Parkinson's Disease and pathological gambling: Results from a functional MRI study

Brief Reports

Rapid Screening of ATP13A2Variant with High-Resolution

Melting Analysis,

Manabu Funayama, PhD,1,2

Hiroyuki Tomiyama, MD, PhD,1

Ruey-Meei Wu, MD, PhD,3 Kotaro Ogaki, MD,1

Hiroyo Yoshino, BS,2 Yoshikuni Mizuno, MD,2

and Nobutaka Hattori, MD, PhD1,2*

1Department of Neurology, Juntendo University School ofMedicine, Tokyo, Japan; 2Research Institute for Diseases ofOld Age, Graduate School of Medicine, Juntendo University,Tokyo, Japan; 3Department of Neurology, National Taiwan

University Hospital, College of Medicine, NationalTaiwan University, Taipei, Taiwan

Abstract: Several genetic and environmental factors areinvolved in the pathogenesis of Parkinson’s disease (PD).Recently, a novel variant of ATP13A2 (p.A746T) responsi-ble for PARK9 was reported as a risk factor for PD in theHan-Chinese population. To investigate the role of thisvariant in Japanese PD patients, we examined 917 Japa-nese PD patients (871 index cases) and 190 controls byhigh-resolution melting curve analysis. We detected heter-ozygous p.A746T variant in a single patient with sporadicPD and a single control subject. These results suggest thatATP13A2 p.A746T variant is unlikely to play a role as acommon risk factor or a pathogenic mutation for PD atleast in Japanese. Our data on Japanese differ from thosereported recently on Han-Chinese. Further studies areneeded to confirm conclusions on roles of ATP13A2variant in Asians or other populations. � 2010 MovementDisorder Society

Key words: Parkinson’s disease; gene risk factor; PARK9;lightscanner

INTRODUCTION

Parkinson’s disease (PD) is the second most com-

mon neurodegenerative disorder pathologically charac-

terized by selective dopaminergic neurodegeneration

and the presence of Lewy bodies in the midbrain. Clin-

ical features of typical PD are resting tremor, rigidity,

bradykinesia, and postural instability. PD is thought to

be caused by interaction with multiple genetic and

environmental factors; however, the exact etiology of

PD remains elusive. To elucidate the mechanisms of

nigral degeneration, monogenic forms of PD provide

good information to identify the cause of not only

monogenic but also sporadic forms of this disease.

Case-control studies using genetic analyses are impor-

tant in identification of susceptibility genes for PD

such as SNCA, LRRK2, and GBA.1–5 In particular,

Asian population-specific variants such as LRRK2p.G2385R and p.R1628P showed strong association

with susceptibility to the pathogenesis of PD.6,7 Inter-

estingly, the LRRK2 p.G2385R variant has been associ-

ated with PD in Asian population including Japanese

and Chinese;3,6 however, LRRK2 p.R1628P variant has

not been found in Japanese population so far, suggest-

ing some differences in ethnic background based on

human migration history among Asians.7 Furthermore,

a novel ATP13A2 p.A746T variant was reported

recently as a risk factor for PD in the Han-Chinese

population.8 Based on the above background, we inves-

tigated the role of ATP13A2 p.A746T variant in Japa-

nese PD patients by examining 917 Japanese PD

patients (871 index cases) and 190 normal controls by

high-resolution melting curve analysis.

PATIENTS AND METHODS

Subjects

The study subjects were 917 Japanese PD patients

(871 index cases) and 190 normal controls. Of these,

61.2% (533/871) were sporadic PD and 38.8% (338/

871) had at least one first and/or second-degree relative

with parkinsonism. Many had been screened for PD-

associated genes and reported previously (screening

rates in each gene were as follows; parkin: 73.4%,

PINK1: 79.5%, DJ-1: 37.3%, SNCA multiplication:

*Correspondence to: Nobutaka Hattori, Department of Neurology,Juntendo University School of Medicine, 2-1-1 Hongo, Bunkyo-ku,Tokyo 113-8421, Japan. E-mail: [email protected]

Potential conflict of interest: Nothing to report.Received 31 August 2009; Revised 20 November 2009; Accepted

22 February 2010Published online in Wiley Online Library (wileyonlinelibrary.

com). DOI: 10.1002/mds.23106

2434

Movement DisordersVol. 25, No. 14, 2010, pp. 2434–2460� 2010 Movement Disorder Society

52.5%, and LRRK2 exon 41: 61.0%).9–14 Furthermore,

25 out of 917 patients were screened for all exons of

ATP13A2 in our previous study.14 Patients with patho-

genic mutation(s) were not included in this study. Di-

agnosis of PD was adopted by the participating neurol-

ogists based on established criteria.15 Clinical and de-

mographic data were obtained for 894 patients. The

mean age at onset (AAO) was 50.6 6 14.9 years

(6SD, range, 7–88 years). Moreover, 407 out of 917

(44.4%) patients had early-onset PD (onset <50 years).

The study included 446 men and 471 women (female:-

male ratio, 1.06:1). The mean age of the control group

at sampling was 58.2 6 16.5 years (6SD, range, 23–

98 years). The study was approved by the ethics com-

mittee of Juntendo University School of Medicine. All

subjects gave informed and written consent form.

Genetic Analyses

PCR was performed in a 10 lL volume using 10 ng

of genomic DNA, 1 lL of LCGreen Plus (Idaho Tech-

nology, Salt Lake City, ID), 5 lL of AmpliTaq Gold

PCR Master Mix (Applied Biosystems, Foster City,

CA), and 5 pmol of each forward and reverse primer.

Mineral oil (15 lL per reaction) was added before

starting the PCR. The amplification conditions were as

follows: preincubation at 958C for 9 minutes, 40 cycles

of denaturation at 958C for 20 seconds, annealing and

extension at 658C for 20 seconds, and final step for

heteroduplex formation at 948C for 30 seconds fol-

lowed by 208C hold. PCR primers were designed by

ExonPrimer (http://ihg2.helmholtz-muenchen.de/ihg/

ExonPrimer.html), and the sequences of the primers

for ATP13A2 p.A746T detection were as follows:

forward; CGCAGACAACGCCAGTTATCC, reverse;

GGGCCCCTACATGCCATTG. Following PCR, high-

resolution melting analysis was performed using Light-

Scanner (Idaho Technology). Fluorescence was col-

lected from 85 to 958C at a ramp rate of 0.18C/s. Melt-

ing curve analysis was performed by the method pro-

vided with LightScanner Call-It software (version 1.5,

Idaho Technology). Samples determined to be variants

were sequenced directly using the method reported pre-

viously by our group.14 We used DNA of one patient

carrying p.A746T variant (identified in a previous

report) as a positive control.8

Haplotype analysis was performed in p.A746T car-

riers using eight microsatellite markers (MSs) and four

single nucleotide polymorphisms (SNPs). MSs and

SNPs were genotyped by PCR using fluorescence-la-

beled primers or direct-sequencing, 3130 Genetic Ana-

lyzer, and GeneMapper software (Applied Biosystems).

Sequences of the primers and conditions of PCR are

available upon request to the corresponding author.

Statistics Analysis

All data are expressed as mean 6 SD. The Fisher’s

exact test was used to calculate the difference in the

allele frequencies. In all statistical analyses, a P value

of 0.05 or less was considered statistically significant.

RESULTS

Genotyping was completed showing a high genotyp-

ing success rate (98.6%) in high-resolution melting.

Heterozygous p.A746T (c.2236G>A) variant was

detected in one patient with sporadic PD (1/533,

0.19%) and one control subject (1/190, 0.53%) by

high-resolution melting analysis and direct sequencing

(Fig. 1 and Table 1). There was no statistical differ-

ence in the frequency of p.A746T variant between

patients with sporadic PD and control subjects (P 50.46). None of the patients with family history of PD

FIG. 1. Genotyping of ATP13A2 p.A746T variant by LightScannerand direct sequencing. The difference between heterozygous p.A746Tvariant (red) and the reference (black) in shifted melting curve andDfluorescence was shown (A). Chromatograms showing wild type andheterozygous p.A746T variant (B). [Color figure can be viewed in theonline issue, which is available at wileyonlinelibrary.com.]

2435ATP13A2 VARIANT IN JAPANESE PD

Movement Disorders, Vol. 25, No. 14, 2010

had p.A746T variant (0/338, 0%). Furthermore, there

was no difference in the frequency between the entire

PD patients and the control subjects (P 5 0.31).

Whereas the frequency in Japanese patients (1/917,

0.11%) was lower than that in Han-Chinese patients

(3/182, 1.65%) (Table 1).8

Haplotype analysis of PARK9 locus revealed that

patients carrying the p.A746T variant shared at least

one allele of MSs and SNPs (Table 2). The patient

with p.A746T variant initially showed left-hand resting

tremor at age 46. Subsequently, he developed resting

tremor in the right hand, bradykinesia, rigidity, and

mild parkinsonian gait without retropulsion (Hoehn

and Yahr stage II). He is still doing well with 2 mg of

trihexyphenidyl a day 10 years after the onset of the

disease. His brain MRI was normal at another hospital

and cardiac MIBG uptake was markedly diminished

(Heart/Mediastinum ratio 1.17 at early image and 1.14

at delayed image; our normal range is above 1.45 for

both imaging). He was taking 2.5 mg of selegiline

when the MIBG scintigraphy was done.

DISCUSSION

In this study, we used high-resolution melting analy-

sis for genotyping. This method is a rapid, sensitive,

and cost-effective technique for detection of mutation

without direct sequencing.16 Indeed, genotyping

p.A746T variant by high-resolution melting analysis

was faster, low cost, and associated with a low error

rate. Thus, as reported previously, high-resolution melt-

ing analysis is useful for primary screening of muta-

tions or SNPs.16,17

Based on this sound method, we detected ATP13A2p.A746T variant in only one Japanese patient with spo-

radic PD. The frequency was significantly different

from that of the previous report in early-onset PD of

Han-Chinese population (P 5 0.016).8 These results

suggest that ATP13A2 p.A746T is a rare variant in Jap-

anese population compared with Han-Chinese popula-

tion. This is similar to the result of LRRK2 p.R1628P

variant in Han-Chinese and Japanese population.7

Based on these findings, both ATP13A2 p.A746T and

LRRK2 p.R1628P variants may be more recent muta-

tions than LRRK2 p.G2385R variant, which is a com-

mon variant among Asian population including Han-

Chinese and Japanese.3,6,7 Moreover, the results of

haplotype analysis suggest that carriers have inherited

the p.A746T variant from a common ancestral founder.

However, because we could not determine the haplo-

type phase, further analyses are needed to verify the

founder effect in Asia.

Lin et al.8 did not detect p.A746T variant in any of

their 589 control subjects. In comparison, we detected

one Japanese control subject carrying heterozygous

p.A746T variant, but the frequency was not signifi-

cantly different compared to PD patients. Thus,

although we could not exclude the possibility that our

normal subject with p.A746T variant will develop PD

in future, our study provided no evidence that

ATP13A2 p.A746T enhances the susceptibility to PD

in Japanese. In addition, our analysis did not identify

any patient with ATP13A2 p.A746T and familial par-

kinsonism despite the large sample size, suggesting

that this variant plays no major roles in familial par-

kinsonism, at least in Japanese. This might be based

on the rarity of the p.A746T variant, ethnic differences,

and/or human migration history. Also, this finding

could be due to phenotypic differences between previ-

ously reported atypical parkinsonism patients with

TABLE 1. Comparison of p.A746T frequency amongJapanese and Han-Chinese population

p.A746T

WT Hetero Frequency (%)

Japanese SPD 532 1 0.19FPD 384 0 0.00Total 916 1 0.11Cont 189 1 0.53

Han-Chinese PDa 179 3 1.65

SPD, sporadic PD; FPD, familial PD; Cont, Normal control; WT,wild type; Hetero, heterozygous; Frequency, heterozygous frequency.

aData from Ref. 8.

TABLE 2. Haplotype analysis of PARK9 locus

Marker PD (JPN) PD (CHN) Cont (JPN)

D1S2644 220/232 232/234 232/232D1S2826 134/134 134/134 126/134D1S1592 236/240 240/240 244/244D1S3669 189/189 185/189 193/201rs2076603 (ex17) C/T C/T C/Cc.2236G>A (ex20, p.A746T) G/A G/A G/Ars9435662 (ex24) C/T C/T C/Crs3738815 (ex25) G/A G/A A/Ars3170740 (ex29) G/A G/A G/GD1S436 205/205 205/211 205/211D1S2672 155/155 147/157 155/157D1S507 187/189 195/201 193/198D1S228 119/123 123/123 119/123

Genotypes of p.A746T carriers; Japanese [PD (JPN)] and Chinese[PD (CHN)]8 patients and Japanese normal control [Cont (JPN)]were shown.

2436 M. FUNAYAMA ET AL.


pathogenic ATP13A2 mutations and patients with typi-

cal parkinsonism.14,18,19

In conclusion, based on the present large study,

ATP13A2 p.A746T variant is not a common risk factor

or pathogenic mutation for PD at least in Japanese.

However, the role of ATP13A2 variant in PD is worth

discussing. Therefore, further analyses should be per-

formed to draw definite conclusions about the role of

ATP13A2 variant in Asians and other populations. Our

study indicates that for genotyping or mutation detec-

tion, high-resolution melting analysis is a rapid and

cost-effective method when the targets are limited.

Acknowledgments: This work was supported by High-Tech Research Center Project, Grant-in-Aid for ScientificResearch (to NH, 17390256, and to HT, 21591098),Grant-in-Aid for Scientific Research on Priority Areas (toNH, 08071510), and Grant-in-Aid for Young Scientists (toMF, 20790625) from the Japanese Ministry of Education,Culture, Sports, Science and Technology. We are gratefulto the patients, their families, and all participants. Wethank Mr. Taka-aki Yanase for the excellent technical as-sistance.

Financial Disclosure: Ruey-Meei Wu, Kotaro Ogaki, Hir-oyo Yoshino, Yoshikuni Mizuno: none. Manabu Funayama:Grant: Japanese Ministry of Education, Culture, Sports, Sci-ence and Technology, Grant-in-Aid for Young Scientists(20790625); Hiroyuki Tomiyama: Grant: Japanese Ministryof Education, Culture, Sports, Science and Technology,Grant-in-Aid for Scientific Research (21591098), JapaneseMinistry of Health, Labor and Welfare, Grant-in-Aid of theResearch Committee of Muro disease (Kii ALS/PDC)(21210301); Nobutaka Hattori: Grant: Japanese Ministry ofEducation, Culture, Sports, Science and Technology, Grant-in-Aid for Scientific Research (09005213), and Grant-in-Aidfor Scientific Research on Priority Areas (08071510), Japa-nese Ministry of Health, Labour and Welfare, Health andLabour Sciences Research Grants (H19-021 and H20-015).

Author Roles: Manabu Funayama was involved in con-ception, organization, and execution of the research project;design, execution, review and critique of the data construc-tion; writing of the first draft, review and critique of themanuscript. Hiroyuki Tomiyama was involved in conceptionand organization of the research project; design, review andcritique of the data construction; review and critique of themanuscript. Ruey-Meei Wu was involved in execution,review and critique of the data construction; review and cri-tique of the manuscript. Kotaro Ogaki was involved in execu-tion of the data construction; writing of the first draft of themanuscript. Hiroyo Yoshino was involved in execution,review and critique of the data construction; review and cri-tique of the manuscript. Yoshikuni Mizuno was involved inexecution of the data construction; review and critique of themanuscript. Nobutaka Hattori was involved in organizationof the research project, review and critique of the data con-struction; review and critique of the manuscript.

REFERENCES

1. Mueller JC, Fuchs J, Hofer A, et al. Multiple regions of alpha-synuclein are associated with Parkinson’s disease. Ann Neurol2005;57:535–541.

2. Mizuta I, Satake W, Nakabayashi Y, et al. Multiple candidate geneanalysis identifies alpha-synuclein as a susceptibility gene for spo-radic Parkinson’s disease. Hum Mol Genet 2006;15:1151–1158.

3. Di Fonzo A, Wu-Chou YH, Lu CS, et al. A common missensevariant in the LRRK2 gene, Gly2385Arg, associated with Parkin-son’s disease risk in Taiwan. Neurogenetics 2006;7:133–138.

4. Aharon-Peretz J, Rosenbaum H, Gershoni-Baruch R. Mutationsin the glucocerebrosidase gene and Parkinson’s disease in Ashke-nazi Jews. N Engl J Med 2004;351:1972–1977.

5. Nichols WC, Pankratz N, Marek DK, et al. Mutations in GBAare associated with familial Parkinson disease susceptibility andage at onset. Neurology 2009;72:310–316.

6. Funayama M, Li Y, Tomiyama H, Yoshino H, et al. Leucine-rich repeat kinase 2 G2385R variant is a risk factor for Parkinsondisease in Asian population. Neuroreport 2007;18:273–275.

7. Ross OA, Wu YR, Lee MC, et al. Analysis of Lrrk2 R1628P asa risk factor for Parkinson’s disease. Ann Neurol 2008;64:88–92.

8. Lin CH, Tan EK, Chen ML, et al. Novel ATP13A2 variant asso-ciated with Parkinson disease in Taiwan and Singapore. Neurol-ogy 2008;71:1727–1732.

9. Kitada T, Asakawa S, Hattori N, et al. Mutations in the parkingene cause autosomal recessive juvenile parkinsonism. Nature1998;392:605–608.

10. Kumazawa R, Tomiyama H, Li Y, et al. Mutation analysis of thePINK1 gene in 391 patients with Parkinson disease. Arch Neurol2008;65:802–808.

11. Tomiyama H, Li Y, Yoshino H, et al. Mutation analysis for DJ-1in sporadic and familial parkinsonism: screening strategy in par-kinsonism. Neurosci Lett 2009;455:159–161.

12. Nishioka K, Hayashi S, Farrer MJ, et al. Clinical heterogeneityof alpha-synuclein gene duplication in Parkinson’s disease. AnnNeurol 2006;59:298–309.

13. Tomiyama H, Li Y, Funayama M, et al. Clinicogenetic study ofmutations in LRRK2 exon 41 in Parkinson’s disease patientsfrom 18 countries. Mov Disord 2006;21:1102–1108.

14. Ning YP, Kanai K, Tomiyama H, et al. PARK9-linked parkin-sonism in eastern Asia: mutation detection in ATP13A2 and clin-ical phenotype. Neurology 2008;70:1491–1493.

15. Hughes AJ, Daniel SE, Kilford L, Lees AJ. Accuracy of clinical di-agnosis of idiopathic Parkinson’s disease: a clinico-pathological studyof 100 cases. J Neurol Neurosurg Psychiatry 1992;55:181–184.

16. Zhou L, Wang L, Palais R, Pryor R, Wittwer CT. High-resolu-tion DNA melting analysis for simultaneous mutation scanningand genotyping in solution. Clin Chem 2005;51:1770–1777.

17. Van Der Stoep N, Van Paridon CD, Janssens T, et al. Diagnosticguidelines for high-resolution melting curve (HRM) analysis: aninterlaboratory validation of BRCA1 mutation scanning using the96-well LightScanner. Hum Mutat 2009;30:899–909.

18. Ramirez A, Heimbach A, Grundemann J, et al. Hereditary parkinson-ism with dementia is caused by mutations in ATP13A2, encoding alysosomal type 5 P-type ATPase. Nat Genet 2006;38: 1184–1191.

19. Di Fonzo A, Chien HF, Socal M, et al. ATP13A2 missensemutations in juvenile parkinsonism and young onset Parkinsondisease. Neurology 2007;68:1557–1562.

2437ATP13A2 VARIANT IN JAPANESE PD


Long-Term Stability of Effects ofSubthalamic Stimulation inParkinson’s Disease: Indian

Experience

Asha Kishore, MD, DM,1* Ravimohan Rao, MS, MCh,1

Syam Krishnan, MD, DM,1 Dilip Panikar, MS, MCh,1

Gangadhara Sarma, MA,1

Mathuranath Pavagada Sivasanakaran, MD, DM,2

and Sankara Sarma, PhD3

1Comprehensive Care Centre for Movement Disorders, SreeChitra Tirunal Institute for Medical Sciences and

Technology, Trivandrum, Kerala, India; 2Cognition andBehavioral Neurology Centre, Sree Chitra Tirunal Institutefor Medical Sciences and Technology, Trivandrum, Kerala,India; 3Achutha Menon Centre for Health Sciences Studies,

Sree Chitra Tirunal Institute for Medical Sciences andTechnology, Trivandrum, Kerala, India

Abstract: Reports of long-term effects of subthalamic(STN) stimulation for Parkinson’s disease (PD) are few,mostly open-label evaluations and from Western centers.We used single-blind and open-label motor, cognitive andquality of life (QOL) evaluations to study the effects ofbilateral STN stimulation in 45 patients over 5 years. Ourpatients showed a stable and substantial reduction in thecardinal signs of PD, motor fluctuations, and dyskinesiasbut less so for axial signs. The reduction in medicationsand the intensity of electrical stimulation needed alsoremained stable during follow up. Although the totalQOL and its parkinsonism and social components showedsustained benefits till 5 years, the gains in emotional andsystemic subsets were short lasting. Global scores formood and cognition did not show significant worsening.Benefits of STN stimulation on the cardinal signs, motorcomplications, and QOL of advanced PD were substantialand sustained till 5 years. The initial benefits in axialmotor signs and emotional and psychological aspects ofQOL did not show similar stability. In general, the proce-dure had insignificant impact on cognition and mood.This is the first report of STN stimulation in Asianpatients with PD. � 2010 Movement Disorder Society

Key words: subthalamic nucleus; deep brain stimulation;motor fluctuations; Asia; Parkinson’s disease

Two recent randomized, multicentre studies demon-

strated that subthalamic (STN) stimulation is superior

to best medical treatment in managing motor compli-

cations of Parkinson’s disease (PD) and improving

the quality of life (QOL) of patients during a 6-month

period.1,2 Although several open-label studies have

reported similar short-term effects,3 its stability

beyond 3 years has been established by only few

reports and these emerged from Western centres.4–10

Concurrent QOL changes in the same cohort were not

reported in them. With the exception of a single, dou-

ble-blind study in 10 patients,5 all were open-label

assessments. We report results of a prospective study

examining the stability of effects of STN stimulation

in PD under single-blind and open-label conditions

over a 5-year period.


Forty-five consecutive patients who received bilat-

eral STN stimulation for PD at our centre from 1999

to 2004 participated in the study. All subjects gave

written informed consent and the study was approved

by the Ethics Committee of the hospital.

Assessments

All subjects were assessed in open-label conditions

using Unified Parkinson’s Disease Rating Scale11

(UPDRS I–IV) 1 week before surgery (baseline) and at

yearly intervals for 5 years. ‘‘drug off’’ and ‘‘drug on’’

assessments were made in defined conditions.12 The

baseline dose of levodopa (L-dopa) was used in all

assessments. After surgery, all patients were evaluated

in ‘‘stimulation on—drug off,’’ ‘‘stimulation on—drug

on,’’ ‘‘stimulation-off (for 2 hours)—drug off,’’ and

‘‘stimulation off—drug on’’ in the same day. All

UPDRS III assessments were recorded on video.

UPDRS II was used to assess patient’s ADL in ‘‘drug

off’’ and ‘‘drug on’’ in the 1 week before the surgery.

The same was assessed after surgery, the only differ-

ence being that they were in stimulation on state con-

tinuously after surgery. Therefore, it is mentioned

under scores during ‘‘stimulation on drug off/drug on.’’

Blinded Ratings

At the end of study, ratings were done on videos

presented at random order by a second movement dis-

order neurologist who was not part of the team during

the entire study period. Blinded ratings (excluding ri-

gidity) of videos at baseline (‘‘drug off’’ and ‘‘drug

*Correspondence to: Dr. Asha Kishore, Professor of Neurology,Comprehensive Care Centre for Movement Disorders, Sree ChitraTirunal Institute for Medical Sciences and Technology, Trivandrum,Kerala 695011, India. E-mail: [email protected]

Potential conflict of interest: Nothing to report.Received 18 February 2010; Revised 6 April 2010; Accepted 30

April 2010Published online in Wiley Online Library (wileyonlinelibrary.

com). DOI: 10.1002/mds.23269


2438 A. KISHORE ET AL.

on’’) and in postoperative visits in ‘‘stimulation on—

drug off’’ and ‘‘stimulation on—drug on’’ states were

done The assessment condition and year of evaluation

were not revealed to the blinded neurologist.

Neuropsychological Evaluation

All patients were interviewed by a neuropsychologist

in the drug on at base line and stimulation on—drug

on after surgery. We used Beck Depression Inventory

(BDI),13 Hospital Anxiety and Depression Scale

(HADS), and Addenbrooke’s Cognitive Examination

(ACE).14,15 Executive functions were tested using Digit

Span, Verbal Fluency (VF) test, Trail Making tests

part A and B, and Wisconsin Card Sorting tests.

Praxis was measured using Object Assembly and

Block Design, and semantic category fluency and a

12-item line drawing test were used to test language.

Wechsler Memory Scale (revised) was used to test

immediate and delayed memory.

Visuospatial orientation was assessed using Benton’s

Judgment of Line Orientation test and Visual Object

and Space Perception Battery.

Quality of Life

QOL was assessed by the PD Quality of Life

(PDQL).16,17 It covers domains of parkinsonism, social,

emotional, and systemic aspects. An increment in

scores indicates improvement.

Surgery

All patients underwent bilateral stereotactic implan-

tation of quadriploar DBS electrode placement in one

session (model 3387 in 9 cases and model 3389 in 36;

Medtronic, MN, USA). STN was located by MRI (1.5

T MR Scanner, Signa, General Electric, MW, USA),

5-channel microelectrode recordings (Lead point 4,

Medtronic, MN) with Bengun microelectrode array and

macro stimulation in selected tracks. Postoperative

MRI was done in all to look for surgical complica-

tions.

Statistical Analyses

The primary outcome measures were changes in

blinded scores of UPDRS III. The secondary outcome

measures were changes in UPDRS I, II, IV, Hoehn and

Yahr staging, Schwab and England scores, neuropsy-

chological tests, L-dopa equivalent dose of drugs

(LEDD), and stimulation settings. Repeated measures

analysis of variance was used to see the effect of time.

Post hoc comparisons were made using paired Stu-

dent’s t-test or Wilcoxson signed-rank test. Bonferroni

correction was applied and a P value less than 0.005

was considered as significant. Statistical analysis was

performed using statistical package for social science

software (version 15.0, SPSS, Chicago, IL, USA) for

Windows.

RESULTS

Patient Characteristics

Of the 45 patients, 18 were women and 27 men.

The mean age at onset of symptoms was 44.1 6 11.4

years, mean age at surgery was 55.4 6 10.9 (range

27–69 years) and mean duration of illness was 11.1 65.7 years. All 45 patients were available for 1-year

assessment. Four patients died between 1 and 3 years

from unrelated events. Five could not participate after

1st year because of long distance travel involved. At

the time of analysis, the remaining 36 had completed

3 years and 29 of them had reached 5-year follow-up.

One committed suicide at 4 years. There was no drop

out between 3 and 5 years.

I. Single-Blind Evaluation of UPDRS III at 3 Years

Stimulation On-Drug Off

UPDRS-III motor score improved from baseline by

43% (48% including rigidity scores from open-label

assessment), tremor by 90%, rigidity by 68%, bradyki-

nesia by 38%, and gait by 43% (Table 1). When com-

pared with baseline, there was no improvement in pos-

tural stability or speech. There was a trend for worsen-

ing of speech between 1 and 3 years. The inter-rater

(blinded and unblinded rater) agreement on UPDRS III

items was excellent (intraclass correlation coefficient

5 0.95).

Stimulation On-Drug On

UPDRS-III and its sub scores did not improve from

baseline. At 3 years, postural stability was worse than

at 1 year.

II. Single-Blind Evaluation of UPDRS III at 5 Years


Total UPDRS-III improved from baseline by 39%

(45% including rigidity), tremor by 85%, rigidity by

66%, and bradykinesia by 38% but not postural stabil-

ity or gait (Table 1). Total UPDRS III showed a

decline between 1 and 5 years.

2439STABILITY OF EFFECTS OF STN STIMULATION



At 5 years, there was no improvement from baseline.

There was a worsening of postural stability compared

with 1 year.

III. Open-Label Evaluations at 3 Years


At 3 years, UPDRS I was unchanged (Tables 1 and

2). UPDRS II improved by 39% and remained stable.

Hoehn and Yahr stage was 29% improved but less

than at 1 year. Schwab and England score improved by

81% with no significant decline after 1st year.

Stimulator On-Drug On

At 3 years, none of the scores showed improve-

ment from baseline except Schwab and England

scale. Hoehn and Yahr stage declined between 1 and

3 years.

IV. Open-Label Evaluations at 5 Years


UPDRS II (37%) and Schwab and England scores

(79%) were still improved and stable when compared

with baseline (Tables 1 and 2). UPDRS I and Hoehn

and Yahr stage declined from 1 to 5 years.


UPDRS I or II did not improve from baseline on.

The Hoehn and Yahr stage was worse than at baseline

and 3 years.

Effect of Chronic Stimulation on Motor

Fluctuations and Dyskinesias at 3 and 5 Years

Scores for dyskinesias (UPDRS IV A) improved

from baseline by 72% and motor fluctuations (UPDRS

IV B) by 52% at 3 years and by 66% and 45%, respec-

tively, at 5 years (Table 2). There was no significant

decline in either score over 5 years.

QOL Scores at 3 and 5 Years

At 3 years, the total QOL score improved from baseline

by 23%, including its parkinsonism (28%), systemic

(19%), emotional (16%), and social (25%) components and

remained stable from 1 to 3 years (Table 3). At 5 years,

total QOL score (20%) and its parkinsonism (20%) and

social (27%) components were improved when compared

with baseline but not the systemic and emotional subsets.

At 5 years, total QOL, parkinsonism, and systemic compo-

nents showed a decline when compared with 1st year.

TABLE 1. UPDRS scores with stimulation on in ‘‘drug off’’ and ‘‘drug on’’ states

Subscales

Baseline 1 yr 3 yr 5 yrBaseline vs. 3 yr Baseline vs. 5 yr 1 vs. 3 yr 1 vs. 5 yrN 5 45 N 5 45 N 5 36 N 5 29

Mean 6 SD Mean 6 SD Mean 6 SD Mean 6 SD P value P value P value P value

Drug offUPDRS-III motor(0–08) 36.4 (11.4) 17.9 6 8.9 20.7 6 10.7 22.1 6 8.7 <0.0001 <0.0001 0.03 0.002Tremor (0–28) 4.0 6 3.9 0.6 6 1.2 0.40 6 0.8 0.62 6 0.9 <0.0001 <0.0001 0.9 0.7Rigiditya (0–20) 10.5 6 4.1 3.5 6 3.3 3.3 6 2.4 3.5 6 2.5 <0.0001 <0.0001 0.5 0.7Bradykinesia (0–32) 16.2 6 5.2 8.6 6 5.1 9.9 6 5.4 9.71 6 5.2 <0.0001 <0.0001 0.1 0.1Postural stability (0–4) 2.1 6 0.8 1.4 6 0.8 1.7 6 0.8 1.8 6 0.7 0.2 0.5 0.01 0.04Gait (0–4) 2.3 6 1.1 1.1 6 0.8 1.3 6 0.9 1.4 6 0.7 <0.0001 0.03 0.03 0.02Speech (0–4) 1.6 6 0.6 1.1 6 0.9 1.7 6 1.1 1.6 6 0.8 0.7 0.1 0.009 0.1UPDRS IIa (0–52) 25.4 6 6.9 13.2 6 5.9 14.4 6 6.7 15.8 6 5.9 <0.0001 <0.0001 0.06 0.004UPDRS Ia (0–16) 2.0 6 2.01 1.9 6 2.1 2.4 6 2.3 3.1 6 2.3 0.7 0.07 0.2 0.002

Drug onUPDRS III motor 16.2 6 8.3 13.9 6 8.1 14.7 6 8.9 16.5 6 7 0.5 0.7 0.4 0.01Tremor 0.4 6 0.9 0.2 6 0.7 0.2 6 0.6 0.1 6 0.2 0.06 0.07 0.3 0.1Rigiditya 3.4 6 3.1 1.7 6 1.9 1.8 6 3.1 1.8 6 2.1 0.006 0.007 0.3 0.7Bradykinesia 8.5 6 5.2 3.2 6 3.1 6.9 6 4.6 8.3 6 4.1 0.05 0.4 0.9 0.04Postural stability 1.2 6 0.7 1.1 6 0.9 1.6 6 0.9 1.7 6 0.9 0.04 0.1 0.001 0.001Gait 1.0 6 0.9 0.7 6 0.6 0.8 6 0.6 0.8 6 0.9 0.6 0.8 0.1 0.7Speech 1.0 6 0.8 1.0 6 1.0 1.2 6 0.9 1.1 6 0.7 0.2 0.1 0.2 0.2UPDRS IIa 9.5 6 8.1 5.9 6 5.1 7.3 6 6.3 7.1 6 4.4 0.1 0.3 0.03 0.02UPDRS Ia 1.3 6 1.9 1.3 6 1.9 1.2 6 1.8 2.1 6 2.0 0.8 0.09 0.8 0.1

aOpen label scores, P < 0.005 is significant.



Progression of Disease (Stimulation Off—Drug Off)

at 3 and 5 Years

There was a significant deterioration only in brady-

kinesia scores (open-label pre- and post-operative

scores used) (Table 4).

L-dopa Response at 3 and 5 Years

There was no significant worsening of L-dopa

response when compared with baseline. Gait was less

L-dopa responsive than at 1st year (Table 4).

Medications and Electrical Stimulation Parameters

at 3 and 5 Years

LEDD could be reduced by 40% at 3 years and

48% at 5 years, and there were no significant

changes in dose of drugs or stimulation parameters

beyond 1st year (Table 2). Stimulators were replaced

during first 5 years in 6 patients. The indications

were hardware failure in 2 and end of battery life

in 4.

Neuropsychological Evaluation at 3 and 5 Years

Mood and Anxiety. There were no significant changes

in global mood or anxiety scores when compared with base-

line (Table 5). Twenty-six patients were depressed at base-

line. At the last follow-up of 36 cases, mood had improved

in 11, unchanged in 13, and worsened in 12.

Global Cognition. There was no significant change

in the ACE scores from baseline or between 1 and 5

years. At baseline, ACE scores (adjusted for levels of

education) were 1 standard deviation below normal in

12 patients. At 5 years, 5 of them were clinically

demented.

Attention and Executive Functions. None of the

tests showed a significant change following surgery. At

baseline, only 1 patient had verbal fluency 1 SD below

normal. By 5 years, 9 additional patients had reduced

verbal fluency (6 were identified in 1-year visit). Apathy

(measured from UPDRS I) was present in 12 at baseline.

At 3 years, apathy worsened in 2 and was newly detected

in 6. At 5 years, apathy was worse in 4 and developed

new in 2 additional patients. Most of the complications

were related to hardware or surgery (Table 6).

TABLE 2. Effect of subthalamic stimulation on UPDRS I, II, IV, and other scales

SubscaleBaseline 1 yr 3 yr 5 yr

Base linevs. 3 yr

Baselinevs. 5 yr 1 vs. 3 yr 1 vs. 5 yr

N 5 45 N 5 45 N 5 36 N 5 29 P value P value P value P value

Dyskinesias(UPDRS IVA) (0–13)

4.4 6 2.3 1.2 6 1.5 1.2 6 1.2 1.5 6 1.3 <0.0001 <0.0001 0.1 0.03

Fluctuations(UPDRS IVB)(0–7)

4.0 6 1.3 2.3 6 1.4 1.9 6 1.2 2.2 6 1.6 <0.0001 <0.0001 0.1 0.5

Schwab and EnglandOFF (0–100%)

43.3 6 21.3 74.2 6 17.9 78.6 6 12.9 77.7 6 14.1 <0.0001 <0.0001 0.6 0.5

Schwab and EnglandON (0–100%)

70.3 6 22.3 86 6 10.3 85.2 6 12.1 82.8 6 12.3 <0.001 0.01 0.6 0.1

Hoehn and Yahr OFF 3.7 6 0.9 2.6 6 0.6 2.8 6 0.5 2.9 6 0.6 0.002 0.3 0.001 0.001Hoehn and Yahr ON 2.3 6 0.5 2.4 6 0.6 2.6 6 0.6 2.7 6 0.5 0.001 0.007 0.001 0.009LEDD (mg) 669.8 6 359.7 415.3 6 365.6 397.1 6 267.7 346.5 6 202.6 <0.0001 <0.0001 0.1 0.2Amplitude of

current (V)NA 3.0 6 0.6 3.1 6 0.5 3.3 6 0.5 NA NA 0.8 0.1

Frequency (Hz) NA 140.6 6 20 143.1 6 21.6 150.3 6 24.6 NA NA 0.5 0.07Pulse width (lsec) NA 64 6 9.8 66.8 6 12.7 70.9 6 14.7 NA NA 0.3 0.2

Data are mean 6 SD, P < 0.005 is statistically significant. Comparisons are with corresponding baseline values.

TABLE 3. Effect of subthalamic stimulation on quality of life scores

PDQL score

Baseline 1 yr 3 yr 5 yrBase vs. 3 yr Base vs. 5 yr 1 vs. 3 yr 1 vs. 5 yrN 5 45 N 5 45 N 5 36 N 5 29

Mean 6 SD Mean 6 SD Mean 6 SD Mean 6 SD Mean 6 SD P value P value P value

Total (37–185) 93.9 6 22 123.2 6 20.4 115.2 6 26.4 112.8 6 21.8 <0.0001 0.001 0.01 0.004Parkinsonism (14–70) 34.5 6 8.9 46.7 6 7.9 44.1 6 10.3 41.6 6 8.9 <0.0001 0.003 0.04 0.007Systemic (7–35) 18.3 6 5.2 23.5 6 4.1 21.7 6 5.4 20.7 6 3.8 <0.0001 0.07 0.01 0.002Emotional (9–45) 25.8 6 7.5 31.8 6 6.3 30.0 6 7.8 29.4 6 6.7 0.001 0.04 0.03 0.02Social (7–35) 15.8 6 4.9 21.5 6 4.6 19.7 6 5.4 20.1 6 5.1 <0.0001 0.001 0.05 0.05

P < 0.005 is statistically significant. Comparisons are with corresponding baseline values.



DISCUSSION

Our study revealed strong and sustained beneficial

effects of STN stimulation on motor fluctuations, dys-

kinesias, ADL, and QOL in patients with advanced

PD. Patients could be maintained on a 40% lower dose

of drugs and stable stimulation settings up to 5 years

and in the majority, no battery replacement was needed

during this period. Tremor, rigidity, and bradykinesia

could be controlled to a large extent by stimulation

alone. These indicate that STN stimulation is a robust

technique that can counter the impact of striatal dopa-

mine deficiency and the pre- and post-synaptic altera-

tions that underlie motor complications, without induc-

ing tolerance. We observed that the initial improve-

ment in speech, postural stability, and gait declined

after 3 years, and there was a trend for gait and pos-

tural instability to be less responsive to L-dopa at 5

years, indicating additional nondopaminergic pathol-

ogy. These symptoms of PD need additional strategies

of long-term management. We did not find much wor-

sening of parkinsonian signs except bradykinesias after

a 2 hours discontinuation of stimulation. This could

result from persisting effects of stimulation and not

necessarily from any neuroprotective effect.8

Earlier reports of STN stimulation on cognition

show variable results.18–27 We did not find any signifi-

cant decline in any of the cognitive spheres in our

cohort. Five patients developed dementia by 5 years,

all of whom had mild baseline impairment in neuro-

psychological tests. We also found new-onset reduction

in verbal fluency, majority of which were mild, clini-

cally insignificant, detected at the first follow-up

assessment itself and with no further worsening. We

believe this may be the microlesioning effect of elec-

trode passage. In contrast, apathy appeared at variable

TABLE 4. UPDRS scores in stimulation off and ‘‘drug off’’ or ‘‘drug on’’

Subscales

Baseline 1 yr 3 yr 5 yrN 5 45 N 5 40 N 5 36 N 5 29 Base vs. 3 yr

P valueBase vs. 5 yr

P value1 vs. 3 yrP value

1 vs. 5 yrP valueMean 6 SD Mean 6 SD Mean 6 SD Mean 6 SD

Stimulation off-drug offUPDRS-III motor 48.1 6 13.6 46.6 6 16.8 53.5 6 19.4 58.4 6 21.5 0.05 0.2 0.07 0.02Tremor 4.7 6 4.1 4.2 6 4.1 5.1 6 4.5 6.8 6 5.4 0.6 0.8 0.4 0.3Rigidity 10.5 6 4.1 9.9 6 4.9 11.9 6 4.9 12.5 6 4.9 0.01 0.1 0.1 0.4Bradykinesia 16.4 6 5.7 15.9 6 6.3 20.6 6 7.4 21.1 6 9.4 0.004 0.007 0.001 0.006Postural instability 2.5 6 0.9 1.9 6 0.9 2.2 6 0.9 2.4 6 1.1 0.2 0.5 0.02 0.01Gait 2.5 6 0.9 2.2 6 0.9 2.5 6 0.9 2.3 6 0.9 0.8 0.5 0.07 0.1Speech 1.6 6 1.1 1.4 6 1.0 1.7 6 1.1 1.6 6 1.1 0.3 0.3 0.02 0.01

Stimulation off-drug onUPDRS III motor (total) 16.9 6 8.3 19.3 6 13.9 21.9 6 15.5 27.3 6 18.9 0.08 0.01 0.3 0.05Tremor 0.5 6 1.1 0.9 6 1.9 1.2 6 2.4 1.2 6 3.5 0.03 0.4 0.9 0.2Rigidity 3.5 6 3.1 4.1 6 3.9 4.7 6 4.7 5.8 6 4.4 0.1 0.06 0.5 0.5Bradykinesia 16.1 6 4.9 11.9 6 5.7 10.0 6 7.1 12.2 6 6.3 0.01 0.02 0.03 0.02Postural stability 0.9 6 0.9 1.0 6 0.9 1.1 6 0.8 1.2 6 0.9 0.02 0.01 0.2 0.03Gait 1.4 6 0.8 1.5 6 0.8 1.7 6 0.8 1.6 6 1.2 0.4 0.05 0.002 0.01Speech 1.0 6 1.1 0.9 6 1.1 1.4 6 1.3 1.3 6 1.1 0.1 0.4 0.02 0.01

Data are mean 6 SD, comparisons are with corresponding baseline values. P < 0.005 is statistically significant.

TABLE 5. Comparison of cognitive and mood scores

Scores

Baseline 1 yr 3 yr 5 yrN 5 45 N 5 43 N 5 36 N 5 27 Base vs. 3 yr

P valueBase vs. 5 yr

P value1 vs. 3 yrP value

1 vs. 5 yrP valueMean 6 SD Mean 6 SD Mean 6 SD Mean 6 SD

BDI 14.0 6 9.3 11.6 6 7.9 12.8 6 10.2 12.3 6 7.6 0.5 0.1 0.5 0.2HADS-D 6.1 6 3.7 5.1 6 4.3 6.7 6 4.1 6.8 6 3.7 0.2 0.5 0.8 0.3HADS-A 8.6 6 4.1 8.9 6 4.2 9.3 6 4.9 10.2 6 3.7 0.4 0.3 0.5 0.3MMSE 27.7 6 3.2 27.1 6 4.0 27.0 6 3.3 26.6 6 3.1 0.4 0.6 0.8 0.6ACE 75.6 6 15.1 76.8 6 18.1 80.3 6 14.5 78.9 6 16.3 0.02 0.5 0.4 0.6VF-letter 8.9 6 4.3 8.1 6 4.9 7.9 6 4.8 8.4 6 5.5 0.3 0.1 0.9 0.5VF-category 11.4 6 4.7 9.1 6 4.7 9.5 6 4.5 10.7 6 5.7 0.2 0.8 0.4 0.3

Data are mean 6 SD, P < 0.005 is statistically significant. Comparisons are with corresponding baseline values.



intervals from surgery and progression of pathology

could be also contribute to it. Long-term studies using

a matched, medically treated arm would be necessary

to assess whether the cognitive changes following

stimulation are the result of damage from electrode

passage, spread of current to cognitive circuits, natural

progression of PD, or from reduction in dopaminergic

medications.

We found variable effects of STN stimulation on

mood, as in previous reports.26–28 In the majority of

patients, depression scores remained unchanged. The

worsening of mood despite adequate treatment in some

patients may be multifactorial in origin and further

studies are needed to understand them.27

We observed that even though the total QOL scores,

parkinsonian symptoms and social functioning showed

persistent benefits until 5 years, similar effects on emo-

tional functions and systemic symptoms were lost by 3

years. Lack of sustained benefit on axial symptoms,

worsening of mood, lack of effect on issues such as

occupation, relationships, and leisure activities or grad-

ual changes in perceptions of health related well being

could all underlie the self-reported loss of initial bene-

fits in QOL.29–32

In India, only few of the deserving PD patients

receive STN stimulation due to the high cost that has

to be met out of pocket and the limited number of cen-

ters that perform the surgery. Our study is the first

report of STN stimulation for PD in Asian patients.

The QOL changes perceived in this patient population,

and their motor and cognitive outcomes compare well

with reports from the West.

Acknowledgments: This study was supported by in-houseresearch funds from Sree Chitra Tirunal Institute for MedicalSciences and Technology, Kerala. We thank all out patientsand their families for their participation.

Financial Disclosures: None.

Author Roles: Asha Kishore: concept, organization, andexecution of project; data extraction and synthesis and writ-ing the first draft of paper. Ravimohan Rao: organization,design, and execution of project; review and critique ofmanuscript. Dilip Panikar: organization, design, and execu-tion of project; review and critique of manuscript. SyamKrishnan: execution of project; review and critique of manu-script. Gangadhara Sarma: execution of project; review andcritique. Mathuranath Pavagada Sankaran: organization andexecution of project; review and critique of manuscript. San-kara Sarma: design, statistical analysis, and review and cri-tique of manuscript.

REFERENCES

1. Deuschl G, Schade-Brittinger CS, Krack P, et al. A randomizedtrial of deep-brain stimulation for Parkinson’s disease. N Engl JMed 2006;355:896–908.

2. Weaver FM, Follett K, Stern M, et al. Bilateral deep brain stimu-lation vs best medical therapy for patients with advanced Parkin-son disease: a randomized controlled trial. JAMA 2009;301:63–73.

3. Kleiner-Fisman G, Herzog J, Fisman DN, et al. Subthalamic nu-cleus deep brain stimulation: summary and meta-analysis of out-comes. Mov Disord 2006;21 (suppl 14):S290–S304.

4. Krack P, Batir A, Van Blercom N, et al. Five-year follow up ofbilateral stimulation of the subthalamic nucleus in advanced Par-kinson’s disease. N Engl J Med 2003;349:1925–1934.

5. Rodriguez-Oroz MC, Zamarbide I, Guridi J, Palmero MR, ObesoJA. Efficacy of deep brain stimulation of the subthalamic nucleusin Parkinson’s disease 4 years after surgery: double blind andopen label evaluation. J Neurol Neurosurg Psychiatry 2004;75:1382–1385.

6. Rodriguez-Oroz MC, Obeso JA, Lang AE, et al. Bilateral deepbrain stimulation in Parkinson’s disease: a multicentre study with4 years follow-up. Brain 2005;128:2240–2249.

7. Ostergaard K, Sundae NA. Evolution of Parkinson’s disease dur-ing 4 years of bilateral deep brain stimulation of the subthalamicnucleus. Mov Disord 2005;21:624–631.

8. Piboolnurak P, Lang AE, Lozano AM, et al. Levodopa responsein long-term bilateral subthalamic stimulation for Parkinson’sdisease. Mov Disord 2007;22:990–997.

9. Schupbach WMM, Chastan N, Welter ML, et al. Stimulation ofthe subthalamic nucleus in Parkinson’s disease: a 5 year followup. J Neurol Neurosurg Psychiatry 2005;76:1640–1644.

10. Simonin C, Tir M, Devos D, et al. Reduced levodopa-induced com-plications after 5 years of subthalamic stimulation in Parkinson’sdisease: a second honey moon. J Neurol 2009;256:1736–1741.

11. Fahn S, Elton RL, andmembers of the UPDRS development com-mittee. Unified Parkinson’s rating scale. In: Fahn S, Marsden CD,Calne DB, Goldstein M, editors. Recent developments in Parkin-son’s disease. Florham Park (NJ): MacMillan; 1987. p153–164.

12. Langston JW, Widner H, Goetz C, et al. Core assessment programfor intracerebral transplantation (CAPIT). Mov Disord 1992;7:2–13.

13. Beck AT, Ward CH, Mendelson M, Mock J, Rraugh J. An inventoryfor measuring depression. Arch Gen Psychiatry 1961;4:561–571.

14. Mathuranath PS, Nestor PJ, Berrios GE, Rakowicz W, Hodges JR.A brief cognitive test battery to differentiate Alzeimer’s diseaseand frontotemporal dementia. Neurology 2000;55:1613–1620.

TABLE 6. Complications of subthalamic stimulation

Procedure related complicationsIntra operative confusion and delirium occurred in 4 patientsIntraoperative seizures in 2 (both small pneumocephalus)Asymptomatic streaks of hemorrhage along electrode tracks in the

post-operative MRI scan—2Fluid collection at battery implantation site necessitating

reimplantation—1Device relatedHardware failure of battery—2Lead repositioning—2Fall and lead breakage—1

Stimulation relatedWeight gain—29Eye lid apraxia—2Transient hypomania—1Impulse control disorder—1New-onset severe depression—1New-onset apathy—8New-onset reduced verbal fluency—9Suicide—1Dementia—5



15. Mathuranath PS, Cherian JP, Mathew R, George A, AlexanderA, Sarma S. Mini mental state examination and the Adden-brooke’s cognitive examination: effect of education and normsfor a multicultural population. Neurol India 2007;55:106–110.

16. de Boer AGEM, Wijker W, Speelman JD, Dehaes JCJM. Qualityof life in patients with Parkinson’s disease: development of aquestionnaire. J Neurol Neurosurg Psychiatry 1996;61:70–74.

17. Marinus J, Ramaker C, van Hilten JJ, Stiggelbout AM. Healthrelated quality of life in Parkinson’s disease: a systematic reviewof disease specific instrument. J Neurol Neurosurg Psychiatry2002;72:241–248.

18. Contarino MF, Daniele A, Sibilia AH, et al. Cognitive outcome5 years after bilateral chronic stimulation of subthalamic nucleusin patients with Parkinson’s disease. J Neurol Neurosurg Psychia-try 2007;78:248–252.

19. Funkiewiez A, Ardouin C, Caputo E, et al. Long-term effects ofbilateral subthalamic nucleus stimulation on cognitive function,mood and behavior in Parkinson’s disease. J Neurol NeurosugPsychiatry 2004;75:834–839.

20. Pilion B, Ardouin C, Damier P, et al. Neuropsychologicalchanges between ‘‘off’’ and ‘‘on’’ STN or GPI stimulation in Par-kinson’s disease. Neurology 2000;55:411–418.

21. Witt K, Daniels C, Reiff J, et al. Neuropsychological and psychi-atric changes after deep brain stimulation for Parkinson’s disease:a randomized, multicentre study. Lancet Neurol 2008;7:605–614.

22. Ardouin C, Pillon B, Peiffer E, et al. Bilateral subthalamic orpallidal stimulation for Parkinson’s disease affects neither mem-ory nor executive functions: a consecutive series of 62 patients.Ann Neurol 1999;46:217–223.

23. Saint-Cyr J, Trepanier LL, Kumar R, Lozano AM, Lang AE.Neuropsychological consequences of chronic bilateral stimulationof the subthalamic nucleus in Parkinson’s disease. Brain 2000;123:2091–2108.

24. Kalbe E, Voges J, Weber T, et al. Frontal FDG-PET activity cor-related with cognitive outcome after STN-DBS in Parkinson dis-ease. Neurology 2009;72:42–49.

25. Smeding HM, Speelman JD, Hulzenga HM, Schuurman PR,Schmand B. Predictors of cognitive and psychosocial outcomeafter STN DBS in Parkinson’s disease. J Neurol Neurosurg Psy-chiatry (in press).

26. Zangaglia R, Pacchetti C, Pasotti C, et al. Deep brain stimulationand cognitive functions in Parkinson’s disease: a three-year con-trolled study. Mov Disord 2009;24:1621–1628.

27. Voon V, Kubu C, Krack P, Houeto JL, Troster AI. Deep brainstimulation: neuropsychological and neuropsychiatric issues. MovDisord 2006;21:S305–S326.

28. Berney A, Vingerhoets FJ, Perrin A, et al. Effect on mood ofsubthalamic DBS for Parkinson’s disease. A consecutive seriesof 24 patients. Neurology 2002;59:1427–1429.

29. Mushmovic D, Post B, Speelman JD, Schmand B, de Haan RJ.Determinants of disability and quality of life in mild to moderateParkinson disease. Neurology 2008;70:2241–2247.

30. Ferrara JM, Diamond A, Hunter C, Davidson A, Almaguer M,Jankovic J. Impact of STN-DBS on life and health satisfaction inpatients with Parkinson’s disease. J Neurol Neurosur Psychiatry(in press).

31. Volkmann J, Albanese A, Kulisevsky J, et al. Long-termeffects of pallidal or subthalamic deep brain stimulation onquality of life in Parkinson’s disease. Mov Disord 2009;24:1154–1161.

32. Drapier S, Raoul S, Drapier D, et al. Only physical aspects ofquality of life are significantly improved by bilateral subthala-mic stimulation in Parkinson’s disease. J Neurol 2005;252:583–588.

Diagnostic Accuracy of theMagnetic Resonance ParkinsonismIndex and the Midbrain-to-Pontine

Area Ratio to DifferentiateProgressive Supranuclear Palsy

from Parkinson’s Disease and theParkinson Variant of Multiple

System Atrophy

Anna Hussl, MD,1 Philipp Mahlknecht, MD,1

Christoph Scherfler, MD,1 Regina Esterhammer, MD,2

Michael Schocke, MD,2 Werner Poewe, MD,1

and Klaus Seppi MD1*

1Department of Neurology, Innsbruck Medical University,Innsbruck, Austria; 2Department of Radiology I, Innsbruck

Medical University, Innsbruck, Austria

Abstract: Using magnetic resonance (MR) planimetry,both the midbrain-to-pontine area ratio (m/p-ratio) andthe MR parkinsonism index (MRPI) have been shownto assist in the differential diagnosis of progressivesupranuclear palsy (PSP) from Parkinson’s disease (PD)and the Parkinson variant of multiple system atrophy(MSA-P). The aim of this study was to determine thediagnostic accuracy of the MRPI compared with the m/p-ratio in a large cohort of 123 patients with neurode-generative parkinsonism including patients with PSP,PD, and MSA-P. Patients with PSP had significanthigher MRPI values and significant smaller m/p-ratioscompared with the other groups with overlapping indi-vidual values. Overall predictive accuracy was similarfor the m/p-ratio (87.0%) and the MRPI (80.5%) witha predictive accuracy for PSP from MSA-P beingsignificantly better for the MRPI (87.5%) comparedwith the m/p-ratio (75%) as well as a predictive accu-racy for PSP from PD being significantly better for them/p-ratio (87.6%) compared with the MRPI (77.3%).Both the m/p-ratio and the MRPI may assist theclinical differential diagnosis in neurodegenerativeparkinsonism. � 2010 Movement Disorder Society

*Correspondence to: Dr. Klaus Seppi, Department of Neurology,Innsbruck Medical University, Anichstrasse 35, A-6020 Innsbruck,Austria. E-mail: [email protected]

Potential conflict of interest: Nothing to report.Received 23 April 2010; Revised 18 June 2010; Accepted 23 June

2010Published online 28 September 2010 in Wiley Online Library

(wileyonlinelibrary.com). DOI: 10.1002/mds.23351

2444 A. HUSSL ET AL.


Key words: MR planimetry; progressive supranuclearpalsy; multiple system atrophy; Parkinson’s disease; parkin-sonism; MR parkinsonism index; midbrain-to-pontine arearatio

Recent findings suggest that magnetic resonance

(MR) planimetry represents a simple method for the

differential diagnosis of neurodegenerative parkinson-

ism. As specific brain structures are known to be

atrophic in different neurodegenerative parkinsonian

disorders, several groups have applied quantitative

measurements including diameters and areas of various

brain structures on structural MRI for their differential

diagnosis.1–6 Atrophy of midbrain and superior cerebel-

lar peduncle (SCP) were associated with progressive

supranuclear palsy (PSP), and atrophy of pons and

middle cerebellar peduncle (MCP) with the Parkinson

variant of multiple system atrophy (MSA-P), respec-

tively.1–6 As the single measurement of these brain

structures has failed to separate PSP from MSA-P and

Parkinson’s disease (PD) on an individual basis, the

midbrain-to-pontine area ratio (m/p-ratio) and the MR

parkinsonism index (MRPI)—calculated by multiplying

the pontine-to-midbrain area (p/m) ratio by the MCP-

to-SCP width ratio (MCP/SCP)—were introduced. Cal-

culation of the m/p-ratio has been demonstrated to dis-

criminate completely between PSP patients and

patients with PD, MSA-P, or healthy controls,3

whereas there were overlapping individual values in

another study.1 Indeed, the MRPI was significantly

larger in patients with PSP than in patients with PD,

with MSA-P, and control participants (cutoff value

‡13.58), without any overlap between the PSP and the

other groups.1 The objective of this study was to test

the diagnostic accuracy of the MRPI compared with

the m/p-ratio in a large sample of patients with neuro-

degenerative parkinsonism, which after the MRI exam-

ination were followed clinically at least for 2 years to

increase the reliability of the clinical diagnosis of the

patients.


Magnetic Resonance Imaging Protocol and Image

Analysis

We have assessed the MRPI in 123 patients with

neurodegenerative parkinsonism (75 patients with PD,

26 with probable MSA-P, and 22 with probable PSP)

using a 1.5 Tesla MR Scanner (Magnetom Symphony;

Siemens, Erlangen, Germany). At the MRI examina-

tion, 8 of the MSA-P patients and 7 of the PSP

patients fulfilled the criteria for possible MSA-P and

possible PSP, respectively. All of them converted to

probable MSA-P and PSP within the 2 years of clinical

follow-up. The MRI protocol included conventional

MRI sequences with a sagittal T1-weighted FLASH

3D sequence (TR 9.7 milliseconds, TE 4 milliseconds,

slice thickness 1.2 millimeter, matrix 256 3 256, field

of view 230 millimeter) and a dual-echo fast spinecho

sequence (TR 3500 milliseconds, TE 22 and 90 milli-

seconds, slice thickness 4 millimeconds, matrix of 256

3 256, FoV 220 milliseconds), which was performed

twice providing 2 3 15 slices that were interleaved

without any gap. Conventional MRI sequences were

visually assessed to exclude symptomatic parkinson-

ism.2 For calculation of the MRPI, measurements of

diameters (MCP and SCP) and areas (pontine and mid-

brain) were performed on a multiplanar reconstruction

program (JVision, Tiani/AGFA, Austria) using the

native 3D T1-weighted images as previously sug-

gested.1 Furthermore, we measured the time it took for

the assessment of the m/p-ratio and the MRPI in 10 of

all patients. The study was approved by the local

Ethics Committee of the Medical University Innsbruck.

Statistical Analysis

Parametric, nonparametric, or the chi-square tests

were used for group comparisons depending on the

scale type of the variables. Between-group comparisons

between PSP and non-PSP (all PD and MSA-P

patients) were performed with the unpaired t-test for

the m/p-ratio, for the MRPI, age at MRI and disease

duration at MRI; with the Mann-Whitney U test for

the Hoehn and Yahr scale and with the chi-square test

for gender distribution, the presence of an abnormal

m/p-ratio and the presence of an abnormal MRPI.

Between-group comparisons between PSP, PD, and

MSA-P were performed with an one-way ANOVA

with post hoc Bonferroni correction for the m/p-ratio,

for the MRPI, age at MRI and disease duration at

MRI; with the Kruskal–Wallis one-way analysis of var-

iance followed by a Mann-Whitney U test corrected

for multiple comparisons (P < 0.05/3 5 0.017) for the

Hoehn and Yahr scale and with the chi-square test cor-

rected for multiple comparisons (P < 0.05/3 5 0.017),

for gender distribution, and the presence of an abnor-

mal m/p-ratio or MRPI. In a next step, we performed a

receiver operating characteristic curve (ROC) analysis

for the MRPI and the m/p-ratio to determine the cutoff

value that separates best between PSP patients and

non-PSP patients. Maximal discrimination is reached at


2445DIAGNOSTIC ACCURACY OF THE MRPI AND THE M/P-RATIO

TABLE

1.Dem

ograph

ic,clinical,an

dplan

imetricinfratentorial

MRIda

taof

patients

withPSP

,PD,an

dMSA

-Pin

this

stud

y

PSP

PD

MSA-P

PSPvs.

non-PSP

PSP

vs.PD*

PSPvs.

MSA-P*

MSA-P

vs.PD*

n22

75

26

Gender

distributiona(m

/f)

11/11

46/29

13/13

ns

ns

ns

ns

Ageat

MRIb

mean6

SD

68.736

9.08

64.836

9.74

64.676

6.60

ns

ns

ns

ns

Disease

durationbat

MRImean6

SD

2.886

1.94

7.496

6.89

4.096

1.79

P<

0.001

P<

0.01

ns

P<

0.05

HoehnandYahrscalec

(range)

III–IV

II–III

III–IV

P<

0.005

P<

0.001

ns

P<

0.001

m/p-ratio

mean6

SD

(95%

CI)

0.186

0.03(0.17–0.19)

0.236

0.04(0.22–0.24)

0.276

0.09(0.24–0.31)

P<

0.001

P<

0.001

P<

0.001

P<

0.001

MRPImean6

SD

(95%

CI)

18.636

5.32(16.28–20.99)

12.736

2.76(12.10–13.37)

9.396

3.46(7.10–10.79)

P<

0.001

P<

0.001

P<

0.001

P<

0.001

Abnorm

alm/p-ratio

a(%

)[<

0.18]

14(63.6%)

4(5.3%)

4(15.4%)

P<

0.001

P<

0.001

P<

0.001

na

Sensitivity

63.6%

63.6%

63.6%

na

Specificity

92.1%

94.7%

84.6%

na

PPV

63.6%

77.8%

77.8%

na

NPV

92.1%

89.9%

84.6%

na

Predictiveaccuracy

87.0%

87.6%

75.0%

na

Likelihoodratio

8.1

12.0

4.1

na

Abnorm

alMRPIa(%

)[‡14.38]

18(81.8%)

18(24.0%)

2(7.7%)

P<

0.001

P<

0.001

P<

0.001

na

Sensitivity

81.8%

81.8%

81.8%

na

Specificity

80.2%

76.0%

92.3%

na

PPV

47.4%

50.0%

90.0%

na

NPV

95.3%

93.4%

85.7%

na

Predictiveaccuracy

80.5%

77.3%

87.5%

na

Likelihoodratio

4.1

3.4

10.6

na

*Posthoc,

Bonferronicorrected(P

<0.05/3

50.017).

aChi-squaretest.

bParam

etrictests[unpairedt-test;univariate

one-way

analysisofvariance

(ANOVA)].

cNonparam

etrictests(M

ann–Whitney

Utest;Kruskal–Wallisone-way

analysisofvariance).

PSP,progressivesupranuclearpalsy;PD,Parkinson’s

disease;MSA-P,Parkinsonvariantofmultiple

system

atrophy;ns,notsignificant;na,

notapplicable;SD,standarddeviation,PPV,

positivepredictivevalue;

NPV,negativepredictivevalue;

m/p-ratio,midbrain-to-pontineratio;MRPI,MRparkinsonism

index.



the cutoff level that has the highest sum of sensitivity

and specificity. This optimal cutoff level (with an area

under the curve of 0.86) for the MRPI to discriminate

between PSP and non-PSP was 14.38 implying that a

MRPI of ‡14.38 (i.e., abnormal MRPI) is indicative of

a diagnosis of PSP and a MRPI <14.38 is indicative

of a diagnosis of non-PSP. The optimal cutoff level

(with an area under the curve of 0.86) for the m/p-ratio

to discriminate between PSP and non-PSP was 0.18

implying that a m/p-ratio �0.18 is indicative of a diag-

nosis of PSP and a m/p-ratio of >0.18 (i.e., normal

m/p-ratio) is indicative of a diagnosis of non-PSP.

Diagnostic accuracy was calculated for the best dis-

criminating MRPI value and m/p-ratio obtained by the

ROC analysis. Sensitivity is the proportion of true pos-

itives, i.e., PSP patients with the abnormal finding/all

with PSP. Specificity is the proportion of true nega-

tives, i.e., patients not having PSP without having the

abnormal finding/all patients not having PSP. The posi-

tive predictive value is the likelihood of a person with

the abnormal finding to have PSP (PSP patients with

the positive test result/all with positive tests). The neg-

ative predictive values are the likelihood of a person

without the abnormal finding not to have PSP (i.e.,

patients not having PSP with the negative test result/all

with negative tests). The predictive accuracy refers to

the proportion of the true positives and true negatives

(i.e., patients with the true test result/all patients). The

likelihood ratio is how much the odds of PSP increase

when the abnormal finding is given. The McNemar’s

test for paired data was used to compare overall pre-

dictive accuracy of MRPI and m/p-ratio for the differ-

entiation of PSP from non-PSP patients. Statistical

analysis was performed with SPSS v. 17.0 for Win-

dows (SPSS, Chicago, IL) and Graph Pad Prism 5.0

for Windows.

RESULTS

Patient characteristics and main findings are sum-

marized in the Table 1 and the Figure 1. PSP patients

had significant higher MRPI values and significant

smaller m/p-ratios compared with the other groups as

demonstrated in the Figure 1 and the Table 1. Diagnos-

tic accuracy is given in the Table 1. Overall predictive

accuracy for PSP from non-PSP was similar for the

MRPI and the m/p-ratio. Although predictive accuracy

for PSP from MSA-P was significant better (P 5 0.03)

for the MRPI than for the m/p-ratio, predictive accu-

racy for PSP from PD was significant better (P 50.04) for the m/p-ratio compared with the MRPI.

Accordingly, the likelihood ratio for the discrimination

of PSP from MSA-P was 12 for the m/p-ratio com-

pared with 3.4 for the MRPI, whereas the likelihood

ratio for the discrimination of PSP from PD was 10.6

for the MRPI compared with 4.1 for the m/p-ratio. It

took significant longer (P < 0.001) time to assess the

MRPI (mean: 2 minutes and 41 seconds; standard devi-

ation SD: 9.1 seconds) compared with the m/p-ratio

(mean: 1 minutes and 7 seconds; SD: 6.1 seconds).

DISCUSSION

Our study confirms that both the m/p-ratio and the

MRPI may represent helpful tools for the differential

FIG. 1. Scatter blot demonstrating the m/p-ratio and MRPI values in patients with PSP, MSA-P, and PD. The PSP fields (i.e., the gray fields)include the abnormal MRPI values (i.e., ‡14.38) and the abnormal m/p-ratios (i.e., �0.18), which both are indicative of a diagnosis of PSP.

2447DIAGNOSTIC ACCURACY OF THE MRPI AND THE M/P-RATIO


diagnosis of PSP. Indeed, in terms of infratentorial

changes, differentiation of PSP and MSA from each

other and from PD is based on studies showing that PSP

patients have relatively greater midbrain atrophy and at-

rophy of the SCP, whereas conversely MSA-patients

have relatively greater pontine and atrophy of the

MCP.1–6 However, we were not able to discriminate

completely between patients with PSP and those with

MSA-P3 or even between patients with PSP and both

those with MSA-P and PD as suggested previously.1

Overall predictive accuracy for PSP compared with

the non-PSP patients was not significant different

between the MRPI and the m/p-ratio. On the other

hand, predictive accuracy for PSP from MSA-P was

better for the MRPI than for the m/p-ratio, whereas

predictive accuracy for PSP from PD was better for

the m/p-ratio compared with the MRPI. The better dis-

crimination of PSP patients from those with MSA-P

with the MRPI compared with the m/p-ratio most prob-

ably derives from the combined assessment of four

brain structures involved in these two neurodegenera-

tive parkinsonian syndromes, where atrophy of the

midbrain and SCPs suggests PSP, whereas atrophy of

the pons and MCPs suggests MSA-P.1,3,5–8 These brain

structures are usually not involved in patients with

PD.1,3 This might explain why discrimination of PSP

patients from those with PD decreases by combining

the assessment of these four infratentorial brain struc-

tures through the MRPI compared with the m/p-ratio.

Using the MRPI compared with the m/p-ratio, the seg-

mentation procedure includes more brain structures.

Therefore, the determination of the MRPI is much

more time consuming than the determination of the

m/p-ratio.

Patients in this study were diagnosed clinically

and misdiagnoses cannot be excluded in the absence

of postmortem verification. However, all the diagno-ses of our patients were based on stringent diagnos-

tic criteria9–13 and patients were followed for atleast 2 years enhancing the reliability of the clinical

diagnosis of our patients. In summary, both the

m/p-ratio and the MRPI, as simple and reasonableadditional aids within the routine MR analysis,

may assist the clinical differential diagnosis in par-kinsonism.

Financial Disclosures: Klaus Seppi has received honora-

ria for speaking and consulting from: Novartis, Boehringer

Ingelheim, Lundbeck, Schwarz Pharma, UCB Pharma, and

GlaxoSmithKline. Werner Poewe served as consultant for

Boehringer Ingelheim, Esai Ltd., Novartis, Sovay, and

Teva. He was in the advisory panel for Boehringer Ingel-

heim, Esai Ltd., Genzyme, Novartis, Schering Plough,

Sovay, Teva, and Valeant. He received research support

from Boehringer Ingelheim and Astra Zeneca. He serves as

review editor for the Journal of Neurology and as a mem-

ber of the editorial advisory board for the European Jour-nal of Neurology.

Author Roles: Anna Hussl was involved in conception,

design, organization, execution of the study, and writing of

the draft. Philipp Mahlknecht was involved in conception,

design, organization, execution of the study, writing of the

draft, and review and critique of the manuscript. Christoph

Scherfler was involved in organization and execution of the

study and review and critique of the manuscript. Regina

Esterhammer was involved in conception, design, and organi-

zation of the study, review and critique of the manuscript,

and the statistical analysis. Michael Schocke was involved in

conception, design, organization, and execution of the study,

review and critique of the manuscript, and the statistical anal-

ysis. Werner Poewe was involved in conception, design, and

organization of the study, review and critique of the manu-

script, and the statistical analysis. Klaus Seppi was involved

in conception, design, organization, and execution of the

study, writing of the draft, design and execution of the statis-

tical analysis, review and critique of the manuscript, and

supervision.

REFERENCES

1. Quattrone A, Nicoletti G, Messina D, et al. MR imaging indexfor differentiation of progressive supranuclear palsy from Parkin-son disease and the Parkinson variant of multiple system atrophy.Radiology 2008;246:214–221.

2. Seppi K, Poewe W. Brain magnetic resonance imaging techni-ques in the diagnosis of parkinsonian syndromes. NeuroimagingClin N Am 2010;20:29–55.

3. Oba H, Yagishita A, Terada H, et al. New and reliable MRI di-agnosis for progressive supranuclear palsy. Neurology 2005;64:2050–2055.

4. Warmuth-Metz M, Naumann M, Csoti I, Solymosi L. Measurement ofthe midbrain diameter on routine magnetic resonance imaging: a sim-ple and accurate method of differentiating between Parkinson diseaseand progressive supranuclear palsy. Arch Neurol 2001;58:1076–1079.

5. Nicoletti G, Fera F, Condino F, et al. MR imaging of middle cer-ebellar peduncle width: differentiation of multiple system atrophyfrom Parkinson disease. Radiology 2006;239:825–830.

6. Paviour DC, Price SL, Stevens JM, Lees AJ, Fox NC. Quantita-tive MRI measurement of superior cerebellar peduncle in pro-gressive supranuclear palsy. Neurology 2005;64:675–679.

7. Aiba I, Hashizume Y, Yoshida M, et al. Relationship betweenbrainstem MRI and pathologic findings in progressive supranuclearpalsy: study in autopsy cases. J Neurol Sci 1997;152:210–217.

8. Groschel K, Kastrup A, Litvan I. Penguins and hummingbirds: midbrainatrophy in progressive supranuclear palsy. Neurology 2006;66:949–950.

9. Litvan I, Bhatia KP, Burn DJ, et al. Movement disorders societyscientific issues committee report: SIC task force appraisal ofclinical diagnostic criteria for parkinsonian disorders. Mov Dis-ord 2003;18:467–486.

10. Hughes AJ, Daniel SE, Kilford L, Lees AJ. Accuracy of clinical di-agnosis of idiopathic Parkinson’s disease: a clinico-pathologicalstudy of 100 cases. J Neurol Neurosurg Psychiatry 1992;55:181–184.

11. Litvan I, Agid Y, Jankovic J, et al. Accuracy of clinical criteriafor the diagnosis of progressive supranuclear palsy (Steele-Richardson-Olszewski syndrome). Neurology 1996;46:922–930.



12. Gibb WR, Lees AJ. The relevance of the Lewy body to thepathogenesis of idiopathic Parkinson’s disease. J Neurol Neuro-surg Psychiatry 1988;51:745–752.

13. Gilman S, Low PA, Quinn N, et al. Consensus statement on the di-agnosis of multiple system atrophy. J Neurol Sci 1999;163:94–98.

Parkinson’s Disease andPathological Gambling: Resultsfrom a Functional MRI Study

Daniela Frosini, MD,1 Ilaria Pesaresi, MD,2

Mirco Cosottini, MD,1 Gina Belmonte, PhD,3

Carlo Rossi, MD,1 Liliana Dell’Osso, MD,4

Luigi Murri, MD,1 Ubaldo Bonuccelli, MD,1

and Roberto Ceravolo, MD1*

1Department of Neuroscience, University of Pisa, Pisa, Italy;2Department of Radiology, University of Pisa, Pisa, Italy;3Department of Medical Physics, University of Pisa, Pisa,

Italy; 4Department of Psychiatry, Neurobiology,Pharmacology and Biotechnology, University of Pisa,

Pisa, Italy

Abstract: Seven patients with a diagnosis of Parkinson’sdisease (PD) and pathological gambling (PG) and 7 PDpatients without PG were investigated by functional MRIand a block-design experiment with gambling-related vis-ual cues alternating with neutral stimuli and rest periods.Compared with PD/non-PG, in PD/PG patients, severalareas of increased cue-related blood oxygen level depend-ent (BOLD)-response were observed including bilateralanterior cingulate cortex, medial and superior frontalgyri, and precuneus, right inferior parietal lobule, andventral striatum. The over activation of cingulate cortexand ventral striatum in PD/PG patients after the cravingtask is similar to that reported in addicted patients,whereas the activation of the parietal structures is prob-ably related to the attentional network. � 2010 MovementDisorder Society

Key words: Parkinson’s disease; fMRI; pathological gam-bling

Pathological gambling1 (PG) represents an emerging

psychiatric complication in idiopathic Parkinson’s dis-

ease (PD). Different risk factors for PG in PD patients

have been described, such as younger age at the onset

of PD, longer duration, male gender, family or perso-

nal history of psychiatric disorders, and dopamine ago-

nists (DAs).2–4

Functional imaging can be helpful in understanding

these phenomena and predisposing factors. So far, a

few functional imaging studies by means of single-

photon emission computed tomography (SPECT)5 and/

or positron emission tomography (PET)6 have been

performed in PG occurring in PD, overall resulting in

a dysfunction of reward system. However, some data

suggest the existence of similarities between PG and

drug addictions.7 In this study, we studied PD subjects

with PG by functional MRI (fMRI) during a gambling-

related video presentation to investigate the activation

pattern associated with a craving-inducing task.


Seven patients with a diagnosis of PD according to

Gelb criteria8 and active PG (Diagnostic and Statistical

Manual of Mental, Fourth Edition)1 (PD/PG), which

had appeared in all patients after exposure to DAs

(mean duration 13.2 6 4.3 months), were enrolled; 7

patients with a diagnosis of PD without PG (PD/non-

PG) were also enrolled. Medical history was collected,

and neurological examination and neuropsychological

assessment were performed. Patients with dementia,

severe dyskinesia, and sight impairment were

excluded. Moreover, none of the patients had no other

active axis I disorders1 and active hallucinations or

delusions. The Minnesota Impulsivity Disorder Inter-

view scale was performed in all patients enrolled in

the study to establish the occurrence of any impulsive

disorders in PD/PG patients and in the control group.

None of the patients fulfilled criteria for alcohol or

substance abuse or dependence. An informed consent

was obtained from each patient according to the decla-

ration of Helsinki. The study was approved by the

local ethic committee. Each scan was performed at the

same time of the day and in the same experimental

conditions.

The PD/non-PG and PD/PG patients did not differ in

age (58.3 6 8.6 vs. 57.5 6 11.1 years), disease dura-

tion (6.8 6 4.2 vs. 5.7 6 2.0 years), disease severity

as assessed by UPDRS III (18.0 6 6.3 vs. 15.5 6 1.3),

cognitive performance as evaluated by MMSE (mean

value 29.6, range 29–30 vs. mean value 29, range 27–

30), or drug treatment [PD/non-PG: four pramipexole,

Daniela Frosini and Ilaria Pesaresi contributed equally to thiswork.

*Correspondence to: Dr. Roberto Ceravolo, Department of Neuro-science, University of Pisa, Via Roma, 67, 56126 Pisa, Italy.E-mail: [email protected]

Potential conflict of interest: Nothing to report.Received 12 May 2010; Revised 28 June 2010; Accepted 7 July

2010Published online in Wiley Online Library (wileyonlinelibrary.

com). DOI: 10.1002/mds.23369

2449GAMBLING IN PARKINSON’S DISEASE: FMRI EVIDENCES


three ropinirole; DAs dose expressed as levodopa (L-

dopa) equivalent dose (LEDD)9: 325 6 50 mg/day; cu-

mulative dopaminergic therapy calculated as the sum

of the L-dopa and DAs converted into LEDD9: 462 6228.7; PD/PG: four pramipexole, three ropinirole; DAs

dose expressed as LEDD: 408.3 6 156.3; cumulative

dopaminergic therapy: 520 6 219.1]. MRI scan was

performed after overnight drug washout (off-therapy

condition form at least 12 hours).

Two PD/PG patients presented another ICD than PG

(one compulsive eating and one hypersexuality). The

favorite games were card games for two, slot machine

for one, and scratch cards for the remaining four. All

the subjects were able to play scratch cards, and a for-

mal diagnosis of PG was allowed also by taking into

account only this game for the whole sampling of PD/

PG patients.

Stimulation Protocol

The stimulation protocol consisted of a block-design

experiment with gambling-related visual cues alternat-

ing with neutral stimuli (NS) and rest periods. The vis-

ual stimuli were projected on a screen placed in front

of the scanner bore and delivered to the patient

through a mirror embedded within the head coil. Gam-

bling-related visual cues were represented by videos

showing a scratch card with 24 covered numbers

aligned in four rows. The first row was scratched

slowly disclosing the six winning numbers. The

patients were simply asked to look at the card, without

an active interaction, whereas the remaining numbers

were slowly unveiled. If one of these numbers matched

one of the six winning numbers, the patient got a vir-

tual variable monetary reward (range: 1 to one million

euros). The stimulation protocol included four scratch

card videos (30 seconds each) alternating with four

neutral videos (30 seconds each) and four rest periods

(15 seconds each). The NS were videos of ordinary

objects containing numbers (calendar, telephone, calcu-

lator, and abstract picture) split into 24 pieces that pro-

gressively appeared on the screen. During the rest pe-

riod, a fixed red cross was projected on the center of

the screen.At the end of the MRI examination, to eval-

uate the attention of the subject during the task, we

asked the patients to relate the number of winning

plays. The sensations evoked by the visual cues were

clinically investigated in all subjects by pre- and post-

task interviews. In particular, the gambling urge was

evaluated through a visual analog scale (0–10) with 10

indicating an extreme urge to play. The gambling urge

was then evaluated by comparing the pre- and post-

task scores.

FMRI Data Acquisition and Processing

FMRI data were acquired with a 1.5-T scanner

(Magnetom Symphony, Siemens). The fMRI data were

obtained by a T�2-weighted gradient recalled echo-pla-

nar imaging (EPI) sequence (TR 2500 millisecond, TE

60 millisecond, delay in TR 20 millisecond, FA 908,image matrix 64 3 64, and in-plane field of view 220

3 220 mm2) with 20 interleaved slices (slice thickness

5 mm) parallel to the anterior–posterior commissural

plane, repeated over 120 volumes for a total scanning

time of 5 min.

For each patient, additional anatomical T1-weightedimages were acquired [three-dimensional (3D) MP-

RAGE sequence]. We acquired MR examinations with

a Siemens MR equipment that automatically eliminates

the first two volumes of acquisition, then we discarded

two additional volumes to avoid T1-effect interference.FMRI data analysis was performed by BrainVoyager

QX (1.9 version). Each functional dataset underwent a

preliminary processing including slice scan time cor-

rection, 3D motion correction, high pass temporal fil-

tering and spatial smoothing. All patients showed

movement-related displacement of <3 mm/38. Proc-

essed functional dataset were coregistered to 3D T1-weighted anatomical images and normalized to the

standard Talairach template10 through linear spatial

transformations. The statistical analysis was performed

by a multistudy general linear model approach. The

design matrix included two predictors for each subject,

which were obtained by convolving the temporal func-

tion of visual stimuli presentation [cue stimuli (CS)

and NS] with the standard hemodynamic response

function.11 We calculated the contrast maps (CS–NS)

both within and between groups. The resulting color-

coded statistical maps were displayed at a statistical

threshold corrected for multiple comparisons (FDR <0.001 for within-group maps and FDR < 0.01 for

between-groups maps), with a cluster extent threshold

of four voxels. We only excluded extracerebral voxels

by masking EPI images (signal intensity range 40–180)

before the statistical analysis.

RESULTS

By the analog visual scale PD/PG patients had a sig-

nificantly higher level of gaming urge after viewing the

scratch card videos (mean 6 standard deviation

increase: PD/PG 7.10 6 1.8 vs. PD/non-PG 1.3 6 0.9).


2450 D. FROSINI ET AL.

Within-group contrast maps (CS–NS), separately per-

formed in PD/PG and in PD/non-PG patients, exhibited

brain activity in some overlapping areas, including

bilateral medial frontal gyrus, superior frontal gyrus,

precentral gyrus, and inferior parietal lobule (Table

1a/b; Fig. 1). When PD/PG were compared with PD/

non-PG patients, a significantly increased cue-related

BOLD response was detected bilaterally in the anterior

FIG. 1. Within-group contrast maps during viewing gambling scenarios with respect to NS (FDR < 0.001) in PD patients with and without PG.[Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

TABLE 1. Within-groups and between-groups contrast maps. Anatomical location, Talairach coordinates of the center ofgravity, maximum statistical value, and spatial extent (voxels) of significant clusters

Anatomical location

Center of gravity Talairachcoordinates

Brodmann area N voxel T-maxX Y Z

A PD/PG1 Inferior parietal lobule (R) 41 254 36 BA 40 6955 82 Precuneus (L 1 R) 2 263 38 BA 7 6497 7.93 Anterior cingulate, caudate head (R) 10 22 23 – 202 5.34 Medial frontal gyrus, superior frontal gyrus (L 1 R) 24 3 53 BA 6 2759 6.25 Cingulate gyrus (L) 25 234 30 BA 31.23 577 5.36 Lentiform nucleus (L) 216 26 7 – 115 5.17 Middle frontal gyrus L 227 23 58 BA 6 302 5.58 Inferior parietal lobule (L) 236 257 35 BA 39.40 2395 6.29 Precentral gyrus (L) 246 210 46 BA 6 841 6.2

B PD/non-PG1 Precentral gyrus (R) 61 21 13 BA 6 532 5.62 Inferior parietal lobule (R) 50 258 42 BA 40.39 303 5.73 Superior parietal lobule (R) 39 268 42 BA 7 344 5.94 Cuneus (R 1 L) 4 274 11 BA 17.18.23 849 5.65 Medial frontal gyrus, superior frontal gyrus (R 1 L) 1 7 52 BA 6 3861 6.96 Precuneus (L) 225 257 34 BA 7 487 6.27 Superior parietal lobule (L) 235 265 46 BA 7 1246 6.68 Precentral gyrus (L) 244 215 56 BA 6 1409 6.2

C PD/PG higher than PD/non-PG1 Inferior parietal lobule (R) 38 253 37 BA 40 1430 5.72 Precuneus (R) 12 258 33 BA 7 1163 63 Medial frontal gyrus, superior frontal gyrus (R) 9 49 31 BA 9 1104 64 Lentiform nucleus (L) 219 8 211 BA 34 242 5.45 Anterior cingulate, medial frontal gyrus (L) 28 42 7 BA 32.10 321 4.76 Precuneus (L) 213 267 42 BA 7 502 5.37 Medial frontal gyrus, superior frontal gyrus (L) 218 25 54 BA 6 204 4.98 Anterior cingulate, caudate head (R) 13 24 23 – 2329 5.39 Anterior cingulate, caudate head (L) 27 15 21 BA 25 810 5.110 Ventral-striatum (L) 211 24 23 – 1371 5.9

2451GAMBLING IN PARKINSON’S DISEASE: FMRI EVIDENCES


cingulate cortex, medial and superior frontal gyri and

precuneus with right prevalence, right inferior parietal

lobule, and left ventral striatum (Table 1c, Fig 2).

DISCUSSION

In PD/PG, with respect to PD/non-PG patients, a

clear-cut increase of activation was observed in bilat-

eral superior frontal gyrus, precuneus, right inferior pa-

rietal lobule, left ventral striatum, right mesial prefron-

tal cortex (MPFC), and bilateral anterior cingulate cor-

tex. The activation of the precuneus and inferior

parietal lobule might be due to the fact that these pari-

etal structures are needed to initiate preferential alloca-

tion of attentional resources in preparation for actions

elicited by craving,12,13 such as visual gambling cues.

The hyperactivation of the anterior cingulate cortex is

probably related to the role of this region in drug addic-

tions. Previous evidences have suggested an overactiva-

tion of anterior cingulate during cocaine cue-videotapes

or pharmacologically produced cocaine effect.14 Fur-

thermore, the increased activation in MPFC is consistent

with the recent report of an overactivation of this area

along with orbitofrontal cortex, cingulate cortex, and

ventral striatum in relation to a gaming task in game-ad-

dicted subjects.15 We could speculate that the hyperacti-

vation in anterior cingulate cortex in our PD/PG subjects

might be related to a sort of craving-like effect. The

effectiveness of visual task in inducing gaming urge was

confirmed by the significant change of post-task assess-

ments in all PD/PG patients.

The crucial role of the ventral striatum in mediating

reward function is extensively known. In a brain perfu-

sional SPECT study,5 a resting relative hyperperfusion

has been reported in ventral basal ganglia, suggesting a

sort of relative preservation of dopaminergic mesocor-

tico-limbic pathway in PD subjects predisposed to de-

velop PG. However, in a previous fMRI study, during a

gambling task, a significant hypoactivation in ventrome-

dial prefrontal cortex and ventral striatum was

reported.16 However, different from our paradigm, this

study was performed on subjects affected by PG without

parkinsonism; the patients were asked to observe the

gambling scene and then to choose a card, and their

selection was followed by winning or losing. In this

respect, the authors speculated that in PG there is a sort

of hypofunction of ventral striatum and the pathologic

behavior could be a compensatory phenomenon. PD sub-

jects developing PG after exposure to dopaminergic

drugs present several behavioral similarities to drug ad-

dicted. Recently, by means of PET and 11C-raclopride in

PD/PG patients, lower baseline levels of D2/D3 recep-

tors were suggested6 supporting the similarity between

PG in PD patients and chemical addictions. In this

regard, our findings of increased activation in the ante-

rior cingulate cortex and ventral striatum after the pre-

sentation of a craving task, although on a limited number

of subjects, might support the inclusion of PG in PD

within the spectrum of behavioral addictions.

Acknowledgments: Financial support: This research hasbeen funded by Tuscany Region. We declare that this study hasbeen done without any private financial support or funding.

Financial Disclosure: None.

Author Roles: Daniela Frosini and Ilaria Pesaresi wereinvolved in conception, organization, and execution ofresearch project, writing of the first draft, review and critiqueof manuscript. Mirco Cosottini and Carlo Rossi were involved

FIG. 2. Between-groups contrast maps for PD/PG vs. PD/non-PG (FDR < 0.01) during viewing gambling scenarios with respect to NS. [Colorfigure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

2452 D. FROSINI ET AL.


in organization, and execution of research project, review andcritique of manuscript. Gina Belmonte was involved in execu-tion of research project, review and critique of manuscript.Liliana Dell’Osso, Luigi Murri, and Ubaldo Bonuccelli wereinvolved in organization of research project, review and cri-tique of manuscript. Roberto Ceravolo was involved in con-ception and organization of research project, writing of thefirst draft, review and critique of manuscript.

REFERENCES

1. American Psychiatric Association. Diagnostic and statistical man-ual of mental, fourth edition. Washington, DC: American Psychi-atric Press; 1994.

2. Voon V, Thomsen T, Miyasaki JM, et al. Factors associated withdopaminergic drug-related pathological gambling in Parkinsondisease. Arch Neurol 2007;64:212–216.

3. Gallagher DA, O’Sullivan SS, Evans AH, Lees AJ, Schrag A.Pathological gambling in Parkinson’s disease: risk factors anddifferences from dopamine dysregulation. An analysis of pub-lished case series. Mov Disord 2007;22:1757–1763.

4. Antonini A, Tolosa E, Mizuno Y, Yamamoto M, Poewe WH. Areassessment of risks and benefits of dopamine agonists in Par-kinson’s disease. Lancet Neurol 2009;8:929–937.

5. Cilia R, Siri C, Marotta G, et al. Functional abnormalities under-lying pathological gambling in Parkinson disease. Arch Neurol2008;65:1604–1611.

6. Steeves TD, Miyasaki J, Zurowski M, et al. Increased striatal do-pamine release in Parkinsonian patients with pathologicalgambling: a [11C] raclopride PET study. Brain 2009;132:1376–1385.

7. Potenza MN. Should addictive disorders include non-substance-related conditions? Addiction 2006;101(Suppl 1):142–151.

8. Gelb DJ, Oliver E, Gilman S. Diagnostic criteria for Parkinsondisease. Arch Neurol 1999;56:33–39.

9. Grosset K, Needleman F, Macphee G, Grosset D. Switchingfrom ergot to nonergot dopamine agonists in Parkinson’s disease:a clinical series and five-drug dose conversion table. Mov Disord2004;19:1370–1374.

10. Talairach J, Tournoux P. Co-planar stereotaxic atlas of thehuman brain: 3-D proportional system: an approach to cerebralimaging. New York: Thieme Medical Publishers; 1988.

11. Friston KJ, Holmes AP, Poline JB, et al. Analysis of fMRI time-series revisited. Neuroimage 1995;2:45–53.

12. Crockford DN, Goodyear B, Edwards J, Quickfall J, el-GuebalyN. Cue-induced brain activity in pathological gamblers. Biol Psy-chiatry 2005;58:787–795

13. Park MS, Sohn JH, Suk JA, Kim SH, Sohn S, Sparacio R. Brainsubstrates of craving to alcohol cues in subjects with alcohol usedisorder. Alcohol Alcohol 2007;42:417–422.

14. Wexler BE, Gottschalk CH, Fulbright RK, et al. Functional mag-netic resonance imaging of cocaine craving. Am J Psychiatry2001;158:86–95

15. Ko CH, Liu GC, Hsiao S, et al. Brain activities associated withgaming urge of online gaming addiction. J Psychiatr Res 2009;43:739–747.

16. Reuter J, Raedler T, Rose M, Hand I, Glascher J, Buchel C.Pathological gambling is linked to reduced activation of the mes-olimbic reward system. Nat Neurosci 2005;8:147–148.

Adult Cases of CongenitalMuscular Torticollis SuccessfullyTreated with Botulinum Toxin

Manon Bouchard, MD, FRCPC,1*Sylvain Chouinard, MD, FRCPC,2

and Oksana Suchowersky, MD, FRCPC1,3

1Department of Clinical Neurosciences,University of Calgary, Calgary, Alberta, Canada;

2Department of Medicine, University of Montreal, Montreal,Canada; 3Department of Medical Genetics, University of

Calgary, Calgary, Alberta, Canada

Abstract: Congenital muscular torticollis (CMT) is themost common cause of torticollis in childhood. This condi-tion is usually recognized and successfully treated ininfancy, but may persist in adulthood, particularly if nottreated. In adult patients, CMT can be differentiatedfrom idiopathic cervical dystonia by the frequent associa-tion with facial asymmetry, presence of a cord-like sterno-cleiodmastoid muscle (SCM), absence of head tremor,lack of sensory trick, and head tilt since infancy. Wedescribe 3 patients with persistent CMT, who were suc-cessfully treated with botulinum toxin injections with longlasting benefit. � 2010 Movement Disorder Society

Key words: congenital muscular torticollis; torticollis;cervical dystonia; botulinum toxin; treatment

Congenital muscular torticollis (CMT) is the third

most common congenital musculoskeletal anomaly af-

ter dislocation of the hip and clubfoot with a preva-

lence between 0.3% and 2% of live births.1,2 The exact

pathophysiological mechanism of CMT is unknown

but involves shortening and fibrosis of the sternocleiod-

mastoid muscle (SCM) resulting in head tilt toward the

affected side and head rotation towards the unaffected

side.3 This condition is usually recognized and success-

fully treated in infancy, but cases may persist in adult-

hood, particularly if not treated. If the torticollis is not

corrected early, facial asymmetry develops in a major-

ity of patients. While there is abundant literature

*Correspondence to: Manon Bouchard, 3350 Hospital Drive NW,Movement Disorders Clinic, Calgary, AB T2N4Z5, Canada.E-mail: [email protected] conflict of interest: Nothing to report.Received 7 April 2010; Revised 11 May 2010; Accepted 5 July


com). DOI: 10.1002/mds.23371

2453CONGENITAL MUSCULAR TORTICOLLIS


addressing the management of CMT in childhood, the

best treatment for adult-persistent CMT is uncertain.

CASE REPORTS

Case 1

A 39-year-old woman sought medical attention 3.5

years after a car accident which resulted in severe

headaches, neck stiffness, and pain in the shoulders

and low back. Over time, the pain subsided but neck

stiffness persisted. The patient noticed prominence of

the left SCM, limitation in neck movements, and ele-

vation of her left shoulder. In retrospect, the patient

admitted that she noted similar but less prominent

problems prior to the accident. She had also been

known to have abnormal head posture as a child. Past

medical history was unremarkable.

On examination, the left shoulder was elevated, and

the left SCM was cord-like and prominent. There was

limitation in voluntary cervical movements and facial

asymmetry, with the left eye and ear being lower than

the right, and the left eye being smaller (Fig. 1). A di-

agnosis of CMT and associated facial asymmetry with

posttraumatic deterioration was made.

The patient was treated using 25 units of onabotuli-

num toxin A (BoNT-A, Botox) placed just behind the

left SCM, in the levator scapulae muscle. The muscle

was not injected directly because it was thick and cord-

like. The injections were very effective in improving

neck tightness, pain, and cervical range of motion with-

out any side effects. The patient has been receiving regu-

lar injections at the same dose for over 4 years.

Case 2

A 37-year-old woman diagnosed at birth with CMT

was unsuccessfully treated with physiotherapy as a

child and later noticed progressive asymmetry of her

face with development of pain and discomfort in the

posterior neck and right shoulder. Past medical history

was unremarkable.

On examination, the right SCM appeared tight, cord-

like, and fibrotic with abnormal head tilt to the right

and left rotation. Hypertrophy and spasm of the right

trapezius and levator scapulae muscles was noted.

Range of cervical movements was limited. Facial

asymmetry was present, the right side appearing drawn

downwards and atrophied compared to the left side

(Fig. 1).

In this patient, 45 units of BoNT-A (Botox) were

injected in the right trapezius and 10 units in the right

levator scapulae, just behind the fibrotic SCM. The

injections resulted in decreased tightness and better

cervical mobility, lasting for 3 weeks. The patient was

reinjected with an increased dose of 80 units, then 100

units hoping to get a more sustained response.

Case 3

A 15-year-old woman was diagnosed with CMT at 2

months of age and treated with physical therapy for 4

months with minimal improvement. The patient had no

further treatment for CMT until seen by a neurologist

for syncope (most likely vasovagal) and referred to a

movement disorders clinic. Past medical history also

included casting in early childhood for a deviated right

foot. On examination, the patient had a head tilt to the

right with atrophy of the right SCM and tenderness on

palpation of the right splenius capitis. She had no fa-

cial asymmetry.

Initially, the patient was injected with 100 units of

BoNT-A (Botox) in the right splenius capitis and 75

units in the right trapezius (for pain) with complete re-

solution of the abnormal head posture and pain after

the second injection. Over the years, the pattern of

injection changed to 150 units in the right splenius

capitis, 50 units in the right trapezius, and 25 units in

the right SCM. She has received regular BoNT-A treat-

ments for 8 years, with sustained benefit.

DISCUSSION

The word torticollis is derived from a latin root

meaning twisted neck. Most cases of torticollis are

related to dystonia (primary or secondary) in adults

and CMT in infants. A variety of other neurological

pathologies can result in torticollis, such as posterior

FIG. 1. Facial asymmetry was present on the left face for Patient 1(left) and on the right face for Patient 2 (right). [Color figure can beviewed in the online issue, which is available at wileyonlinelibrary.com.]

2454 M. BOUCHARD ET AL.


fossa or cervical spine tumors, syringomyelia, and

obstetrical brachial plexus palsies. Torticollis may also

result from anomalies of upper cervical spine or cra-

niocervical junction such as Arnold-Chiari malforma-

tion, rotatory cervical instability, C1–C2 subluxation,

hemiatlas, scoliosis, and Klippel-Feil syndrome. Cer-

tain infectious processes have been reported to cause

abnormal head posture such as parapharyngeal abcess,

Grisel’s syndrome, or spondylodiscitis. Other causes

include ocular conditions (eye muscle weakness or

nystagmus), hearing deficit, Sandifer syndrome,

trauma, and radiation therapy.1,2,4,5

CMT is a common finding in the newborn period

with a reported prevalence up to 2%.2 The pathophysi-

ology of this condition is still unclear. The most popu-

lar hypothesis involves the occurrence of compartment

syndrome either from venous compression of the neck

at birth or from injury to the muscle in utero. This hy-

pothesis is supported by histological specimens show-

ing edema, degeneration of muscle fibers, and diffuse

fibrosis of the SCM, consistent with vascular compro-

mise.2 Other causes that have been suggested to

explain the shortening of the SCM include intrauterine

crowding and malposition, fibrosis from peripartum

bleed, and primary myopathy of the SCM.2 Magnetic

resonance imaging of the neck shows muscle atrophy

and interstitial fibrosis in about one third of cases.2

If CMT is not corrected early, mild to severe facial

asymmetry develops in 88% to 100% of subjects, usu-

ally starting after 5 years of age.4,6–8 Facial abnormal-

ities can include posterior recession of both the zy-

goma and the forehead, posterior and inferior displace-

ment of the ear, inferior displacement of the orbit with

reduced palpebral aperture, and mandibular shortening

on one side resulting in dental malocclusion.4,9 The

craniofacial structures involved in the asymmetry are

those to which either the SCM or the investing layer

of deep cervical fascia are attached, suggesting that

fascial contraction is responsible for craniofacial distor-

sion.9 Another possible explanation for the facial

asymmetry would be positional moulding of open cra-

nial sutures arising from the head tilt.9

Up to 95% of CMT resolve completely within the

first year of life either spontaneously, with physiotherapy

or gentle controlled passive manual stretching exer-

cises.10 It has been recommended that children who do

not respond to physiotherapy should be considered can-

didates for BoNT-A injections as adjunctive therapy to

reduce pain and muscle spasm and improve long-term

outcome.7,11,12 Surgery is usually recommended to

improve cervical range of motion and prevent or reverse

facial asymmetry in children with persistent limitation

of cervical movements after 6 months of manual stretch-

ing or when they are older than one year of age.10,11

Although CMT is the most common cause of torti-

collis in infancy, very few cases persist in adulthood

because of successful early treatment. In adults, CMT

must be differentiated from the more common idio-

pathic cervical dystonia. Apart from facial asymmetry

and history of head tilt since infancy, other features

evident in CMT and usually absent in idiopathic cervi-

cal dystonia include presence of a cord-like SCM, ab-

sence of head tremor, lack of sensory trick, and the

constant nature of the abnormal head posture.7

Treatment for CMT persisting in adulthood is not

clear. We found a single case series in the literature

describing 6 adult patients with persisting CMT, who

were treated with BoNT-A injections. Two of the 6

patients had moderate improvement in range of

motion, and the remaining patients did not have signifi-

cant improvement.7 All our patients reported good

improvement in neck pain, tightness, and cervical mo-

bility with BoNT-A injections. Since two of our

patients had spasm or tenderness in neck muscles other

than the SCM, we hypothesize the effectiveness of

BoNT-A in CMT may be explained by improvement

in associated musculoskeletal factors. In case 1, this

was likely aggravated by the motor vehicle accident.

We feel confident that our patients had CMT (and not

idiopathic cervical dystonia) despite not having con-

firmed the diagnosis with cervical MRI or needle EMG

given the presence of head tilt since infancy, cord-like

SCM (2 patients), and facial asymmetry (2 patients).

Although surgical treatment has been shown to be

most effective in childhood,4 adult cases not responsive

to botulinum toxin can also benefit from surgery. In a

recent study, 14 adult patients with neglected CMT

had surgical bipolar sectioning of the SCM and 86%

had excellent or good results with regards to cervical

range of motion. Two of the patients even had some

improvement of the facial asymmetry.3 Another group

reported improvement in neck movements in all adult

patients following open SCM tenotomy, but no

improvement in facial asymmetry.13

CONCLUSIONS

Although typically successfully treated in childhood,

CMT can persist in adulthood and must be differenti-

ated from idiopathic cervical dystonia or other causes

of torticollis. In CMT patients presenting in adulthood,

botulinum toxin injections should be tried before con-

sidering surgical treatment.

2455CONGENITAL MUSCULAR TORTICOLLIS


Financial Disclosures: Manon Bouchard: Speaker

for Allergan. Oksana Suchowerky: Advisory board for

Teva and Allergan. Sylvain Chouinard: Advisory board

or consultant for Teva, Novartis, Allergan, Merz, Bio-

vail.

Author Roles: Bouchard: manuscript: writing of the

first draft. Chouinard: manuscript: review and critique.

Suchowersky: manuscript: review and critique.

REFERENCES

1. Peyrou P, Moulies D. Torticollis in children: diagnosticapproach. Arch Pediatr 2007;14:1264–1270.

2. Do TT. Congenital muscular torticollis: current concepts andreview of treatment. Curr Opin Pediatr 2006;18:26–29.

3. Omidi-Kashani F, Hasankhani EG, Sharifi R, Mazlumi M. Is sur-gery recommended in adults with neglected congenital musculartorticollis? A prospective study. BMC Musculoskelet Disord2008;9:158.

4. Hollier L, Kim J, Grayson BH, McCarthy JG. Congenital muscu-lar torticollis and the associated craniofacial changes. PlastReconstr Surg 2000;105:827–835.

5. Ballock RT, Song KM. The prevalence of nonmuscular causes oftorticollis in children. J Pediatr Orthop 1996;16:500–504.

6. Cheng JC, Tang SP, Chen TM, Wong MW, Wong EM. The clin-ical presentation and outcome of treatment of congenital muscu-lar torticollis in infants—a study of 1,086 cases. J Pediatr Surg2000;35:1091–1096.

7. Collins A, Jankovic J. Botulinum toxin injection for congenitalmuscular torticollis presenting in children and adults. Neurology2006;67:1083–1085.

8. Yu CC, Wong FH, Lo LJ, Chen YR. Craniofacial deformity inpatients with uncorrected congenital muscular torticollis: anassessment from three-dimensional computed tomography imag-ing. Plast Reconstr Surg 2004;113:24–33.

9. Chate RA. Facial scoliosis from sternocleidomastoid torticollis:long-term postoperative evaluation. Br J Oral Maxillofac Surg2005;43:428–434.

10. Cheng JC, Wong MW, Tang SP, Chen TM, Shum SL, WongEM. Clinical determinants of the outcome of manual stretchingin the treatment of congenital muscular torticollis in infants. Aprospective study of eight hundred and twenty-one cases. J BoneJoint Surg (Am) 2001;83:679–687.

11. Oleszek JL, Chang N, Apkon SD, Wilson PE. Botulinum toxintype A in the treatment of children with congenital muscular tor-ticollis. Am J Phys Med Rehabil 2005;84:813–816.

12. De Chalain TMB, Park S. Torticollis associated with positional pla-giocephaly: a growing epidemic. J Craniofac Surg 2005;16:411–418.

13. Ippolito E, Tudisco C. Idiopathic muscular torticollis in adults:results of open sternocleidomastoid tenotomy. Arch OrthopTrauma Surg 1986;105(I):49–54.

Fatigue in Parkinson’s Disease:Prevalence and Associated Factors

Antoine G. Beiske, MD, PhD,1*Jon Havard Loge, MD, PhD,2,3

Marianne J. Hjermstad, PhD,4,5

and Elisabeth Svensson, PhD6

1Department of Neurology, Akershus University Hospital,Norway; 2Department of Oncology, National Resource

Centre for Late Effects, Oslo University Hospital Montebello,Norway; 3Department of Behavioural Sciences in Medicine,University of Oslo, Norway; 4Department of Oncology,Regional Centre for Excellence in Palliative Care, Oslo

University Hospital, Ulleval, Norway;5Department of Cancer Research and Molecular Medicine,Faculty of Medicine, Norwegian University of Science andTechnology, Norway; 6Department of Adult Mental Health,Division of Mental Health, Norwegian Institute of Public

Health, Norway

Abstract: The purpose of this study was to examine theprevalence of fatigue in Parkinson’s disease (PD) patientsand compare this to the general population. Factors asso-ciated with fatigue were investigated by linear regression.Fatigue was assessed by the fatigue questionnaire. Themean age of the 176 PD patients (41% women) was 69years (range 35–90), and the mean UPDRSIII was 22.3(SD 11.7). Fatigue levels (means) were significantly higherin PD patients compared with the general population;however, effect sizes were moderate for women for physi-cal and total fatigue indicating clinically significant differ-ences here only. Only female PD patients had morechronic fatigue than the general population. Fatigue wasrelated to characteristics of PD but also to sleep disturb-ance, depression, and gender. This population-based studydemonstrates that fatigue is a common symptom in PDpatients, but compared with the general population, clini-cally significant differences were only found for femalePD patients. � 2010 Movement Disorder Society

Key words: fatigue; Parkinson; prevalence; Norway;chronic fatigue; associated factors; population based

*Correspondence to: A.G. Beiske, Department of Neurology, Aker-shus University Hospital, N-1478 Lørenskog, Norway.E-mai: [email protected] conflict of interest: Nothing to report.Received 4 March 2010; Revised 13 April 2010; Accepted 5 July


com). DOI: 10.1002/mds.23372


2456 A.G. BEISKE ET AL.

Fatigue is a common symptom in most chronic disor-

ders; in the past two decades, several studies have exam-

ined fatigue in Parkinson’s disease (PD) patients

(reviewed in Ref. 1). Previous studies have reported

prevalence of fatigue from 37 to 58%,2–7 but the samples

have often been small and hospital-based convenience

samples. The wide range is probably due to varying defi-

nitions of fatigue and different measurement methods.8

There is no universally accepted definition of fatigue.

In this study, three dimensions of fatigue: physical, men-

tal, and chronic fatigue are investigated. Physical fatigue

is the subjective feeling of being exhausted and lacking

energy, whereas mental fatigue measures the subjective

feelings of having impaired concentration, reduced mem-

ory, and speech difficulties. Chronic fatigue is defined as

having elevated levels of fatigue lasting for a minimum of

6 months.9 The concept of chronic fatigue is particularly

useful in patient populations with relatively stable dis-

eases because it helps to separate acute and transient fa-

tigue from fatigue that is stable over time.

Fatigue is a common phenomenon in the general

population, amongst the elderly and ill, thus it is im-

portant to compare levels of fatigue in a PD population

with the general population. To our knowledge, the

only population-based study investigating this found a

significant higher prevalence of fatigue than in the gen-

eral population.2

Previous studies have examined fatigue and its associ-

ated factors in PD patients (reviewed in Ref. 1), many

focusing on depression. However, there is still a need for

studies investigating the relationship of fatigue to other

characteristics of PD, such as onset of motor symptoms

and its correlation with other comorbidities.1

The purpose of this study was to examine physical,

mental, and chronic fatigue in PD patients in compari-

son with the general population. Associated factors

with fatigue in PD patients were also investigated.

MATERIAL AND METHODS

Material

All PD patients living in the eastern part of Aker-

shus county, Norway (320,000 inhabitants) were

defined as the target population. Detailed information

about the inclusion has been published previously (see

Ref. 10). In total, 176 eligible patients were included

consecutively until the end of the inclusion period,

yielding a response rate of 87% (176 of 202).

Methods

Medical variables were collected in a structured

interview and a clinical examination. Staging of dis-

ease was performed in accordance with present stand-

ards [Modified Hoehn and Yahr Staging,11 Unified Par-

kinson’s Disease Rating Scale (UPDRS)12]. Cognitive

functioning was assessed by the mini-mental state ex-

amination.13 All patients suffering from motor fluctua-

tions were examined during the on-period.

Patients were asked to fill in a self-report question-

naire, which assessed demographic status, fatigue [the

fatigue questionnaire (FQ)14], sleep disturbances [Par-

kinson’s Disease Sleep Scale (PDSS)15], and symptoms

of anxiety and depression (MH-Short Form-3616,17).

The patients were also asked whether they had any so-

matic comorbidity.

Fatigue was assessed by the Norwegian version of

the FQ.18 The FQ is a self-report questionnaire, devel-

oped to measure physical (7 items) and mental fatigue

(4 items). The sum score of responses to all 11 items

is designated as total fatigue, with minimum/maximum

scores of 0/33. All items in the FQ were also scored

on a dichotomized scale based on the four response

categories (0 5 better or no more than usual and 1 5worse or much worse than usual), defining chronic

fatigue as scores of ‡4, with symptoms lasting for

6 months or longer. The FQ has demonstrated good

face and discriminant validity and good and stable psy-

chometric properties across populations.14 Reference

data on fatigue levels from the Norwegian general pop-

ulation exists.18

The study was approved by the Regional Committee

for Medical Research Ethics. Informed consent was

obtained from all respondents.

STATISTICAL METHODS

Descriptive statistics for fatigue, clinical, and demo-

graphic variables were calculated. The effect size,

Cohen’s d, was calculated (using http://www.uccs.edu/

�faculty/lbecker/) and deemed small if under 0.5, me-

dium if between 0.5 and 0.8, and large if over 0.8.19

A stepwise linear regression was conducted to assess

factors associated with fatigue; block one including de-

mographic factors (age and gender), block two adding

disease characteristics (disease duration and UPDRS),

and block three adding other possible explanatory fac-

tors (sleep disturbance, symptoms of anxiety and

depression, and comorbidity). A significance level of

0.05 was chosen.

Analyses were performed using STATA version 8.

RESULTS

Of the 176 patients examined with a mean age of 60

years (SD 8.8, range 35–90), 41% were women. The

2457FATIGUE IN PARKINSON’S PATIENTS


mean UPDRSIII was 22.3 (SD 11.3), and the mean

disease duration was 7.5 years (SD 5.3). The mean

mental health SF-36 score was 72.3 (SD 18.8), and the

mean PDSS score was 102.8 (SD 23.3). Comorbidities

reported by the PD patients were: cardiovascular dis-

eases: 18%, diabetes mellitus type II: 6%, and other

comorbidities (including cancer, respiratory problems,

and musculoskeletal problems): 16%. All patients were

on antiparkinsonian drugs. In addition, 8.5% were on

antidepressants/anticonvulsant treatment.10

The levels of physical, mental, and total fatigue are

shown in Table 1, together with the comparative levels

for the Norwegian general population aged 60 to 80

years.18 All levels of fatigue were significantly higher

in the PD patients compared with the general popula-

tion when comparing differences in means. However,

statistically significant differences are less important if

they occur in a scale with large range of values and a

large SD. The magnitude of the score differences were

moderate (Cohen’s d >0.5, <0.8) for women on physi-

cal and total fatigue, the remainder were small (<0.5).

The prevalence of chronic fatigue was 33% for

women and 22% for men, overall 28% (Table 1). The

corresponding figures from the general population aged

60 to 80 years are 22, 17, and 19%, respectively.18

There was a significantly higher proportion of women

with chronic fatigue (P < 0.05) in the PD population

compared with the general population over 60 years.

The factors associated with total fatigue are shown

in Table 2. Gender, UPDRS score, symptoms of anxi-

ety and depression (MH-SF36), and sleep disturbances

(PDSS) were all predicting total fatigue (Adjusted R2

for the final model 0.28).

DISCUSSION

Compared to the general population, the prevalence

of chronic fatigue is 50% higher among women and

30% higher among men, but yielding statistical signifi-

cance for women only. However, this does not make

fatigue a less important problem in PD patients, as it

just points to fatigue being an important problem in

the general population as well, with mechanisms that

may be common across disorders.3

Fatigue is a subjective problem, thus the patients’

own perception of what they are experiencing is of pri-

mary interest. There is no ‘‘gold standard’’ for fatigue

assessment and objective assessment methods are not

available. Thus, it is possible that different measure-

ments could yield different prevalence estimates and

measure different aspects of fatigue. This is illustrated

by a comparison of the Fatigue Severity Scale and the

Functional Assessment of Chronic Illness Therapy-Fa-

tigue Scale, concluding that they do not appear to mea-

sure identical aspects of fatigue.20 The dimensionality

of fatigue in general is not clearly established. How-

ever, mental and physical fatigue seems to be included

in most fatigue instruments and they are repeatedly

demonstrated as two separate dimensions of fatigue.21

Strengths of this study are that it is population

based, and that the results from the PD patients are

compared with general population scores. In Norway,

the prevalence of PD is about 111 per 100.000 inhabi-

tants,22 suggesting about 355 patients in our recruit-

ment area. Thus, our initial population of 345 was

probably close to all cases in the catchment area. The

normative data for fatigue are from the general popula-

tion, thus, the findings are generalizable to the Norwe-

gian population. A limitation of the generalizability is

that the study does not address fatigue in PD patients

with dementia or in patients otherwise unable to utilize

self-report instruments for data collection.

Our results are somewhat in agreement with previous

studies examining associated factors with fatigue by dif-

ferent questionnaires, such as for depression and degree

of the disease (UPDRS).3,4,23 However, for two factors,

our study are not in accordance with previous studies,

TABLE 1. Total fatigue, physical fatigue, mental fatigue, and chronic fatigue cases by genderin Parkinson patients and the general population over 60 years of agea

Women Men

Fatigue PD (n 5 72)

Generalpopulation17

(n 5 263) Cohen’s dPD

(n 5 104)

Generalpopulation17

(n 5 238) Cohen’s d

Physical 11.1 (3.9) 9.0 (3.5) 0.57 9.9 (3.2) 8.4 (3.2) 0.47Mental 5.1 (1.8) 4.4 (1.4) 0.43 5.0 (1.7) 4.5 (1.2) 0.33Total 16.4 (5.0) 13.4 (4.2) 0.65 14.9 (5.0) 12.9 (3.8) 0.45Chronic fatigue 33.3* 21.7 22.1 16.8

aData expressed as mean (SD). Chronic fatigue cases expressed as percent of columns total.*Significant P < 0.05.



namely sleep and gender.2,4,24 Sleep disturbance, as meas-

ured by a PD-specific scale, was significantly associated

with fatigue, as also found by Okuma et al.25 The PDSS

systematically addresses and quantifies the different

aspects of sleep disturbance in PD,15 probably capturing

the importance of disease-specific sleep disturbance asso-

ciated with fatigue not captured by general sleep quality

questionnaires. Few studies have reported the relationship

to gender.1 Here, an association between gender and fa-

tigue in PD patients was found. Women in general do

report higher levels of fatigue in the general population.18

These issues need to be further investigated.

The treatment of fatigue is still a challenge, and a li-

mitation of this study is that there was only informa-

tion about antidepressant/anticonvulsant therapy. How-

ever, documented treatment alternatives are scarce.

Levodopa is shown to reduce both central and periph-

eral fatigue26 and a randomized, controlled study found

methylphenidate to be effective.27 As sleep dysfunction

and symptoms of depression are associated with higher

levels of fatigue, it is important to treat these symp-

toms. Treatment of depression may, for example, lead

to improvement in both mental and physical dimen-

sions of fatigue.28 The benefits of exercise as treatment

for fatigue in medical conditions may extend to PD

patients as well.29 However, sufficient exercise to

make a difference for fatigue may be difficult to obtain

for patients with severe motor dysfunction.

Acknowledgments: We give special thanks to ProfessorKjell Magne Tveit at the Department of Oncology, Oslo Uni-versity Hospital, Ulleval and Vibeke Schou Jensen at OsloUniversity Hospital, Ulleval, Norway and Anne Rønningenfor their support of the study. We also wish to acknowledgethe patients who participated in the study. The work was sup-ported by a grant from Oslo University Hospital, Uleval,Norway, which made the carrying out of the study possible.

Financial Disclosures: None.

Author Roles: A.G. Beiske: research project: conception,organization, and execution; statistical analysis: review andcritique; manuscript: writing of the first draft, review and cri-tique. J.H. Loge: research project: conception; statistical anal-ysis: design, review and critique; manuscript: review and cri-tique. M.J. Hjermstad: statistical analysis: design, review andcritique; manuscript: review and critique. E. Svensson: statis-tical analysis: design and execution; manuscript: writing ofthe first draft, review and critique.

REFERENCES

1. Friedman JH, Brown RG, Comella C, et al. Fatigue in Parkin-son’s disease: a review. Mov Disord 2007;22:297–308.

2. Karlsen K, Larsen JP, Tandberg E, Jorgensen K. Fatigue inpatients with Parkinson’s disease. Mov Disord 1999;14:237–241.

3. Hagell P, Brundin L. Towards an understanding of fatigue in Par-kinson disease. J Neurol Neurosurg Psychiatry 2009;80:489–492.

4. Shulman LM, Taback RL, Bean J, Weiner WJ. Comorbidity ofthe nonmotor symptoms of Parkinson’s disease. Mov Disord2001;16:507–510.

5. Alves G, Wentzel-Larsen T, Larsen JP. Is fatigue an independentand persistent symptom in patients with Parkinson disease? Neu-rology 2004;63:1908–1911.

6. Schifitto G, Friedman JH, Oakes D, et al. Fatigue in levodopa-na-ive subjects with Parkinson disease. Neurology 2008;71:481–485.

7. Barone P, Antonini A, Colosimo C, et al. The PRIAMO study: amulticenter assessment of nonmotor symptoms and their impacton quality of life in Parkinson’s disease. Mov Disord2009;24:1641–1649.

8. Friedman JH, Alves G, Hagell P, et al. Fatigue rating scales cri-tique and recommendations by the Movement Disorders Societytask force on rating scales for Parkinson’s disease. Mov Disord2010;25:805–822.

9. Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komar-off A. The chronic fatigue syndrome: a comprehensive approachto its definition and study. International Chronic Fatigue Syn-drome Study Group. Ann Intern Med 1994;121:953–959.

10. Beiske AG, Loge JH, Ronningen A, Svensson E. Pain in Parkin-son’s disease: prevalence and characteristics. Pain 2009;141:173–177.

11. Hoehn MM, Yahr MD. Parkinsonism: onset, progression andmortality. Neurology 1967;17:427–442.

12. Fahn S, Elton RL. Members of the UPDRS Development Com-mittee: unified Parkinson’s disease rating scale. In: Fahn S, Mars-den CD, Calne DB, Lieberman A, editors. Recent developmentsin Parkinson’s disease. Florham Park: MacMillan Health Care In-formation; 1987. p 153–163.

13. Folstein MF, Folstein SE, McHugh PR. ‘‘Mini-mental state’’. Apractical method for grading the cognitive state of patients forthe clinician. J Psychiatr Res 1975;12:189–198.

14. Chalder T, Berelowitz G, Pawlikowska T, et al. Development ofa fatigue scale. J Psychosom Res 1993;37:147–153.

15. Chaudhuri KR, Pal S, DiMarco A, et al. The Parkinson’s diseasesleep scale: a new instrument for assessing sleep and nocturnaldisability in Parkinson’s disease. J Neurol Neurosurg Psychiatry2002;73:629–635.

16. McHorney CA, Ware JE, Jr, Raczek AE. The MOS 36-ItemShort-Form Health Survey (SF-36): II. Psychometric and clinicaltests of validity in measuring physical and mental health con-structs. Med Care 1993;31:247–263.

17. Ware JE, Jr, Gandek B, the IQOLA project group. The SF-361

Health Survey: development and use in mental health researchand the IQOLA Project. Int J Mental Health 1994;23:49–73.

TABLE 2. Demographic and clinical factors associated withtotal fatigue in 176 Norwegian PD patients

Variable

Block one Block two Block three

Beta P-value Beta P-value Beta P-value

Age (yr) 0.015 0.36 20.019 0.63 0.006 0.87Gender 1.46 0.049 1.9 0.007 1.41 0.04Disease duration (yr) 0.096 0.157 0.07 0.27UPDRS 0.119 <0.001 0.07 0.02Mental health (SF-36) 20.07 <0.001Sleep disturbance

(PDSS)20.05 0.002

ComorbiditiesCardiovascular 20.92 0.29Diabetes mellitus 21.76 0.048Other 0.31 0.81


2459FATIGUE IN PARKINSON’S PATIENTS

18. Loge JH, Ekeberg O, Kaasa S. Fatigue in the general Norwegianpopulation: normative data and associations. J Psychosom Res1998;45(1 Spec No):53–65.

19. Cohen J. A power primer. Psychol Bull 1992;112:155–159.20. Hagell P, Hoglund A, Reimer J, et al. Measuring fatigue in

Parkinson’s disease: a psychometric study of two brief genericfatigue questionnaires. J Pain Symptom Manage 2006;32:420–432.

21. Lou JS, Kearns G, Oken B, Sexton G, Nutt J. Exacerbated physi-cal fatigue and mental fatigue in Parkinson’s disease. Mov Dis-ord 2001;16:190–196.

22. Tandberg E, Larsen JP, Nessler EG, Riise T, Aarli JA. The epi-demiology of Parkinson’s disease in the county of Rogaland,Norway. Mov Disord 1995;10:541–549.

23. Herlofson K, Larsen JP. Measuring fatigue in patients with Par-kinson’s disease—the Fatigue Severity Scale. Eur J Neurol2002;9:595–600.

24. Havlikova E, van Dijk JP, Rosenberger J, et al. Fatigue in Par-kinson’s disease is not related to excessive sleepiness or qualityof sleep. J Neurol Sci 2008;270:107–113.

25. Okuma Y, Kamei S, Morita A, et al. Fatigue in Japanese patientswith Parkinson’s disease: a study using Parkinson fatigue scale.Mov Disord 2009;24:1977–1983.

26. Lou JS, Kearns G, Benice T, Oken B, Sexton G, Nutt J. Levodopaimproves physical fatigue in Parkinson’s disease: a double-blind, pla-cebo-controlled, crossover study. Mov Disord 2003;18: 1108–1114.

27. Mendonca DA, Menezes K, Jog MS. Methylphenidate improvesfatigue scores in Parkinson disease: a randomized controlled trial.Mov Disord 2007;22:2070–2076.

28. Havlikova E, Rosenberger J, Nagyova I, et al. Clinical and psy-chosocial factors associated with fatigue in patients with Parkin-son’s disease. Parkinsonism Relat Disord 2008;14:187–192.

29. Friedman JH, Chou KL. Sleep and fatigue in Parkinson’s disease.Parkinsonism Relat Disord 2004;10(Suppl 1):S27–S35.



Parkinson's Disease and pathological gambling: Results from a functional MRI study

Documents

Transcript of Parkinson's Disease and pathological gambling: Results from a functional MRI study