ARTICLE IN PRESS

Ecotoxicology and Environmental Safety 73 (2010) 970–981

Contents lists available at ScienceDirect

Ecotoxicology and Environmental Safety

0147-65

doi:10.1

n Corr

Castilla

Spain. F

E-m

(M. Bel

journal homepage: www.elsevier.com/locate/ecoenv

Plant treatment, pollutant load, and soil type effects in rhizosphere ecology oftrace element polluted soils

M. Belen Hinojosa a,c,n, Jose A. Carreira a, Roberto Garcıa-Ruız a, Jose M. Rodrıguez-Maroto b,Tim J. Daniell c, Bryan S. Griffiths d

a Dpto. Biologıa Animal, Biologıa Vegetal y Ecologıa, Universidad de Jaen, 23071 Jaen, Spainb Dpto. de Ingenierıa Quımica, Universidad de Malaga, 29071 Malaga, Spainc Environment Plant Interactions Programme, Scottish Crop Research Institute, Dundee DD2 5DA, United Kingdomd Teagasc, Johnstown Castle Research Centre, Wexford, Ireland

a r t i c l e i n f o

Article history:

Received 27 September 2008

Received in revised form

13 January 2010

Accepted 16 January 2010Available online 10 April 2010

Keywords:

Rhizosphere

Trace element

Enzyme activity

Bacteria

Nematode

13/$ - see front matter & 2010 Elsevier Inc. A

016/j.ecoenv.2010.01.013

esponding author. Centro de Investigacione

la Mancha, Campus de la Fabrica de Armas, Av

ax: +34 925265748.

ail addresses: MariaBelen.Hinojosa@uclm.es, m

en Hinojosa).

a b s t r a c t

Re-vegetation of trace element contaminated soils can alter the pH and chelating capacity in the

rhizosphere, increasing the mobility of pollutants, which, in turn, may impact on rhizosphere ecology.

In this study a short-term pot experiment was carried out in order to investigate the multi-factorial

effects of: buffering capacity (sandy-loam and loam soils); pollutant load (0%, 1.3%, and 4% of pyrite

sludge), and the presence/absence of plant (Lolium perenne L. and Medicago sativa L.) on the mobility of

trace elements, soil biochemical functionality (hydrolase activities), and biological diversity (bacterial

and nematode communities). The experiment was carried out with representative soils from the

Guadiamar basin (SW Spain), an area where the Aznalcollar mining spill affected over 4000 ha. Results

indicated that the development of rhizospheres in polluted soils (coarse-textured) increases the

mobilization of trace elements. In general the presence of roots has stimulatory effects on soil quality

indicators such as hydrolase activities and both bacterial and nematode communities. However, the

presence of high amount of metals interferes with these beneficial effects. This study provided evidence

about the complexity of the impact of growing plants on trace element polluted soils. Trace element

mobilization, hydrolase activities and bacterial and nematode communities in the rhizosphere are

dependent on plant species, soil type, and pollution dose.

& 2010 Elsevier Inc. All rights reserved.

1. Introduction

Ecological restoration and mine reclamation have becomeimportant parts of sustainable development strategy. However,most studies have focused on the process of vegetation restora-tion and engineering technology of mine soil systems, rather thanunderground soil rehabilitation, evolvement, and effect on theecological system (Liao and Xie, 2007).

In 1998, with the Aznalcollar mining spill, five million m3 oftrace element-enriched pyrite sludge and associated acid tailingswere released into the Guadiamar basin (SW Spain), severelyaffecting over 4000 ha of the riparian zone (Lopez-Pamo et al.,1999). Despite extensive mitigation efforts carried out immedi-ately after the spill, total trace element concentrations in soils

ll rights reserved.

s del Fuego, Universidad de

. Carlos III s/n, 45071 Toledo,

bhinojosa@yahoo.com

remained higher than background levels in many areas, especiallyin the upper watershed (Lacal et al., 2003).

Land use in the affected area was reoriented toward theestablishment of a green corridor along the Guadiamar basin andsubsequent restoration practices were focused on intensive affor-estation and on the enhancement of spontaneous re-vegetation(Consejerıa de Medio Ambiente, 2002).

However, re-vegetation of polluted land has given rise toconcerns regarding potential side effects (Van-Camp et al., 2004).The impact of roots on the mobilization of trace elements isunclear, as low molecular weight organic acids released by rootsmay affect trace element desorption, solubility, and mobility byreducing soil pH and forming complexes with trace elements(Renella et al., 2004; Schwab et al., 2008). In contrast, increasedtrace element adsorption by soil in the presence of organic ligandshas been also observed (Qin et al., 2004; Schwab et al., 2005).

We consider that the examination of microbial and nematodecommunity from the same soils allow the relative effects oftrace element contamination on different components of theecosystem to be addressed. In this sense, while a large number ofstudies have been carried out to identify and quantify the impact

ARTICLE IN PRESS

M.B. Hinojosa et al. / Ecotoxicology and Environmental Safety 73 (2010) 970–981 971

of different plant species or artificial root exudates on soilmicrobial community structure and activity (for example:Baudoin et al., 2003; Soderberg et al., 2004; Renella et al., 2007;Singh et al., 2007), the capacity of root exudates to influencerhizosphere microbial communities in trace element pollutedsoils is less well understood.

On the other hand, the analysis of nematode community hasbeen successfully used in many occasions to determinate theeffect of trace element pollution in soils (Bongers, 1990; Nagy,1999; Kools et al., 2009). Also differences in nematode communityassociated to soil with different plant species rhizospheres hasbeen published (Bais et al., 2006; Hofmann and Grundler, 2007).However, to our knowledge few studies (Shao et al., 2008) haveevaluated the influence of rhizospheres in nematode communityof trace element polluted soils.

In order to look at the potential effects of trace elementpollution on rhizosphere ecology, we undertook a short-term potexperiment to study (i) how the development of rhizospheres inpolluted soils affects mobilization of trace elements, (ii) what arethe effects of these processes on a set of soil enzyme activities,and (iii) additionally, how the structure of bacterial and nematodecommunities is affected by re-vegetation of trace elementpolluted soils. We hypothesized that the chemical properties ofrhizosphere in polluted soils would affect the mobility andbioavailability of trace elements and, subsequently, inducechanges in hydrolase activity and both bacterial and nematodecommunity structure.

2. Material and methods

2.1. Experimental design and sample preparation

To carry out this study a complete factorial design was used with three levels

of pollution (0%, 1.3%, and 4% pyrite sludge); three vegetation treatments (no

plant, Lolium perenne L., and Medicago sativa L.) and two soil types (sandy loam and

loam). Levels of each factor were replicated six times, except for the treatment

without plants, which was replicated three times as less variance in the data was

expected.

As source of pollution we used the pyrite sludge that was released accidentally

into the Guadiamar basin, which contained on average: Pb, 39.9 g kg�1;

Cd, 0.1 g kg�1; Zn, 38.8 g kg�1; Cu, 9.5 g kg�1; Cr, 0.01 g kg�1; Fe, 234.1 g kg�1;

Table 1Main physical and chemical properties of the soils used in this manipulative

experiment.

Sandy loam soil Loam soil

Sand (%) 78.26 41.51

Clay (%) 7.15 11.68

Carbonate (%) 1.0 10.8

CEC (meq 100 g�1) 6.96 11.30

Ca exchangeable (meq 100 g�1) 11.77 28.39

Mg exchangeable (meq 100 g�1) 1.52 2.03

K exchangeable (meq 100 g�1) 0.21 0.82

Na exchangeable (meq 100 g�1) 0.20 0.31

Organic matter (%) 1.31 1.58

Total N (%) 0.09 0.14

Table 2Dry weight (g) of total aerial biomass (shoots) for each treatment over the 105 days e

Dry weight (g per pot) Pollutant dose (%) (Pyrite sludge)

Sandy loam soil

0 1.3 4

L. perenne 0.7570.14 0.5670.07 0.3

M. sativa 0.9670.09 0.7370.13 0.4

Mn, 0.3 g kg�1; Hg, 0.1 g kg�1; As, 2.8 g kg�1;and Ni, 0.003 g kg�1; (dry weight) at

pH 2.5. Doses of pyrite sludge added to soils were chosen in order to resemble the

pollution levels established by the Andalusian Regional Government as the

attention level (1.3% of pyrite sludge, at which soils need further monitoring) and

the intervention level (4%, at which soils require further remediation; Hinojosa

et al., 2008). Soils without pyrite sludge (0%) were used as a control. M. sativa and

L. perenne were chosen as experimental plant species, as their fast growing nature

would provide an extensive rhizosphere and for their relative tolerance to trace

elements (Gardea-Torresdey et al., 1999; Arienzo et al., 2004). Two unpolluted

soils, an Eutric Fluvisol (sandy loam) and a Calcareous Fluvisol (loam; FAO, 1974),

were chosen to be representative of soils across the upper and lower sections of

the affected area in the Guadiamar basin, and collected up to a depth of 15 cm

from locations at 611302200N, 3713005000E, and 611505900N, 3711600000E, respectively.

Chemical and physical properties of these soils are listed in Table 1. Fresh soil was

sieved (2 mm) and thoroughly mixed with different doses of pyrite sludge to

achieve the desired pollution levels (previously mentioned).

Fifty seeds of each plant species were sown in replicate pots of 300 g of each

soil type and plants were grown for 105 days in a covered enclosure outside,

watered every 3 days with 75 ml de-ionized water per pot. A saucer was placed

under each pot to collect any trace element leached from the pot during the

experiment. At the end of the experiment, trace elements were re-dissolved from

the saucers using 45 ml of 0.1 N HCl for further quantification.

After 105 days, the plant root systems had completely colonised the interior of

the planted pots; therefore, all soil in the pot was defined as rhizosphere. For each

pot, rhizosphere soil was separated from the roots by gentle shaking and

representative subsamples transported to the laboratory in dry ice and stored at

�80 1C for DNA extraction. The remaining rhizosphere soil was placed in a

polyethylene bag and stored at 4 1C for further analysis. Roots were separated

from shoots, rinsed thoroughly with de-ionized water, transported to the

laboratory in dry ice, and stored at �80 1C for DNA extraction. Table 2 shows

the dry weight of total aerial biomass (shoots) for each treatment over the

experimental period.

2.2. Physico-chemical analysis

Soil pH was determined in a 1:1 soil:CaCl2 (0.01 M) solution (McLean, 1982).

Both the mobile (extracted by 0.01 mol l�1CaCl2) and the mobilizable (extracted

by 0.005 mol l�1 DTPA) fractions of Cd, Cu, Zn, and Pb were evaluated using a short

sequential procedure with two steps (Maiz et al., 1997).

Total Cd, Cu, Zn, and Pb concentration in the leachate from each pot (i.e.

redissolved from the saucers) was quantified by flame atomic absorption

spectrometry (Perkin-Elmer 1100B), as a test of trace element mobility from

pyrite sludge polluted soils.

2.3. Enzyme activities analysis

A set of soil enzymes related to C, N, P, and S cycling were assayed in this

study. Acid phosphatase (EC 3.1.3.2, orthophosphoric-monoester phosphohydro-

lase, acid optimum); alkaline phosphatase (EC 3.1.3.1, orthophosphoric-monoester

phosphohydrolase, alkaline optimum); arylsulfatase (EC 3.1.6.1, arylsulfate

sulfohydrolase), and b-glucosidase (EC 3.2.1.21, b-D-glucoside glucohydrolase)

activities were assayed according to Tabatabai (1994). Urease activity (EC 3.5.1.5,

urea amidohydrolase) was determined according to Gianfreda et al. (1994), where

the product, NH4+, was quantified colorimetrically using the Indophenol Blue

Method (Keeney and Nelson, 1982). Controls were performed in all cases by

adding substrate after the reaction was stopped and prior to the filtration of the

soil suspension.

Dehydrogenase was assayed as described by Casida et al. (1964) with the

following modifications: 1 g soil mixed with 0.01 g of CaCO3 was incubated with

1 ml 3% 2,3,5 tri-phenyl tetrazolium chloride (TTC) and 3 ml water at 37 1C in

darkness. After 6 h, 5 ml methanol was added, and the suspension homogenized

and filtered. Methanol addition was repeated three times, to reach a final volume

of 20 ml added. The optical density at 485 nm was compared to those of tri-phenyl

formazan standards. All results of enzyme activities are reported on dry soil

weight.

xperimental period (mean 7standard deviation).

Loam soil

0 1.3 4

870.13 0.8170.23 0.6970.08 0.6470.07

470.05 0.6170.03 0.6270.02 0.5470.12

ARTICLE IN PRESS

M.B. Hinojosa et al. / Ecotoxicology and Environmental Safety 73 (2010) 970–981972

2.4. Rhizosphere DNA extraction

DNA was extracted from soil as described in Pennanen et al. (2004) in a

96-well format with some modifications: briefly, 1 g of sub-sampled soil was

suspended in 2 ml of 0.12 M NaHPO4 1% SDS; 1 ml of this slurry was bead-beaten

using 1.1 mm glass beads (Thistle Scientific) 3 times at 30 Hz for 1.5 min (Retsch

Mixer Mill MM300) with tubes kept on ice and boxes rotated between pulses to

ensure even beating. Samples were then centrifuged at 5000 rev min�1 for 5 min

and the aqueous phase transferred to new 96-well plates. The samples were

subjected to phenol/chloroform and chloroform extraction followed by precipita-

tion, using isopropanol and sodium acetate, and washing with 70% ethanol

(vortexed and re-centrifuged). The resultant pellet was re-suspended in 100 ml of

10 mM Tris–HCl, (pH 8.5) and treated with polyvinylpolypyrrolidone (PVPP,

Sigma) using Multiscreen HTS HV plates (Millipore), previously equilibrated by

repeated addition of de-ionized water.

2.5. Root DNA extraction

DNA was extracted from root fragments (ca. 40 mg) using the DNeasyTM 96

Plant kit (QIAGEN) according to the manufacturer’s protocol for frozen vegetal

tissues, with the exception that 20 1.1 mm glass beads (Thistle Scientific) were

used instead of a single bead, and samples were repeatedly beaten until root

fragments were pulverized.

2.6. DNA amplification by PCR

Bacterial DNA was amplified using general eubacterial primers, through a

nested PCR approach to provide higher PCR-amplification yields with better band

resolution by agarose gel electrophoresis for all samples. DNA extracted from both

soil and root was used as template to amplify a fragment of 16S gene from

rhizosphere and endophytic–rhizoplane bacteria, respectively.

For the first round PCR amplification, 16f27 (50AGAGTTTGATCMTGGCTCAG 30;

Lane, 1991) and 1405r (50CGGGCGGTGTGTACAAG 30; Pennanen et al., 2004) were

used as primers. The final volume of the reaction mix (25 ml) was achieved as a

mixture of Master Mix (24 ml per reaction), which contained 2.5 U DNA

polymerase (Expand High Fidelity enzyme mix-Roche), 5 pmole of each primer,

0.5 mM final concentration of each nucleotide, 2.5 ml of buffer Expand High Fidelity

(Roche), and 0.5 mg of bovine serum albumin (BSA); 1 ml of extracted DNA was

used as template. PCR was performed with a DNA Engine DYAD thermocycler (MJ),

with an initial denaturation step of 95 1C for 5 min followed by 35 cycles of 95 1C

for 45 s, 54 1C for 45 s, and 72 1C for 90 s, completed by a final extension period of

72 1C for 5 min.

The amplicons generated by the first round PCR were diluted 10 fold

and subjected to a second PCR amplification using as primers: 63f

(50CAGGCCTAACACATGCAAGTC 30; Marchesi et al., 1998) labeled with 6-FAM

and 1087r (50CTCGTTGCGGGACTTACCCC 30; Lane, 1991; MWG Biotech AG). The

second PCR was carried out as described before but performing an elongation of

1 min. PCR products were visualized by agarose gel electrophoresis (1.5%) with

TBE as buffer.

2.7. TRFLP of universal bacterial PCR amplicons

The nested PCR approach generated amplicons with similar band intensity as

revealed by agarose electrophoresis. Digestions with Hpa II restriction enzyme

(Promega) were carried out in a total volume of 10 ml containing 5 ml of PCR

product, 5 U of enzyme, and digestion buffer as recommended by the manufac-

turer, at 37 1C for 4 h. Digests were then diluted 10 fold and 1 ml mixed with

8.95 ml of formamide (Applied Biosystems) and 0.05 ml of GS500 size standard

(Applied Biosystems). Samples were analyzed on an ABI 3700 automated

sequencer. Post run analysis was performed using Genemapper s Software v3.7

(Applied Biosystems UK). Peaks on the resulting electropherogram represented

terminal restriction fragments (TRFs).

2.8. Nematode community analysis

Nematodes were extracted from a 60–65 g subsample of rhizosphere soil using

a decanting and sieving technique (Brown and Boag, 1988). Extracted nematodes

were fixed with 1% formaldehyde (final concentration), counted, processed in

glycerol (Southey, 1970), and mounted on microscope slides, where a representa-

tive subsample of 55 individuals per sample were identified.

2.9. Statistical analysis

A three-way ANOVA was used to test significant effect of the three factors

(pollution load, soil type, and plant treatment) and their interactions on each

assayed enzyme, pH, trace element concentration, and number of nematodes.

One-way ANOVA was used to evaluate the significance of differences among plant

treatments for each dose of pollution and for both soils. Where significant F values

were obtained, differences between individual means were tested using the Tukey

HSD test.

Multivariate analysis of variance (MANOVA) was carried out to test the effects

of pyrite sludge pollution, soil type, and plant treatment, on leached trace

elements and enzyme activities and nematode community. Data were analyzed

using the STATISTICA v 7.0 package (StatSoft, 2004).

A Mantel test was performed to examine similarities between patterns of

terminal restriction fragments (TRFs) from both rhizosphere and endophytic–

rhizoplane bacteria using PC-ORD (McCune and Mefford, 1999). Sørensen’s

distance measure and the randomization (Monte Carlo) procedure with 1000

randomized runs were used to evaluate the null hypothesis of no correlation

between the two distance matrices.

Non-metric multidimensional scaling (NMS) analysis was used to ordinate

samples, taking into account data set containing relative abundance of TRFs from

both rhizosphere and endophytic–rhizoplane bacteria. NMS analysis was also

conducted using data of relative abundance of each nematode family. In all cases

the NMS analysis was based on Sørensen’s distance and the ‘‘slow and thorough’’

autopilot mode of NMS in PC-ORD (McCune and Mefford, 1999) using randomized

data for a Monte Carlo test of significance. The final stability of each run was

evaluated by examining plots of stress (a measure of the dissimilarity between

ordinations in the original n-dimensional space and in the reduced dimensional

space) versus number of iterations. NMS ordination was followed by a three-way

MANOVA of coordinates in ordination axes 1 and 2 for bacterial community data.

Pearson’s correlation indexes between enzyme activities, pH, trace element

content, and the scores of ordination axes resulting from NMS analysis were also

calculated.

3. Results

3.1. Soil pH and leached trace elements

There was a significant reduction of pH after adding 1.3%and 4% pyrite sludge to the sandy loam but not to the loam soil(1-way ANOVA; Po0.05). However, the presence of plants did notcause detectable changes in soil pH (Fig.1).

Soil DTPA and CaCl2 extractable Cd, Pb, Cu, and Zn are reportedin Table 3. Both trace element fractions showed higherconcentration on sandy loam soil than on loam soil (ANOVA;Po0.001). However, there were no significant effects due to thepresence of plant for any of the trace element soil fractions(ANOVA; P40.01). Only DTPA-extractable Pb and Cu, and CaCl2-extractable Cu concentrations increased consistently with the riseof pyrite sludge dose on soils.

Pb was not detected in the leachate but there was a significanttri-factorial interaction effect on the amount of Cd, Cu, and Znleached (3-way MANOVA; Po0.01; Table 4). Only in the sandyloam soil, the presence of plants significantly increased theconcentration of leached Cd, Cu, and Zn (1-way ANOVA; Po0.05;Fig.1). There was also a significant effect of the interactionbetween pollutant dose and plant treatment in the amount ofleached trace elements in the sandy loam soil (2-way MANOVA,Po0.01; Table 4a). Thus, depending on the combination ofpollutant dose and plant species, 3–20 times more traceelements were leached from the sandy loam soil in plantedversus unplanted pots. Generally, the higher the pyrite sludgedose the larger the contribution of plants to trace elementmobilization (Fig.1). However, differential plant species effectswere found for the highest pyrite sludge treatment (4%), wheresignificantly more Cd and Cu were leached from pots containingL. perenne than M. sativa (Fig. 1). Despite the relatively highdifference in the amount of trace elements leached betweencontrol and planted pots, the absolute amounts of Cd, Cu, and Znleached represented a small proportion of the total amountadded. In the sandy loam soil with the highest pyrite sludge dose(4%) only 1.8% and 0.87% of total Cd was leached from L. perenne

and M. sativa pots, respectively. The corresponding values were0.58% and 0.29% for Cu, and 0.25% and 0.20% for Zn, respectively.

ARTICLE IN PRESS

SANDY LOAM SOILeutric fluvisol

H 6

8

10 WITHOUT PLANTLolium perenneMedicago sativa

ns

LOAM SOILcalcareous fluvisol

ns ns nsns

NSA

Bp

0

2

4

6

0.10

ns

ns

NS

BC

B

CA

DM

IUM

μg C

d g-1

μg C

u g-1

0.04

0.06

0.08 b

c

NS

A A

B

0.00

0.02

2

3

4

ns ns

b

a

c

nsnsns

NSB

CO

PPER

0

1

6

nsb b

a

a

ns nsns0.2 A A

ZIN

C

μg Z

n g-1

23456

b b b

b b

0.2

NSB

A A

0%0

bns b b

aa

nsns

a a

PYRITE SLUDGE DOSE (%)

4%1.3% 0% 4%1.3%

Fig. 1. Soil pH and amounts of Cd, Cu, and Zn leached per gram of soil in pots differing in soil type, pollution, and plant treatments (no plant=white column, Lolium

perenne=light gray, Medicago sativa=dark gray), over the experimental period (105 days). Significant differences among plant treatments are noted by lower case letters,

and significant differences among pollution levels by upper case letters (Tukey HSD, Po0.05). Non-significant differences are denoted as ns or NS.

M.B. Hinojosa et al. / Ecotoxicology and Environmental Safety 73 (2010) 970–981 973

In the loam soil, significant plant effects (Po0.05) on leachingwere only found for Zn and in the soils amended with 1.3% pyritesludge (Fig. 1).

3.2. Enzyme activities

There were significant ‘‘soil type�pollution’’ and ‘‘pollu-tion�plant treatment’’ interactions, and main factor (degree ofpollution, soil type, and plant treatment) effects on enzyme

activities (3-way MANOVA; Table 4). Generally, soil enzymeactivities in the loam soil were significantly higher than in thesandy loam soil, but negative effects of pollution were moreevident for the sandy loam soil (Fig. 2). In the sandy loam soil,there was a reduction of about 38% and 58% in enzyme activitieswith 1.3% and 4% pyrite sludge doses, respectively, apart fromurease activity, which was not significantly reduced by pyritesludge (1-way ANOVA; Po0.05; Fig. 2). In the loam soil, alkalinephosphatase was more sensitive to pollution than the otherenzymes, showing a reduction of around 45% with the addition of

ARTICLE IN PRESS

Table 3DTPA and CaCl2 extractable trace element concentrations (mg kg�1) in soils. Mean 7 standard deviation.

Pollution load Plant treatment DTPA extractable CaCl2 extractable

Cd Pb Cu Zn Cd Pb Cu Zn

Sandy loam soil

0% No plant 0.9070.07 2.3071.64 3.7970.44 11.7370.95 0.0670.02 14.1778.71 0.0070.00 0.0870.11

L perenne 0.7670.07 1.1671.67 3.3370.95 11.3971.54 0.0770.04 11.46710.22 0.1470.24 0.1270.10

M. sativa 0.8470.08 0.7271.60 4.2770.95 12.3871.23 0.1070.03 12.0079.69 0.4370.31 0.0670.08

1.3% No plant 0.7170.23 12.2572.50 4.6770.69 11.5270.91 0.1670.09 14.6178.21 1.1170.96 0.7070.49

L perenne 0.6970.15 11.3574.07 3.8871.17 10.4771.42 0.1170.03 10.3879.24 1.2971.14 1.7871.57

M. sativa 0.9170.13 12.1475.10 5.2870.69 12.0670.93 0.1370.04 10.59711.30 0.3870.58 0.4170.57

4% No plant 0.8470.05 33.2676.60 5.0672.77 9.1676.47 0.1470.03 12.0174.57 4.6370.51 5.3271.23

L perenne 0.8270.07 30.9674.57 5.1071.87 9.1374.14 0.1970.24 9.8277.93 2.9871.64 2.9271.43

M. sativa 0.9870.05 32.59715.1 10.2179.14 12.0873.49 0.4670.59 5.1772.08 3.4371.23 3.3871.27

Loam soil

0% No plant 0.0070.00 4.5470.95 1.3170.08 1.8470.12 0.1270.06 5.0573.27 0.1370.19 0.1670.05

L perenne 0.0570.04 4.3370.50 1.0570.45 1.7270.64 0.1070.02 6.8277.07 0.2570.22 0.0870.08

M. sativa 0.0570.05 3.9772.16 2.2570.58 2.4070.35 0.0570.02 7.0774.84 0.0970.17 0.0570.08

1.3% No plant 0.0870.02 38.7371.96 4.6370.59 5.5270.40 0.0670.01 10.4176.44 0.4070.57 0.0070.00

L perenne 0.0770.01 40.1274.15 5.2170.83 5.2771.25 0.0870.06 8.4277.87 0.4270.29 0.0270.03

M. sativa 0.0770.03 41.7176.31 4.8872.32 5.5470.60 0.1470.07 9.4078.69 0.3870.42 0.1370.11

4% No plant 0.2170.09 62.5572.28 14.6472.56 14.3471.69 0.1170.05 2.4871.17 0.7870.00 0.0070.00

L perenne 0.1470.07 50.5672.67 9.6174.66 9.6074.48 0.1070.03 5.1576.50 0.4870.22 0.0770.08

M. sativa 0.3970.56 62.7178.13 9.3773.56 9.9974.25 0.1070.07 2.7371.55 0.0870.19 0.0470.08

Table 4Three-way MANOVA for the effects of soil type, pollution level, and plant treatment on leached trace elements (Cd, Cu, and Zn), enzyme activities, and bacterial and

nematode communities.

Leached trace

elements

Enzyme activities

(rhizosphere)

Bacterial community

(rhizosphere)

Bacterial community

(rhizoplane)

Nematode community

(rhizosphere)

Soil (S) nn n nn nn n

Pollution (Po) nn nn nn nn nn

Plant (Pl) nn nn ns nn n

S�Po nn nn nn nn nn

S�Pl nn ns ns nn n

Po�Pl nn n ns nn nn

S�Po�Pl nn ns ns nn n

(a) 2-way MANOVA for sandy loam soil

Pollution (Po) nn nn nn nn nn

Plant (Pl) nn nn ns nn nn

Po�Pl nn n ns nn ns

(b) 2-way MANOVA for loam soil

Pollution (Po) n nn n n ns

Plant (Pl) ns nn ns nn ns

Po�Pl ns ns ns nn ns

Note: Soil factor has two levels: sandy loam and loam. Pollution factor has three levels: 0%, 1.3%, and 4% pyrite sludge. Plant treatment includes three levels: no plant,

M. sativa, and L. perenne; (a) and ( b) show 2-way MANOVA for the effects of pollution level and plant treatment in sandy loam and loam soil, respectively. nPo0.05;nn Po0.01; ns denote not significant effect.

M.B. Hinojosa et al. / Ecotoxicology and Environmental Safety 73 (2010) 970–981974

pyrite sludge (Fig. 2). Arylsulfatase, urease, and dehydrogenaseactivities were significantly reduced only by the addition of 4%pyrite sludge (Po0.05; Fig. 2).

However, as a consequence of a significant ‘‘plant treat-ment�pollution dose’’ interaction effect (3-way MANOVA,Po0.05), soils with the highest pyrite sludge dose showed thelowest enzyme activity enhancement due to the presence of plant,mainly in the sandy loam soil (Table 4, Fig. 2). The non-pollutedsandy loam soil with plants showed significantly higher (1-wayANOVA; Po0.05) arylsulfatase and acid phosphatase thanunplanted soil, b-glucosidase and dehydrogenase activitiesshowed the same pattern but only with the presence ofL. perenne. The non-polluted loam soil showed only an increaseof urease activity in the presence of plants.

3.3. Rhizosphere and endophytic–rhizoplane bacterial communities

In the sandy loam soil with 4% pyrite sludge no plants survivedthe experimental period of 105 days. Thus, these experimentalunits were not included in the endophytic–rhizoplane bacteriaanalysis. However, they were included in the rhizosphereanalysis, since plants died 8–12 days before the end of theexperiment, although data should be interpreted with caution.

Figs. 3a and b show the results of the non-metric multi-dimensional scaling (NMS) analysis based on relative abundanceof TRFs resulting from rhizosphere and rhizoplane bacterialcommunity. Soil type, pollution level, and their interaction hadsignificant effects (3-way MANOVA; Po0.01) on the scores of thesamples in the rhizosphere ordination axes (Fig. 3a, Table 4).

ARTIC

LEIN

PRESS

SANDY LOAM SOILeutric fluvisol

100

LOAM SOILcalcareous fluvisol

SANDY LOAM SOILeutric fluvisol

150

175

LOAM SOILcalcareous fluvisol

nsb

a a aAAB

A

NS

μg p

NP

g-1

h-1

40

60

80

μg p

NP

g-1h-1

50

75

100

125

a

b b

nsns

ns

nsns

ab

ab b

aba bab

b

a a

b

A

B B

BA

B B

AR

YLSU

LFA

TASE

0

20

300

350

β-G

LUC

OSI

DA

SE

0

25

50

60ns ns b

ns

b

b b

NS NSA AB

μg p

NP

g-1h-1

100

150

200

250

UR

EASE

μg N

H 4+ g-1

h-1

20

30

40

ns ns ns

ns

ns

a

b b

b b

a

aa

b bA

B

C

B

AC

ID P

HO

SPH

ATA

SE

0

50

250

3000

10

50

ns

ns ns ns

a

BA

A

A A

B

μg p

NP

g-1h-1

100

150

200

μg T

PF g

-1h-1

20

30

40ns

ns

ns

ns

ns

a

b b

b ba

b b ba

b aba b

a

C

B A

B BA

B

C

B

0%

ALK

ALI

NE

PHO

SPH

ATA

SE

0

50 DEH

YDR

OG

ENA

SE

0

10

WITHOUT PLANT

nsab a aa

Lolium perenneMedicago sativa

4%1.3% 0% 4%1.3% 0% 4%1.3% 0% 4%1.3%

Fig. 2. Rhizosphere enzyme activities (mean 7SE) under different soil type, pollution, and plant treatments. Significant differences among plant treatments are noted by lower case letters, and significant differences among

pollution levels by upper case letters (Tukey HSD, Po0.05). Non-significant differences are denoted as ns or NS.

M.B

.H

ino

josa

eta

l./

Eco

toxico

log

ya

nd

En

viro

nm

enta

lSa

fety7

3(2

01

0)

97

0–

98

19

75

ARTICLE IN PRESS

SOIL BACTERIAL COMMUNITY0.4

0.6

AL0

RHIZOPLANE BACTERIAL COMMUNITY1.0

AL0 BM0

2 (2

1.6%

)

0.0

0.2 A0A4AM4

AL4

AM0

AL0

0.0

0.5BM4

BL4AM0BL0

BL1.3

Axi

s

-0.6

-0.4AL1.3

Axi

s2 (3

9.2%

)

-1.0

-0.5

AM1.3

AL1.3

Axis 1 (61.7%)-2.0

-0.8

Axis 1 (49.7%)-0.8

-1.5

-0.2

1.00.50.0-0.5-1.0-1.5

AM1.3A1.3

BM1.3

1.00.80.60.40.20.0-0.2-0.4-0.6

Fig. 3. Non-metric multidimensional scaling plot of TRF patterns of rhizosphere and endophyte-rhizoplane bacterial communities from different soil type, pollution, and

plant treatments. The proportion of variance explained by each axis is reported in brackets. Sandy loam soil is noted as A (squares) and loam soil as B (circles), Lolium

perenne as L (dots) and Medicago sativa as M (crosses), and the % of pyrite sludge added is noted by 0, 1.3, and 4. Bars are least significant differences at Po0.05.

Table 5Diversity descriptors of both rhizosphere and endophyte-rhizoplane bacterial communities.

Pollutant dose (%)

Sandy loam soil Loam soil

0 1.3 4 0 1.3 4

Rhizosphere

Richness

No plant 13.170.6 a 11.774.5 10.070.9 a 18.372.2 19.270.3 16.370.7

L. perenne 16.072.5 b 12.672.3 14.570.3 b 18.271.8 19.371.2 15.870.8

M. sativa 15.271.8 b 14.472.4 14.570.5 b 18.671.6 19.070.9 16.270.9

Shannon index (H0)

No plant 1.870.0 1.770.3 2.170.2 2.370.2 2.470.2 2.470.2

L. perenne 1.670.2 1.670.2 2.070.2 2.070.2 2.570.1 2.370.1

M. sativa 1.870.1 1.970.2 2.270.1 2.270.1 2.370.2 2.370.0

Rhizoplane

Richness

L. perenne 11.570.2 12.370.9 11.372.4 17.570.3 18.370.7 TT

M. sativa 11.571.0 8.371.8 12.371.5 17.370.7 16.572.9 TTTT

Shannon index (H0)

L. perenne 2.5700 2.470.1 2.170.2 2.770.0 2.570.1 TTTT

M. sativa 2.470.1 2.170.1 2.170.1 2.470.1 2.270.1 TT

Note: Data are the mean (7 standard error) values of richness (number of TRFs) and Shannon index was calculated as –SPi ln Pi, where Pi is the relative abundance of each

terminal restriction fragment. In the same column, different letters mean significant differences among soils with different plant treatments (1-way ANOVA, Po0.05).

M.B. Hinojosa et al. / Ecotoxicology and Environmental Safety 73 (2010) 970–981976

Bacterial TRF patterns differed for the two soil types, withsignificant effects of pollution for both soils. However, for noneof the soils the presence of plants had a significant effect(P40.05) on rhizosphere bacterial community structure (2-wayMANOVA; Po0.05; Fig. 3a).

The descriptors of diversity for rhizosphere bacterial commu-nity (Table 5) showed no significant changes due to pollution. Thepresence of plants caused a significant increase in TRF richness forsandy loam soil with 0% and 4% pyrite sludge.

There were significant ‘‘soil�pollution’’ and ‘‘soil�pollution�plant’’ interactions, and all main factors effects, on the scores ofendophytic–rhizoplane bacteria samples from the NMS analysis(3-way MANOVA; Po0.01; Fig. 3b; Table 4). For both soil types wefound significant effects in endophytic–rhizoplane bacterial TRFpatterns due to both plant and pollution factors and their interaction(2-way MANOVA; Po0.01; Table 4). In the loam soil, bacterial TRFpatterns of L. perenne rhizosphere were not significantly (1-way

MANOVA; P40.05) affected by pollution at the 1.3% pollution level,but those of M. sativa were significantly affected by both 1.3% and 4%pyrite sludge doses (1-way MANOVA; Po0.05).

Richness and Shanon indexes estimated from rhizoplane TRFdid not show significant effect due to pollution or plant treatment(Table 5).

Both bacterial TRF patterns (rhizosphere and endophytic–rhizo-plane) were correlated (r=0.31; Po0.001; Mantel test), indicating asimilar tendency in the shift in both bacterial communities due tosoil type, pollution level, and plant treatments.

3.4. Nematodes

In the sandy loam soil there were significantly (1-way ANOVA;Po0.001) fewer nematodes than in the loam soil at all levels ofpollution and plant treatments (Fig. 4). Soil pollution significantly

ARTICLE IN PRESS

30

40

WITHOUT PLANTLolium perenneMedicago sativa ns

b

a

c

nsA

A

B B

num

ber o

f nem

atod

es g

-1 (d

w)

10

20 ns

nsb

a a

a

B

C

0%0

Pyrite sludge dose (%)4%1.3% 0%

Pyrite sludge dose (%)4%1.3%

SANDY LOAM SOIL LOAM SOIL

Fig. 4. Mean total amount of individual nematodes per gram of rhizosphere soil under each soil type, pollution, and plant treatment. Bars denote standard errors.

Significant differences among plant treatments are noted by lower case letters and significant differences among pollution levels by upper case letters (Tukey HSD,

Po0.05). Non-significant differences are denoted as ns or NS.

Table 6Trophic structure of nematode community in planted and unplanted soils (sandy loam and loam) with increasing levels of pyrite sludge.

Pollutant dose (%)

Sandy loam soil Loam soil

0 1.3 4 0 1.3 4

Bacterial feeders

No plant 42.073.1 a 85.7714.3 a 100.070.0 19.174.1 a 20.775.8 a 25.573.3 a

L. perenne 24.472.4 b 60.974.2 ab 50.070.0 21.177.4 a 22.472.1 a 36.876.74 b

M. sativa 43.973.8 a 52.8712.1 b nd 30.573.5 b 41.271.0 b 42.275.8 c

Fungal feeders

No plant 13.175.0 a 10.770.0 a nd 46.472.7 a 49.978.5 a 40.872.9 a

L. perenne 22.172.4 b 23.676.1 b nd 48.777.9 a 40.272.7 a 32.671.5 b

M. sativa 20.472.1 b 47.2712.1 c nd 48.372.7 a 24.471.5 b 23.972.6 c

Plant feeders

No plant 6.472.2 a nd nd 13.773.1 a 7.972.3 a 15.875.4a

L. perenne 24.173.9 b 9.670.8 50.070.0 7.072.8ab 10.773.1 a 9.871.9ab

M. sativa 12.277.6 c nd nd 6.971.3 b 10.873.8 a 6.872.1 b

Predators/omnivorous

No plant 38.578.1 a 3.670.0 nd 21.276.3 a 21.474.9 a 17.973.9 a

L. perenne 29.571.1ab 5.972.9 nd 23.172.3 a 26.774.4 a 20.874.2ab

M. sativa 23.575.5 b nd nd 14.470.7 b 23.673.2 a 27.172.2 b

Data are the mean (7 standard error) of the relative abundance of each trophic level. In the same column, different letters mean significant differences among soils with

different plant treatments (1-way ANOVA, Po0.05); nd is used to denote that nematodes were not detected in the sample.

M.B. Hinojosa et al. / Ecotoxicology and Environmental Safety 73 (2010) 970–981 977

decreased the number of nematodes in both soils, although moredrastically in the sandy loam soil (Fig. 4). The presence of plantssignificantly increased (1-way ANOVA; Po0.05) the number ofnematodes in the loam soil without pollution, with moreindividuals under M. sativa than L. perenne (Fig. 4). In the sandyloam soil with 1.3% pyrite sludge the number of nematodes wassignificantly higher under L. perenne compared with the othertreatments.

Unplanted sandy loam soil consistently showed the highestproportion of bacterial feeders, and the lowest proportion ofomnivores-predator nematodes, at all doses of pyrite sludgepollution (Table 6). However, when plants were present, theproportion of plant and fungal feeders increased in the treatmentswith null or low levels of pollution. In the loam soil, theproportion of different trophic groups was generally not affectedby pollution or the presence of plants.

Fig. 5 shows the multivariate analysis NMS carried out withthe relative abundance of each nematode family in rhizospheresamples. After NMS analysis, Axis 1, which differentiatesnematode community structure according to pollution level,explaining 66% of total variability, was positively (Po0.05)correlated with the percentage of Cephalobidae and negatively(Po0.05) with the percentage of Dorylaimidae. Axis 2, explaining27% of total variability and discriminating nematode communitystructure according to soil type, was positively correlated with thepercentage of Aphelenchidae and negatively with Tylenchidae.

4. Discussion

Soil type and different levels of pyrite sludge played animportant role in the bioavailability of trace elements (DTPA and

ARTICLE IN PRESS

1.0

1.5

AM0

AM1.3

A0

AX

IS 2

(27%

)

0.0

0.5

BL4

BM4

AL0

A0A1.3

B4

AL1.3

BM1.3

-1.0

-0.5

BM4B4BL1.3

B1.3BM0

B0BL0

AXIS 1 (66%)-1.0 -0.5 0.0 0.5 1.0 1.5 2.0

Fig. 5. Non-metric multidimensional scaling plot with percentages of each

nematode family. The proportion of variance explained by each axis is reported

in parentheses. Sandy loam soil is noted as A (squares) and loam soil as B (circles),

Lolium perenne as L (dots) and Medicago sativa as M (crosses), and the % of pyrite

sludge added is noted by 0, 1.3, and 4. Bars are least significant differences at

Po0.05. Pots on sandy loam soil with the highest level of pollution (4% of pyrite

sludge) were not included in the analysis due to the lack of nematodes.

M.B. Hinojosa et al. / Ecotoxicology and Environmental Safety 73 (2010) 970–981978

CaCl2 extractable). Similar results were described and discussed inHinojosa et al. (2008).

These results, according to our previous studies, showed adecrease in soil pH due to an increase of pyrite sludge pollution(Hinojosa et al., 2004a, 2008; Carreira et al., 2008).

The lack of detectable changes in soil pH values as aconsequence of plant growth is contrary to the acceptance thatpH may decrease due to acid rhizodeposition (Shen et al., 2001;Garcıa et al., 2005; Hinsinger et al., 2005).

However, we found that the amount of leached trace elementswas higher in treatments with plants than without, particularly inthe sandy loam soil. The occurrence of localized micro-sitedecreases in soil pH, which were enough to cause transient traceelement mobilization (Killham, 1994) but not to be detected withthe standard pH measurements employed in this study, mayexplain these results.

Although mobility was not observed for Pb in these soils,which has been previously reported (Camobreco et al., 1996;Schwab et al., 2008; Marti!nez-Alcala! et al., 2009), the amount ofZn, Cd, and Cu leached in polluted soil was increased by thepresence of plants. This enhancement was more significant in thecase of Cd, which is considered to be the most mobile traceelement in soil (Alloway and Jackson, 1991). For the interpreta-tion of our results it should be considered that while acidificationmay influence the exchangeable trace element fraction, leachingmay be affected by trace element adsorption by clay mineralor organic material as root exudates or other rhizodeposits (Bell,1998), which unfortunately have not been analyzed in this studybut open new lines for future research.

Our study confirms that, in soils with low bufering capacity(sandy loam) and polluted with pyrite sludge, the presence of ahigh density of root system can mobilize some metallic species.During our manipulative experiment (105 days), the percentageof trace elements leached from planted pots was up to 1.8% of thetotal added (sandy loam soil, 4% of pyrite sludge). There is noevidence to confirm that these results are indicative of a directrisk of trace element lixiviation at field scale and conditions.

Controversy exists about the effects of root exudates ontrace element solubility (Cattani et al., 2006, Degryse et al.,2008, Dessureault-Rompre et al., 2008, Martınez-Alcala et al.,2010).

In our opinion, the impact of organic acids exuded byplants and microorganisms on trace element mobilization iscomplex and is likely to depend on specific chemical species, plantspecies, and environmental conditions. For the correct interpreta-tion of these data it should be taken into account that traceelement mobilization on these pots (experimental units), wherethe plant died by the end of the experiment, could be affected alsoby the release or leakage of low molecular weight (LMW)molecules resulting from damaged or dead root tissues.

However, according to Hees et al. (2000), organic acidsgenerally correspond to 0.5–15% of the total acidity. In addition,decreases in pH might be explained by the respiration of bothroots and microorganisms, which contribute significantly to thebuild-up of CO2 in the rhizosphere and consequently decrease soilsolution pH (Van Breemen, 1991; Hinsinger et al., 2005).

In this sense, a further identification and quantification ofdirect factors involved in trace element mobilization (for example,LMW molecules in the rhizosphere) could contribute to themechanistic understanding of these processes and move this fieldforward.

Under field conditions, in terms of risk evaluation, otherfactors should be considered, as for example that roots canalso increase aggregate stabilization in soil (Lynch and Bragg,1985) reducing soil erosion and transport of contaminatedparticles (Albadalejo et al., 1996). In addition, according toPerez-de-Mora et al. (2005, 2007), it should be considered alsothat re-vegetation of trace element polluted soil, previouslyamended with leonardite, litter, or sugarbeet lime, could be asuitable option for long term reclamation of moderately con-taminated soil.

While analytical methods have been developed for estimatingthe mobility and bioavailability of trace elements in soil (Sauveet al., 1997), the relationship of these values to ecological toxicityis not fully understood. Therefore, true indicators of the ecologicalharm caused by contaminants could be the indigenous organisms(Ellis et al., 2001).

In this study changes in microbial community structure andfunction in the rhizosphere of polluted soil were a consequence ofcomplex interactions between soil type, pollution dose, and plantspecies. Hydrolase activities (arylsulfatase, alkaline and acidphosphatases, and b-glucosidase) were negatively correlated(Po0.05) with pyrite sludge dose, confirming our previousfield-based observations of a reduction in soil enzyme activitiesdue to pyrite sludge pollution (Hinojosa et al., 2004a, b; Carreiraet al., 2008). Similar results in relation to the effect of traceelements in enzyme activities have been reviewed by Speir andRoss (2002). Although dehydrogenase was a good indicator ofpolluted soil in this and previous studies (e.g. Hinojosa et al.,2004a, b), it should be used with caution because of severalconfounding factors. In theory it should only operate as anenzyme (or group of enzymes) involved in electron transportduring oxidative metabolism in viable cells. However, thereare extracellular phenol oxidases and alternative electron accep-tors (such as nitrate or humic acids) in soils, which can causean overestimation of dehydrogenase activity (Bremner andTabatabai, 1973). Furthermore, Cu reduces the measured dehy-drogenase activity by interfering with the assay procedure(Chander and Brookes, 1991).

According to Speir et al. (1992), the mode of action of traceelements on enzyme activity reduction varies with enzyme andlittle is known about the exact mechanisms by which traceelements interact with the multitude of enzymes that exist in soil.Thus, we do not know for certain if changes of each individualenzyme activity were due to the effect of pH or bioavailabletrace elements, or to a combination of both. Establishing therelative effects of pH and bioavailable trace elements on enzyme

ARTICLE IN PRESS

M.B. Hinojosa et al. / Ecotoxicology and Environmental Safety 73 (2010) 970–981 979

activities is difficult since both factors have been shown toconcomitantly promote changes in enzyme activities (Speir et al.,1999).

However, it is widely accepted that the nature and degree ofenzyme activity reduction induced by trace elements are stronglydependent on the soil type. In the present study, the sandy loamsoil showed the highest reduction in soil enzyme activities due topyrite sludge pollution. This is likely to be due to its low surfacearea, CEC, and organic matter content, all of which may reduce thepotential of the soil to inactivate trace elements via complexationor sorption reactions, resulting in an increase in availability oftrace elements with a higher subsequent effect on enzymeprocesses (Speir et al., 1995).

Our results show that different hydrolase activities arestimulated depending on plant and soil type, agreeing with thoseof Renella et al. (2007). The increase of hydrolase activity due tothe presence of roots could be a result of greater microbial activitysustained by exudates and/or due to the release of enzymes fromplant roots (Pinton et al., 2001). On the other hand, the decrease ofhydrolase activities caused by the presence of high amounts oftrace elements interferes with the possible beneficial effects of theplant–soil association. Thus, in the sandy loam soil there was asignificant interaction effect of plant treatment and pollutantdose. Here the inhibition of enzyme activities by pollution wasattenuated by the presence of plants at 1.3% pyrite sludge but notat the highest pollutant dose (i.e. 4%). This could imply that in thissoil the capability of the plant to chelate trace elements via rootexudates was effective at the lower trace element dose but not atthe higher dose. This complexity prevents accurate selection ofthe best enzyme or enzymes in order to be used as key indicators.Further studies are needed to better elucidate whether reducedmineralization in the rhizosphere of contaminated soils is due tolower amounts of root exudates metabolized by soil microorgan-isms or due to direct toxic effects of trace elements to rhizospheremicroorganisms.

Differences in enzyme activities due to soil type and pollutioneffects could be also due to changes in the composition of soilmicrobial community, although it is difficult to point out a clearrelationship between enzyme activities and specific group ofmicroorganism that produce them (Nannipieri et al., 2003).Results obtained for bacterial communities demonstrated aconsistent influence of soil type on bacterial community struc-tures. Both rhizosphere and endophytic–rhizoplane bacterialcommunities were different in non-polluted and polluted soils,agreeing with results of a previous field study of microbialcommunity in soils from the Guadiamar basin affected differentlywith pyrite sludge pollution (Hinojosa et al., 2005). In thisprevious field research both PL-FA and EL-FA approachessuccessfully discriminated, in a multivariate basis, soil microbialcommunities according with the level of pollution and soil type.Other studies have also detected shifts in the rhizospherebacterial community caused by heavy metal contamination usingother molecular techniques (Muller et al., 2002; Gremion et al.,2004; Zhang et al., 2007).

In our study there were no significant differences inrhizosphere bacterial community composition associatedwith different plant species in the same soil. However, differencesin endophytic–rhizoplane bacterial community structurewere dependent on the plant species. Specific microbialcommunities of plant species have been described previously instudies, where different plant species were grown separately(Marschner et al., 2001; Ibekwe and Kennedy, 2003; Singhet al., 2007).

These differences in endophytic–rhizoplane bacterial commu-nity among plant species may be attributed to differentialamounts and composition of root exudates (Baudoin et al.,

2003; Marschner et al., 2005). Each plant species may modifythe conditions in the rhizosphere in order to optimize nutrientacquisition by promoting particular functional groups of micro-organisms (Marschner et al., 2005). However, it should be notedthat under field conditions, variables such as soil type and texture,micro-site variation in nutrient availability, and soil moisture willalso influence rates of root exudation and their chemicalcomposition.

In our study the TRF patterns generated by both rhizosphereand endophytic–rhizoplane bacterial communities weresignificantly correlated. This agrees with those of DellAmicoet al. (2004), who found that the DGGE profiles obtained directlyfrom the DNA of the rhizosphere and rhizoplane fractionswere very similar, indicating a similarity in both bacterialspecies composition and dominance of several groups in bothfractions.

Scores in Axis 1 from NMS analysis with TRFLP rhizospheredata were correlated with enzyme activities (alkaline phophatase,urease, and dehydrogenase; r=�0.62 to �0.80, Po0.05), sug-gesting that bacterial community composition and some func-tions were linked. Likewise, Kandeler et al. (2002) found that theobserved decrease of acid and alkaline phosphatase with increas-ing distance from the root surface was associated with changes inbacterial community composition. However, some hydrolyticactivities (arylsulfatase, acid phosphatise, and b-glucosidase) didnot show consistent links with bacterial community compositionin the present study. This may be due to the fact that decreases inabundance and/or activity of a certain species can be compen-sated by increases in abundance and/or activity of another specieswith a similar function, i.e. there is functional redundancy (Zaket al., 1994).

Nematode abundance and community structure were affectedby the pyrite sludge pollution, mainly in the sandy loam soil.Similar results showing significant effects of trace elementpollution on nematode communities have been previouslydescribed (Zullini and Peretti, 1986; Korthals et al., 1996; Nagy,1999; Shao et al., 2008). The decrease of pH associated with pyritesludge pollution in the sandy loam soil might, by itself, alsoexplain the differences found in nematode community as somespecies are known to be very responsive to pH changes (Patonet al., 2006).

The nematode family Cephalobidae, mainly cp2 bacterialfeeders, described as colonizer-persister group by Bongers andBongers (1998), was the most resistant to pyrite sludge pollution.This agrees with Bongers and Bongers (1998), who proposed thatin a stressed environment, with low soil activity, cp2 nematodestend to dominate.

The nematode family Dorylaimidae (mainly cp4 and cp5omnivores) was the most sensitive group to pyrite sludgepollution. Similarly, previous studies pointed out that the orderDorylaimida was the most sensitive group to trace elementpollution (Zullini and Peretti, 1986; Shao et al., 2008). Theobservation that these persister nematodes were more sensitiveto pollution than colonizers is likely to be due to: (i) cumulativeeffects in long-lived species, (ii) high genetic variability ofopportunists accelerating the selection of tolerant genotypes,and (iii) rapid recovery of opportunists during fluctuations instress concentration.

We found a general tendency of increasing nematode abun-dance with the presence of plants, although it was significant justin the case of loam soil without pollution. We also foundsignificant changes in the proportion of different trophic groupsas a consequence of plant presence, indicating that nematodecommunity was affected directly and/or indirectly (throughchanges in microbial community) by root exudates (Bouwmanet al. 2005, Shao et al., 2008).

ARTICLE IN PRESS

M.B. Hinojosa et al. / Ecotoxicology and Environmental Safety 73 (2010) 970–981980

5. Conclusions

Our work confirms that the development of rhizospheres inpolluted soils might increase the mobilization of trace elements incoarse-textured soil. On the other hand, in general the presence ofroots has stimulatory effects on soil quality indicators such ashydrolase activities and both bacterial and nematode commu-nities. However, the presence of high amounts of trace elementsinterferes with these beneficial effects of plant presence.

Furthermore, this study provided evidence that the impact ofgrowing plants on trace element polluted soils is complex. Traceelement mobilization, hydrolase activities, and bacterial andnematode communities are dependent on plant species, soil type,and pollution dose. In addition, not all trace elements, soilenzymes, bacteria, or nematode groups respond in the sameway to plant root presence, suggesting that polluted soils are asystem of a great complexity.

Data here demonstrate that to build a true picture of theimpact of trace element contamination, it is necessary to examineseveral components of the ecosystem, as they may responddifferently to environmental perturbations. Finally, to elucidate amore realistic potential impact of re-vegetation in the ecology oftrace element polluted soil, there is the need of further in situ

studies.

Acknowledgments

This work was supported by the Environmental ProtectionAgency of the Regional Government of Andalusia, as part of thePICOVER and SECOVER projects (Planes de Investigacion ySeguimiento Ecorregional del Corredor Verde del Guadiamar).Dr. Hinojosa thanks the Regional Government of Andalusia(Consejerıa de Educacion y Ciencia) for funding a short-stay-abroad fellowship to carry out part of this research in the ScottishCrop Research Institute (SCRI). We thank three anonymousreviewers for their helpful suggestions to improve this manu-script.

References

Albadalejo, J., Castillo, V., Roldan, A., 1996. Rehabilitation of degraded soils bywater erosion in semiarid environment. In: Rubio, J.L., Calvo, A. (Eds.), SoilDegradation and Desertification in Semiarid Environments. Geoforma, Logrono,pp. 265–278.

Alloway, B.J., Jackson, A.P., 1991. The behavior of heavy metals in sewage-sludgeamended soils. Sci. Total Environ. 100, 151–176.

Arienzo, M., Adamo, P., Cozzolino, V., 2004. The potential of Lolium perenne forrevegetation of contaminated soil from a metallurgical site. Sci. Total Environ.319, 13–25.

Bais, H.P., Weir, T.L., Perry, L.G., Gilroy, S., Vivanco, J.M., 2006. The role of rootexudates in rhizosphere interactions with plants and other organisms. Annu.Rev. Plant Biol. 57, 233–266.

Baudoin, E., Benizri, E., Guckert, A., 2003. Impact of artificial root exudates on thebacterial community structure in bulk soil and maize rhizosphere. Soil Biol.Biochem. 35, 1183–1192.

Bell, F.G., 1998. Environmental Geology: Principles and Practice. Blackwell ScienceLtd., Oxford 594pp.

Bongers, T., 1990. The maturity index: an ecological measure of environmentaldisturbance based on nematode species composition. Oecologia 83, 14–19.

Bongers, T., Bongers, M., 1998. Functional diversity of nematodes. Appl. Soil Ecol.10, 239–251.

Bouwman, L.A., Bloem, J., Romkens, P.F.A.M., Japenga, J., 2005. EDGA amendmentof slightly heavy metal loaded soil affects heavy metal solubility, crop growthand microbivorous nematodes but not bacteria and herbivorous nematodes.Soil Biol. Biochem. 37, 271–278.

Bremner, J.M., Tabatabai, M.A., 1973. Effect of some inorganic substances on TTCassay of dehydrogenase activity in soils. Soil Biol. Biochem. 5, 385–386.

Brown, D.J.F., Boag, B., 1988. An examination of methods used to extract virus-vector nematodes (Nematoda: Longidoridae and Trichodoridae) from soilsamples. Nematol. Medit. 16, 93–99.

Camobreco, V.J., Richards, B.K., Steenhuis, T.S., Peverly, J.H., McBride, M.B., 1996.Movement of heavy metals through undisturbed and homogenized soilcolumns. Soil Sci. 161, 740–750.

Carreira, J.A., Vinegla, B., Garcıa-Ruız, R., Ochoa, V., Hinojosa, M.B., 2008. Recoveryof biochemical functionality in polluted flood-plain soils: the role ofmicrohabitat differentiation through revegetation and rehabilitation of theriver dynamics. Soil Biol. Biochem. 40, 2088–2097.

Casida, L.E., Klein Jr, D.A., Santero, T., 1964. Soil dehydrogenase activity. Soil Sci. 98,371–376.

Cattani, I., Fragoulis, G., Boccelli, R., Capri, E., 2006. Copper bioavailability in therhizosphere of maize (Zea mays L.) grown in two Italian soils. Chemosphere 64,1972–1979.

Chander, K., Brookes, P.C., 1991. Is the dehydrogenase assay invalid as a method toestimate microbial activity in Cu-contaminated and non-contaminated soils?Soil Biol. Biochem. 23, 901–915.

Consejerıa de Medio Ambiente, 2002. Programa de Investigacion del CorredorVerde del Guadiamar. PICOVER 1999–2002. Sevilla, 192pp.

Degryse, F., Verma, V.K., Smolders, E., 2008. Mobilization of Cu and Zn by rootexudates of dicotyledonous plants in resin-buffered solutions and soils. PlantSoil 306, 69–84.

DellAmico, E., Cavalca, L., Andreoni, V., 2004. Analysis of rhizobacterial commu-nities in perennial Graminaceae from polluted water meadow soil, andscreening of metal-resistant, potentially plant growth-promoting bacteria.FEMS Microbiol. Ecol. 52, 153–162.

Dessureault-Rompre, J., Nowack, B., Schulin, R., Tercier-Waeber, M.-L., Luster, J.,2008. Metal solubility and speciation in the rhizosphere of Lupinus albuscluster roots. Environ. Sci. Technol. 42, 7146–7151.

Ellis, R.J., Neish, B., Trett, M.W., Best, J.G., Weightman, A.J., Morgan, P., Fry, J.C.,2001. Comparison of microbial and meiofaunal community analyses fordetermining impact of heavy metal contamination. J. Microbiol. Methods 45,171–185.

FAO/UNESCO, 1974. FAO/UNESCO. Soil Map of the World, vol. I. FAO, Rome.Garcıa, C., Roldan, A., Hernandez, T., 2005. Ability of different plant species to

promote microbiological processes in semiarid soil. Geoderma 124, 193–202.Gardea-Torresdey, J.L., Tiemann, K.J., Gamez, G., Dokken, K., 1999. Effects of

chemical competition for multi-metal binding by Medicago satia alfalfa.J. Hazard. Mater. 69, 41–51.

Gianfreda, L., Sannino, F., Ortega, N., Nannipieri, P., 1994. Activity of freeand inmobilized urease in soil: effects of pesticides. Soil Biol. Biochem. 26,777–784.

Gremion, F., Chatzinotas, A., Kaufman, K., Von Sigler, W., Harms, H., 2004. Impact ofheavy metal contamination and phytoremediation on a microbial communityduring a twelve-month microcosm experiment. FEMS Microbiol. Ecol. 48, 273–283.

Hees, P.A.W.V., Lundstrom, U.S., Giesler, R., 2000. Low molecular weight organicacids and their complexes in soil solution-composition, distribution andseasonal variation in three podzolized soils. Geoderma 94, 173–200.

Hinojosa, M.B., Carreira, J.A., Garcıa-Ruız, R., Dick, R.P., 2004a. Soil moisture pre-treatment effects on enzyme activities as indicators of heavy metal-contaminated and reclaimed soils. Soil Biol. Biochem. 36, 1559–1568.

Hinojosa, M.B., Carreira, J.A., Rodrıguez-Maroto, J.M., Garcıa-Ruız, R., 2008. Effectsof pyrite sludge pollution on soil enzyme activities: ecological dose–responsemodel. Sci. Total Environ. 396, 89–99.

Hinojosa, M.B., Garcıa-Ruız, R., Vinegla, B., Carreira, J.A., 2004b. Microbial rates andenzyme activities as indicators of functionality in soils affected by theAznalcollar toxic spill. Soil Biol. Biochem. 36, 1637–1644.

Hinojosa, M.B., Carreira, J.A., Garcıa-Ruız, R., Dick, R.P., 2005. Microbial response toheavy metal-polluted soils: community analysis from phospholipid-linked fattyacids and ester-linked fatty acids extracts. J. Environ. Qual. 34, 1789–1800.

Hinsinger, P., Plassard, C., Jaillard, B., 2005. Rhizosphere: a new frontier for soilbiogeochemistry. J. Geochem. Explor. 88, 210–213.

Hofmann, J., Grundler, F.M.W., 2007. How do nematodes get their sweets? Solutesupply to sedentary plant-parasitic nematodes. Nematology 4, 451–458.

Ibekwe, A.M., Kennedy, A.C., 2003. Fatty acid methyl ester (FAME) profiles as a toolto investigate community structure of two agricultural soils. Plant Soil 151,151–161.

Kandeler, E., Marschner, P., Tscherko, D., Gahoonia, T.S., Nielsen, N.E., 2002.Microbial community composition and functional diversity in the rhizosphereof maize. Plant Soil 238, 301–312.

Keeney, D.R., Nelson, D.W., 1982. Nitrogen—inorganic forms. In: Page, A.L., Miller,R.H., Keeney, D.R. (Eds.), Methods of Soil Analysis. Part 2, Chemical andMicrobiological Properties. ASA-SSSA, Madison (WI), pp. 625–642.

Killham, K., 1994. Soil Ecology. Cambridge University Press, Cambridge 260pp.Korthals, G., Lexmond, T., Kammenga, J., Bongers, T., 1996. Long-term effects of

copper and pH on the nematode community in an agroecosystem. Environ.Toxicol. Chem. 15, 979–985.

Kools, A.E.S., Boivin, M.-E.Y., Van Der Wurff, A.W.G., Berg, M.P., Van Gestel, C.A.M.,Van Straalen, N.M., 2009. Assessment of structure and function in metalpolluted grasslands using terrestrial model ecosystems. Ecotoxicol. Environ.Saf. 72, 51–59.

Lacal, J., da Silva, M.P., Garcıa, R., Sevilla, M.T., Procopio, J.R., Hernandez, L., 2003. Studyof fractionation and potential mobility of metal in sludge from pyrite mining andaffected river sediments: changes in mobility over time and use of artificial ageingas a tool in environmental impact assessment. Environ. Pollut. 124, 291–305.

Lane, D., 1991. 16S/23S rRNA squencing. In: Stackebrandt, E., Goodfellow, M. (Eds.),Nucleic Acid Techniques in Bacterial Systematics. John Wiley & Sons, Chichester,UK, pp. 115–175.

ARTICLE IN PRESS

M.B. Hinojosa et al. / Ecotoxicology and Environmental Safety 73 (2010) 970–981 981

Liao, M., Xie, X.M., 2007. Effect of heavy metals on substrate utilization pattern,biomass, and activity of microbial communities in a reclaimed miningwasteland of red soil area. Ecotoxicol. Environ. Saf. 66, 217–223.

Lopez-Pamo, E., Barettino, F.D., Anton, P.C., Ortız, G., Arranz, G., Gumiel, J.C., Martınez-Pledel, B., Aparicio, M., Montouto, O., 1999. The extent of the Aznalcollar pyriticsludge spill and its effects on soils. Sci. Total Environ. 242, 57–88.

Lynch, J.M., Bragg, E., 1985. Microorganisms and soil aggregate stability. Adv. SoilSci. 2, 133–171.

Maiz, I., Esnaola, M.V., Millan, E., 1997. Evaluation of heavy metal availability incontaminated soils by a short sequential extraction procedure. Sci. TotalEnviron. 206, 107–115.

Marchesi, J.R., Sato, T., Weightman, A.J., Matin, T.A., Fry, J.C., Hiom, S.J., Wade, W.G.,1998. Design and evaluation of useful bacterium-specific PCR primers that amplifygenes coding for bacterial 16S rRNA. Appl. Environ. Microbiol. 64, 795–799.

Marschner, P., Griersonb, P.F., Rengel, Z., 2005. Microbial community compositionand functioning in the rhizosphere of three Banksia species in native woodlandin Western Australia. Appl. Soil Ecol. 28, 191–201.

Marschner, P., Yang, C.H., Lieberei, R., Crowley, D.E., 2001. Soil and plant specificeffects on bacterial community composition in the rhizosphere. Soil Biol.Biochem. 33, 1437–1445.

Martınez-Alcala, I., Clemente, R., Bernal, M.P., 2009. Metal availability andchemical properties in the rhizosphere of Lupinus albus L. growing in a high-metal calcareous soils. Water Air Soil Pollut. 201, 283–293.

Martınez-Alcala, I., Walker, D.J., Bernal, M.P., 2010. Chemical and biologicalproperties in the rhizosphere of Lupinus albus alter soil heavy metal fractiona-tion. Ecotoxicol. Environ. Saf., in press, doi:10.1016/j.ecoenv.2009.12.009.

McCune, B., Mefford, M.J., 1999. PC-ORD for Windows. Multivariate Analysis ofEcological Data, Version 4.01. MjM Sofware, Oregon, USA.

McLean, E.O., 1982. Soil pH and lime requirement. In: Page, A.L., Miller, R.H.,Keeney, D.R. (Eds.), Methods of Soil Analysis, Part 2. Chemical andMicrobiological Properties. ASA-SSSA, Madison, WI, pp. 199–224.

Muller, A.K., Westergaard, K., Christensen, S., Sørensen, S.J., 2002. The diversity andfunction of soil microbial communities exposed to different disturbances.Microb. Ecol. 44, 49–58.

Nagy, P., 1999. Effect of an artificial metal pollution on nematode assemblage of acalcareous loamy chernozem soil. Plant Soil 212, 35–43.

Nannipieri, P., Ascher, J., Ceccherini, M.T., Landi, L., Pietramellara, G., Renella, G.,2003. Microbial diversity and soil functions. Eur. J. Soil Sci. 54, 655–670.

Paton, G.I., Viventsova, E., Kumpenec, J., Wilson, M.J., Weitza, H.J., Dawson, J.J.C.,2006. An ecotoxicity assessment of contaminated forest soils from the KolaPeninsula. Sci. Total Environ. 355, 106–117.

Pennanen, T., Caul, S., Daniell, T.J., Griffiths, B.S., Ritz, K., Wheatley, R., 2004.Community-level responses of metabolically-active soil microorganismsto the quantity and quality of substrate inputs. Soil Biol. Biochem. 36, 841–848.

Perez-de-Mora, A., Ortega-Calvo, J.J., Cabrera, F., Madejon, E., 2005. Changes inenzyme activities and microbial biomass after ‘‘in situ’’ remediation of a heavymetal-contaminated soil. Appl. Soil Ecol. 28, 125–137.

Perez-de-Mora, A., Madrid, F., Cabrera, F., Madejon, E., 2007. Amendments and plantcover influence on trace element pools in a contaminated soil. Geoderma 139, 1–10.

Pinton, R., Varanini, Z., Nannipieri, P., 2001. The Rhizosphere: Biochemistry andOrganic Substrances at the Soil-Plant Interface. Marcel Dekker, New York.

Qin, F., Shan, X.Q., Wei, B., 2004. Effects of low-molecular-weight organic acids andresidence time on desorption of Cu, Cd, and Pb from soils. Chemosphere 57,253–263.

Renella, G., Landi, L., Nannipieri, P., 2004. Degradation of low molecularweight organic acids complexed with heavy metals in soil. Geoderma 122,311–315.

Renella, G., Landi, L., Valori, F., Nannipieri, P., 2007. Microbial and hydrolaseactivity after release of low molecular weight organic compounds by a modelroot surface in a clayey and sandy soil. Appl. Soil Ecol. 36, 124–129.

Sauve, S., McBride, M.B., Hendershot, W.H., 1997. Speciation of lead incontaminated soils. Environ. Pollut. 98, 149–155.

Schwab, A.P., He, Y.H., Banks, M.K., 2005. The influence of organic ligands on theretention of lead in soil. Chemosphere 61, 856–866.

Schwab, A.P., Zhu, D.S., Banks, M.K., 2008. Influence of organic acids on thetransport of heavy metals in soil. Chemosphere 72, 986–994.

Shao, Y., Zhang, W., Shen, J., Zhou, L., Xia, H., Shu, W., Ferris, H., Fu, S., 2008.Nematodes as indicators of soil recovery in tailings of a lead/zinc mine, SoilBiol. Biochem. 40, 2040–2046.

Shen, H., Wang, X.C., Shi, W.M., 2001. Isolation and identification of specific rootexudates in elephantgrass in response to mobilization of iron- and aluminum-phosphates. J. Plant Nutr. 24, 1117–1130.

Singh, B.K., Munro, S., Potts, J.M., Millard, P., 2007. Influence of grass species andsoil type on rhizosphere microbial community structure in grassland soils.Appl. Soil Ecol. 33, 147–155.

Soderberg, K.H., Probanza, A., Jumpponen, A., Baath, E., 2004. The microbial communityin the rhizosphere determined by community-level physiological profiles (CLPP)and direct soil- and cfu-PLFA techniques. Appl. Soil Ecol. 25, 135–145.

Southey, J.F., 1970. Laboratory Methods for Work with Plant and Soil Nematodes.Ministry of Agriculture, Fisheries and Food, London 285pp.

Speir, W., Kettles, H.A., Parshotam, A., Searle, P.L., Vlaar, L.N.C., 1995. A simple kineticapproach to derive the ecological dose value, ED50, for the assessment of Cr(VI)toxicity to soil biological properties. Soil Biol. Biochem. 27, 801–810.

Speir, T.W., Ross, D.J., 2002. Hydrolytic enzyme activities to assess soil degradationand recovery. In: Burns, R.G., Dick, R.P. (Eds.), Enzymes in the Environment.Activity, Ecology and Applications. Marcel Dekker, New York, pp. 407–431.

Speir, T.W., Ross, D.J., Feltham, C.W., Orchard, V.A., Yeates, G., 1992. Assessment ofthe feasibility of using CCA (copper, chromium and arsenic)-treated and boricacid-treated sawdust as soil amendments. II. Soil biochemical and biologicalproperties. Plant Soil 142, 249–258.

Speir, T.W., Kettles, H.A., Percival, H.J., Parshotam, A., 1999. Is soil acidification thecause of biochemical response when soils are amended with heavy metalsalts? Soil Biol. Biochem. 31, 1953–1961.

StatSoft, Inc., 2004. STATISTICA (data analysis software system), version 7. /www.statsorf.comS.

Tabatabai, M.A., 1994. Soil enzymes. In: Weaver, R.W., Angle, J.S., Bottomley, P.J.,Bezdicek, D.F., Smith, S., Tabatabai, M.A., Wollum II, A.G. (Eds.), Methods of SoilAnalysis. Part 2: Microbial and Biochemical Properties. Soil Science Society ofAmerica, Madison, WI, pp. 775–833.

Van Breemen, N., 1991. Soil acidification and alkalinization. In: Ulrich, R., Sumner,M.E. (Eds.), Soil Acidity. Springer, Berlin.

Van-Camp, L., Bujarrabal, B., Gentile, A.R., Jones, R.J.A., Montanarella, L., Olazabal, C.,Selvaradjou, S.K., 2004. Reports of the Technical Working Groups establishedunder the Thematic Strategy for Soil Protection. EUR 21319 EN/4, Office forOfficial Publications of the European Communities, Luxembourg, 872pp.

Zhang, H.-B., Yang, M.-X., Shi, W., Zheng, Y., Sha, T., Zhao, T.-W., 2007. Bacterialdiversity in mine tailings compared by cultivation and cultivation-indepen-dent methods and their resistance to lead and cadmium. Microb. Ecol. 54,705–712.

Zak, J.C., Willing, M.R., Moorhead, D.L., Wildman, H.G., 1994. Functional diversityof microbial communities: a quantitative approach. Soil Biol. Biochem. 26,1101–1108.

Zullini, A., Peretti, E., 1986. Lead pollution and moss-inhabiting nematodes of anindustrial area. Water Air Soil Pollut. 27, 403–410.