Plant Biotechnology Journal

(2008)

6

, pp. 465–476 doi: 10.1111/j.1467-7652.2008.00333.x

© 2008 ACPFGJournal compilation © 2008 Blackwell Publishing Ltd

465

Blackwell Publishing LtdOxford, UKPBIPlant Biotechnology Journal1467-76441467-7652© 2008 Blackwell Publishing LtdXXXOriginal Articles

Endosperm-specific promoters from rice

Ming Li

et al.

Spatial and temporal expression of endosperm transfer cell-specific promoters in transgenic rice and barley

Ming Li

1

, Rohan Singh

1

, Natalia Bazanova

2

, Andrew S. Milligan

2

, Neil Shirley

2

, Peter Langridge

2

and Sergiy Lopato

2,

*

1

Plant and Pest Science, School of Agriculture, Food and Wine, University of Adelaide, Waite Campus, Glen Osmond, SA 5064, Australia

2

Australian Centre for Plant Functional Genomics, Hartley Grove, Urrbrae, SA 5064, Australia

Summary

Two putative endosperm-specific rice genes,

OsPR602

and

OsPR9a

, were identified from

database searches. The promoter regions of these genes were isolated, and transcriptional

promoter:

β

-glucuronidase (GUS) fusion constructs were stably transformed into rice and

barley. The GUS expression patterns revealed that these promoters were active in early grain

development in both rice and barley, and showed strongest expression in endosperm

transfer cells during the early stages of grain filling. The GUS expression was similar in both

rice and barley, but, in barley, expression was exclusively in the endosperm transfer cells and

differed in timing of activation relative to rice. In rice, both promoters showed activity not

only in the endosperm transfer cells, but also in the transfer cells of maternal tissue and in

several floral tissues shortly before pollination. The expression patterns of

OsPR602

and

OsPR9a

in flowers differed. The similarity of expression in both rice and barley suggests that

these promoters may be useful to control transgene expression in the transfer cells of cereal

grains with the aim of altering nutrient uptake or enhancing the barrier against pathogens

at the boundary between maternal tissue and the developing endosperm. However, the

expression during floral development should be considered if the promoters are used in rice.

Received 9 February 2008;

accepted 26 February 2008

.

*

Correspondence

(fax +63 8 830 37 102,

e-mail sergiy.lopato@ACPFG.com.au)

Keywords:

barley, endosperm, grain,

promoter, rice, transfer cells.

Introduction

The cereals rice, wheat, maize and barley are major sources

of human food and animal feed, and also provide the raw

material for many industries. Some of the limitations of

conventional breeding of cereals may be overcome by applying

the techniques of genetic transformation or engineering

(Vonwettstein, 1993; Sinclair

et al

., 2004; Shrawat and Lörz,

2006). An important application of genetic engineering is

expected to be in the improvement of grain size, quality

and yield by the modulation of the levels of expression of

particular gene(s), whilst retaining the desirable qualities

in the selected cultivar. Negative effects of constitutive

transgene expression on plant development may be prevented

by the use of tissue- or development-specific promoters

(Potenza

et al

., 2004). Endosperm-specific promoters are of

great importance for the development of modified grains

with altered grain size, shape and composition, as well as

biotic and abiotic stress tolerance.

After cellularization, the endosperm of cereals comprises

at least four different tissues which have specialized roles: the

endosperm transfer cells (ETCs), embryo surrounding region

(ESR), starchy endosperm and aleurone. ETCs are responsible

for the uptake of nutrients and act as a barrier against

pathogens. The ESR protects the embryo, transfers nutrients

to the embryo and acts as a channel for regulatory cross-talk

between the endosperm and embryo. Starchy endosperm

cells make up the bulk of the endosperm and accumulate

storage proteins and starch. The aleurone layer is important

as the site of synthesis of enzymes which hydrolyse the

storage reserves in the endosperm cells at the time of seed

germination (Becraft, 2001; Olsen, 2001, 2004).

Most of the endosperm-specific promoters from monocots

described in the literature have been shown to be active in

466

Ming Li

et al.

© 2008 ACPFGJournal compilation © 2008 Blackwell Publishing Ltd,

Plant Biotechnology Journal

,

6

, 465–476

the late phases of grain development, and are expressed

mainly in starchy endosperm (Russell and Fromm, 1997;

Lamacchia

et al

., 2001; Qu and Takaiwa, 2004; Su

et al

.,

2004). They show maximal activity at the middle of grain

maturation, when cell proliferation and differentiation are

mostly complete. These promoters are useful for biotechno-

logical projects attempting to increase starch and protein

content or to enrich grain with particular amino acids

(Vonwettstein, 1993). Strong endosperm-specific promoters

of storage proteins are also widely used for the high-level

expression of proteins of non-grain origin, with the aim of

large-scale protein production for applications such as the

production of pharmaceuticals and in industry (Wang

et al

.,

1994b; Hood and Jilka, 1999; Hood

et al

., 2002). However,

for the manipulation of grain size and shape, it is probable

that the expression of transgenes will be needed before or

during cellularization and in tissues involved in nutrient

transfer to the developing endosperm, such as the ETC layers.

ETCs are in contact with cells of the maternal tissue. These

cells transfer efficiently sugars and amino acids from

maternal tissue to the endosperm (Wang

et al

., 1994b; Becraft,

2001; Olsen, 2004). To increase the efficiency of transfer,

ETCs develop cell wall ingrowths, which increase the surface

area by up to 22-fold (Wang

et al

., 1994b).

In maize, transfer cells are restricted to the aleurone layer

and three to four adjacent layers of starchy endosperm

(Thompson

et al

., 2001; Olsen, 2004). In barley and wheat,

transfer cells are formed from maternal nucellar cell pro-

jections adjacent to the endosperm cavity and at least one layer

of ETCs on the other side of the endosperm cavity (Wang and

Fisher, 1994; Wang

et al

., 1994a,b; Broekaert

et al

., 1997;

Olsen, 2004). In rice, the pericarp has four vascular bundles,

three of which are situated on the ventral part and side faces

of the grain and are responsible for the supply of nutrients

and water for the development of the pericarp. The fourth

vascular bundle is situated on the dorsal side of the grain and

transports organic solutes and minerals to the endosperm.

In the portion of aleurone adjacent to the vascular bundles,

there are three to five layers of cells responsible for the transfer

of nutrients to the starchy endosperm (Hoshikawa, 1989).

Several types of gene have been found to be expressed

only or mainly in ETCs (Thompson

et al

., 2001; Olsen, 2004).

Most encode low-molecular-weight, cysteine-rich proteins

with hydrophobic signal peptides. Four types of these

proteins have been found in maize basal endosperm transfer

layers (BETLs). BETL-1 and BETL-3 show sequence homology

to defensin-like proteins; BETL-2 has no homologous

sequences; BETL-4 has some homology to the Bowman–Birk

family of

α

-amylase/trypsin inhibitors (Hueros

et al

., 1995,

1999b). As defensins and low-molecular-weight trypsin

inhibitors have been shown to inhibit the growth of fungi and

bacteria (Broekaert

et al

., 1997), BETL proteins may help

protect the grain from infection. Defensins can also alter the

permeability of fungal plasma membranes, and hence may

act as regulators of transport through the plasmalemma

(Thompson

et al

., 2001).

The

BETL-1

promoter was isolated and used to direct

β

-glucuronidase (GUS) gene expression in transgenic maize.

GUS activity was found exclusively in BETL cells (Hueros

et al

.,

1999a,b). Expression of BETL proteins is greatly reduced in

the maize

rgf1

(

reducing grain filling1

) mutant, which also

shows decreased uptake of sugars in endosperm cells at

5–10 days after pollination (DAP) (Maitz

et al

., 2000). The

identification and characterization of homologues of

BETL

genes in other grasses have not been reported.

One further class of ETC genes, encoding low-molecular-

weight, cysteine-rich proteins, was identified in the barley

transfer cell domain of the endosperm coenocyte. This cell

type gives rise to the cells that differentiate into transfer cells

(Doan

et al

., 1996). The gene was designated

Endosperm 1

(

END1

). The expression activities of the barley gene

HvEND1

and its orthologue from wheat were studied using

in situ

hybridization (Doan

et al

., 1996; Drea

et al

., 2005) to show

that

END1

is expressed in the coenocyte above the nucellar

projection during the free-nuclear division stage. After cellu-

larization,

END1

transcripts accumulated mainly in the ventral

endosperm over the nucellar projection, but, from 8 DAP, a

low level of expression was also detected in the modified

aleurone and the neighbouring starchy endosperm (Doan

et al

., 1996).

Several other ETC genes have also been identified and

partially characterized. These include

ZmTCRR-1

(Muniz

et al

.,

2006), the transcription factor

ZmMRP-1

(Gomez

et al

., 2002)

and

meg1

(

maternally expressed gene1

) (Gutierrez-Marcos

et al

., 2004) from maize.

In this study, the promoters of two rice genes, designated

OsPR602

and

OsPR9a

, were isolated and characterized. They

were cloned into the pMDC164 plant transformation vector

upstream of the GUS reporter gene, and the activity of the

promoters was analysed using stable

Agrobacterium

-

mediated transformation of rice and barley. The spatial and

temporal activities of the promoters were studied using

whole-mount and histological analysis. It was shown that

OsPR602

and

OsPR9a

promoters lead to GUS expression

in ETCs of developing caryopses in both rice and barley.

However, the promoters exhibit less specific expression in

rice than in barley, as rice shows expression in certain flower

tissues shortly before pollination.

Endosperm-specific promoters from rice

467

© 2008 ACPFGJournal compilation © 2008 Blackwell Publishing Ltd,

Plant Biotechnology Journal

,

6

, 465–476

Results

Identification and isolation of promoter regions of

OsPR602

and

OsPR9a

A cDNA library was prepared from the liquid endosperm of

wheat at 3–6 DAP (Lopato

et al

., 2006). Inserts from 100

randomly selected clones were sequenced, and several cDNAs

encoding full-length, low-molecular-weight, cysteine-rich

proteins were identified. One such clone, designated

TaPR60

(Accession Number EU264062), showed protein sequence

identity with

HvEND1

(Doan

et al

., 1996) (Figure 1a). Another

cDNA, designated

TaPR9

(Accession Number EU264058),

encoded a short protein with no close homologues in the

databases, although the position of some cysteines was

similar to the position of cysteines in BETL-3, a defensin-like

protein from maize (Hueros

et al

., 1995) (Figure 1b).

Northern blot hybridization suggested that both

TaPR9

and

TaPR60

mRNAs were transcribed and accumulated at

high levels in the developing grain between 6 and 10 DAP,

but were not detectable in any other tissues tested (Figure 2a).

Quantitative real-time polymerase chain reaction (PCR)

analysis showed that the amount of

TaPR9

mRNA started to

increase in the grains at 6–7 DAP, reached a maximum at

8–10 DAP and remained present until 16–20 DAP (Figure 2b).

The level of

TaPR60

transcripts was up to 100-fold higher

than that of

TaPR9

transcripts. These were first seen at 3 DAP,

reached a maximum expression level at 7–8 DAP and were

not detected at 18–20 DAP. At 5 DAP, the expression of both

TaPR9

and

TaPR60

was found mainly in the liquid fraction of

the endosperm (Figure 2b). As the objective of the research

was to isolate cereal promoters that showed specific expression

during early endosperm development, the rice genome

sequence was used to identify the promoter regions. The

amino acid sequences of TaPR60 and TaPR9 allowed the

identification of rice homologues, designated as

OsPR602

and

OsPR9a

, respectively, in expressed sequence tag (EST)

databases. ESTs for

OsPR602

originated from cDNA libraries

prepared from the panicle or pistil a short time after flowering

[Institute for Genomic Research (TIGR) libraries #ILF, #68F,

#IL6, #IL0, #IKS, #IJM]. The EST for

OsPR9a

was represented

by a singleton in a library prepared from rice immature seed

(TIGR library #OS36). Contigs containing full-length coding

sequences were found for both

OsPR602

and

OsPR9a

[Accession

Numbers CA767165 (EST), EU264061 (gene) and CA760707

(EST), EU264060 (gene), respectively]. Quantitative real-time

PCR analysis showed that the amount of

OsPR602

mRNA

started to increase in the grains at 2–5 DAP, with a very small

amount remaining detectable after 11 DAP. A very low copy

number of

OsPR602

mRNA was also found in pre-anthesis

panicles (Figure 2b).

OsPR9a

mRNA was detected in pre-

anthesis panicles and in panicles between 2 and 11 DAP, but

was not detectable at 12–18 DAP. No expression of either

gene was detected in the other tissues tested (Figure 3). The

level of

OsPR602

transcripts in panicles was up to several

100-fold higher than that of

OsPR9a

transcripts.

The nucleotide sequences of the two EST contigs were used

to identify the translational start site of the genes in the rice

genomic database. DNA fragments of 2808 and 1730 bp,

upstream of the translational start site of

OsPR602

and

OsPR9a

,

respectively, were isolated by PCR using rice (

Oryza sativa

ssp.

japonica cv. Nipponbare) genomic DNA as template. These

promoter sequences were then cloned into the plant trans-

formation vector pMDC164 (Curtis and Grossniklaus, 2003) to

provide the transcriptional GUS fusion promoter constructs

designated as pMDC164-OsPR602 and pMDC164-OsPR9a.

Computer analysis for putative

cis

-elements in

the promoters of

OsPR602

and

OsPR9a

Computer analysis of the

OsPR602

and

OsPR9a

promoters

using

PLACE

software (http://www.dna.affrc.go.jp/PLACE/

Figure 1 Multiple alignments of protein sequences of OsPR9a to TaPR9 (a) and OsPR602 to TaPR60 and HvEND1 (b). Identical amino acids are shown in black boxes; similar amino acids are shown in grey boxes.

468

Ming Li

et al.

© 2008 ACPFGJournal compilation © 2008 Blackwell Publishing Ltd,

Plant Biotechnology Journal

,

6

, 465–476

signalscan.html) revealed several putative

cis

-elements which

could be involved in endosperm-specific activation. These

included: the GCN4-like motif (GLM; 5

′

-ATGAG/CTCAT-3

′

),

recognized by bZIP proteins of the Opaque2 subfamily

(Albani

et al

., 1997; Wu

et al

., 1998; Conlan et al., 1999;

Onate et al., 1999; Vicente-Carbajosa and Carbonero, 2005);

the prolamin box (PB; 5′-TGTAAAG-3′) recognized by one

zinc finger (DOF) class of transcription factors (Mena et al.,

1998; Lijavetzky et al., 2003; Yanagisawa, 2004); and a motif

for the R2R3 subclass of MYB transcription factors (5′-AAC/

TA-3′) (Suzuki et al., 1998; Diaz et al., 2002). It has been

demonstrated previously that DOF transcriptional factor(s)

interact with R2R3MYB (GAMYB) in vivo to activate

endosperm-specific promoters (Diaz et al., 2005).

The recently discovered cis-element from the BETL-1

promoter (Barrero et al., 2006), which comprises two -TATCTC-

repeats and specifically interacts with ZmMRP-1, was not

identified in either the OsPR602 or OsPR9a promoter. Two

single -TATCTC- sequences were found at 1189 and 1677 bp

upstream of the translational start site in the OsPR602

promoter. However, no confirmation of the role of predicted

cis-elements in the activation of the OsPR602 or OsPR9a

promoter was undertaken.

Generation of transgenic plants

pMDC164-OsPR602 and pMDC164-OsPR9a constructs were

transformed into Agrobacterium tumefaciens strain AGL1,

and the presence of plasmid in selected colonies was

confirmed by PCR using specific primers. Transformed Agro-

bacterium was subsequently used to introduce constructs

into rice and barley. The integration of promoter:GUS fusions

Figure 2 Expression of TaPR60 and TaPR9 in different wheat tissues shown by Northern hybridization (a) and quantitative real-time polymerase chain reaction (Q-PCR) (b). Q-PCR was performed using four independent replicates for each tissue. DAP, days after pollination.

Endosperm-specific promoters from rice 469

© 2008 ACPFGJournal compilation © 2008 Blackwell Publishing Ltd, Plant Biotechnology Journal, 6, 465–476

in transgenic plants was confirmed by either PCR (for rice) or

Southern blot hybridization (for barley) (Table 1). Southern

blot hybridization gave additional data showing the number

of inserts in transgenic lines of barley. All GUS-expressing

lines showed the same spatial and temporal patterns of

expression after GUS staining. However, the level of expression

differed.

Sixteen rice lines transformed with pMDC164-OsPR602

were selected on hygromycin, and the integration of the

transgene was confirmed by PCR in all lines. However, GUS

activity was detected in only six lines. Six from six selected

barley plants transformed with pMDC164-OsPR602 were

positive in staining for GUS activity. Lines 1, 2, 4 and 5 had

single-copy insertions, whereas two copies of the transgene

were found in line 3 and at least three copies were integrated

in line 6. GUS analyses were performed with all six T0

lines using untransformed wild-type barley and/or barley

transformed with empty vector plasmid as the negative

control. No differences were found between wild-type plants

and plants transformed with empty vector. The profile of

OsPR602 promoter activity was identical in all six independent

T0 lines. The highest level of GUS activity was detected in

line 1.

Integration of pMDC164-OsPR9a was confirmed by

PCR for 11 transgenic rice lines. However, only five T0 lines

exhibited GUS activity. The pattern of GUS expression was

the same in all five lines. Nine transgenic barley lines with

the same construct were selected on hygromycin, and

integration of the transgene was confirmed in all selected

lines by Southern blot hybridization (Table 1). Lines 1, 4, 6, 7

and 9 contained single-copy insertions. Two to three copies

were integrated in lines 2, 5 and 8; line 3 contained more

than five copies of the transgene in the genome. However,

only three transgenic lines (2, 5 and 8) showed GUS activity.

The strongest GUS expression was found in line 2.

The numbers of transgenic lines, transgene copy number

and relative strength of expression are summarized in

Figure 3 Expression of OsPR9a and OsPR602 in different rice tissues, as shown by quantitative real-time polymerase chain reaction. DAP, days after pollination.

Table 1 Information about T0 transgenic lines

Transgenic line

OsPR602:GUS

in transgenic rice

OsPR602:GUS

in transgenic barley

OsPR9a:GUS

in transgenic rice

OsPR9a:GUS

in transgenic barley

Number of putative transgenic lines

selected on antibiotic

16 6 11 9

Number of transgenic lines confirmed

by polymerase chain reaction and

Southern blot hybridization

16 6 11 9

Number of transgene insertions N/A Lines 1, 2, 4 and 5 have

single-copy insertions. Line

3 has two copies. Line 6

contains three copies

N/A Lines 1, 4, 6, 7 and 9 have

single-copy insertions. Line 2

has three copies. Lines 5 and

8 contain two copies. Line 3

has seven copies

Number of transgenic lines with

GUS expression

6: lines 3, 5, 8, 9, 12 and

16; line 8 has the strongest

GUS expression

6: lines 1–6; line 1 has the

strongest GUS expression

5: lines 2, 3, 8, 9

and 11

3: lines 2, 5 and 8; line 2 has

the strongest GUS expression

GUS, β-glucuronidase.

470 Ming Li et al.

© 2008 ACPFGJournal compilation © 2008 Blackwell Publishing Ltd, Plant Biotechnology Journal, 6, 465–476

Table 1. All T0 lines, and T1 progeny derived from at least two

independently transformed T0 transgenic lines, were used

for analysis.

Spatial and temporal control of GUS expression by the

OsPR602 promoter in transgenic rice and barley

In the transgenic rice lines transformed with pMDC164-

OsPR602, GUS activity was detected in the pistils and some

flower tissues at anthesis. In flowers, it was found in the

rachilla and vascular bundles of the lemma and palea, but

was not detected in the anther and ovary (Figure 4a, A2). No

GUS expression was observed in the leaf blade, sheath, culm,

auricle, ligule, root or rachis. In the T1 caryopsis, the OsPR602

promoter was found to be switched on at 7 DAP. No GUS

staining was detected in any grain tissues before 7 DAP (data

not shown). In the grain collected at 15 DAP, GUS activity

was clearly observed towards the dorsal side of the grain

(Figures 3 and 4), in the aleurone transfer cell layers and the

adjacent starchy cells. The aleurone transfer cell layers retained

GUS activity until 24 DAP. No GUS activity was detected in

the grain of control plants at any stage (Figure 4a, A3).

Following the GUS assay, the samples of rice grain were

embedded in paraffin wax, sectioned and counter-stained

with safranin orange to achieve high contrast and resolution

of cell morphology. The micrographs A5–A10 in Figure 4a

demonstrate the distribution of GUS expression during early

grain filling. The ovular vascular traces formed a large tissue

mass down the dorsal side of the grain, which serves as a

path linking the maternal vascular tissue to the inner side of

the nucellus. In the grain at 9 DAP, GUS was strongly

expressed in the ovular vascular cells, the adjacent pigment

strand and testa, the three to four layers of aleurone transfer

cells and the adjacent starchy cells (Figure 4a, A5 and A6).

Figure 4 Spatial and temporal β-glucuronidase (GUS) expression in rice (a) and barley (b) directed by the OsPR602 promoter. GUS activity in transgenic rice detected in flower (A2) and towards the dorsal side of the grain at 15 days after pollination (DAP) (A4), but not in control flower (A1) and grain (A3). Bars, 1 mm. Histochemical GUS assay in a transverse section of a T1 caryopsis at 9 DAP (A5, A6) and 13 DAP (A7, A8); longitudinal section of rice caryopsis at 15 DAP (A9, A10). Bars: A5, A7 and A9, 800 µm; A6, A8 and A10, 100 µm. GUS activity in barley detected in hand-cut longitudinal (B2) and transverse (B4) sections of transgenic lines, but not in wild-type (B1, B3) caryopsis at 10 DAP. Histochemical GUS assay counter-stained with safranin in a 10 µm thick transverse section of transgenic barley caryopsis at 10 DAP (B5), longitudinal section of wild-type caryopsis at 10 (B7), 16 (B9), 26 (B11) and 30 DAP (B13), and transgenic barley caryopsis at 10 (B6), 16 (B8), 23 (B10) and 30 DAP (B12). Arrows show GUS-stained tissues. AL, aleurone; DVB, dorsal vascular bundle; ETC, endosperm transfer cell; mp, maternal pericarp; NE, nucellar epidermis; NP, nucellar projection; OVT, ovular vascular trace; PS, pigment strand; Ra, rachilla; SEC, starchy endosperm cells; VB, vascular bundle; VT, vascular tissue. Bars, 1 mm.

Endosperm-specific promoters from rice 471

© 2008 ACPFGJournal compilation © 2008 Blackwell Publishing Ltd, Plant Biotechnology Journal, 6, 465–476

GUS activity gradually declined and could not be detected in

the ovular vascular trace or pigment strand at 13 DAP, but

remained in other transfer tissues (Figure 4a, A7 and A8).

Figure 4a (A9 and A10) illustrates GUS activity in the posterior

pole of a caryopsis at 18 DAP.

The whole-mount GUS analyses of grain from transgenic

barley plants transformed with pMDC164-PR602 revealed a

spatial pattern similar to that in rice grain; GUS staining could

be seen as two parallel lines in the ventral groove zone of

transgenic T1 caryopses. The activity of the promoter was

detected in the ETCs and a few layers of adjacent starchy

endosperm cells (Figure 4b, B2 and B4). No GUS activity was

observed in control grain (Figure 4b, B1 and B3). No GUS

activity was found in transgenic caryopses before 10 DAP.

GUS expression in ETCs of barley was observed throughout

grain maturation. It started at 10 DAP and finished at 30 DAP

(Figure 4b, B6 and B12). In one of the six barley lines (line 5),

GUS expression was weaker than in the other lines, but the

OsPR602 promoter was still active at 35 DAP and GUS expres-

sion was observed in two to three layers of transfer cells.

A transverse section (B5) through the middle of the barley

caryopsis (line 1) at 10 DAP is shown in Figure 4b. The identities

of the aleurone layers at the endosperm adaxial axis and

modified aleurone cells near the abaxial side were already

established at this stage, and could be distinguished from the

central starchy endosperm cells. The GUS expression is clearly

seen in the transfer cell layer and adjacent starchy endosperm.

The spatial activation patterns of the OsPR602 promoter in

barley matched well with the data obtained for this promoter

in rice, except that the ventral pigment strand and the

vascular bundles down the chalaza pad in barley did not show

GUS expression. GUS activity was not detected in the flowers

or any vegetative tissues of the transgenic barley plants.

The temporal expression patterns of OsPR602 in rice

differed slightly from those in barley. In rice, GUS expression

started 3 days earlier and stopped 6 days earlier than in

barley.

Spatial and temporal control of GUS expression by the

OsPR9a promoter in transgenic rice and barley

The whole-mount GUS staining of a T1 caryopsis of rice at

26 DAP is shown in Figure 5a (A2 and A3). OsPR9a activity

was present in the rachilla, anthers and mature pollen shortly

before pollination (Figure 5a, A1). No activity in the anthers

and mature pollen was observed for the OsPR602 promoter

in either rice or barley. No activity of the OsPR9a promoter

was detected in the vascular tissues of the lemma and palea

or in other plant tissues. The strongest OsPR9a promoter

activity in rice was found in aleurone transfer cell layers

between 5 and 26 DAP. After 26 DAP, the activity diminished,

and no GUS activity was detected later than 35 DAP.

In the transgenic T1 barley caryopsis, the OsPR9a promoter

was active in the ETC layers and the adjacent starchy

endosperm cells (Figure 5b, B3, B4, B6 and B7). This resembles

the pattern observed for the OsPR602 promoter in barley.

The promoter was active at 9 DAP and activity was detectable

until 35 DAP. No GUS staining was found in the pedicels and

anthers of transgenic barley plants before or at anthesis. No

GUS activity was detected in vegetative plant tissues.

Although transgenic lines were generated with different

levels of GUS expression, on the whole, the OsPR9a promoter

was weaker than the OsPR602 promoter.

Discussion

The manipulation of grain size, shape and composition

depends on access to seed-specific promoters, in particular,

promoters that can drive transgene expression during early

endosperm development. An important group of promoters

are those that are active in the ETC. Several ETC-specific

genes have been described in the literature (Hueros et al.,

1995, 1999b; Doan et al., 1996; Gomez et al., 2002; Gutierrez-

Marcos et al., 2004; Muniz et al., 2006), but the cloning and

analysis of only one ETC-specific promoter, from BETL-1 of

maize, has been reported (Hueros et al., 1999a). The activity

of the BETL-1 promoter was tested in maize, but not in other

plant species. A number of sequences were identified

encoding cysteine-rich proteins similar to the products of the

END1 and BETL genes in mRNA from the liquid fraction of the

syncytial endosperm of wheat. Northern blots and quantitative

PCR confirmed that transcription of two of the cloned genes,

designated TaPR60 and TaPR9, is specifically activated in

grain at the end of the cellularization phase, and that the

genes are expressed until the end of grain maturation

(Figure 2). The cloning of wheat promoters is still a slow

process because of the absence of a genome sequence. In

contrast, rice genome databases are available, but ETC-

specific genes from rice have not been reported. Therefore,

ETC-specific promoters from rice were identified and

characterized in rice and barley to evaluate their broad

applicability in cereal biotechnology. Protein sequences

of TaPR60 and TaPR9 were used to identify their rice

homologues, OsPR602 and OsPR9a, respectively, in rice EST

databases. The alignment of the protein sequences derived

from the rice ESTs with proteins from other plants is shown

in Figure 1. Quantitative PCR analysis of OsPR602 and OsPR9a

expression revealed their specific expression in panicles

472 Ming Li et al.

© 2008 ACPFGJournal compilation © 2008 Blackwell Publishing Ltd, Plant Biotechnology Journal, 6, 465–476

before pollination and at 11 DAP. This is very similar to the

data obtained for wheat homologues, except that, in rice,

expression was detected in pre-anthesis panicles (flowers)

and expression in both panicles and developing grain strongly

decreased after 11 DAP.

The nucleotide sequences of the coding regions of

OsPR602 and OsPR9a were subsequently used to identify the

translation start sites of their genes. Regulatory sequences

containing promoters and 5′-untranslated regions (5′-UTRs)

were cloned, and the activity of the promoters was analysed

using the stable transformation of rice and barley plants with

promoter:GUS gene fusion constructs.

Surprisingly, the OsPR602 promoter in rice was active not

only in ETCs, but also in transfer cells of maternal tissue.

Indeed, the spatial pattern was similar, but not identical, to

the previously described expression pattern of END1 in barley

and wheat, as shown by in situ hybridization analyses (Doan

et al., 1996; Drea et al., 2005). In rice, the pericarp has four

vascular bundles, one on each of the ventral and dorsal sides,

and one on each side face. The vascular bundle on the dorsal

side is the widest. It contains many conducting elements and

extends to the upper end of the grain (Hoshikawa, 1989;

Krishnan and Dayanandan, 2003). The activity of OsPR602

was found in the dorsal vascular bundle, but was not

detected in the other three narrow vascular bundles of the

grain. In the early stages (7–12 DAP) of rice endosperm

differentiation, the OsPR602 promoter was active in the ovular

vascular trace, the adjacent pigment strand, the adjacent

nucellar epidermis, the three to four layers of ETCs and the

adjacent starchy endosperm cells. Although the activity of the

OsPR602 promoter was not detected in the remaining three

narrow vascular bundles of the pericarp, it was observed in

vascular tissues of the lemma and palea shortly before anthesis

(Figure 4a, A2). The lemma has five swollen vertical ridges

Figure 5 Analysis of β-glucuronidase (GUS) expression in rice (a) and barley (b) directed by the OsPR9a promoter. GUS activity detected in flowers at anthesis (A1), and in uncut (A2) and hand-cut (A3) caryopsis of rice at 26 days after pollination (DAP). Hand-cut transverse and longitudinal sections of wild-type caryopsis at 18 and 10 DAP (B1, B2) and transgenic barley caryopsis at 20 DAP (B3, B4). Histochemical GUS assay and safranin counter-staining in transverse section of wild-type caryopsis at 20 DAP (B5), and in transverse (B6, B8) and longitudinal (B7) sections of transgenic barley caryopsis at 20 DAP. Arrows show GUS-stained tissues. An, anthers; ETC, endosperm transfer cell; Ra, rachilla. Bars, 1 mm (except B8, 0.25 mm).

Endosperm-specific promoters from rice 473

© 2008 ACPFGJournal compilation © 2008 Blackwell Publishing Ltd, Plant Biotechnology Journal, 6, 465–476

with a vascular bundle running through each. The palea has

three vascular bundles – one at the centre of the dorsal

surface and one on both sides (Hoshikawa, 1989). GUS

activity was found in all eight vascular bundles at anthesis,

but disappeared at the early stages of grain development.

The OsPR9a promoter showed rather different patterns of

GUS expression in rice flowers. It was active in the rachilla,

anthers and the mature pollen shortly before pollination, but

showed no activity in the ovary or vascular tissue of the

lemma and palea (Figure 5a, A1). GUS expression was detected

in aleurone transfer cells and adjacent layers of starchy cells,

but was not found in transfer cells of maternal tissues of grain

(data not shown).

The activity of the OsPR602 promoter in rice seeds was

similar to that of the barley asi promoter in developing trans-

genic barley seeds, for which gfp expression was observed

specifically in the pericarp, vascular tissue, nucellar projection

cells and ETCs (Furtado et al., 2003). However, in barley, both

the OsPR602 and OsPR9a promoters are active only in the

ETCs and adjacent starchy endosperm cells. GUS expression

could not be detected in either transfer cells of maternal

tissue or in flowers before pollination. A transcription factor

ZmMRP-1, which can specifically activate promoters in ETCs,

has been identified in maize (Gomez et al., 2002). The

expression pattern of GUS for OsPR602 and OsPR9a in flowers

is clearly different from the situation in maize, and could

mean that the transcription regulator from rice has a broader

specificity than its maize orthologue. However, it is more

probable that the OsPR602 and OsPR9a promoters are

activated by two different transcription factors. If this is the

case, it is probable that only the cis-element responsible for

expression in ETCs is conserved between the two species. In

maize, ZmMRP-1 can activate the BETL-1 promoter in vivo and

interact in vitro with the specific cis-element -TATCTCTATCTC-

from the promoter (Barrero et al., 2006). However, this element

was not found in the promoters of OsPR602 and OsPR9a.

Quantitative PCR data for the expression of OsPR602 and

OsPR9a genes, data obtained for their orthologues from

wheat, as well as data published for END1 and BETL (Hueros

et al., 1999b), indicate that transcriptional activation of the

promoters of these genes takes place at the middle of

endosperm cellularization at 3–6 DAP, reaches a maximum

activity at the end of endosperm cellularization at 8–10 DAP,

and the promoter becomes inactive close to the middle of

endosperm maturation at 20 DAP. A 3–5-day difference was

found in the activation of the same promoter in rice and

barley. This can be partially explained by the observation that

endosperm cellularization is complete at 6 DAP in rice, wheat

and maize, whereas, in barley, it ends at 8 DAP (Olsen, 2001).

If it is assumed that the transcriptional activation of OsPR602

and OsPR9a starts at the middle of the cellularization phase

of endosperm development, this could explain the temporal

difference in the initiation time of activation of both promoters

in barley relative to rice. It is interesting that a gradual

increase in GUS activity from the time of promoter activation

was not seen. Strong GUS activity appeared suddenly at

9–10 DAP.

Northern hybridization identified the weak expression of

END1 in the barley endosperm coenocyte at 5–7 DAP, with

strong expression from 9 DAP until 30 DAP (Doan et al.,

1996). In contrast, mRNA levels of BETL genes in maize grain

deceased at 15–20 DAP (Hueros et al., 1999b). The quantita-

tive PCR data obtained for the orthologous wheat genes

matched the maize BETL result. GUS expression in ETCs

of barley was observed during the whole phase of grain

maturation, long after the expected end of the transcriptional

activity of OsPR602 and OsPR9a promoters. Hence, the

detection of GUS at 30–35 DAP is most probably a result of

the stability of mRNA of the transgene and GUS protein in

ETC cells, rather than sustained expression. In most cases,

strong expression of GUS was observed until 20 DAP and it

then slowly diminished, suggesting an end of transcriptional

activity followed by slow degradation of mRNA and protein.

This implies that the OsPR602 and OsPR9a promoters can be

used to express transgenes until approximately 20 DAP, but

thereafter the amount of protein produced may be dependent

on mRNA and protein degradation.

The activity of the promoters was not quantified, as their

specific expression is restricted to a relatively small number of

grain cells, making quantification problematic. The strength

of GUS activity is also dependent on the number of copies

and position of transgene insertions in the genome. Never-

theless, the OsPR602 promoter appears to be several-fold

stronger than OsPR9a in both rice and barley.

This work suggests that the OsPR602 and OsPR9a promoters

are suitable for ETC-specific expression of genes of interest in

barley. As wheat and barley are closely related species, similar

expression patterns can be expected. However, for the

modulation of nutrient uptake in rice, the OsPR602 promoter

would be preferable for transgene expression, as the OsPR9a

promoter is also active in non-target organs, e.g. anthers and

pollen.

These promoters offer the potential to improve the grain

quality by modifying the quality and quantity of nutrient

uptake through the ETC. Improvements in disease resistance

may also be gained by enhancing the efficacy of this tissue as

a barrier to pathogen movement from maternal tissue to the

developing endosperm.

474 Ming Li et al.

© 2008 ACPFGJournal compilation © 2008 Blackwell Publishing Ltd, Plant Biotechnology Journal, 6, 465–476

Experimental procedures

Promoter cloning and plasmid construction

Promoters and 5′-UTRs of OsPR602 and OsPR9a were amplified fromrice cv. Nipponbare genomic DNA using the primers shown inTable 2. The proof-reading DNA polymerase Pfx (Invitrogen,Mulgrave, VIC, Australia) was used to minimize PCR-induced muta-tions and to produce blunt-end fragments for directional cloninginto the pENTR-D-TOPO vector (Invitrogen). The cloned inserts weresequenced and subcloned into the pMDC164 vector (Curtis andGrossniklaus, 2003) using recombination cloning. The resulting con-structs were designated as pMDC164-PR602 and pMDC164-PR9a,and were transformed into Agrobacterium tumefaciens strain AGL1by electroporation. The presence of plasmids in selected clones wasconfirmed by PCR using promoter-specific primers (Table 2).

Southern blot hybridization and quantitative PCR

analysis

Transgene integration into rice plants was confirmed by PCR usingGUS-specific primers (Table 2) with genomic DNA from selectedtransgenic lines. Transgene integration in barley plants was con-firmed by Southern blot hybridization. Genomic DNA from selectedbarley lines was digested with EcoRV, which cuts the T-DNA regiononce upstream of the selectable marker gene. The Southern blot wasprobed with the coding sequence of the hygromycin phosphotrans-ferase selectable marker gene.

Quantitative PCR was carried out according to Burton et al. (2004)using the primer combinations shown in Table 2.

Rice and barley transformation

The constructs pMDC164-PR602 and pMDC164-PR9a were trans-formed into rice and barley using Agrobacterium-mediated trans-formation and the method developed by Tingay et al. (1997) andmodified by Matthews et al. (2001). Rice (Oryza sativa L. ssp. Japonicacv. Nipponbare) and barley (Hordeum vulgare L. cv. Golden Promise)were used as donor plants. To prevent the generation of multiple plantsderived from the same transformation event, individual regenerantswere selected from independently transformed and cultured piecesof callus.

The promoter activity was tested in T0 and T1 plants (T1 and T2 grain).

Histochemical and histological GUS assays

GUS activity in transgenic barley plants was analysed by histochemicalstaining using the chromogenic substrate 5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid (X-Gluc) (Bio Vectra, Oxford, CT, USA), asdescribed by Hull and Devic (1995). Different plant organs, wholegrain and grain sections of different ages were immersed in a 1 mM

X-Gluc solution in 100 mM sodium phosphate, pH 7.0, 10 mM sodiumethylenediaminetetraacetate, 2 mM FeK3(CN)6, 2 mM K4Fe(CN)6 and0.1% Triton X-100. After vacuum infiltration at ~88 043 Pa for20 min, the samples were incubated at 37 °C until satisfactory stain-ing was observed. Tissues were incubated in 20%, 35% and 50%ethanol, fixed in FAA (50% ethanol, 5% acetic acid and 4% formal-dehyde) and cleared in 70% ethanol. The whole-mount grains werethen observed under a dissecting microscope, and photographswere taken using a Leica digital camera (Leica, North Ryde, NSW,Australia). The grain samples were further dehydrated in 80% and90% ethanol, and then incubated in 95% ethanol with 0.05% ofthe counter-stain safranin orange for contrast. For longitudinal andtransverse sectioning, the tissues were embedded in paraffin wax,sectioned at 9–12 µm, deparaffinized and mounted in DPX mount-ant (Fluka Biochemika, Buchs, Switzerland), as described in Weigeland Glazebrook (2002). The specimens were observed under a com-pound microscope and photographed.

Acknowledgements

We thank Professor U. Grossniklaus for providing us with a

collection of pMDC vectors, Dr R. Burton for cDNA prepared

from rice tissues, and Ursula Langridge for assistance with

growing plants in the glasshouse.

This work was supported by the Australian Grain Research

and Development Corporation (grant no. UA00083 to P.L.),

International Postgraduate Research Scholarship (IPRS) and

Adelaide University Scholarship (AUS).

References

Albani, D., Hammond-Kosack, M.C.U., Smith, C., Conlan, S., Colot, V.,Holdsworth, M. and Bevan, M.W. (1997) The wheat transcriptionalactivator SPA: a seed-specific bZIP protein that recognizes theGCN4-like motif in the bifactorial endosperm box of prolamingenes. Plant Cell, 9, 171–184.

Table 2 A list of primer sequences used in reverse transcriptase-polymerase chain reaction (RT-PCR), quantitative polymerase chain reaction (Q-PCR) and promoter cloning

Gene Forward primer Reverse primer

TaGAPdH (Q-PCR) TTCAACATCATTCCAAGCAGCA CGTAACCCAAAATGCCCTTG

TaPR60 (Q-PCR) GCCAGCAAATCCGAAGATAGAT TTCTCCTCCCACAGCTAAACTAGAG

TaPR9 (Q-PCR) AGCCAATCCTCCATTGTACTGC CCAGACAACACAAGAGGCTCAAT

OsPR602 (promoter) CACCACTCAAAACGAGAAAACTCATTG GGCTATTGCTTTAGTATAAAGCAGC

OsPR9a (promoter) CACCGTGTTCTTCAGGGACGAAAATGATACTCC ATTAGATGATTTATAACACAATCTTATCTAC

GUS (RT-PCR) AGTGTACGTATCACCGTTTGTGTGAAC TACGGATGGTATGTGTCCAAAGCGGCGAT

Endosperm-specific promoters from rice 475

© 2008 ACPFGJournal compilation © 2008 Blackwell Publishing Ltd, Plant Biotechnology Journal, 6, 465–476

Barrero, C., Muniz, L.M., Gomez, E., Hueros, G. and Royo, J. (2006)Molecular dissection of the interaction between the transcrip-tional activator ZmMRP-1 and the promoter of BETL-1. Plant Mol.Biol. 62, 655–668.

Becraft, P.W. (2001) Cell fate specification in the cereal endosperm.Semin. Cell Dev. Biol. 12, 387–394.

Broekaert, W.F., Cammue, B.P.A., DeBolle, M.F.C., Thevissen, K.,DeSamblanx, G.W. and Osborn, R.W. (1997) Antimicrobialpeptides from plants. Crit. Rev. Plant Sci. 16, 297–323.

Burton, R.A., Shirley, N.J., King, B.J., Harvey, A.J. and Fincher, G.B.(2004) The CesA gene family of barley. Quantitative analysis oftranscripts reveals two groups of co-expressed genes. Plant Physiol.134, 224–236.

Conlan, R.S., Hammond-Kosack, M. and Bevan, M. (1999) Transcrip-tion activation mediated by the bZIP factor SPA on the endospermbox is modulated by ESBF-1 in vitro. Plant J. 19, 173–181.

Curtis, M.D. and Grossniklaus, U. (2003) A Gateway cloning vectorset for high-throughput functional analysis of genes in planta.Plant Phys. 133, 462–469.

Diaz, I., Vicente-Carbajosa, J., Abraham, Z., Martinez, M., Isabel-LaMoneda, I. and Carbonero, P. (2002) The GAMYB protein frombarley interacts with the DOF transcription factor BPBF andactivates endosperm-specific genes during seed development.Plant J. 29, 453–464.

Diaz, I., Martinez, M., Isabel-LaMoneda, I., Rubio-Somoza, I. andCarbonero, P. (2005) The DOF protein, SAD, interacts withGAMYB in plant nuclei and activates transcription of endosperm-specific genes during barley seed development. Plant J. 42, 652–662.

Doan, D.N.P., Linnestad, C. and Olsen, O.A. (1996) Isolation ofmolecular markers from the barley endosperm coenocyte and thesurrounding nucellus cell layers. Plant Mol. Biol. 31, 877–886.

Drea, S., Leader, D.J., Arnold, B.C., Shaw, P., Dolan, L. and Doonan,J.H. (2005) Systematic spatial analysis of gene expression duringwheat caryopsis development. Plant Cell, 17, 2172–2185.

Furtado, A., Henry, R., Scott, K. and Meech, S. (2003) The promoterof the asi gene directs expression in the maternal tissues of theseed in transgenic barley. Plant Mol. Biol. 52, 787–799.

Gomez, E., Royo, J., Guo, Y., Thompson, R. and Hueros, G. (2002)Establishment of cereal endosperm expression domains: identifi-cation and properties of a maize transfer cell-specific transcriptionfactor, ZmMRP-1. Plant Cell, 14, 599–610.

Gutierrez-Marcos, J.F., Costa, L.M., Biderre-Petit, C., Khbaya, B.,O’Sullivan, D.M., Wormald, M., Perez, P. and Dickinson, H.G.(2004) maternally expressed gene1 is a novel maize endospermtransfer cell-specific gene with a maternal parent-of-origin patternof expression. Plant Cell, 16, 1288–1301.

Hood, E.E. and Jilka, J.M. (1999) Plant-based production of xeno-genic proteins. Curr. Opin. Biotechnol. 10, 382–386.

Hood, E.E., Woodard, S.L. and Horn, M.E. (2002) Monoclonal anti-body manufacturing in transgenic plants – myths and realities.Curr. Opin. Biotechnol. 13, 630–635.

Hoshikawa, K. (1989) The Growing Rice Plant. Anatomical Mono-graph. Tokyo: Nobunkyo Press.

Hueros, G., Varotto, S., Salamini, F. and Thompson, R.D. (1995)Molecular characterization of BET1, a gene expressed in theendosperm transfer cells of maize. Plant Cell, 7, 747–757.

Hueros, G., Gomez, E., Cheikh, N., Edwards, J., Weldon, M., Sala-mini, F. and Thompson, R.D. (1999a) Identification of a promotersequence from the BETL1 gene cluster able to confer transfer-

cell-specific expression in transgenic maize. Plant Physiol. 121,1143–1152.

Hueros, G., Royo, J., Maitz, M., Salamini, F. and Thompson, R.D.(1999b) Evidence for factors regulating transfer cell-specificexpression in maize endosperm. Plant Mol. Biol. 41, 403–414.

Hull, G.A. and Devic, M. (1995) The beta-glucuronidase (gus)reporter gene system: Gene fusions, spectrophotometric, fluoro-metric, and histochemical detection. In: Methods in Plant MolecularBiology, Vol. 49. Plant Gene Transfer and Expression Protocols(Jones, H. ed), pp. 125–141. Totowa NJ: Hunsana Press Inc.

Krishnan, S. and Dayanandan, P. (2003) Structural and histochemicalstudies on grain-filling in the caryopsis of rice (Oryza sativa L.).J. Biosci. 28, 455–469.

Lamacchia, C., Shewry, P.R., Di Fonzo, N., Forsyth, J.L., Harris, N.,Lazzeri, P.A., Napier, J.A., Halford, N.G. and Barcelo, P. (2001)Endosperm-specific activity of a storage protein gene promoter intransgenic wheat seed. J. Exp. Bot. 52, 243–250.

Lijavetzky, D., Carbonero, P. and Vicente-Carbajosa, J. (2003)Genome-wide comparative phylogenetic analysis of the rice andArabidopsis Dof gene families. BMC Evol. Biol. 3, 17–28.

Lopato, S., Bazanova, N., Morran, S., Milligan, A.S., Shirley, N. andLangridge, P. (2006) Isolation of plant transcription factors usinga modified yeast one-hybrid system. Plant Methods, 2, 3–17.

Maitz, M., Santandrea, G., Zhang, Z.Y., Lal, S., Hannah, L.C., Salamini,F. and Thompson, R.D. (2000) rgf1, a mutation reducing grainfilling in maize through effects on basal endosperm and pediceldevelopment. Plant J. 23, 29–42.

Matthews, P.R., Wang, M.B., Waterhouse, P.M., Thornton, S., Fieg,S.J., Gubler, F. and Jacobsen, J.V. (2001) Marker gene eliminationfrom transgenic barley, using co-transformation with adjacent‘twin T-DNAs’ on a standard Agrobacterium transformationvector. Mol. Breed. 7, 195–202.

Mena, M., Vicente-Carbajosa, J., Schmidt, R.J. and Carbonero, P.(1998) An endosperm-specific DOF protein from barley, highlyconserved in wheat, binds to and activates transcription from theprolamin-box of a native B-hordein promoter in barleyendosperm. Plant J. 16, 53–62.

Muniz, L.M., Royo, J., Gomez, E., Barrero, C., Bergareche, D. andHueros, G. (2006) The maize transfer cell-specific type-A responseregulator ZmTCRR-1 appears to be involved in intercellular signal-ling. Plant J. 48, 17–27.

Olsen, O.A. (2001) Endosperm development: cellularization and cellfate specification. Annu. Rev. Plant Physiol. 52, 233–237.

Olsen, O.A. (2004) Nuclear endosperm development in cereals andArabidopsis thaliana. Plant Cell, 16, S214–S227.

Onate, L., Vicente-Carbajosa, J., Lara, P., Diaz, I. and Carbonero, P.(1999) Barley BLZ2, a seed-specific bZIP protein that interacts withBLZ1 in vivo and activates transcription from the GCN4-like motifof B-hordein promoters in barley endosperm. J. Biol. Chem. 274,9175–9182.

Potenza, C., Aleman, L. and Sengupta-Gopalan, C. (2004) Targetingtransgene expression in research, agricultural, and environmentalapplications: promoters used in plant transformation. In Vitro Cell.Dev. Biol. Plant. 40, 1–22.

Qu, L.Q. and Takaiwa, F. (2004) Evaluation of tissue specificity andexpression strength of rice seed component gene promoters intransgenic rice. Plant Biotechnol. J. 2, 113–125.

Russell, D.A. and Fromm, M.E. (1997) Tissue-specific expression intransgenic maize of four endosperm promoters from maize andrice. Transgenic Res. 6, 157–168.

476 Ming Li et al.

© 2008 ACPFGJournal compilation © 2008 Blackwell Publishing Ltd, Plant Biotechnology Journal, 6, 465–476

Shrawat, A.K. and Lörz, H. (2006) Agrobacterium-mediated trans-formation of cereals: a promising approach crossing barriers.Plant Biotechnol. J. 4, 575–603.

Sinclair, T.R., Purcell, L.C. and Sneller, C.H. (2004) Crop transformationand the challenge to increase yield potential. Trends Plant Sci. 9,70–75.

Su, P.H., Yu, S.M. and Chen, C.S. (2004) Expression analyses of a rice10 kDa sulfur-rich prolamin gene. Bot. Bul. Acad. Sin. 45, 101–109.

Suzuki, A., Wu, C.Y., Washida, H. and Takaiwa, F. (1998) Rice MYBprotein OSMYB5 specifically binds to the AACA motif conservedamong promoters of genes for storage protein glutelin. Plant CellPhysiol. 39, 555–559.

Thompson, R.D., Hueros, G., Becker, H.A. and Maitz, M. (2001)Development and functions of seed transfer cells. Plant Sci. 160,775–783.

Tingay, S., McElroy, D., Kalla, R., Fieg, S., Wang, M.B., Thornton, S.and Brettell, R. (1997) Agrobacterium tumefaciens-mediatedbarley transformation. Plant J. 11, 1369–1376.

Vicente-Carbajosa, J. and Carbonero, P. (2005) Seed maturation:developing an intrusive phase to accomplish a quiescent state.Int. J. Dev. Biol. 49, 645–651.

Vonwettstein, D. (1993) Genetic engineering and plant breeding,especially cereals. Food Rev. Int. 9, 411–422.

Wang, H.L., Offler, C.E. and Patrick, J.W. (1994a) Nucellar pro-jection transfer cells in the developing wheat grain. Protoplasma,182, 39–52.

Wang, H.L., Offler, C.E., Patrick, J.W. and Ugalde, T.D. (1994b) Thecellular pathway of photosynthate transfer in the developingwheat grain. 1. Delineation of a potential transfer pathway usingfluorescent dyes. Plant Cell Environ. 17, 257–266.

Wang, N. and Fisher, D.B. (1994) Monitoring phloem unloading andpost-phloem transport by microperfusion of attached wheatgrains. Plant Physiol. 104, 7–16.

Weigel, D. and Glazebrook, J. (2002) Arabidopsis: a Laboratory Manual.Cold Spring Harbor: Cold Spring Harbor Laboratory Press.

Wu, C.Y., Adachi, T., Hatano, T., Washida, H., Suzuki, A. andTakaiwa, F. (1998) Promoters of rice seed storage protein genesdirect endosperm-specific gene expression in transgenic rice.Plant Cell Physiol. 39, 885–889.

Yanagisawa, S. (2004) Dof domain proteins: plant-specific trans-cription factors associated with diverse phenomena unique toplants. Plant Cell Physiol. 45, 386–391.