Pro®lin in Phaseolus vulgaris is encoded by two genes(only one expressed in root nodules) but multiple isoformsare generated in vivo by phosphorylation on tyrosineresidues

Gabriel GuilleÂn, VõÂctor Valde s-Lo pez, Rau l Noguez,

Juan Olivares, Luis Carlos RodrõÂguez-Zapata,

HeÂctor Pe rez³, Luis Vidali², Marco A. Villanueva and

Federico SaÂnchez*

Plant Molecular Biology Department, Institute of

Biotechnology UNAM, PO Box 510±3, Cuernavaca,

Morelos 62250, Mexico

Summary

Actin-binding proteins such as pro®lins participate in the

restructuration of the actin cytoskeleton in plant cells.

Pro®lins are ubiquitous actin-, polyproline-, and inositol

phospholipid-binding proteins, which in plants are

encoded by multigene families. By 2D-PAGE and

immunoblotting, we detected as much as ®ve pro®lin

isoforms in crude extracts from nodules of Phaseolus

vulgaris. However, by immunoprecipitation and gel

electrophoresis of in vitro translation products from

nodule RNA, only the most basic isoform of those found

in nodule extracts, was detected. Furthermore, a bean

pro®lin cDNA probe hybridised to genomic DNA

digested with different restriction enzymes, showed

either a single or two bands. These data indicate that

pro®lin in P. vulgaris is encoded by only two genes. In

root nodules only one gene is expressed, and a single

pro®lin transcript gives rise to multiple pro®lin isoforms

by post-translational modi®cations of the protein. By in

vivo 32P-labelling and immunoprecipitation with both,

antipro®lin and antiphosphotyrosine-speci®c antibodies,

we found that pro®lin is phosphorylated on tyrosine

residues. Since chemical (TLC) and immunological

analyses, as well as plant tyrosine phosphatase (AtPTP1)

treatments of pro®lin indicated that tyrosine residues

were phosphorylated, we concluded that tyrosine

kinases must exist in plants. This ®nding will focus

research on tyrosine kinases/tyrosine phosphatases that

could participate in novel regulatory functions/

pathways, involving not only this multifunctional

cytoskeletal protein, but other plant proteins.

Introduction

Some of the most abundant actin-binding proteins

(Hatano, 1994) are the pro®lins, which were originally

identi®ed as an important and common pollen allergen in

plants (Valenta et al., 1991; Valenta et al., 1992). Pro®lins

are small proteins (12±15 kDa) that are ubiquitous in

eukaryotic cells (Haarer and Brown, 1990; Machesky and

Pollard, 1993; Staiger et al., 1997; Sun et al., 1995; Valenta

et al., 1993). The function of pro®lin in the regulation of the

actin ®laments in vivo is not yet fully understood since

many of the observations are consistent with both positive

and negative effects on actin polymerisation (SchluÈ ter

et al., 1997; Sun et al., 1995; Theriot and Mitchison, 1993).

In fact, pro®lin can prevent, as well as stimulate actin

polymerisation in vitro (Pantaloni and Carlier, 1993). It is

interesting to note that pro®lin is found in protein

complexes; in Acanthamoeba it interacts with seven

proteins which include two actin-related proteins (Arp2/3)

(Machesky et al., 1994). A similar complex initiates actin

polymerisation at the Listeria monocytogenes surface and

is required to mediate actin tail formation and motility

within the cytoplasm of infected host cells (Welch et al.,

1997). In addition, this complex can act as a nucleator for

actin assembly which can be enhanced by ActA, a protein

used by Listeria to polymerise host actin (Welch et al.,

1998; Zigmond, 1998).

Pro®lin also binds poly L-proline (PLP) in vitro (Archer

et al., 1994; Tanaka and Shibata, 1985) as well as stretches

of proline residues found in proteins such as the (VASP)

vasodilator-stimulated phosphoprotein (Kang et al., 1997).

These complexes are normally associated with focal

adhesions and stress ®bres, but also become localised

during Listeria or Shigella infections to the surface of these

bacteria (Theriot, 1995). Pro®lin is also found associated to

Bni1p and Bnr1p and related proteins, which are target

proteins for Rho small GTPases that interact directly with

pro®lin at the FH1 domains (Chang et al., 1997; Evangelista

et al., 1997; Imamura et al., 1997; Watanabe et al., 1997).

Furthermore, both plant and animal pro®lins can bind

phosphatidylinositol-4-phosphate (PtdIns[4P]); and phos-

phatidylinositol 4,5-bisphosphate (PtdIns[4,5P]2) with high

af®nity (Clarke et al., 1998; Gibbon et al., 1998; Machesky

and Pollard, 1993), and inhibit phosphoinositide-speci®c

phospholipase C (PLC) activity (Drùbak et al., 1994;

Goldschmidt-Clermont et al., 1991). Therefore, pro®lin is

Received 23 April 1999; revised 18 June 1999; accepted 23 June 1999.*For correspondence (fax +527 313 9988; e-mail federico@ibt.unam.mx).²Present address: University of Massachusetts, Department of Biology,Amherst, MA 01003, USA.³In memoriam.

The Plant Journal (1999) 19(5), 497±508

ã 1999 Blackwell Science Ltd 497

an important protein that has the potential to function as a

link between the polyphosphoinositide pathway and actin

cytoskeleton reorganisation and seems to be a key

element integrating information from external stimuli

and the spatial and temporal regulation of actin.

The above mentioned evidence in association with a

recent report indicating that pro®lin has an inhibitory

effect on the phosphorylation of several pollen proteins in

vitro (Clarke et al., 1998), strongly suggest that not only

animal and yeast, but also plant pro®lins, play a key role in

signal transduction.

In Arabidopsis thaliana (Christensen et al., 1996; Huang

et al., 1996) and Zea mays (Staiger et al., 1993), pro®lin

isoforms are encoded by multigene families, which exhibit

two expression patterns, one found in ¯oral tissues, and

the other expressed in all tissues. The Arabidopsis pollen-

speci®c AthPRF4 (Huang et al., 1996) is in the class that

includes pro®lins from monocot (Asturias et al., 1997b;

Staiger et al., 1993) and dicot plants (Mittermann et al.,

1995; Valenta et al., 1993; Yu et al., 1998). Other plant

pro®lin sequences form a new clade which includes

several Arabidopsis (Ath PRF 1±3), and the common bean

pro®lin from root nodules (Vidali et al., 1995). This second

clade most likely represents a vegetatively expressed class

of pro®lins that regulate general functions of the actin

cytoskeleton (Christensen et al., 1996; Huang et al., 1996;

Yu et al., 1998). Interestingly, it has been suggested that

plant pro®lin genes, like actin genes, have evolved from a

single common ancestral plant gene (Huang et al., 1996).

Many plant tissues appear to express several pro®lin

isoforms in mature and germinating pollen (Gibbon et al.,

1998; Mittermann et al., 1995; Staiger et al., 1993).

Nevertheless, the signi®cance of pollen expressing multi-

ple pro®lins, and whether each isoform has a unique

function, or some of them are functionally redundant, is

still unknown. The fact that several pro®lin isoforms have

particular tissue-speci®c expression patterns (Christensen

et al., 1996; Huang et al., 1996; Staiger et al., 1993) and

distinct af®nities for poly L-proline binding, and alter

cytoarchitecture (Clarke et al., 1998; Gibbon et al., 1998)

would seem to point towards the ®rst possibility. In

particular, when ZmPRO4 is compared with other maize

pro®lin isoforms, it displays a signi®cantly greater af®nity

for PLP and disrupts cellular architecture in Tradescantia

virginiana stamen hair cells more rapidly (Gibbon et al.,

1998).

In this work we report that, in P. vulgaris (common bean)

only two genes encode for pro®lins. In root-nodules only

one gene is expressed and a single transcript gives rise to

multiple pro®lin isoforms, generated by in vivo phosphor-

ylation. Since chemical and enzymatic treatments of

pro®lin indicated that tyrosine residues were phosphory-

lated, we take these results as reasonably good evidence

to suggest the presence of tyrosine kinases in plants.

Possible fuctional implications of pro®lin phosphorylation

are also discussed.

Results

Gene analysis of the Phaseolus vulgaris pro®lin

To gain insight into the complexity of pro®lin gene copies

in the P. vulgaris genome a Southern blot experiment was

performed. Total genomic DNA was puri®ed from

P. vulgaris leaves isolated from a single plant and

restricted with several enzymes. We knew from the

sequence data of our previously cloned pro®lin cDNA

(Vidali et al., 1995), which restriction sites were present

within the coding region. A PCR ampli®ed 133 bp fragment

which corresponded to exon two (Christensen et al., 1996)

was used as a probe, as shown in Figure 2. At high

stringency hybridisation conditions, the blot showed

either a single or two bands in each lane (Figure 1).

Identical results were obtained using low and moderately

low stringency conditions (data not shown), suggesting

that in the P. vulgaris genome, pro®lin is encoded by no

more than two gene(s) and not by a large multigenic

family as in other plants (Christensen et al., 1996; Huang

Figure 1. Phaseolus vulgaris genomic Southern blot.Total DNA from a single plant was isolated and 2.5 mg were digested withthe different restriction enzymes PstI, SalI, ApaI, EcoRI, EcoRV, HindIII,Sau3A, and XbaI (lanes 1±8, respectively). A 0.8% agarose gel was runand the DNA blotted to a nylon membrane. The probe used forhybridisation was the putative exon 2 fragment described in Figure 2.

498 Gabriel GuilleÂn et al.

ã Blackwell Science Ltd, The Plant Journal, (1999), 19, 497±508

et al., 1996; Staiger et al., 1993). To further substantiate

these data, we carried out genomic PCR analysis using two

primers (PROF3 and PROF5) directed towards two highly

conserved regions found in all reported plant pro®lins, and

which cover part of the pro®lin amino and carboxy

terminal coding sequences, respectively. After completing

the PCR reaction in the presence of common bean DNA,

we analysed the ampli®ed products by agarose electro-

phoresis. A single band that presumably contained two

small introns (Figure 2), was ampli®ed (Figure 3, lanes 2

and 4), suggesting that only one copy of the gene could be

ampli®ed from these primers, or that both genes have two

introns with similar additive size. RT±PCR shown in Figure

3, lanes 3 and 5, indicated that the additive length of both

introns could be about 600 bp.

Multiple pro®lin isoforms in Phaseolus vulgaris root

nodule extracts

Previous results had indicated that in hypocotyls and

nodules from P. vulgaris, only one isoform of pro®lin was

present. These data were obtained by PLP-Sepharose

chromatography, equilibrated with 100 mM KCL, washed

with 3 M urea and then eluted with 8 M urea. By this

method only 10±30% of the pro®lin found in the crude

extracts was recovered. Western blots were made by using

a high dilution of the antipro®lin antibody (1:10 000) for the

immunoblotting and a short incubation time (60 min)

(Vidali et al., 1995).

In the present study, we made two important modi®ca-

tions in order to analyse all the pro®lin present in the crude

extract and to increase the sensitivity for the detection in

the Western blot experiments. We used crude homoge-

nates from roots and nodules and both the primary

antibody concentration (1:2500) and incubation time (12 h

at 4°C instead of 1 h at 25°C) were increased; and most

importantly, the PLP-Sepharose column was avoided for

this experiment since we have recently found that a

considerable amount of pro®lin is eluted from the af®nity

column when washed with 1±3 M urea, and that a minor

amount still remains bound after the 8 M urea elution

(GuilleÂn et al. manuscript in preparation). These improve-

ments resulted in the detection of several pro®lin isoforms

in the crude extracts. We observed that, in roots, two

isoforms were present of pI's 4.4 and 4.6 (Figure 4a). In

contrast, in nodules, two major isoforms of pI's 4.6 and 5

as well as three minor isovariants of pI's 4.4, 5.4 and 5.8

(Figure 4b) were detected, suggesting a differential iso-

form expression in the nodules with respect to the roots.

Nevertheless, given the Southern blot results, some of

these isoforms with diverse isoelectric points could be due

to factors other than differential gene expression such as

alternative splicing or post-translational modi®cations.

In vitro translation analysis of root-nodules mRNA

We performed in vitro translation assays of nodule mRNA

in which we radiolabelled the translated products with

[35S]-methionine. The radiolabelled products were immu-

noprecipitated and analysed by two-dimensional SDS±

PAGE. After autoradiography of the gels, a single isoform

of pI 5.8 which corresponded to the most basic isoform

found in the nodule extracts, was observed (Figure 4c).

These data suggest that, in root nodules (and probably in

all vegetative organs), a single transcript gives rise to

multiple pro®lin isoforms, and that four out of ®ve

isoforms are most likely generated by post-translational

modi®cations. Interestingly, although a maximum number

of ®ve isoforms is found, the ratio of major/minor pro®lin

isoforms varies in different tissues and developmental

stages (GuilleÂn et al., manuscript in preparation).

Pro®lin is phosphorylated on tyrosine residues

In order to determine the nature of the post-translational

modi®cations, seedlings were incubated in phosphate-free

medium with 32P-orthophosphate and pro®lin was puri®ed

by a modi®ed PLP-af®nity chromatography (see experi-

mental procedures). After pro®lin was separated by SDS±

PAGE, a 14 kDa radioactively labelled protein was detected

(Figure 5a, lane 2). This same band was identi®ed with

antipro®lin antibody (Figure 5a, lane 1), suggesting that

Figure 2. Map of pro®lin cDNA from Phaseolus vulgaris.The locations of putative introns are indicated by triangles, pointing to aminoacid positions 41/42 and 87/88. The non-coding region is represented by theshaded rectangles and the coding region is indicated by white rectangles. Sau 3a1 restriction sites are indicated at the top of the bar. The arrows show thepositions of the oligonucleotides (E1, E2) that were used to PCR amplify a 130 bp fragment which was used to probe the Southern blot.

Bean pro®lin is tyrosine-phosphorylated 499

ã Blackwell Science Ltd, The Plant Journal, (1999), 19, 497±508

pro®lin was phosphorylated. The identity of the putative

phosphoaminoacid(s) present in the 14 kDa band, was

assessed by the following methods.

TLC phosphoamino acid analysis, and acid or alkali

treatments of [32P] in vivo labelled pro®lin. An excised

piece of membrane containing the [32P]-in vivo -labelled

pro®lin was acid hydrolysed and phosphoaminoacids

were separated by TLC chromatography. Figure 5(b), lane

1, shows that no radioactive signal was detected on the

phosphoserine and phosphothreonine positions, only

radioactive phosphotyrosine was detected in the TLC

autoradiogram. Nevertheless, the previous result had to

be corroborated by an alternative method, as well as we

had to explore the possibility that pro®lin could be

phosphorylated on additional aminoacids besides tyrosine

residues. Treatment of phosphoproteins with acid is a

suitable method to discriminate if a protein is phosphory-

lated on histidine residues. EnvZ, is an inner membrane

histidine kinase that belongs to a two component regula-

tory system responding to environmental stimuli (Kenney,

1997). We used EnvZ as a positive control to corroborate if

pro®lin could be phosphorylated on histidine residues.

Figure 5(c) presents the acid and alkali treatments of

blotted pro®lin which was puri®ed and separated by the

above procedure (lanes 2, 4 and 6). Figure 5(c), lanes 1, 3

and 5 contained equal amounts of a crude extract from a32P-metabolically labelled E, coli DH5aIQ strain containig

plasmid pIM25 (see Experimental procedures) which was

grown in high osmolarity conditions (MartõÂnez-Flores

et al., 1999). Blots with lanes 1 and 2 were subjected to

alkaline treatment, lanes 3 and 4 were acid treated, and

untreated controls (lanes 5 and 6) were incubated with

0.5 M Tris±HCl (pH 8.8) according to Gamble et al. (1998).

The fact that phospho-pro®lin is resistent to both treat-

ments corroborated the TLC result, indicating that this

protein is phosphorylated on tyrosine and not on serine

Figure 4. Two D-PAGE analysis of Phaseolusvulgaris pro®lin isoforms from root, root-nodules, and immunoprecipitated in vitrotranslation products from root-nodulemRNA.Protein extracts from roots (a) and root-nodules (b) were prepared and fractionatedon two dimensional O'Farrell gels andpro®lin isoforms were detected byimmunoblot analysis with pro®lin speci®cantibodies. Root-nodule polysomal RNAwas in vitro translated in rabbit reticulocytelysate containing 50 mCi [35S]-methionine.Pro®lin was immunoprecipitated withantipro®lin antibodies, fractionated by 2D-PAGE, subjected to ¯uorography andexposed to X-ray ®lm (c). The pH gradientranged from 4.0 to 6.5.

Figure 3. Pro®lin RT±PCR and PCR analysis from Phaseolus vulgaris.Genomic DNA (lane 2) and cDNA (lane 3) synthesised from nodulemRNA were quanti®ed and subjected to serial PCR ampli®cations withspeci®c pro®lin primers (PROF3 and PROF5). A Southern blot of the PCRproducts from genomic DNA (lane 4) and cDNA (lane 5) reveals only onepro®lin gene product.

500 Gabriel GuilleÂn et al.

ã Blackwell Science Ltd, The Plant Journal, (1999), 19, 497±508

and threonine residues. Furthermore, the acid treatment

shown in Figure 5(c), lanes 3 and 4, eliminated the

presence of phosphohistidine residues on pro®lin since

these are acid-labile in EnvZ.

Immunoprecipitation and Western blotting with different

antibodies. Commercial antiphosphotyrosine, antipho-

sphoserine, antiphosphothreonine and bean antipro®lin

speci®c antibodies were reacted with nodule extracts. The

results (Figure 6, lanes 3±5) showed a 14 kDa band

immunoprecipitated by three different antiphosphotyro-

sine antibodies, which was also recognised by the

antipro®lin antibodies. Conversely, the same 14 kDa band

immunoprecipitated with the antipro®lin antibodies was

also detected by the antiphosphotyrosine antibodies

(Figure 6, lane 6). Although three different antiphosphotyr-

osine antibodies clearly cross-reacted with pro®lin (Zymed

Laboratories, San Francisco, CA, USA), neither the anti-

phosphoserine nor the antiphosphothreonine antibodies

tested gave any positive signal with this protein (data not

shown). Antibodies previously incubated with phospho-

tyrosine completely abolished the immunodetection reac-

tion (Figure 6, lane 7) and the recognition of tyrosine

phosphorylated proteins in an extract of a mouse ®bro-

blast cell line L9±29 (Figure 6, lane 8).

Phosphatase treatments. To con®rm that native pro®lin

was phosphorylated on tyrosine residues, two different

phosphatase treatments were performed. Two of the most

prominent acidic root-nodule pro®lin isoforms were

selectively eluted from the poly L-proline af®nity chroma-

tography column, which was ®rst washed with 1 M KCl and

then eluted with 8 M urea. Acid isoforms were treated with

either calf thymus alkaline protein phosphatase (APP),

which dephosphorylates proteins speci®cally at ser/thr,

and Arabidopsis thaliana protein tyrosine phosphatase

(AtPTP1) (Xu et al., 1998), which dephosphorylates only at

tyrosine residues (see Experimental procedures).

Enzymatic dephosphorylation reactions were analysed by

2D-PAGE and the pI mobility shifts of the isoforms were

assessed. We observed that the pIs of the acid nodule

pro®lin isoforms (pI 4.6 and 5.0) remained unchanged with

alkaline phosphatase treatment (data not shown).

Conversely, when these acidic pro®lins were treated with

AtPTP1, only the pI 5.3 isoform was observed (Figure 7b).

Taken together, the chromatographical, chemical, immu-

nological and enzymatic experiments indicated that pro®-

lin isoforms could be generated by in vivo phosphoryla-

tion on tyrosine residues in P. vulgaris.

Discussion

Recent advances in our understanding on the regulation of

the actin cytoskeleton in plants have been made on two

fronts: ®rst, the isolation and characterisation of the actin

protein itself (Ren et al., 1997), and its gene families

(McKinney and Meagher, 1998; Meagher, 1995); and

second, on the identi®cation, cell localisation and char-

acterisation of pro®lin and other actin binding proteins

(ABP's) (Asturias et al., 1997b; Christensen et al., 1996;

Huang et al., 1996; Lo pez et al., 1996; McCurdy and Kim,

1998; Nakayasu et al., 1998; Staiger et al., 1993; Vidali and

Hepler, 1997; Xu et al., 1992; Yang et al., 1993; Yokota et al.,

1998).

One transcript gives rise to multiple pro®lin isoforms in

P. vulgaris

By a modii®ed detection procedure we observed as

many as ®ve isoforms in nodule extracts (Figure 4b),

Figure 5. Pro®lin phosphorylation in vivo.In vivo labelled pro®lin was puri®ed, separated by SDS±PAGE andtransferred to Hybond C-extra. Pro®lin was detected with antipro®lin-speci®c antibodies (panel a, lane 1) and the labelled proteins werelocalised on the PhosphorImager(panel a, lane 2). The excised piece ofmembrane containing the labelled band was HCl-hydrolysed. Labelledaminoacids (panel b, lane 1) and commercial phosphoaminoacids (panelb, lane 2) were separated by TLC. Panel (c) shows treatments of in vivo-labelled pro®lin (lanes 2, 4 and 6) with alkali-(lanes 1, 2), acid-(lanes 3, 4)and non-treated control with only Tris±HCl, pH 8.8 (lanes 5,6). Lanes 1, 3and 5, contained equal amounts of a crude extract from an E. coliDH5aIQ strain, overexpressing EnvZ, an E. coli protein phosphorylatedon histidine residues (see Experimental procedures; upper left arrow). Asexpected, the phosphate on the protein was labile to acid treatment (lane3). However, alkali treatment (lane 1) did not remove the phosphate andthus, showed identical results to the untreated control (lane 6). Someother high molecular weight proteins resistant to both the acid and alkalitreatment, and therefore, probably phosphorylated on tyrosine residueswere also observed (lanes 1, 3 and 5).

Bean pro®lin is tyrosine-phosphorylated 501

ã Blackwell Science Ltd, The Plant Journal, (1999), 19, 497±508

two major and three minor. Most of these had escaped

detection from our previous analysis (Vidali et al., 1995).

This is somewhat different to what has recently been

reported for pro®lin in Phleum pratense (timothy grass),

which is encoded by a multigene family and that by

isoelectrofocusing of highly puri®ed pro®lin the pre-

sence of at least ®ve isoforms was observed (Asturias

et al., 1997a).

By genomic Southern blot analysis with a P.vulgaris

pro®lin cDNA fragment, we were unable to detect more

than two bands with DNA from a single plant restricted

with different enzymes (Figure 1). The fact that only one

PCR product instead of two, was ampli®ed from the bean

genomic DNA (Figure 3, lanes 2 and 4) could arise if both

pro®lin genes had introns with similar lengths, as is the

case of two Arabidopsis pro®lin genes, PFN1 and PFN2

(Christensen et al., 1996). The size of the intron in the

aminoacid position 41/42 is 507 bp and in the position 87/

88 is 92 bp for PNF1; and 479 bp and 111 bp for PFN2,

respectively (Christensen et al., 1996). Furthermore, we

detected only one pro®lin isoform from in vitro translation

products (Figure 4c), which represents the most basic

isoform (pI 5.8) of those found in the nodule extracts

(Figure 4b). Since these results suggest that pro®lin in

P.vulgaris is encoded by two genes at the most, it could be

speculated that one is pollen-speci®c and the other is

expressed vegetatitively in all tissues by analogy to other

plants. (Christensen et al., 1996; Huang et al., 1996; Yu

et al., 1998).

Post-translational modi®cation of pro®lin by tyrosine-

phosphorylation, actin cytoskeleton regulation and

signal-transduction

It is now known that plant pro®lin can dramatically alter

the actin organisation in Tradescantia stamen hair cells

(Staiger et al., 1994; Valster et al., 1997). This interaction

with actin as well as its ability to interact with phosphoi-

nositides renders this protein a versatile cytoskeletal

regulator and a key component of signal transduction

events (Drùbak et al., 1994). Recently published data

provided evidence that pollen pro®lin not only plays a

role in regulating the actin cytoskeleton but that it also

interacts in vitro with cytosolic components affecting

protein phosphorylation, probably by modulating the

activity of protein kinases or phosphatases (Clarke et al.,

1998).

Phosphate, phosphopeptides, and the individual phos-

phoamino acids from puri®ed samples can be resolved

adequately in one dimension chromatography at pH 3.5

(van der Geer et al., 1993). TLC analysis of individual

phosphoamino acids generated by acid-hydrolysis of 32P

in in vivo-labelled puri®ed pro®lin indicated that Tyr

residues were phosphorylated (Figure 5b, lane 1).

Sometimes dipeptides phosphorylated on ser/thr can

migrate at the position of phosphotyrosine in one-dimen-

Figure 6. Pro®lin can be immunoprecipitatedwith antiphosphotyrosine antibodies.Pro®lin was immunoprecipitated from root-nodule extracts with antiphosphotyrosineantibodies (lanes 2, 3, 4) and antipro®linantibodies (lanes 5, 6, 7), separated by SDS±PAGE and transferred to a Hybond C-Extramembrane. A Western blot was carried outand the membranes probed withantiphosphotyrosine antibodies (lanes 6, 7,8, 9) and antipro®lin antibodies (lanes 1±5).Lane 1 contains root-nodule extract. Lanes 8and 9 contained 15 mg of extract frommouse ®broblast L9±29 cell line. In lanes 7and 8, antiphosphotyrosine antibodies werepreviously incubated with phosphotyrosineas an internal control for immunospeci®city.

Figure 7. Pro®lin dephosphorylation with AtPTP1, a plant tyrosinephosphatase.Acidic pro®lin isoforms were selectively eluted from a PLP-column andtreated with 100 ng ml±1 of protein tyrosine phosphatase fromArabidopsis (AtPTP1). Untreated (a), and dephosphorylated samples (b),were separated by 2D-PAGE, transferred and blotted with the antipro®linantibody.

502 Gabriel GuilleÂn et al.

ã Blackwell Science Ltd, The Plant Journal, (1999), 19, 497±508

sional analysis, this possibility seems to be unlikely since

there are no contiguous ser/thr residues present in the

pro®lin sequence (Vidali et al., 1995). Although we did not

see any changes after alkaline phosphatase treatment

(data not shown), phosphorylations at ser/thr cannot be

ruled out based just on this treatment, since this enzyme is

not able to remove all phosphates from Ser/Thr in all

proteins. Similarly, although alkaline treatment (Figure 5c,

lane 2) supports the result obtained with the TLC and

phosphatase treatments, it does not de®nitely eliminate

this possibility. On the other hand, acid treatment (Figure

5c, lane 4) of phosphorylated pro®lin suggests that the

presence of phosphorylated histidines is very unlikely,

since these are acid labile, as shown for EnvZ (Figure 5c,

lane 3).

Tyrosine phosphatase (AtPTP1) activity effectively

removed the phosphate on tyrosine residues from

pro®lin isoforms with pI 4.6 and 5.0. Although the pI

4.4 isoform was not detected in this particular sample,

tyrosine phosphatase treatment on other pro®lin pre-

parations from nodules and other tissues, indicated that

this pI 4.4 isoform is also tyrosine phosphorylated (data

not shown). In this regard, it is important to remark that

the most basic isoform (pI 5.8) was not observed after

the AtPTP1 ezymatic treatment. This result was repeated

several times and although there is no simple explana-

tion for this, it is possible that the pI 5.4 isoform could

still be tyrosine phosphorylated albeit, not being a

substrate for AtPTP1. The other possibility is that the

pI 5.4 isoform has other(s) modi®cation(s) that are yet

to be identi®ed. From the data here presented we

suggest that, in P. vulgaris, pro®lin isoforms could be

generated by post-translational modi®cations, speci®-

cally phosphorylations on tyrosine residues. This would

be the ®rst strong evidence for the existence of tyrosine

protein kinases in plants, being pro®lin a physiological

substrate.

Among the 9 highly conserved aminoacids in all

eukaryotic pro®lins (Staiger et al., 1993), two are Tyr

residues (equivalent positions Tyr 6 and Tyr 125 in the

bean sequence). The consensus sequence (100% con-

served residues) in all reported plant pro®lins show

conserved Tyr residues at positions 6, 72, 106, 125

(Vidali et al., 1995). Additionally, bean pro®lin has an

extra tyrosine residue at position 66. Protein modelling

indicates that all tyrosine residues except Tyr 72 are

located on the surface of the molecule (data not

shown).

Although we do not have a clear idea of which could be

the functional implications of pro®lin tyrosine phosphor-

ylation, it is possible that this could affect its af®nity for

poly L-proline binding which could, in turn, modify its

cellular spatial/temporal functions. This is based on the

fact that it has been reported that a maize pro®lin gain-of-

function mutant, where tyrosine 6 was mutagenized to

phenylalanine (ZmPRO1-YF6) was found to enhance its

poly L-proline binding activity and to more rapidly disrupt

cytoarchitecture, implicating that the binding for this

ligand might have important consequences for the regula-

tion of actin cytoskeletal dynamics in plant cells (Gibbon

et al., 1998). Consistent with this result, we have found that

the most basic isoform (pI 5.8), remains tightly bound to

the poly L-proline column after the 8 M elution step (data

not shown).

Phosphorylation is one of the key mechanisms for the

regulation of actin cytoskeleton function

Many cytoskeletal proteins are known to be phosphory-

lated usually reversibly and with important functional

consequences. In plants, the maize-actin-depolymerizing

factor, ZmADF3 is phosphorylated on Ser6 by a calcium-

stimulated protein kinase. Phosphorylated ZmADF3 does

not bind G- or F-actin and has a negligible effect on

accelerating the rate of disassembly of actin ®laments,

therefore remodelling of F-actin could be mediated by

reversible phosphorylation of ADF (Smertenko et al.,

1998).

In recent years, several reports indicate that phos-

phorylation and dephosphorylation of both, tubulin (Cox

and Maness, 1993; MacRae, 1997), and actin regulate

their functions in several organisms (De Corte et al.,

1996; van Delft et al., 1995; Furuhashi et al., 1998). It has

been reported that actin in Dictyostelium discoideum is

tyrosine phosphorylated by stress conditions (Jungbluth

et al., 1995). In dormant spores, half of the actin

molecules are tyrosine-phosphorylated; such high levels

of phosphorylated actin seem to be required for

maintaining dormancy (Kishi et al., 1998). Other actin

cytoskeletal proteins have been reported to be phos-

phorylated on tyrosine residues (Jiang et al., 1995) and

many of them are known to be potential Src substrates

(Flynn et al., 1993).

To date, the evidence for tyrosine phosphorylation in

plant proteins is still limited (Duerr et al., 1993;

HaÊ kansson and Allen, 1995; Suzuki and Shinshi, 1995;

Torruella et al., 1986; Trojanek et al., 1996; Zhang et al.,

1996). In tobacco cells treated with a fungal elicitor, a

protein kinase is transiently activated by tyrosine

phosphorylation (Suzuki and Shinshi, 1995). Mitogen-

activated protein kinase (MAPK) cascades are thought to

have important roles in stress signal transduction path-

ways in higher plants (Mizoguchi et al., 1997). Also in

tobacco BY-2 cells, it has been reported that auxin-

induced activation of two MAP kinase homologues

ocurrs by rapidly increasing the extent of phosphoryla-

tion of some of their threonine and tyrosine residues,

by a MAPK-kinase activity (Mizoguchi et al., 1994).

Bean pro®lin is tyrosine-phosphorylated 503

ã Blackwell Science Ltd, The Plant Journal, (1999), 19, 497±508

Additionally, RodrõÂguez-Zapata and HernaÂndez-

Sotomayor (1998) recently demonstrated the presence

of two phosphoproteins, 63 and 40 kDa proteins in

Catharanthus roseus hairy roots. Published data by the

same group (Islas-Flores et al., 1998) presented changing

pro®les of Tyr-phosphorylated proteins and Tyr-kinase

activity suggesting that this kinase has a role in coconut

zygotic embryo development.

The phosphorylation of proteins on tyrosine can also be

controlled by PTPases (Luan, 1998); in this regard, AtPTP1

is the ®rst tyrosine-speci®c protein phosphatase from

plants to be described (Xu et al., 1998). In this report we

present evidence that phosphorylated bean pro®lins are a

substrate, at least in in vitro conditions, for this novel plant

phosphatase (Figure 7).

Animal pro®lin has been shown to be an in vitro

substrate of puri®ed human placental protein kinase C

(PKC); such activity is speci®cally stimulated by phospha-

tidylinositol bisphosphate (PIP2) (Hansson et al., 1988). The

results presented in this paper propose a novel and

interesting in vivo regulatory pathway not previously

described for pro®lin.

Finally, SH2 (Src homology) domains are implicated

in signal-transduction pathways regulating cellular

growth and morphogenesis, cytokinesis, and actin

organisation. Thus, the regulation of plant pro®lins by

tyrosine kinases/tyrosine phosphatases could also have

an impact on modulating micro®lament assembly and

cell signalling processes since tyrosine phosphorylation

acts as a switch to induce the binding of SH2 domain-

containing proteins. Up to date, proteins bearing these

domains have been described only for animal systems

(Koch et al., 1991).

Experimental procedures

Biological materials

Bean (Phaseolus vulgaris L., cv. Negro jamapa) seeds weregerminated for 6 days on sterile trays in complete darkness at25°C. Six-day-old roots were collected in liquid nitrogen andstored a ±70°C until use. Alternatively, bean seeds were germi-nated for two days and transferred to pots, inoculated withRhizobium tropici strain CIAT 899. Root nodules were harvestedand stored at ±70°C until use.

Protein extraction

Root and nodule soluble protein fractions were prepared bygrinding approximately 3 g of frozen tissue with liquid nitrogenand by resuspension at 4°C in extraction buffer (140 mM NaCl,2.8 mM NaH2PO4, 7.2 mM Na2HPO4, 1 mM b-mercaptoethanol,pH 7.5). The homogenate was ®ltered through two layers ofcheesecloth and centrifuged at 10 000 g for 15 min. The super-natant was recovered and ®ltered through miracloth, storedfrozen at ±70°C or used immediately for analysis.

Gel electrophoresis, immunoblotting and

autoradiography

Samples were boiled in Laemmli's sample buffer for 5 min andseparated by 15% SDS±PAGE (Laemmli, 1970). Two-dimensionalgel electrophoresis (2D-PAGE) was carried out as described byO'Farrell (1975) with the modi®cations recommended by HoeferScienti®c Instruments for mini-gels. Gels were transferred for 3 hat 400 mA onto nitrocellulose sheets in Towbin's transfer buffer(Towbin et al., 1979) and blocked with 3% (w/v) bovine serumalbumin in PBS (140 mM NaCl, 2.8 mM NaH2PO4, 7.2 mM Na2HPO4,pH 7.5) for 1 h at 50°C. The blocked membranes were immunos-tained by incubating overnight at 4°C with antipro®lin antibodies(Vidali et al., 1995) and 2 h at 25°C with alkaline-phosphataseconjugated goat anti-rabbit IgG (Boehringer MannheimBiochemica, Indianapolis, IN, USA). The bands were visualisedwith the substrate mixture as recommended by the manufacturer.Gels with [35S]-labelled proteins were processed for ¯uorographywith AmplifyTM (Amersham, Arlington Heights, IL, USA) andexposed to X-ray Hyper®lm (Kodak, Rochester, NY, USA). Theisoelectric points of the pro®lin isoforms were estimated from theposition of the marker proteins from IEF mix (Sigma, St. Louis,MO, USA).

Genomic Southern blot

Genomic DNA was isolated from P. vulgaris leaves. To avoidpolymorphisms, DNA was obtained from single individuals. Toisolate the DNA, we used the CTAB isolation procedure asreported by Doyle et al. (1990) and CTAB precipitation step assuggested by Dellaporta et al. (1983). DNA was restricted and 5 mgof DNA per lane were loaded. The DNA was transferred to HybondN+ nylon membranes using 0.4 N NaOH. The blot was prehy-bridised for 2 h with 53 SSC, 0.5% SDS and 200 mg ml±1 heparinat 65°C. Hybridisation was done overnight under the sameconditions, with approximately 7 3 106 cpm ml±1 of 32P labelledpro®lin full length cDNA. The blot was washed twice with 0.13

SSC, 0.5% SDS at 65°C. For the low stringency conditions, the blotwas pre-hybridised and hybridised with 53 SSC, 0.5% SDS and200 mg ml±1 heparin at 42°C, and washed with 23 SSC, 0.5% SDSat 45°C. The blots were exposed to X-Omat X-ray ®lm (Kodak) at ±70°C.

In vitro translation and immunoprecipitation

Total polysomal RNA (10 mg) was translated in vitro in 10 ml ofreticulocyte lysate, as described by the manufacturer (BoehringerMannheim Biochemica, Indianapolis, IN, USA), containing 50 mCiof [35S]-methionine and incubated for 60 min at 30°C. The in vitrotranslation products were diluted ®vefold with buffer B (150 mM

NaCl, 1% (w/v) sodium dodecyl sulfate, 1% (v/v) nonidet-P40, 1%(w/v) sodium deoxycholate, 100 Kallikrein inactivator units ml±1

aprotinin, 10 mM sodium phosphate, pH 7.2) (BoehringerMannheim Biochemica, Indianapolis, IN, USA). The sampleswere pre-adsorbed with a non-immune rabbit serum for 15 minat 4°C, treated with staphylococci-bound protein A and incubated15 min at 4°C. Following the removal of-non-speci®c antibody-antigen complexes, the samples were incubated with pro®lin-speci®c antibodies (®nal dilution 1/50) and incubated 120 min at4°C. Antibody-antigen complexes were sedimented withStaphylococcus-bound protein A. The suspension was centri-fuged at 12 000 g for 3 min and the pellet was washed extensively

504 Gabriel GuilleÂn et al.

ã Blackwell Science Ltd, The Plant Journal, (1999), 19, 497±508

(53) in buffer B. Precipitated complexes were released bytreatment of the pellet with 2% (v/v) nonidet P-40, 5% (v/v)b-mercaptoethanol and heated 5 min at 95°C. The sample wasadded with 9.5 M urea, 2% (v/v) ampholines and analysed by 2D-PAGE (O'Farrell, 1975).

Southern blotting and PCR analysis

PCR primers PROF5 (5¢ CGGATCCATGTCGTGGCAAACGTACG-TCG 3¢) and PROF3 (5¢ GGAATTCGAGACCCTGTTCAATGAGA-TAATCACC 3¢) corresponding to the pro®lin terminal coding andanticoding sequences, respectively, were used to amplifyPhaseolus genomic DNA by PCR. Genomic DNA (1 mg) was mixedwith 20 pmol of each oligonucleotide primer and ampli®ed withTaq DNA Polymerase (Boehringer Mannheim Biochemica,Indianapolis, IN, USA) during 35 cycles with: 94°C, 60 sec fordenaturing; 50°C, 90 sec for annealing; and 72°C, 120 sec forsynthesis. The products were hybridised to a pro®lin cDNA probe.PCR primers E1 sense (5¢ CGGGATCCCCGGAAGAAATA ACT-GGGATC 3¢) and E2 antisense (5¢ GGAATTCCTTGCCTCGAATGACAGAGC 3¢) were used to amplify the exon II fragment.Reaction was run 1 cycle for 3 min at 94°C for denaturing; 1 min at58°C for annealing and 1 min at 72°C for synthesis during 30cycles.

Immunoprecipitation and immunoblotting

Equal amounts of root-nodule protein were immunoprecipitatedwith either antiphosphotyrosine antibodies (13±5900, 13±6300and 61±5800; Zymed Laboratories, Inc San Francisco, CA, USA) orantipro®lin antibodies (Vidali et al., 1995). The samples wereincubated for 10 h at 4°C and the complexes were collected withproteinA-agarose as recommended by the manufacturer(Boehringer Mannheim). The samples were separated by SDS±PAGE, and transferred to Hybond C-extra. Anti-phosphotyrosine-immunoprecipitated proteins were probed with antipro®lin anti-body and the antipro®lin immunoprecipitates were detected withantiphosphotyrosine antibody. The immunolabelled proteinbands were developed with the appropriate horseradish perox-idase-conjugated secondary antibody by chemiluminescenceaccording to the manufacturer instructions (BoehringerMannheim). Anti-phosphotyrosine antibodies (1.5 mg ml±1 of 13±5900) were preincubated with 50 mM phosphotyrosine for 2 h at4°C.

In vivo 32P labelling of pro®lin and phosphaminoacid

analysis

Bean seeds were germinated for 2 days on sterile trays incomplete darkness at 25°C. Seedlings were incubated 24 h inphosphate-free Farhaeus medium with 1 mCi [32P]-orthopho-sphate and harvested. Proteins were extracted with two volumesof buffer A (10 mM Tris pH 7.0; 0.5 mM CaCl2; 0.01% NaN3; 50 mM

NaF, 30 mM NaPPi; 0.4 mM ATP; 0.5 mM DTT; 0.5 mM PMSF;100 mM sodium orthovanadate and PI cocktail) and centrifuged at30 000 g for 20 min to remove insoluble debris. The supernatantwas added to PLP-agarose beads pre-equilibrated with PBS(140 mM NaCl; 2.8 mM NaH2PO4; 7.2 mM Na2HPO4) at 4°C.Pro®lin was eluted from the PLP-column with 30% DMSO.Radiolabelled pro®lin was separated by SDS±PAGE, transferredto Hybond C-extra, localised on the PhosphorImager (MolecularDynamics, Chesham, UK), and identi®ed by the antipro®lin

antibodies. The excised Hybond C-extra membrane piece contain-ing the [32P]-labelled protein was acid hydrolysed and phospho-aminoacids were separated by TLC according to Islas-Flores et al.(1998).

Phosphatase treatments

Root-nodule proteins were extracted with two volumes of bufferA and centrifuged at 30 000 g for 20 min to remove debris. Thesupernatant was added to a PLP-agarose column pre-equilibratedwith buffer A at 4°C and washed with three volumes of buffer A.Pro®lin was eluted from the PLP column with 8 M urea. Proteinswere separated by SDS±PAGE and transferred to Hybond C-extra.The pro®lin isoforms were treated with, either 10 U of calf thymusalkaline protein phosphatase (APP) (Boehringer Mannheim) for1 h at 37°C (dephosphorylates proteins speci®cally at ser/thr), orwith 100 ng ml±1 of tyrosine phosphatase enzyme (AtPTP1) fromArabidopsis (Xu et al., 1998) for 3 h at 30°C. Dephosphorylatedsamples were separated by 2D-PAGE, transferred and blottedwith antipro®lin antibodies. E. coli DH5aIQ strain with plasmidpIM25 was grown in 0.3 M NaCl (high osmolarity conditions)(MartõÂnez-Flores et al., 1999). The strain was incubated in minimalmedium without phosphates in presence of 32P-orthophosphate(Amersham Corp.) for 2 h. The labelling was terminated byprecipitation with trichloroacetic acid to a ®nal concentration of5%. The pellets were resuspended in urea buffer (50 mM Tris±HCl,pH 7.2, 6 M urea, 1% SDS) and crude extracts were separated bySDS±PAGE on a 15% acrylamide gel and blotted onto anitrocellulose membrane (Millipore, Bedford, MA, USA). Proteinconcentration was estimated by the Bradford method (Bradford,1976).

Acknowledgements

This work was partially supported by grants from CONACyT27640-N, and DGAPA-UNAM, IN 212298, and IN201696. Technicalassistance from Mario Trejo and Georgina Estrada is acknowl-edged. L. Vidali had a PhD fellowship from DGAPA. We aregrateful to Dr Sheng Luan for kindly providing recombinantAtPTP1, to Dr Edmundo Calva for E. coli DH5aIQ strain withplasmid pIM25, Dr Carlos Rosales for the L9±29 cell line extractand anti PY antibodies, and to Gerard van der Kroght who did partof the genomic Southern-blotting experiment. Finally to CarmenQuinto and Jimena DomõÂnguez for critically reading the manu-script and to Drs Yvonne Rosenstein a Gustavo Pedraza forenlightening discussions. The BQ Company is acknowledged forthe generous gift of antiphosphoaminoacid antibodies.

References

Archer, J.S., Vinks, V.K., Pollard, T.D. and Torchia, D.A. (1994)Elucidation of the poly-L-proline binding site inAcanthamoeba pro®lin I by NMR spectroscopy. FEBS Lett.357, 145±151.

Asturias, J.A., Arilla, M.C., Bartolome, B., MartõÂnez, J., MartõÂnez,

A. and Palacios, R. (1997a) Sequence polymorphism andstructural analysis of timothy grass pollen pro®lin allergen(Phl, p. 11) Biochim. Biophys. Acta, 1352, 253±257.

Asturias, J.A., Arilla, M.C., Go mez-Bayo n, N., MartõÂnez, A.,

MartõÂnez, J. and Palacios, R. (1997b) Recombinant DNAtechnology in allergology: cloning and expression of plantpro®lins. Allergol. Inmunopathol. 25, 127±134.

Bean pro®lin is tyrosine-phosphorylated 505

ã Blackwell Science Ltd, The Plant Journal, (1999), 19, 497±508

Bradford, M.M. (1976) A rapid and sensitive method for thequanti®cation of microgram quantities of protein utilizing theprinciple of protein-dye binding. Anal. Biochem. 72, 248±254.

Chang, F., Drubin, D. and Nurse, P. (1997) Cdc12p, a proteinrequired for cytokinesis in ®ssion yeast, is a component of thecell division ring and interacts with pro®lin. J. Cell Biol. 137,169±182.

Christensen, H.E.M., Ramachandran, S., Tan Chio-Tee, Surana,U., Dong, C.-H. and Chua, N.-H. (1996) Arabidopsis pro®lins arefunctionally similar to yeast pro®lins: identi®cation of avascular bundle-speci®c pro®lin and pollen-speci®c pro®lin.Plant J. 10, 269±279.

Clarke, S.R., Staiger, C.J., Gibbon, B.C. and Frankling-Tong, V.(1998) A potential signalling role for pro®lin in pollen ofPapaver rhoeas. Plant Cell, 10, 967±979.

Cox, M.E. and Maness, P.F. (1993) Tyrosine phosphorylation ofalpha-tubulin is an early response to NGF and pp. 60v-src inPC12 cells. J. Mol. Neurosci. 4, 63±72.

De Corte, V., Gettemans, J., Eaelkens, E. and Vandekerckhove, J.(1996) In vivo phosphorylation of actin in Physarumpolycephalum. Study of the substrate speci®city of the actin-fragmin kinase. Eur. J. Biochem. 241, 901±908.

van Delft, S., Verkleij, A.J., Boonstra, J. and van Bergen enHonegouwen, P.M.P. (1995) Epidermal growth factor inducesserine phosphorylation of actin. FEBS Lett. 357, 251±254.

Dellaporta, S.L., Wood, J. and Hicks, J.B. (1983) A Plant DNA.Minipreparation, Version II. Plant Mol. Biol. Report, 1, 19±21.

Doyle, J.J., Doyle, J.L. and Hortorin, L.B.H. (1990) Isolation ofplant DNA from fresh tissue. Focus, 12, 13±15.

Drùbak, B.K., Watkins, P.A.C., Valenta, R., Dove, S.K., Lloyd, C.W.and Staiger, C.J. (1994) Inhibition of plant plasma membranephosphoinositide phospholipase-C by the actin-bindingprotein, pro®lin. Plant J. 6, 389±400.

Duerr, B., Gawienowski, M., Ropp, T. and Jacobs, T. (1993)MsERK1: a mitogen-activated protein kinase from a ¯oweringplant. Plant Cell, 5, 87±96.

Evangelista, M., Blundell, K., Longtine, M.S., Chow, C.J., Adames,N., Pringle, J.R., Peter, M. and Bonne, C. (1997) Bni1p, a yeastformin linking Cdc42p and the actin cytoskeleton duringpolarised morphogenesis. Science, 276, 118±122.

Flynn, D.C., Leu, T.H., Reynolds, A.B. and Parsons, J.T. (1993)Identi®cation and sequence analysis of cDNAs encoding a 110-kilodalton actin ®lament-associated pp. 60src substrate. Mol.Cell Biol. 13, 7892±7900.

Furuhashi, K., Ishigami, M., Suzuki, M. and Titani, K. (1998) Drystress-induced phosphorylation of Physarum actin. Biochem.Biophys. Res. Commun. 242, 653±658.

Gamble, R.L., Coon®eld, M.L. and Schaller, G.E. (1998) Histidinekinase activity of the ETR1 ethylene receptor from Arabidopsis.Proc. Natl Acad. Sci. USA, 95, 7825±7829.

van der Geer, P., Luo, K., Sefton, B.M. and Hunter, T. (1993)Phosphodipeptide mapping and phosphoaminoacid analysison cellulose thin-layer plates. In Protein Phosphorylation. APractical Approach Volume 2 (Hardie, D.G., ed.) Oxford: IRLPress, pp. 31±59.

Gibbon, B.C., Zonia, L.E., Kovar, D.R., Hussey, P.J. and Staiger,C.J. (1998) Pollen pro®lin functions depends on interaction withproline-rich motifs. Plant Cell, 10, 981±993.

Goldschmidt-Clermont, P.J., Machesky, L.M., Boberstein, S.K.and Pollard, T.D. (1991) Mechanism of the interaction of humanplatelet pro®lin with actin. J. Cell Biol. 113, 1081±1089.

Haarer, B.K. and Brown, S.S. (1990) Structure and function ofpro®lin. Cell Motil. Cytoskeleton, 17, 71±74.

HaÊkansson, G. and Allen, J.F. (1995) Histidine and tyrosine

phosphorylation in pea mitochondria: evidence for proteinphosphorylation in respiratory redox signalling. FEBS Lett. 372,238±242.

Hansson, A., Skoglund, G., Lassing, I., Lindberg, U. and Ingleman-Sundberg, M. (1988) Protein kinase C-dependentphosphorylation of pro®lin is speci®cally stimulated byphosphatidylinositol bisphosphate (PIP2) Biochem. Biophys.Res. Comm. 150, 526±531.

Hatano, S. (1994) Actin-binding proteins in cell motility. Int. Rev.Cytology, 156, 199±273.

Huang, S., McDowell, J.M., Weise, M.J. and Meagher, R.B. (1996)The Arabidopsis pro®lin gene family. Evidence for an ancientsplit between constitutive and pollen-speci®c pro®lin genes.Plant Physiol. 111, 115±126.

Imamura, H., Tanaka, K., Hihara, T., Umikawa, M., Kamei, T.,Takahashi, K., Sasaki, T. and Takai, Y. (1997) Bni1p andBnr1p: Downstream targets of the Rho family small G-proteins which interact with pro®lin and regulate actincytoskeleton in Saccharomyces cerevisiae. EMBO J. 16,2745±2755.

Islas-Flores, I., Oropeza, C. and HernaÂndez-Sotomayor, S.M.T.(1998) Protein Phosphorylation during Coconut zygotic embryodevelopment. Plant Physiol. 118, 257±263.

Jiang, W.G., Hiscox, S., Singharo, S.K., Puntis, M.C., Nakamura,T., Mansel, R.E. and Hallet, M.B. (1995) Induction of tyrosinephosphorylation and translocation of ezrin by hepatocytegrowth factor/scatter factor. Biochem. Biophys. Res. Commun.217, 1062±1069.

Jungbluth, A., Eckerskon, C., Gerish, G., Lottpeich, F., Stocker,S. and Schweiger, A. (1995) Stress-induced tyrosinephosphorylation of actin in Dictyostelium cells andlocalization of the phosphorylation site to tyrosine-53adjacent to the DNAse I binding loop. FEBS Lett. 375, 87±90.

Kang, F., Laine, R.O., Bubb, M.R., Southwick, F.S. and Purich, D.L.(1997) Pro®lin interacts with the Gly-Pro-Pro-Pro-Pro-Prosequences of vasodilator-stimulated phosphoprotein (VASP):Implications for actin-based Listeria motility. Biochemistry, 36,8334±8392.

Kenney, L.J. (1997) Kinase activity of EnvZ, an osmoregulatorysignal transducing protein of Escherichia coli. Arch. Biochem.Biophys. 346, 303±311.

Kishi, Y., Clements, C., Mahadeo, D.C., Cotter, D.A. andSameshima, M. (1998) High levels of tyrosinephosphorylation: correlation with the dormant state ofDictyostelium spores. J. Cell Sci. 111, 2923±2932.

Koch, A.C., Anderson, D., Moran, M.F., Ellis, C. and Powson, T.(1991) SH2 and SH3 Domains: Elements that controlinteractions of cytoplasmic signalling proteins. Science, 252,668±674.

Laemmli, U.K. (1970) Cleavage of structural proteins during theassembly of bacteriophage T4. Nature, 227, 680±685.

Lo pez, I., Anthony, R.G., Maciver, S.K., Jiang, C.-J., Khan, S.,Weeds, A.G. and Hussey, P.J. (1996) Pollen speci®c expressionof maize genes encoding actin depolymerizing factor-likeproteins. Proc. Natl Acad. Sci. USA, 93, 7415±7420.

Luan, S. (1998) Protein phosphatases and signalling cascades inhigher plants. Trends in Plant Sci. 3, 271±275.

Machesky, L.M., Atkinson, S.J., Ampe, C., Vanderkerckove, J. andPollard, T.D. (1994) Puri®cation of a cortical complex containingtwo unconventional actins from Acanthamoeba by af®nitychromatography. J. Cell Biol. 127, 107±115.

Machesky, L.M. and Pollard, T.D. (1993) Pro®lin as a potentialmediator of membrane-cytoskeleton communication. Trends inCell Biol. 3, 381±385.

506 Gabriel GuilleÂn et al.

ã Blackwell Science Ltd, The Plant Journal, (1999), 19, 497±508

MacRae, T.H. (1997) Tubulin post-translational modi®cations-enzymes and their mechanisms of action. Eur. J. Biochem.244, 265±278.

MartõÂnez-Flores, I., Cano, R., Bustamante, V.H., Calva, E. andPuente, J.L. (1999) The ompB operon partially determinesdifferental expression of OmpC in Salmonella typhi andEscherichia coli. J. Bacteriol. 181, 556±562.

McCurdy, D.W. and Kim, M. (1998) Molecular cloning of a novel®mbrin-like cDNA from Arabidopsis thaliana. Plant Mol. Biol.36, 23±31.

McKinney, E.C. and Meagher, R.B. (1998) Members of theArabidopsis actin gene family are widely dispersed in thegenome. Genetics, 149, 663±675.

Meagher, R.B. (1995) The impact of historical contingency ongene phylogeny: plant actin diversity. In Evolutionary Biology(Hecht, M.K. MacIntyre, R.J. and Klegg, M.T., eds) New York:Plenum Press, pp. 195±215.

Mittermann, I., Swoboda, I., Pierson, E., Eller, N., Kraft, D.,Valenta, R. and Heberle-Bors, E. (1995) Molecular cloning andcharacterization pro®lin from tobacco (Nicotiana tabacum):increased pro®lin expression during pollen maturation. PlantMol. Biol. 27, 137±146.

Mizoguchi, T., Gotoh, Y., Nishida, E., Yamaguchi-Shinozaki, K.,Hayashida, N., Iwasaki, T., Kamada, H. and Shinosaki, K. (1994)Characterization of two cDNAs that encode MAP kinasehomologues in Arabidopsis thaliana and analysis of thepossible role of auxin in activating such kinase activities incultured cells. Plant J. 5, 111±122.

Mizoguchi, T., Ichimura, K. and Shinozaki, K. (1997)Environmental stress response in plants: the role of mitogen-activated protein kinases. Trends in Biotech. 15, 15±19.

Nakayasu, T., Yokota, E. and Shimmen, T. (1998) Puri®cation ofan actin-binding protein composed of 115-kDa polypeptidefrom pollen tubes of lily. Biochem. Biophys. Res. Commun. 249,61±65.

O'Farrell, P.M. (1975) High resolution two-dimensionalelectrophoresis of proteins. J. Biol. Chem. 250, 4007±4021.

Pantaloni, D. and Carlier, M.F. (1993) How pro®lin promotes actin®lament assembly in the presence of thymosin b4. Cell, 75,1007±1014.

Ren, H., Gibbon, B.C., Asworth, S.L., Sherman, D.M., Yuan, M.and Staiger, C.J. (1997) Actin puri®ed from maize pollenfunctions in living plant cells. Plant Cell, 9, 1445±1457.

RodrõÂguez-Zapata, L.C. and HernaÂndez-Sotomayor, S.M.T. (1998)Evidence of protein-tyrosine activity in Catharanthus roseusroots transformed by Agrobacterium rhizogenes. Planta, 204,70±77.

SchluÈ ter, K., Jockusch, B.M. and Rothkegel, M. (1997) Pro®lins asregulators of actin dynamics. Biochim. Biophys. Acta, 1395, 97±109.

Smertenko, A.P., Jiang, C.-J., Simmons, N.J., Weeds, A.G.,Davies, D.R. and Hussey, P. (1998) Ser6 in the maize actin-depolymerizing factor, ZmADF3, is phosphorylated by acalcium-stimulated protein kinase and is essential for thecontrol of functional activity. Plant J. 14, 187±193.

Staiger, C.J., Gibbon, B.C., Kovar, D.R. and Zonia, L.E. (1997)Pro®lin and actin-depolymerizing factor: modulators of actinorganization in plants. Trends in Plant Sci. 7, 275±281.

Staiger, C.J., Goodbody, K.C., Hussey, P.J., Valenta, R., Drùbak,B.K. and Lloyd, C.W. (1993) The pro®lin multigene family ofmaize: differential expression of three isoforms. Plant J. 4, 631±641.

Staiger, C.J., Yuang, M., Valenta, R., Shaw, P.J., Warn, R.M. andLloyd, C.W. (1994) Microinjected pro®lin affects cytoplasmic

streaming in plant cells by rapidly depolymerizing actinmicro®laments. Curr. Biol. 4, 215±219.

Sun, H.O., Kwiatkowska, K. and Yin, H.L. (1995) Actin monomerbinding proteins. Curr. Opinion Cell Biol. 5, 193±199.

Suzuki, K. and Shinshi, H. (1995) Transient activation and tyrosinephosphorylation of a protein kinase in tobacco cells treatedwith a fungal elicitor. Plant Cell, 7, 639±647.

Tanaka, M. and Shibata, H. (1985) Poly (L-proline)-bindingproteins from chick embryos are pro®lin and a pro®lactin.Eur. J. Biochem. 151, 291±297.

Theriot, J.A. (1995) The cell biology of infection by intracellularbacterial pathogens. Ann. Rev. Cell Dev. Biol. 7, 213±239.

Theriot, J.A. and Mitchison, T.J. (1993) The three faces of pro®lin.Cell, 75, 835±838.

Torruella, M., Casano, L.M. and Vallejos, R.H. (1986) Evidence ofthe activity of tyrosine kinase (s) and of the presence ofphosphotyrosine proteins in pea plantlets. J. Biol. Chem. 261,6651±6653.

Towbin, J., Staehelin, T. and Gordon, J. (1979) Electrophoretictransfer of proteins from polyacrylamide gels to nitrocellulosesheets: Procedure and some applications. Proc. Natl Acad. Sci.USA, 76, 4350±4354.

Trojanek, J., Ek, P.S., MuszynÄ ska, G. and EngstroÈ m, L. (1996)Tyrosine phosphorylation in proteins of maize seedlings. Eur. J.Biochem. 253, 338±344.

Valenta, R., Duchene, M., Ebner, C., et al. (1992) Pro®linsconstitute a novel family of functional plant pan-allergens.J. Exp. Med. 175, 377±385.

Valenta, R., Duchene, M., Pettenburger, K., et al. (1991)Identi®cation of pro®lin as a novel pollen allergen;IgE autoreactivity in sensitized individuals. Science, 253,557±560.

Valenta, R., Ferreira, F., Grote, M., et al. (1993) Identi®cation ofpro®lin as an actin-binding protein in higher plants. J. Biol.Chem. 268, 22777±22781.

Valster, A.H., Pierson, E.S., Valenta, R., Hepler, P.K. and Emons,A.M.C. (1997) Probing the plant-actin cytoskeleton duringcytokinesis and interphase by pro®lin microinjection. PlantCell. 9, 1815±1824.

Vidali, L. and Hepler, P.K. (1997) Characterization and localizationof pro®lin in pollen grains and tubes of Lilium longi¯orum. CellMotil. Cytoskeleton, 36, 323±338.

Vidali, L., Pe rez, H., Valde s Lo pez, V., NogueÂz, R., Zamudio, F. andSaÂnchez, F. (1995) Puri®cation, characterization and cDNAcloning of pro®lin from Phaseolus vulgaris. Plant Physiol. 108,115±123.

Watanabe, N., Madaule, P., Reid, T., et al. (1997) p140mDia, amammalian homolog of Drosophila diaphanos, is a targetprotein for Rho small GTPase and is a ligand for pro®lin. EMBOJ. 16, 3044±3056.

Welch, M.D., Iwamatsu, A. and Mitchinson, T.J. (1997) Actinpolymerization is induced by Arp2/3 protein complex at thesurface of Listeria monocytogenes. Nature, 385, 265±269.

Welch, M.D., Rosenblatt, J., Skoble, J., Portnoy, D.A. andMitchinson, T.J. (1998) Interaction between the human Arp2/3complex and Listeria monocytogenes ActA protein in actin®lament nucleation. Science, 281, 105±108.

Xu, Q., Fu, H.-H., Gupta, R. and Luan, S. (1998) Molecularcharacterization of a tyrosine-speci®c protein phosphataseencoded by a stress-responsive gene in Arabidopsis. PlantCell, 10, 849±857.

Xu, P., Lloyd, C.W., Staiger, C.J. and Drùbak, B.K. (1992)Association of phosphatidylinositol 4-kinase with the plantcytoskeleton. Plant Cell, 4, 941±951.

Bean pro®lin is tyrosine-phosphorylated 507

ã Blackwell Science Ltd, The Plant Journal, (1999), 19, 497±508

Yang, W., Burkhart, W., Cavallius, J., Merick, W.C. and Boss, W.F.(1993) Puri®cation and characterization of aphosphatidylinositol 4-kinase activator in carrot cells. J. Biol.Chem. 268, 392±398.

Yokota, E., Takahara, K. and Shimmen, T. (1998) Actin-bundlingprotein isolated from pollen tubes of Lily. Plant Physiol. 116,1421±1429.

Yu, L.X., Nasrallah, J., Valenta, R. and Parthasarathy, M.V. (1998)

Molecular cloning and mRNA localization of tomato pollenpro®lin. Plant Mol. Biol. 36, 699±707.

Zhang, K., Letham, D. and John, P. (1996) Cytokinins control thecell cycle at mitosis by stimulating the tyrosinedephosphorylation and activation of p34cdc2 -like H1 histonekinase. Planta, 200, 2±12.

Zigmond, S.H. (1998) Actin cytoskeleton: The Arp2/3 complex getsto the point. Curr. Biol. 8, R654±R657.

508 Gabriel GuilleÂn et al.

ã Blackwell Science Ltd, The Plant Journal, (1999), 19, 497±508