This article was published in the above mentioned Springer issue.The material, including all portions thereof, is protected by copyright;all rights are held exclusively by Springer Science + Business Media.

The material is for personal use only;commercial use is not permitted.

Unauthorized reproduction, transfer and/or usemay be a violation of criminal as well as civil law.

ISSN 0049-4747, Volume 42, Number 5

Polymorphism of BMPR1B, BMP15 and GDF9 fecunditygenes in prolific Garole sheep

Shamik Polley & Sachinandan De & Biswajit Brahma & Ayan Mukherjee &

Vinesh P.V. & Subhasis Batabyal & Jaspreet Singh Arora & Subhransu Pan &

Ashis Kumar Samanta & Tirtha Kumar Datta & Surender Lal Goswami

Accepted: 27 November 2009 /Published online: 18 December 2009# Springer Science+Business Media B.V. 2009

Abstract Mutation studies in different prolific sheepbreeds have shown that the transforming growth factorbeta super family ligands viz. the growth differentiationfactor 9 (GDF9/FecG), bone morphogenetic protein 15(BMP15/FecX) and associated type I receptors, bonemorphogenetic protein receptor (BMPR1B/FecB), aremajor determinant of ovulation rate and consequentincrease in litter size. The Garole sheep is a highlyprolific sheep breed of India. Characterization offecundity genes in these animals could substantiallyimprovise the breeding programme in these animals aswell as other sheep breeds of the region. The presentstudy was therefore designed with the objective ofpolymorphism study of fecundity genes in these prolificmicrosheep. A total of 11 point mutations were detectedby polymerase chain reaction (PCR)-based method. A

competitive technique called tetra-primer amplificationrefractory mutation system-PCR was adapted to type atotal of ten points of two ovine fecundity genes (GDF9and BMP15). The FecB locus of the BMPR1B gene andG1 locus of GDF9 gene were found to be polymorphic.In FecB locus, two genotypes, wild type (FecB+) andmutant (FecBB), were detected with allele frequenciesof 0.39 and 0.61, respectively. At G1 locus, twogenotypes, mutant (A) and wild types (G) weredetected with allele frequencies of 0.18 and 0.82,respectively. This study reports Garole sheep as thefourth sheep breed after Belclare/Cambridge, Lacauneand Small-tailed Han sheep, where coexisting poly-morphism has been found in two different fecunditygenes (BMPRIB and GDF9 genes).

Keywords Garole sheep . Prolificacy . BMPR1B .

GDF9 . BMP15

Introduction

Sheep has been considered as a model species forstudying genes involved in mechanisms controllingovulation rate. Genetic variation associated withovulation rate in sheep has been widely documentedand the evidences show substantial (Bindon et al.1996). In 1980, Booroola gene (FecB) was identifiedas the first major gene for prolificacy in sheep.Studies thereafter have indicated that the ovulationrate and litter size can be genetically regulated by a

Trop Anim Health Prod (2010) 42:985–993DOI 10.1007/s11250-009-9518-1

S. Polley : S. De :A. Mukherjee :V. P.V. : J. S. Arora :T. K. Datta : S. L. GoswamiAnimal Biotechnology Centre,National Dairy Research Institute,Karnal, Haryana 132001, India

B. Brahma (*)Krishi Vigyan Kendra, SKUAST-Jammu,Doda,Bhaderwah, Jammu and Kashmir 182221, Indiae-mail: jitt77@gmail.com

S. Batabyal : S. Pan :A. K. SamantaWest Bengal University of Animal and Fishery Sciences,68, Kshudiram Bose Sarani, Belgachia,Kolkata, West Bengal 700 037, India

Author's personal copy

set of different genes, collectively named as fecundity(Fec) genes (Piper and Bindon 1982; Davis et al.1982). Three fecundity genes have identified in sheep,namely, bone morphogenetic protein receptor type IB(BMPRIB) or activin-like kinase 6 or FecB onchromosome 6 (Souza et al. 2001), growth differen-tiation factor 9 (GDF9) or FecG on chromosome 5(Hanrahan et al. 2004) and bone morphogeneticprotein 15 (BMP15) or FecX on chromosome X(Hanrahan et al. 2004; Galloway et al. 2000). TheFecB (Booroola) mutated allele is associated withadditive effect on ovulation rate (Souza et al. 2001),whereas mutations of FecG (five single nucleotidepolymorphisms (SNPs)) and FecX (five SNPs) areassociated with increased ovulation rates in heterozy-gous animals and sterility in homozygous animals(Hanrahan et al. 2004; Bodin et al. 2007). All threeFec genes belong to the transforming growth factorbeta gene superfamily (Fabre et al. 2006).

Mutations in fecundity gene family have beenreported to be associatedwith altered rate of reproductiveprocesses including ovulation rate, litter size, fertility,etc. In the FecB locus, transition of nucleotide from ‘A’to ‘G’ at position 746 of the cDNA sequence induces anon-synonymous substitution of glutamine with anarginine corresponding to position 249 (Q249R) of themature protein (Souza et al. 2001; Davis et al. 2002,2006).

The changing concentrations of GDF9 in vivo leadsto incremental changes in ovulation rate in sheep(Galloway et al. 2000; Juengel et al. 2004; Hanrahanet al. 2004). The BMP15, a close homolog of GDF9, isexpressed in the oocyte at primary follicular stage andcontinues through ovulation (Dube et al. 1998).Heterozygous carrier ewes of the FecGH (high fertility,S395F), FecXI (Inverdale, V31D), FecXH (Hanna,Q23Ter), FecXB (Belclare, S99I), FecXL (Lacaune,C53Y) or FecXG (Galway, Q239Ter) alleles exhibitone to two additional ovulations, when compared tonon-carriers (Hanrahan et al. 2004; Galloway et al.2000; McNatty et al. 2005; Bodin et al. 2007).

The Garole sheep is a small-sized native sheepbreed of Sunderban, the swampy delta region(4,226 km2) of the Ganges River in West Bengal(21–23°N latitude and 87–89°E longitude). Thesesheep are popular meat animals in the area, althoughaverage live weight of adult ranges between 10 and14 kg only. However, the breed is best known in theregion for its prolificacy, with mean litter size of 2.27

(Nimbkar et al. 1998). Owing to their high fecundityand ability to thrive on low quality forages and agro-byproducts, these animals constitute a major source ofincome for their owners. Characterization of fecunditygenes in these animals could substantially improvethe breeding programme in these animals as well asother sheep breeds of the region. The present studywas therefore designed with the objective of poly-morphism study of fecundity genes in these prolificmicrosheep.

Materials and methods

Experimental animals and DNA isolation

A total of 22 Garole sheep, randomly selected overdifferent regions of Sunderban, West Bengal, India,were genotyped for the present investigation. Bloodsamples were collected from jugular vein of the animalsand immediately transported to the laboratory with icebefore DNA isolation. Isolation of genomic DNA fromthe samples was made as per standard procedurementioned by Sambrook and Russell (2001).

Primer designing

A total of 11 point mutations were detected bypolymerase chain reaction (PCR)-based method. Aschematic diagram of these point mutations representingactual nucleotide and corresponding amino acid changesare shown in Fig. 1. A competitive technique calledtetra-primer amplification refractory mutation system(ARMS) PCR was adapted to type a total of ten pointsof two ovine fecundity genes (GDF9 and BMP15). Intetra-primer ARMS-PCR, four primers are used toamplify a larger fragment from DNA containing theSNP and amplicons representing each of the two allelicforms. Two allele-specific (inner) primers weredesigned in opposite orientation and in combinationwith the common (outer) primers, so that simultaneousamplification of both the wild-type and the mutantamplicons could be possible. To increase the specificityof the reaction, a mismatch is introduced at position −2from the 3′ terminus of inner primers (Newton et al.1989). For the present experiment, primers weredesigned following methodology described by Ye et al.(2001) and were based on ovine GDF9 (AF078545)and BMP15 (AH009593) gene with respective posi-

986 Trop Anim Health Prod (2010) 42:985–993

Author's personal copy

tions mentioned before and after the oligonucleotidesequences (Table 1). Earlier, we used the same primercombination for amplification of GDF9 and BMP15genes mutation points for Black Bengal goats (Polley etal. 2009). The amplified products would therefore differin size that should be specific to presence or absence ofa particular allele. The product with different length,thereafter, can easily be separated by simple agarose gelelectrophoresis. For detection of FecB point mutation ofBMPR1B gene, the primers were designed based onovine genomic DNA sequence (AF312016) withrespective positions mentioned before and after theoligonucleotide sequences (Table 2). These primerswere previously used for amplification of caprineBMPR1B gene also (Polley et al. 2009).

PCR amplification and electrophoretic separation

PCR amplification of the selected genes was per-formed in 25-μl reaction volume. Each reactioncontained 2.5 µl of thermophilic DNA polymerase10× buffer (10 mM Tris–HCl [pH 9.0 at 25°C],50 mM KCl and 0.1% Triton X-100), 200 μM ofdNTPs, 25 mM MgCl2, 10 pmol of each primers and0.5 units of Taq DNA polymerase (Promega Corpo-ration, Madison, WI, USA) and sterile water to bringthe total volume to 25 μl. Around 100 ng of genomic

DNA was used as template. For each allele, thecycling conditions of PCR parameters wereprogrammed separately so that the allele-specificamplification of both wild and mutant type could bepossible (Table 1). PCR amplifications for GDF9 andBMP15 were performed with a simple programme:94°C for 4 min, 32 cycles of 30–45 s at 94°Cdepending upon mutation point, annealing tempera-ture as given in Table 1 and 30 s at 72°C, with a finalcycle at 72°C for 4 min to complete extension.BMPR1B gene was amplified in touchdown cyclingparameter with a gradual decrease of annealingtemperature from a higher annealing temperature toan optimised temperature and, finally, 30 more cycleswere performed in the lowest annealing temperature.The separation of PCR products were done in ahorizontal submarine gel electrophoresis unit (DNAseand RNAse free agarose 2%; 1× TAE buffer; 100 V).The gel was stained with ethidium bromide solution(0.5 µg/ml) for 10 min in dark and photographedusing a molecular imager (Gel Doc XR, BIO-RAD).

Results

The tetra-primer ARMS-PCR method was successfullyapplied to type a total of ten known point mutations of

Q239Ter Q23Ter C53Y S 99 IV31D

Exon 2

DNA level Protein level

Allele Intron 2

(AH009593)

Allele

DNA level Protein level

Exon 1 Exon 2

Intron 1

(AF078545).

Allele

DNA level Protein level

Exon 8 Exon 9Intron 8

(AF312016)

(A)

(B)

(C)

Fig. 1 Identified mutations affecting ovulation rate in sheep. a–c Point mutations with nucleotide and amino acid changes in BMP15,GDF9 and BMPR1B gene, respectively

Trop Anim Health Prod (2010) 42:985–993 987

Author's personal copy

Table 1 The primer pairs, expected product size and polymerase chain reaction parameters used for amplification of GDF9 andBMP15 gene mutation points (Polley et al. 2009)

Gene Mutation Primer Primers Sequence (5′→3′) Product size (bp) Temperaturecondition

GDF9(AF078545)

G1 IF(A) 334 CTGCAGCCAGATGACAGAGCTTTTCA 359 Mut 205, WT 247,Co. 396

55°C (32 cyclesfor 30 s)IR(G) 388 CGTATGCCTTATAGAGCCTCTTCATGTCGC 359

OF 168 GCCTGGCTCTGTTTTCCTATTAGCCTTG 188

OR 537 TCTTCTTCCCTCCACCCATTAACCAATC 510

G4 IF(G) 296 TTCACATGTCTGTAAATTTTACATGTGAGG325

Mut 212, WT 26,1 Co.417

50°C (32 cycles for30 s)

IR(A) 350 GCTGAAGGATGCTGCAGCTGGTCGTT 325

OF 90 CAACAACTCCATTTCTTTTCCCTTTCCTG 118

OR 506 TAGGCAGATAGCCCTCTC TTCTGGTCAG 479

G6 IF(A) 573 CAGCTCTGAATTGAAGAAGCCTCGGA 598 Mut 193, WT 223,Co.362

52°C (32 cyclesfor 30 s)IR(G) 625 ATTCACTCAGATTGACTGAAGCTGGCAC 598

OF 403 TATCTGAACGACACAAGTGCTCAGGCTT 430

OR 764 CTGGGACAGTCCCCTTTACAGTATCGAG 737

G7 IF(G) 688 AGTCAGCTGAAGTGGGACAACTGGAGTG 715 Mut 187, WT 212,Co. 343

50°C (32 cyclesfor 30 s)IR(A) 742 ATCGAGGGTTGTATTTGTGTGGGGCAAT 715

OF 556 AGAGACCAGGAGAGTGCCAGCTCTGAAT 583

OR 898 CGATGGCCAAAACACTCAAAGGGCTATA 871

G8 IF (T) 763 AGGGCGGTCGGACATCGGTATGGATT 788 Mut 146, WT 108,Co. 198

55°C (32 cyclesfor 30 s)IR(C) 817 TGATGTTCTGCACCATGGTGTGAACCGTAG

788

OF 710 GGATTGTGGCCCCACACAAATACAACCC 737

OR 907 CATCAGGCTCGATGGCCAAAACACTCAA 880

BMP15(AH009593)

FecXG IF (C) 363 CTTCTTGTTACTGTATTTCAATGACAATC 391 Mut 112 WT 102Co.158

48ºC (32 cyclesfor 30 s)IR(T) 417 GAGAGGTTTGGTCTTCTGAACACTATA 391

OF 306 AAGAGGTAGTGAGGTTCTTGAGTTCT 331

OR 463 AGAGAAGAGAAGGGTCTTTTTCTGTA 438

FecXH IF (C) 519 GGAGCATGATGGGCCTGAAAGTACCC 544 Mut 248, WT 203,Co. 395

56°C (32 cyclesfor 40 s)IR(T) 573 GCTGACTTGAAAAGGGTGGAGGGAACAATA

544

OF 326 AGTTCTGGTGGCATGGCACTTCATCATT 353

OR 720 CACCAGCTCACTGACAAGGTTCTGGATG 693

FecXI IF(A) 541 AACCAGTGTTCCCTCCACCCTTTTCATGA 569 Mut 212, WT 261,Co.418

55°C (32 cyclesfor 45 s)IR(T) 594 ATCCCAGCCCAGCTGCTGGAAGCAGA 569

(OF 334 TGGCATGGCACTTCATCATTGGACACTG 361

OR 751 GGACACAGGAAGGCTGAGGGACATTCTGA723

FecXL IF(A) 606 TGCTCCCCATCTCTATACCCCAAACTAATA 635 Mut 204, WT 252,Co.398

52°C (32 cyclesfor 35 s)IR(G) 662 TGTAGTACCCGAGGACATACTCCCTGAC 635

OF 411 ACCTCTCCCTAAAGGCCTGAAAGAGTTT 438

OR 808 ACAAGATACTCCCATTTGCCTCAATCAG 781

FecXB IF(G) 743 CCTTATAAGTATGTTCCCATGAG 773 Mut 240, WT 126,Co. 308

52°C (32 cyclesfor 40 s)IR(T) 800 CTCCCATTTGCCTCAATCAGAAGGACGA 773

OF 561 TTTTCAAGTCAGCTTCCAGCAGCTGGGC 588

OR 868 TGCACCTTTGCCGTCACCTGCATGTG 843

The nucleotide specificity is indicated in parentheses

F forward, R reverse, O outer (common), I inner (allele specific), Mut indicates size of mutant fragment, WT indicates size of wild-typefragment, Co. indicates size of control fragment

988 Trop Anim Health Prod (2010) 42:985–993

Author's personal copy

GDF9 and BMP15 gene. The point mutation ofBMPR1B gene was detected by a touchdown PCRcycling parameter with an initial annealing temperatureof 5°C to 8°C higher than the optimised annealingtemperature. All the genes under the study wereamplified successfully, and the bands of the PCRproducts were unambiguous and consistent with theexpected size, as analysed from their gene sequenceinformation.

Polymorphism status of fecundity genes

BMPR1B

Analysis of BMPR1B gene locus in Garole sheeprevealed association of two types of alleles viz. ‘A’as non-carrier, wild-type nucleotide and ‘G’ ascarrier, FecB mutant nucleotide. Two genotypes(AG and GG) were found in the study population.

An amplicon size of 136 bp was obtained fromhomozygous FecB mutant (‘G’, carrier) animals.However, in heterozygous animals (AG), both1,100-bp (‘A’ carrier) and 136-bp-sized ampliconswere found to be amplified (Fig. 2). The genotypicand allelic frequencies at BMPRIB locus in Garolesheep were calculated and are presented in Table 3.The heterozygous genotype AG was found to be thepredominant genotype in Garole sheep under thestudy. Frequencies of AG and GG genotypes were0.77 and 0.23, respectively. The allelic frequenciesfor A and G alleles were 0.39 and 0.61, respectively.This indicates the abundance of mutant type (G)nucleotide in prolific Garole sheep.

BMP15

Five point mutations were detected in the BMP15locus. All these mutation points were wild-type

Table 2 The primer pairs, expected size and touchdown polymerase chain reaction parameters used for amplification of the BMPR1Bgene (Polley et al. 2009)

Gene(mutation)

Primername

Primers sequence (5′→3′) Tm(°C)

Ampliconsize (bp)

Annealing condition

BMPR1B (FecBB)(AF312016)

WF(A) 82 GCTGGTTCCGAGAGACAGAAATATATCA 109 59.7 1,100 Touchdown from 60°Cto 52°C then at 52°C(30 cycles for 40 s)

WR 1178 CCCCGTCCCTTTGATATCTGCAGCAATG 1151 62.9

MF 1 GTCGCTATGGGGAAGTTTGGATGGGAA 27 62.3 136 Touchdown from 70°Cto 65°C then at 65°C(30 cycles for 45 s)

MR(G) 136 ATGTTTTCATGCCTCATCAACACCGTCC 109 61.2

1 2 3 4

GG GG GG AG

1100 bp

136 bp

L M W M W M W M W N

1000 bp

500 bp

300 bp

100 bp

Fig. 2 Agarose gel electro-phoresis (2%) of allele-specific FecB (BMPR1B)polymerase chain reaction(PCR) product. Lanes 1–4:Amplification of wild-type(W=1,100 bp product) ormutant (M=136 bp product)allele in the Garole sheepgenomic DNA. Lane L:DNA molecular weightmarker (O'RangeRular100 bp DNA Ladder, Fer-mentus, Lithuania). N: PCRwithout genomic DNA(template negative control).Lane 4: Heterozygoushaving both W and M allele

Trop Anim Health Prod (2010) 42:985–993 989

Author's personal copy

genotype (Fig. 3e–i). A similar wild-type pattern hasalso been observed in native cattle (data not shown)and Black Bengal goat (Polley et al. 2009) popula-tion. These BMP15 wild-type alleles have C, C, T, Gand G nucleotides at corresponding locations encod-ing glutamine, glutamine, valine, cysteine and serineamino acid, respectively (Fig. 1).

GDF9

Similar to BMP15 locus, five point mutations werealso observed in GDP 9 gene at five positions(R87H, E241K, V332I, V371M and S395F), asanalysed by tetra-primer-based ARMS-PCR. Thetested Garole sheep populations were of wild-typegenotype (Fig. 3a–d) except for G1 locus, whichwas found polymorphic (Fig. 4). At G1 locus, bothmutant (A) and wild-type (G) alleles were detectedwith frequencies of 0.18 and 0.82, respectively. Thewild type (GG) was found to be the predominantgenotype in tested Garole sheep population. Fre-quencies of GG and AG genotypes were 0.64 and0.36, respectively (Table 4). In GDF9, wild-typealleles were having A, G, G and C nucleotides at G4,

G6, G7 and G8 locations that corresponds toglutamic acid, valine, valine and serine amino acid,respectively (Fig. 1). The result indicates that amongthree fecundity genes, at least two loci, FecB loci ofBMPR1B gene and G1 of GDF9 are polymorphic inthe Garole sheep.

Discussion

Genotyping an SNP can be achieved by restrictionendonuclease digestion or allele-specific oligonu-cleotide hybridization. The hybridization techniquerestriction fragment length polymorphism was su-perseded by amplification methodologies after theinvention of PCR. Random amplification of poly-morphic DNAs and amplified fragment lengthpolymorphism are able to produce many markers ina single PCR without prior sequence knowledge ofthe genomes of interest. Allele-specific oligonucleo-tide melting is another widely used SNP typingtechniques, although it involves lengthy blotting andhybridisation procedures. Tetra-primer ARMS-PCR

Table 3 Allelic and genotype frequencies of the Garole sheep for BMPR1B locus (FecB)

Gene (mutation) No of animal Allele frequency Genotype frequency

A G AG GG

BMPR1B (FecBB) 22 0.39 0.61 0.77 0.23

A B C

417 bp261 bp 223 bp

343 bp212 bp

500 bp

200 bp

500 bp

200 bp

500 bp

200 bp

D E F

198 bp108 bp

158 bp102 bp

395 bp

203 bp200 bp100 bp

200 bp 100 bp

400 bp

200 bp

G H I

418 bp261 bp

398 bp252 bp

308 bp126 bp

500 bp

200 bp

500 bp

300 bp

300 bp

100 bp

Fig. 3 Agarose gel electrophoresis (2%) of polymerase chainreaction (PCR) product of tetra-primer amplification refractorymutation system-PCR. Lanes 1–6: Amplification of commonouter product and allele-specific inner product. The size ofcommon outer product and allele-specific inner product areindicated by arrow on the right side of the respective gel

photograph. Lane M: DNA molecular weight marker (O'Ran-geRular 100 bp DNA Ladder, Fermentus, Lithuania). A–D Gelphotographs of PCR products for G4, G6, G7 and G8 mutationpoints of GDF9 gene, respectively. E–I Gel photographs ofPCR products for FecXG, FecXH, FecXI, FecXL and FecXB

mutation points of BMP15 gene, respectively

990 Trop Anim Health Prod (2010) 42:985–993

Author's personal copy

is a simple, rapid, cheap and easy to use method forSNP genotyping. This system, which encompassesprinciple of ARMS and the tetra-primer PCR method(Newton et al. 1989), can amplify both wild-type andmutant alleles, as well as the control fragment in asingle-tube PCR reaction.

Sheep, as a small and litter-bearing animal, areideally suited as a model organism for studyingfecundity genes. The BMPR1B, GDF9 and BMP15genes have been found to be closely associated withprolificacy in sheep (Souza et al. 2001; Hanrahan etal. 2004; Galloway et al. 2000; Fabre et al. 2006;Bodin et al. 2002; Monteagudo et al. 2009). It hasbeen reported that the litter size and ovulation rate insheep increase with number of mutations in BMPR1Bgene (Fabre et al. 2006). Ewes inheriting one copy ofthe Booroola gene from either of parents producedabout 1.5 extra eggs and gave birth to about 1.0 extralamb per lambing. Homozygous carriers producedabout 3.0 extra eggs resulting in about 1.5 extra lambsper lambing (Fabre et al. 2006). This increase inovulation rate of FecBB carriers is associated with aprecocious maturation of a large number of antral

follicles that ovulate at a smaller size than non-carrierfollicles (McNatty et al. 1986). The FecGH (G8)mutation in GDF9 gene causes an amino acidsubstitution (S77F) that have been reported to beassociated with increased prolificacy in Belclareand Cambridge sheep (Hanrahan et al. 2004). Totalsix mutations in BMP15 gene have been known tobe associated with the prolificacy in various sheepbreeds. These mutations include non-synonymousamino acid substitution (FecXI, FecXB and FecXL),premature stop codons (FecXG and FecXH) and17 bp deletion of reading frame of functional gene(Monteagudo et al. 2009). Ovulation rates in GDF9and BMP15 mutants are high in the heterozygotes.The homogygotes, however, have small, flattenedstreak ovaries with follicles that do not develop up tothe primary stage (Hanrahan et al. 2004; Galloway etal. 2000; McNatty et al. 2005; Bodin et al. 2007)resulting in complete sterility in these animals(Galloway et al. 2000; Hanrahan et al. 2004; Bodinet al. 2007; Monteagudo et al. 2009).

The FecB mutations have been reported in some ofthe world's most prolific sheep breeds viz. AustralianBooroola Merino (Souza et al. 2001), Indian Garole(Davis et al. 2002), Indonesian Javanese (Davis et al.2002), Small-tailed Han and Hu sheep of China(Davis et al. 2006). However, prolificacy seems tobe less correlated with mutations at the FecX locus.The Small-tailed Han and Hu sheep did not have theFecXB or FecXH mutation (Liu et al. 2003; Chu et al.2005a, b). None of Garole, Javanese, Small-tailedHan, or Hu sheep had the FecXI mutation (Davis et al.2002, 2006; Liu et al. 2003; Wang et al. 2003; Chu etal. 2005a). The FecXG mutation was found to beabsent in Hu sheep, although FecXG mutation(C718T) has been reported in Small-tailed Han,Belclare and Cambridge ewes (Chu et al. 2005b). Asthe most famous high prolific sheep in China, Husheep has BB genotype in FecB, and no BMP15mutation has been reported so far (Wang et al. 2003;Davis et al. 2006; Guan et al. 2007). FecXI mutationwas also not found in Chinese Merino (54), XinjiangFine Wool (35) and Romolly Hills (40; Dai 2004).

M 1 2 3 4 5 6 N

100 bp

1000 bp

200 bp

396 bp

247 bp

205 bp

500 bp

Fig. 4 Agarose gel electrophoresis (2%) of polymerase chainreaction (PCR) product of tetra-primer amplification refractorymutation system-PCR for G1 locus of GDF9 gene. Lanes 1–6:Amplification of wild type or heterozygous in the Garole sheepgenomic DNA. The size of common outer product (396 bp) andallele-specific wild-type (247 bp) and mutant-type (205 bp)inner product are indicated by arrow on the right side of therespective gel photograph. Lane M: DNA molecular weight marker(O'RangeRular 100 bp DNA Ladder, Fermentus, Lithuania). LaneN: PCR without genomic DNA (template negative control). Lanes2 and 5: Heterozygous having both W and M allele

Gene (mutation) Number of animal Allele frequency Genotype frequency

G A GG AG

GDF9 (G1) 22 0.82 0.18 0.64 0.36

Table 4 Allelic andgenotype frequencies of theGarole sheep for G1 locusof GDF9 gene

Trop Anim Health Prod (2010) 42:985–993 991

Author's personal copy

Although there are many reports on mutations in asingle gene of fecundity gene family, mutations at themultiple loci of fecundity genes have been reported inthree sheep breeds only. These include the Belclare/Cambridge sheep with mutations at GDF9 andBMP15 loci (Hanrahan et al. 2004), the Lacaunesheep at FecL and BMP15 loci (Bodin et al. 2002)and Small-tailed Han sheep at BMPRIB and BMP15loci (Chu et al. 2007). To the best knowledge of theauthors, the Garole sheep is therefore the fourth sheepbreed that has coexisting mutations in two differentfecundity genes (BMPR1B and GDF9). The findingsof this study point to a preliminary supposition thatmutations of both the FecB locus of BMPR1B geneand G1 locus of GDF9 gene might be majordeterminant to influence prolificacy in the Garolesheep.

Conclusion

Garole sheep, a prolific sheep breed of India, wasfound to be polymorphic at two important fecunditygene loci, the BMP1B or FecB gene and GDF9 geneor FecG. No polymorphism was detected in BMP15gene. Mutations in FecB and FecG genes haveimportant consequences on ovulation rate and fecun-dity. These genes can be introduced into a breed or apopulation while retaining the breed's characteristics(Davis et al. 2006). The present study, however,includes a small number of animals, and a directliaison of these genes with efficient prolificacy couldonly be established after extensive investigations inthe Garole sheep.

References

Bindon, B. M., Piper, L. R. and Hillarda, M. A., 1996. ProlificSheep. Fahmy, M. H. Ed. (CAB International, UK).

Bodin, L., SanCristobal, M., Lecerf, F., Mulsant, P., Bibe, B.,Lajous, D., Belloc, J.P., Eychenne, F., Amigues, Y. andElsen, J.M., 2002. Segregation of a major gene influencingovulation in progeny of Lacaune meat sheep. GeneticsSelection Evolution, 34, 447-464.

Bodin, L., Di Pasquale, E., Fabre, S., Bontoux, M., Monget, P.,Ersani, L. and Mulsant, P., 2007. A novel mutation in thebone morphogenetic protein 15 gene causing defectiveprotein secretion is associated with both increased ovula-

tion rate and sterility in Lacaune sheep, Endocrinology,148, 393-400.

Chu, M. X., Cheng, R., Chen, G. H., Fang, L. and Ye, S. C.,2005a. Study on bone morphogenetic protein 15 as acandidate gene for prolificacy of Small Tailed Han sheepand Hu sheep. Journal of Anhui Agriculture University,32, 278-282.

Chu, M. X., Sang, L. H., Wang, J. Y., Fang, L. and Ye, S. C.,2005b. Study on BMP15 and GDF9 as candidate genes forprolificacy of Small Tailed Han sheep. Acta GeneticaSinica, 32, 38-45.

Chu, M. X., Jiao, C. L., He, Y. Q.,Wang, J. Y., Liu, Z. H. andChen, G. H., 2007. Association between PCR-SSCP ofbone morphogenetic protein 15 gene and prolificacy inJining grey goats. Animal Biotechnology, 18, 263–274.

Dai, R., 2004. Analyzed relationship between CLPG, BMP15gene polymorphic and production performance of sevensheep populations in north of Xinjiang. (Master's ThesisNanjing Agriculture University. [in Chinese])

Davis, G. H., Montgomery, G. W., Allison, A. J., Kelly, R. W.and Bray, A. R., 1982. Segregation of a major geneinfluencing fecundity in progeny of Booroola sheep. NewZealand Journal of Agricultural Research, 25, 525–529.

Davis, G. H., Galloway, S. M., Ross, I. K., Gregan, S. M.,Ward, J., Nimbkar, B. V., Ghalsasi, P. M., Nimbkar, C.,Gray, G. D., Subandriyo, Inounu, I., Tiesnamurti, B.,Martyniuk, E., Eythorsdottir, E., Mulsant, P., Lecerf, F.,James, P., Hanrahan, Bradford, G. E. and Wilson, T., 2002.DNATests in Prolific Sheep from Eight Countries ProvideNew Evidence on Origin of the Booroola (FecB) Mutation.Biology of Reproduction, 66, 1869-1874.

Davis, G. H., Balkrishnan, L., Ross, I. K., Wilson, T., Galloway, S.M., Lumsden, B. M., Hanrahan, J. P., Mullen, M., Mao, X.Z., Wang, G. L., Zhao, Z. S., Zeng, Y. Q., Robinson, J. J.,Mavrogenis, A. P., Papachristoforou, C., Peter, C., Baumung,R., Cardyn, Baujenane, I., Cockett, N. E., Eythorsdottir,E., Arranz, J. J. and Notter, D. R., 2006. Investigationof the Booroola (Fec B) and Inverdale (Fec X I)muatation in 21 prolific breeds and strains of sheepsamples in 13 countries. Animal Reproduction Science,92, 87-96.

Dube, J. L., Wang, P., Elvin, J., Lyons, K. M., Celeste, A. J. andMatzuk, M. M., 1998. The bone morphogenetic protein 15gene is X-linked and expressed in oocytes. MolecularEndocrinology, 12, 1809–1817.

Fabre, S., Pierre, A., Mulsant, P., Bodin, L., DiPasquale, E.,Persani, L., Monget, P. and Monniaux, D., 2006. Regulationof ovulation rate in mammals: contribution of sheep geneticmodels. Reproductive Biology and Endocrinology, 4, 20.

Galloway, S. M., McNatty, K. P., Cambridge, L. M., Laitinen, M.P., Jennifer, J. L., Jokiranta, S., McLaren, R. J., Luiro, K.,Dodds, K. G., Montgomery, G. W., Beattie, A. E., Davis, G.H. and Ritvos, O., 2000. Mutations in an oocyte-derivedgrowth factor gene (BMP15) cause increased ovulation rateand infertility in a dosage-sensitive manner. Nature Genetics,25, 279–283.

Guan, F., Shou-ren, L., Shi, G. Q. and Yang, L. G., 2007.Polymorphism of FecB gene in nine sheep breeds orstrains and its effects on litter size, lamb growth anddevelopment. Animal Reproduction Science, 99, 44–52

992 Trop Anim Health Prod (2010) 42:985–993

Author's personal copy

Hanrahan, P. J., Gregan, S. M., Mulsant, P., Mullen, M., Davis,G. H., Powell, R. and Galloway, S. M., 2004. Mutations inthe genes for oocyte-derived growth factors GDF9 andBMP15 are associated with both increased ovulation rateand sterility in Cambridge and Belclare sheep (Ovis aries).Biology of Reproduction, 70, 900–909.

Juengel, J. L., Hudson, N. L., Whiting, L. and McNatty, K. P.,2004. Effects of immunization against bone morphogeneticprotein 15 and growth differentiation factor 9 on ovulationrate, fertilization, and pregnancy in ewes. Biology ofReproduction, 70, 557–561.

Liu, S. F., Jiang, Y. L. and Du, L. X., 2003. Studies of BMPR-IB and BMP15 as candidate genes for fecundity in littletailed han sheep. Yi Chuan Xue Bao [Acta GeneticaSinica], 30, 755-760

McNatty, K. P., Lun, S., Heath, D. A., Ball, K., Smith, P.,Hudson, N. L., McDiarmid, J., Gibb, M. and Henderson,K. M., 1986. Differences in ovarian activity betweenBooroola Merino ewes which were homozygous, hetero-zygous and non-carriers of a major gene influencing theirovulation rate. Journal of Reproduction and Fertility, 77,193-205.

McNatty, K. P., Juengel, J. L., Reader, K. L., Lun, S.,Myllymaa, S., Lawrence, S. B., Western, A., Meerasahib,M. F., Mottershead, D. G., Groome, N. P., Ritvos, O. andLaitinen, M. P., 2005. Bone morphogenetic protein 15 andgrowth differentiation factor 9 cooperate to regulategranulosa cell function. Reproduction, 129, 473–480.

Monteagudo, L. V., Ponz, R., Tejedor, M. T., Lavina, A. andSierra, I., 2009. A 17 bp deletion in the Bone Morphoge-netic Protein 15 (BMP15) gene is associated to increasedprolificacy in the Rasa Aragonesa sheep breed. AnimalReproduction Science, 110, 139-146.

Newton, C. R., Graham, A., Heptinstall, L. E., Powell, S. J.,Summers, C., Kalsheker, N., Smith, J. G. and Markham,A.F., 1989. Analysis of any point mutation in DNA. The

amplification refractory mutation system (ARMS).Nucleic Acids Research, 17, 2503-2516.

Nimbkar, C., Ghalsasi, P. M., Ghatge, R. R. and Gray, G. D.,1998. Establishment of prolific Garole sheep from WestBengal in the semi-arid Deccan plateau of Maharashtra. InProceedings of 6th World Congress on Genetics Appliedto Livestock Production, Armidale, Australia, 1998, vol.25, pp. 257–260.

Piper, L. R. and Bindon, B. M., 1982. The Booroola Merinoand the performance of medium non-peppin crosses atArmidale. In: Piper, L. R., Bindon, B. M., and Nethery, R.D. (Eds.), The Booroola Merino. Proceedings of aWorkshop, Armidale, 24-25 August 1980, CSIRO, pp.9–19.

Polley, S., De, S., Batabyal, S., Kaushik, R., Yadav, P., Arora, J.S., Chattopadhyay, S., Pan, S., Brahma, B., Datta, T. K.and Goswami, S. L., 2009. Polymorphism of fecunditygenes (BMPR1B, BMP15 and GDF9) in the Indian prolificBlack Bengal goat. Small Ruminant Research, 85, 122–129.

Sambrook, J., and Russell, D., 2001. Molecular cloning. Alaboratory manual 3rd ed. (Cold Spring Harbor Press,Cold Spring Harbor N.Y.)

Souza, C. J.,MacDougall, C., Campbell, B. K.,McNeilly, A. S. andBaird, D. T., 2001. The Booroola (FecB) phenotype isassociated with a mutation in the bone morphogeneticreceptor type 1 B (BMPR1B) gene. Journal of Endocrinology,169, R1-R6.

Wang, G. L., Mao, X. Z., Davis, G. H., Zhao, Z. S., Zhang, L. J.and Zeng, Y. Q., 2003. DNA tests in Hu sheep andHan sheep(small tail) showed the existence of Booroola (FecB)mutation. Journal of Nanjing Agricultural University, 26,104-106.

Ye, S., Dhillon, S., Ke, X., Collins, A. R. and Day, I. N., 2001.An efficient procedure for genotyping single nucleotidepolymorphisms. Nucleic Acids Research, 29, e88–8.

Trop Anim Health Prod (2010) 42:985–993 993

Author's personal copy