT, as well as of CDC27A

(Figure 4c) with APC2, with the latter being detected with

a specific polyclonal antibody (Capron et al., 2003b).

Conversely, we detected APC2 protein in HA immunopre-

cipitates from protein extracts of pHBT::HA-HBT-express-

ing plants (Figure 4c), confirming the association between

APC2 and HA-HBT. However, we were unable to detect

CDC27A protein in HA-HBT immunoprecipitates (data not

shown).

Our results suggest the existence of separate HBT and

CDC27A APC/C isoforms in vivo, but at this point we cannot

exclude the possibility that HBT and CDC27A reside in the

same APC/C multimer in vivo if some epitopes are masked

in such a complex.

hbt mutants accumulate cyclin B-GUS reporter proteins

Because targeted degradation of cyclin B and securin are

major functions of the APC/C complex during the cell cycle

(Thornton and Toczyski, 2003), and because plants lack the

securin homologue (Capron et al., 2003a), we analyzed sta-

bilization of cyclin B reporters in hbt mutants to address

whether an HBT-containing APC/C complex served canoni-

cal roles. A constitutively expressed form of CycB1;1 from

tobacco fused to GUS (35S::NtCycB1;1-GUS) highly accu-

mulates in the hbt-1 (Figure 5b,c), but not in WT seedlings

(Figure 5a), mirroring the expression dynamics of the D-box

mutated NtCycB;1-GUS that is resistant to APC/C-mediated

degradation (Weingartner et al., 2004; data not shown). In

addition, pCycB1;1::D-boxCycB1;1-GUS, which marks cells

in the G2/M phase (Colon-Carmona et al., 1999; Figure 5d), is

ectopically expressed in hbt-1 hypocotyls and cotyledons

(Figure 5e), as well as highly expressed in embryos

(a) (c)

(b)

Figure 4. HOBBIT (HBT) protein interaction

studies.

(a) Interaction of the anaphase-promoting com-

plex (APC/C) activators with HBT in a yeast two-

hybrid assay. Autoactivation and repression of

autoactivation of yeast strains containing the

APC/C activators and the empty vector are pre-

sented on the left-hand control panel. Growth of

yeast strains was followed in a 10-fold dilution

series on selective medium in the absence of

3-AT as well as at 10 mM 3-amino-1,2,4-triazole

(3-AT) in the case of Ccs52A1 and Ccs52B.

Activator–HBT interactions are shown on the

right-hand panel, where yeast strains were

grown under identical conditions as the controls.

White numbers indicate the highest 3-AT con-

centrations in millimolar that still allow yeast

growth. (b) Yeast two-hybrid assay for CDC27A

and HBT interaction with APC10, and for homo-

and heterodimerization of CDC27A and HBT.

Experimental conditions are the same as in

Figure 4(a) except that interactions are shown

at 5 mM 3-AT. (c) Detection of hemaglutinin

(HA)-tagged HBT (HA-HBT) in protein extracts

using monoclonal mouse anti-HA antibodies.

APC2 detection in HA immunoprecipitates from

pHBT::HA-HBT-expressing plants. Immunopre-

cipitation of the APC/C complex using anti-

APC2 antibodies and detection of its association

with functional HA-HBT and CDC27A. I, input; –,

specific antibody not added.

Functional characterization of plant CDC27s 7

ª 2007 The AuthorsJournal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), doi: 10.1111/j.1365-313X.2007.03312.x

(Figure 5f,g). To exclude the possibility that the enhanced

CycB1;1-GUS levels reflected upregulation of B-type cyclin

gene expression in the hbt mutants, rather than protein

stabilization, transcript levels of CycB1;1 and other mitotic

cyclin genes were measured by real-time RT-PCR. Several

mitotic cyclin genes were downregulated rather than up-

regulated in the hbt-1 mutants (Figure 5h). Therefore, our

data indicate that hbt-1 seedlings are defective in targeted

proteolysis of mitotic cyclins, in line with HBT activity in a

canonical APC/C complex.

Discussion

The initial discovery that HBT/CDC27B encoded a potential

APC/C subunit left the question of how interference with the

function of the APC/C complex leads to specific embryonic

and post-embryonic developmental phenotypes open for

investigation (Blilou et al., 2002; Willemsen et al., 1998).

Recently, clonal analysis studies suggested that the primary

role of HBT was in cell division and cell expansion (Serralbo

et al., 2006). Here, we addressed the apparent discrepancy

between a canonical role for HBT as cell cycle regulator, and

the specific phenotypes, by examining the redundancy

between HBT/CDC27B and its homolog CDC27A. Whereas

CDC27A and core Arabidopsis APC/C subunits are constitu-

tively expressed (Blilou et al., 2002; Capron et al., 2003b;

Kwee and Sundaresan, 2003), we show that HBT/CDC27B

protein is restricted to mitotically active and elongating cells,

and is mostly excluded from differentiated tissues. Strong

hbt mutants impair meristematic cell division and cell

elongation post-embryonically, and cdc27a null mutants

display at most a very mild gametophytic transmission

defect in our experimental conditions. However, the double

mutant is synergistic, displaying a gametophytic lethal

phenotype. Our data suggest that both proteins are redun-

dantly required for the full APC/C function during cell cycle

progression, but that HBT/CDC27 is essential to drive cell

division-associated post-embryonic growth. In line with

specialized roles of different APC/C subunits, HBT protein

fusions, but not CDC27A antibodies, stain the mitotic spindle

at both the prophase and the anaphase, and we were unable

to detect complexes containing both CDC27 homologues

after immunoprecipitation with the core APC2 protein.

Complex roles for the plant APC/C

Cryo-electron microscopy and quantitative determination of

subunit stoichiometry of yeast APC/C complexes indicates

multiple copies of each TPR-containing protein (Cdc27,

Cdc23, Cdc16 and Apc5) (Passmore et al., 2005). However,

similar studies on vertebrate APC/C suggest that Cdc27 is

present in a single copy per complex (Dube et al., 2005). The

(a) (b) (d)

(c)

(e)

(f) (h)(g)

Figure 5. Cyclin B expression in hbt-1 mutants.

35S::NtCycB1;1-GUS expression in wild-type

(WT) roots (a) and hbt-1 (b, c) seedlings.

pCycB1;1::DBCycB1;1-GUS expression pattern

in young seedlings (d, WT; e, hbt-1) and embryos

(f, WT; g, hbt-1). (h) Real-time PCR quantization

of mitotic cyclin gene expression. Scale bars:

25 lm.

8 Jose M. Perez-Perez et al.

ª 2007 The AuthorsJournal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), doi: 10.1111/j.1365-313X.2007.03312.x

latter stoichiometry would be consistent with the formation

of CDC27-variant specific APC/C complexes in Arabidopsis,

but does not readily explain the ability of HBT to dimerize.

Therefore, isolation and subunit analysis will be required to

compare plant and non-plant APC/C complexes.

Recent results suggest that the three AtCcs52 activator

proteins specifically interact in vitro with different subset of

A- and B-type cyclins (Fulop et al., 2005), highlighting the

complexity of the G2/M transition in plants. Our findings that

CDC27A and HBT differentially interact with a subset of

activators indicate that the versatile control of degradation

through APC/C may not only be regulated by its activators,

but also by its subunit composition. Although apc2 nulls are

only impaired in female gametogenesis (Capron et al.,

2003b), nomega mutants defective in the CDC16 subunit of

the APC/C complex show both female and male gameto-

phyte transmission defects (Kwee and Sundaresan, 2003),

similar to cdc27a hbt (this study). Potential targets for such a

differential regulation are suggested by Arabidopsis tardy

asynchronous meiosis (tam) mutants, which carry a mis-

sense mutation in the CycA1;2 gene that reduces cell cycle

progression specifically during male meiosis (Wang et al.,

2004).

A primary role for HOBBIT in cell cycle control

Our analysis of weak alleles indicates that the primary HBT

function is to mediate cell division and endoreduplication,

which contributes to meristem activity and cell expansion.

Accordingly, post-embryonic removal of a single comple-

menting HBT gene between recombination sites affects cell

division and cell elongation, prior to other defects in auxin

response and cell differentiation (Serralbo et al., 2006).

These data are in line with canonical roles for APC/C

components, and suggest that effects on cell division

planes and maintenance of cell identity in strong alleles are

secondary consequences of cell division and cell expansion

defects.

hbt mutants were selected because of a defined embryo-

nic defect in RM founder cells, which at the time was taken to

indicate a primary role in cell specification (Willemsen et al.,

1998). Our findings indicate that cell cycle control is a

primary HBT function, which suggests that alterations in cell

cycle can interfere with cell fate determination in plants, for

example by disrupting specific signalling events as a con-

sequence of altered cell division patterns. Mutations in DNA

polymerase �, which lengthen the cell cycle, cause similar

specific defects in the founder cells for the RM (Jenik et al.,

2005). This strengthens the notion that subtle cell cycle

alterations in the embryo can interfere with developmental

programming in RM founder cells. Interestingly, callus can

be induced from hbt mutants, which was, at the time, taken

to suggest that the cell cycle was not primarily controlled by

HBT (Willemsen et al., 1998). However, cell cycle rates in

such callus were not measured, and tissue culture might

relax the demand for high HBT activity.

Regulation of APC/C activity through the HBT subunit

may help defining cell division and cell EZs

Cells in roots of weak hbt TILLING alleles reached smaller

sizes and their endoreduplication levels were reduced, and

effects on cell expansion and ploidy levels were also

observed upon clonal deletion of HBT in roots and leaves

(Serralbo et al., 2006). The HBT gene is transcriptionally

active in mitotic cells, but the protein persists in the EZ.

Interestingly, plant Fizzy-related and CycA2;3 proteins have

been implicated in ploidy control (Cebolla et al., 1999; Imai

et al., 2006). In addition, the Drosophila APC2 subunit of the

APC/C complex controls both mitotic and endoreduplication

cycles (Kashevsky et al., 2002). It is therefore an attractive

hypothesis that HBT protein limits APC/C controlled endo-

cycles in the early EZ, and thereby determines final cell size,

and future experiments should probe this scenario.

Experimental procedures

Plant material and growth conditions

hbt-11 was found in the progeny of the Salk_021513 line. The hbt-12and hbt-13 mutants were identified in a collection of ArabidopsisTILLING EMS-induced mutants (Till et al., 2003). hbt-12 carries aV328–M point mutation and the hbt-13 mutation changes G335–R.cdc27a-1, cdc27a-2 and cdc27a-3 mutants in the CDC27A gene wereobtained from the Salk_0141413, Salk_059166 and Salk_0872250insertion lines, respectively, from the SIGNAL collection (Alonsoet al., 2003). Primer pairs used for genotyping are displayed inTable 3. After sterilization seeds were stratified for 2 days at 4�C inthe dark, and were then transferred to near vertically oriented agarplates containing 0.5 · MS salt mixture (Duchefa, http://www.duchefa.com) and 1% sucrose (pH 5.8), maintained at 22�Cwith a 16-h light and 8-h dark cycle.

Flow cytometry

Between 30 and 40 root tips (500 lm) of 7-day-old seedlings werechopped in 500 ll of cold nuclear isolation buffer [45 mM MgCl2,30 mM sodium citrate, 20 mM (4-morpholino)propanesulfonate,pH 7.0, 0.1% (w/v) Triton X-100; Galbraith et al., 1983; ] containing2.5 lg ml)1 4¢,6-diamidino-2-phenylindole (DAPI; Roche, http://www.roche.com). The crude preparation of isolated nuclei wasfiltered (48 lm) and immediately analysed on an ELITE ESPcytometer (Beckman-Coulter, http://www.beckman.com) using UVexcitation and gates to eliminate debris or doublets as described inCoba de la Pena and Brown (2001). DNA histograms correspondingto 5000 isolated nuclei were drawn, and the frequency of ploidylevels was calculated using WINMDI 2.8 software (Joe Troter, TheScripps Research Institute, http://www.scripps.edu).

HBTg-GUS and HBTg-GFP protein fusions

A rescuing 9-kb genomic fragment of the HBT gene (Blilou et al.,2002) digested with ClaI was fused in frame to the GUS or to the GFP

Functional characterization of plant CDC27s 9

ª 2007 The AuthorsJournal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), doi: 10.1111/j.1365-313X.2007.03312.x

sequences. The resulting pHBT::HBTg-GUS or pHBT::HBTg-GFPconstructs were introduced into Agrobacterium tumefaciens strainC58C1 (GV3101) by electroporation, and were used to transformHBT/hbt-1 heterozygotes with the floral-dip method (Clough andBent, 1998). Whereas HBTg-GUS protein fusion partially rescued thestrong hbt-1 allele, rescue of the hbt phenotype in pHBT::HBTg-GFP-expressing plants confirms that HBTg-GFP is fully functional. His-tochemical analysis of GUS activity was performed as described inWillemsen et al. (1998). HBTg-GFP seedlings stained with propidi-um iodide (10 lg ml)1 in distilled water) were visualized by laserscanning confocal microscopy (LSCM) using a Leica (http://www.leica.com) SP2 inverted confocal microscope equipped withGFP filters.

Proteosome inhibitor treatment

pHBT::HBTg-GFP and pHBT::HBTg-GUS seedlings were grown onnear vertically oriented plates for 4 days and were then transferredto 24-well Microtiter plates containing 1 ml of 0.5 · MS salt mixtureand 1% sucrose (pH 5.8), with 10 lM MG132 proteosome inhibitorand 5 lM cicloheximide. Seedlings were kept for 24 h in the growthchamber and roots were examined by LSCM as described above.

Quantitative RT-PCR

RNA was extracted from frozen samples of 50–100 mg using theQiagen RNeasy Mini Kit (Qiagen, http://www.qiagen.com), follow-ing the instructions of the manufacturer, and chromosomal DNAcontamination was removed using the DNA-free kit (Ambion, http://www.ambion.com). Each RNA sample (4 lg) was reverse tran-scribed using an oligo-dT12-18 primer (Amersham, http://www.amersham.com) and SuperScriptIII (Invitrogen, http://www.invitrogen.com), following the instructions of the manufac-turer. The cDNA obtained in this way was diluted by adding 60 ll ofdistilled water. For the real time PCR, 25-ll reaction mixes wereprepared including 12.5 ll of the SYBR Green PCR Master Kit (Ap-plied Biosystems, http://www.appliedbiosystems.com), 0.4 pmol ofa primer pair (Table 3) and 1 ll of cDNA. PCR amplifications werecarried out in 96-well optical reaction plates on the ABI PRISM 7700Sequence Detection System (Applied Biosystems). At least threeindependent amplifications were performed from each cDNA sam-ple. The thermal cycling program started with a step of 2 min at 50�Cand 10 min at 95�C, followed by 40 cycles (15 sec at 95�C and 1 minat 60�C). Dissociation kinetics analyses of the amplification productsconfirmed that only the expected products were amplified.

Relative quantization of gene expression was carried out usingthe 2–DDC

T method (Livak and Schmittgen, 2001). Expression levelsof the target genes were normalized using the EF1a (At5g60390)gene as a reference. The relative levels of target gene transcriptsand confidence intervals were calculated following the methoddescribed by Perez-Perez et al. (2004). Data were represented as therelative gene expression normalized to the internal reference (EF1a)and relative to gene expression in WT.

Yeast two-hybrid analysis

GATEWAYTM (Invitrogen) compatible yeast two-hybrid vectorswere designed by inserting the GATEWAYTM cassette into thepGADT7 and pGBKT7 backbone. The open reading frames (ORFs) ofAPC10, CDC27A and CDC27B/HBT were amplified using attB-flankedgene-specific primers, and were transferred via BP and LR reactionsto the pGBKgtw and pGADgtw vectors mentioned above. The yeaststrain AH109 (Clontech, http://www.clontech.com) was co-trans-formed with pGADgtw and pGBKgtw constructs containing thedifferent inserts. Plates were incubated for 3 days at 30�C on med-ium without leucine and tryptophan. For each interaction tested,three individual colonies were mixed in 100 ll H2O and diluted 10-,100- and 1000-fold. Each dilution series (4 ll) was spotted on med-ium lacking leucine, tryptophan and histidine. Growth was scored3–4 days after incubation at 30�C. Cdc20.1, Cdc20.2, Ccs52A1 andCcs52B exhibited autoactivation. The 10-fold dilution series of theyeast cultures containing Cdc20.1 and Cdc20.2 with the emptyvector reduced the growth on the selective medium. This wasinsufficient in the case of Ccs52A1 and Ccs52B, which grew even in1000-fold dilution. Autoactivation was controlled by the quantitativeinhibitor 3-amino-1,2,4-triazole (3-AT). The strength of the interac-tions was measured by the ability of yeast strains to grow on his-tidine-free medium supplemented with 0, 5 and 10, or 25, 50 and100 mM 3-AT. The lowest concentration that inhibited autoactiva-tion of Ccs52A1 and Ccs52B was 10 mM.

Immunoprecipitation and Western blots

Proteins were extracted from young seedlings using the bufferdescribed in Vodermaier et al. (2003) containing a completeprotease-inhibitor cocktail (Roche). For the immunoprecipitation ofthe APC/C complex, 1 mg of protein extract was pre-cleared withProtein A Sepharose� 4 Fast Flow (Amersham) for 1 h at 4�C. Thesupernatant was incubated with 1:300 affinity-purified mouse anti-APC2 (Capron et al., 2003b) for 2 h at 4�C, followed by incubation

Table 3 Primer pairs used in this work

Gene (ATG number)

Oligo sequences (5¢ fi 3¢)PCR productsize (bp)Forward Reverse

HBT (At2g20000)RT-qPCR ATGGATATATACTCTACGGTCCTC AGTGTCTTGTATCTACACGAAGTG 298Salk_021513 ATTAAATACCTCCGCACCAGG GGAAGCTATGCTTGTGGACTG 1063Tilling AGTTCTCCAAAGTCCACTGTTAAC GAAGTTTCATATACGTATCCAGTGC 896

CDC27A (At3g16320)RT-qPCR TGCTTTTACAGGTAATGGATGCT CGCACTCCATGTACAGACATC 82Salk_141413 TTGTCGGAATCTAGAGGATGC TGCAGAGAATTGAATTTGTTGC 1054Salk_059166 GAAATCCTTGCAGGTCAATCA GACGTCAGGCCAGTCTGTAAG 738Salk_087225 AACGCCTCATCGTTTCTCTG TGATTGACCTGCAAGGATTTC 1032

T-DNALBa1 TGGTTCACGTAGTGGGCCATCG – –

10 Jose M. Perez-Perez et al.

ª 2007 The AuthorsJournal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), doi: 10.1111/j.1365-313X.2007.03312.x

with 30 ll of Protein A Sepharose� 4 Fast Flow (Amersham) foranother 2 h at 4�C. The washing and elution of immune complexeswere performed according to the manufacturer’s recommen-dations. The eluates were loaded on 10% SDS-PAGE gels, andproteins were transferred to Hybond-ECL membranes (Amersham).The efficiency of the immunoprecipitation was verified using 1:3000mouse monoclonal 12CA5 anti-HA antibody (Roche) or 1:2000affinity-purified rabbit anti-CDC27A (Capron et al., 2003b). Second-ary goat anti-mouse or goat anti-rabbit horseradish peroxidase(HRP)-conjugated antibodies (Amersham) were used at 1:5000dilution. Detection was performed using the ECL� Western BlottingDetection kit following the instructions of the manufacturer(Amersham).

Microscopy and histology

For whole-mount, starch granules visualization and GUS staining,seedlings were cleared and mounted according to the methoddescribed by Willemsen et al. (1998). Root length was measured asdescribed (Willemsen et al., 1998). The number of root meristematiccells was obtained by counting cortex cells showing no signs ofrapid elongation.

Images were taken using a Zeiss Axioskop microscope equippedwith a Nikon DXM1200 digital camera (Carl Zeiss, Inc., http://www.zeiss.com) and were digitally processed with the AdobePHOTOSHOP 7.0 program (Adobe Systems Incorporated, http://www.adobe.com).

Aniline blue staining on WT and hbt-11 imbibed seeds wasperformed as described in Bougourd et al. (2000).

Acknowledgements

We thank Maarten Terlou for help with morphometric analysis andFritz Kindt, Ronald Leito and Piet Brouwer for photography. Thiswork was supported by an EC-RTN contract to JMPP (HPRN-CT-2002-00333) and an EC-MCF fellowship to OS (HPMF-CT-1999-00013).

References

Aida, M., Beis, D., Heidstra, R., Willemsen, V., Blilou, I., Galinha, C.,

Nussaume, L., Noh, Y.S., Amasino, R. and Scheres, B. (2004) ThePLETHORA genes mediate patterning of the Arabidopsis rootstem cell niche. Cell, 119, 109–120.

Alonso, J.M., Stepanova, A.N., Leisse, T.J. et al. (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science,301, 653–657.

van den Berg, C., Willemsen, V., Hendriks, G., Weisbeek, P. and

Scheres, B. (1997) Short-range control of cell differentiation in theArabidopsis root meristem. Nature, 390, 287–289.

Blilou, I., Frugier, F., Folmer, S., Serralbo, O., Willemsen, V.,

Wolkenfelt, H., Eloy, N.B., Ferreira, P.C.G., Weisbeek, P. and

Scheres, B. (2002) The Arabidopsis HOBBIT gene encodes aCDC27 homolog that links the plant cell cycle to progression ofcell differentiation. Genes Dev. 16, 2566–2575.

Bougourd, S., Marrison, J. and Haseloff, J. (2000) Technicaladvance: an aniline blue staining procedure for confocalmicroscopy and 3D imaging of normal and perturbed cellularphenotypes in mature Arabidopsis embryos. Plant J. 24, 543–550.

Callis, J. and Vierstra, R.D. (2000) Protein degradation in signaling.Curr. Opin. Plant Biol. 3, 381–386.

Capron, A., Okresz, L. and Genschik, P. (2003a) First glance at theplant APC/C, a highly conserved ubiquitin-protein ligase. TrendsPlant Sci. 8, 83–89.

Capron, A., Serralbo, O., Fulop, K. et al. (2003b) The Arabidopsisanaphase-promoting –complex or cyclosome: molecular andgenetic characterization of the APC2 subunit. Plant Cell, 15, 2370–2382.

Casimiro, I., Beeckman, T., Graham, N., Bhalerao, R., Zhang, H.,

Casero, P., Sandberg, G. and Bennett, M.J. (2003) DissectingArabidopsis lateral root development. Trends Plant Sci. 8, 165–171.

Castro, A., Bernis, C., Vigneron, S., Labbe, J.C. and Lorca, T. (2005)The anaphase-promoting complex: a key factor in the regulationof cell cycle. Oncogene, 24, 314–325.

Cebolla, A., Vinardell, J.M., Kiss, E., Olah, B., Roudier, F., Kondorosi,

A. and Kondorosi, E. (1999) The mitotic inhibitor ccs52 is requiredfor endoreduplication and ploidy-dependent cell enlargement inplants. EMBO J. 18, 4476–4484.

Clough, S.J. and Bent, A.F. (1998) Floral dip: a simplified method forAgrobacterium-mediated transformation of Arabidopsis thaliana.Plant J. 16, 735–743.

Clute, P. and Pines, J. (1999) Temporal and spatial control of cyclinB1 destruction in metaphase. Nat. Cell Biol. 1, 82–87.

Coba de la Pena, C.T. and Brown, S.C. (2001) Flow cytometry. In:Plant Cell Biology: Practical Approach, 2nd edn, (Hawes, C. andSatiat-Jeunemaıtre, B., eds). Oxford, UK: Oxford University Press,pp. 85–106.

Colon-Carmona, A., You, R., Haimovitch-Gal, T. and Doerner, P.

(1999) Technical advance: spatio-temporal analysis of mitoticactivity with a labile cyclin-GUS fusion protein. Plant J. 20, 503–508.

Dewitte, W., Riou-Khamlichi, C., Scofield, S., Healy, J.M., Jacqmard,

A., Kilby, N.J. and Murray, J.A. (2003) Altered cell cycle distribu-tion, hyperplasia, and inhibited differentiation in Arabidopsiscaused by the D-type cyclin CYCD3. Plant Cell, 15, 79–92.

Di Laurenzio, L., Wysocka-Diller, J., Malamy, J.E., Pysh, L.,

Helariutta, Y., Freshour, G., Hahn, M.G., Feldmann, K.A. and

Benfey, P.N. (1996) The SCARECROW gene regulates an asym-metric cell division that is essential for generating the radialorganization of the Arabidopsis root. Cell 86, 423–433.

Dube, P., Herzog, F., Gieffers, C., Sander, B., Riedel, D., Muller, S.A.,

Engel, A., Peters, J.M. and Stark, H. (2005) Localization of thecoactivator Cdh1 and the cullin subunit Apc2 in a cryo-electronmicroscopy model of vertebrate APC/C. Mol. Cell, 20, 867–879.

Fulop, K., Tarayre, S., Kelemen, Z., Horvath, G., Kevei, Z., Nikovics,

K., Bako, L., Brown, S., Kondorosi, A. and Kondorosi, E. (2005)Arabidopsis anaphase-promoting complexes: multiple activatorsand wide range of substrates might keep APC perpetually busy.Cell Cycle, 4, 1084–1092.

Galbraith, D.W., Harkins, K.R., Maddox, J.M., Ayres, N.M., Sharma,

D.P. and Firoozabady, E. (1983) Rapid flow cytometry analysis ofthe cell cycle in intact plant tissues. Science, 220, 1049.

Harper, J.W., Burton, J.L. and Solomon, M.J. (2002) The anaphase-promoting complex: it’s not just for mitosis any more. Genes Dev.16, 2179–2206.

Heidstra, R., Welch, D. and Scheres, B. (2004) Mosaic analyses usingmarked activation and deletion clones dissect ArabidopsisSCARECROW action in asymmetric cell division. Genes Dev. 18,1964–1969.

Helariutta, Y., Fukaki, H., Wysocka-Diller, J., Nakajima, K., Jung, J.,

Sena, G., Hauser, M.T. and Benfey, P.N. (2000) The SHORT-ROOTgene controls radial patterning of the Arabidopsis root throughradial signaling. Cell, 101, 555–567.

Imai, K.K., Ohashi, Y., Tsuge, T., Yoshizumi, T., Matsui, M., Oka, A.

and Aoyama, T. (2006) The A-type Cyclin CYCA2;3 is a key regu-lator of ploidy levels in Arabidopsis endoreduplication. Plant Cell,18, 382–396.

Functional characterization of plant CDC27s 11

ª 2007 The AuthorsJournal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), doi: 10.1111/j.1365-313X.2007.03312.x

Jakoby, M. and Schnittger, A. (2004) Cell cycle and differentiation.Curr. Opin. Plant Biol. 7, 661–669.

Jenik, P.D., Jurkuta, R.E. and Barton, M.K. (2005) Interactionsbetween the cell cycle and embryonic patterning in Arabidopsisuncovered by a mutation in DNA polymerase epsilon. Plant Cell,17, 3362–3377.

Kashevsky, H., Wallace, J.A., Reed, B.H., Lai, C., Hayashi-Hagihara,

A. and Orr-Weaver, T.L. (2002) The anaphase promoting complex/cyclosome is required during development for modified cellcycles. Proc. Natl Acad. Sci. U.S.A. 99, 11217–11222.

Kwee, H. S. and Sundaresan, V. (2003) The NOMEGA gene requiredfor female gametophyte development encodes the putativeAPC6/CDC16 component of the Anaphase Promoting Complex inArabidopsis. Plant J. 36, 853–866.

Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative geneexpression data using real-time quantitative PCR and the 2(-DeltaDelta C(T)) Method. Methods, 25, 402–408.

Passmore, L.A., Booth, C.R., Venien-Bryan, C., Ludtke, S.J., Fioretto,

C., Johnson, L.N., Chiu, W. and Barford, D. (2005) Structuralanalysis of the anaphase-promoting complex reveals multipleactive sites and insights into polyubiquitylation. Mol. Cell, 20,855–866.

Perez-Perez, J.M., Ponce, M.R. and Micol, J.L. (2004) The ULTRA-CURVATA2 gene of Arabidopsis encodes an FK506-binding pro-tein involved in auxin and brassinosteroid signaling. PlantPhysiol. 134, 101–117.

Peters, J.M. (2002) The anaphase-promoting complex: proteolysisin mitosis and beyond. Mol. Cell, 9, 931–943.

Sabatini, S., Heidstra, R., Wildwater, M. and Scheres, B. (2003)SCARECROW is involved in positioning the stem cell niche in theArabidopsis root meristem. Genes Dev. 17, 354–358.

Serralbo, O., Perez-Perez, J.M., Heidstra, R. and Scheres, X. (2006)Non-cell-autonomous rescue of anaphase-promoting complexfunction revealed by mosaic analysis of HOBBIT, an Arabidop-sis CDC27 homolog. Proc. Natl Acad. Sci. U.S.A. 103, 13250–13255.

Tang, Z., Li, B., Bharadwaj, R., Zhu, H., Ozkan, E., Hakala, K.,

Deisenhofer, J. and Yu, H. (2001) APC2 Cullin protein and APC11RING protein comprise the minimal ubiquitin ligase module

of the anaphase-promoting complex. Mol. Biol. Cell, 12, 3839–3851.

Tarayre, S., Vinardell, J.M., Cebolla, A., Kondorosi, A. and Kondo-

rosi, E. (2004) Two classes of the Cdh1-type activators of theanaphase-promoting complex in plants: novel functionaldomains and distinct regulation. Plant Cell, 16, 422–434.

Thornton, B.R. and Toczyski, D.P. (2003) Securin and B-cyclin/CDKare the only essential targets of the APC. Nat. Cell Biol. 5, 1090–1094.

Till, B.J., Colbert, T., Tompa, R., Enns, L.C., Codomo, C.A. et al.

(2003) High-throughput TILLING for functional genomics. Meth-ods Mol. Biol. 236, 205–220.

Vodermaier, H.C., Gieffers, C., Maurer-Stroh, S., Eisenhaber, F. and

Peters, J.M. (2003) TPR subunits of the anaphase-promotingcomplex mediate binding to the activator protein CDH1. Curr.Biol. 13, 1459–1468.

Wang, Y., Magnard, J.L., McCormick, S. and Yang, M. (2004) Pro-gression through meiosis I and meiosis II in Arabidopsis anthersis regulated by an A-type cyclin predominately expressed inprophase I. Plant Physiol. 136, 4127–4135.

Weigel, D. and Jurgens, G. (2002) Stem cells that make stems.Nature, 415, 751–754.

Weingartner, M., Criqui, M.C., Meszaros, T., Binavora, P., Schmit,

A.C., Helfer, A., Derevier, A., Erhardt, M., Bogre, L. and Genschik,

P. (2004) Expression of a non-degradable Cyclin B1 affects plantdevelopment and leads to endomitosis by inhibiting the forma-tion of a phragmoplast. Plant Cell, 16, 643–657.

Wildwater, M., Campilho, A., Perez-Perez, J.M., Heidstra, R., Blilou,

I., Korthout, H., Chatterjee, J., Mariconti, L., Gruissem, W. and

Scheres, B. (2005) The RETINOBLASTOMA-RELATED gene regu-lates stem cell maintenance in Arabidopsis roots. Cell, 123, 1–12.

Willemsen, V., Wolkenfelt, H., de Vrieze, G., Weisbeek, P. and

Scheres, B. (1998) The HOBBIT gene is required for formation ofthe root meristem in the Arabidopsis embryo. Development, 12,521–531.

Wyrzykowska, J., Schorderet, M., Pien, S., Gruissem, W. and

Fleming, A.J. (2006) Induction of differentiation in the shoot api-cal meristem by transient overexpression of a retinoblastoma-related protein. Plant Physiol. 141, 1338–1348.

12 Jose M. Perez-Perez et al.

ª 2007 The AuthorsJournal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), doi: 10.1111/j.1365-313X.2007.03312.x