Oxidative Stress Modulates DNA Methylation during MelanocyteAnchorage Blockade Associated with Malignant Transformation1

Ana C. E. Campos*,2, Fernanda Molognoni*,2, Fabiana H. M. Melo*, Luciano C. Galdieri y, Celia R. W. Carneiro*,Vania D’Almeida y, Mariangela Correa* and Miriam G. Jasiulionis*,z

*Departamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de Sao Paulo – UNIFESP,Sao Paulo, SP, Brazil; yDepartamento de Ciencias da Saude, Universidade Federal de Sao Paulo – UNIFESP,Sao Paulo, SP, Brazil; zDepartamento de Farmacologia, Universidade Federal de Sao Paulo – UNIFESP,Sao Paulo, SP, Brazil

Abstract

Both oxidative/nitrosative stress and alterations in DNA

methylation are observed during carcinogenesis of dif-

ferent tumor types, but no clear correlation between

these events has been demonstrated until now. Mela-

noma cell lines were previously established after sub-

mitting the nontumorigenicmelanocyte lineage, melan-a,

to cycles of anchorage blockade. In this work, increased

intracellular oxidative species and nitric oxide levels, as

well as alterations in the DNA methylation, were ob-

served after melan-a detachment, which were also as-

sociated with a decrease in intracellular homocysteine

(Hcy), an element in the methionine (universal methyl

donor) cycle. This alteration was accompanied by

increase in glutathione (GSH) levels and methylated

DNA content. Furthermore, a significant increase in

dnmt1 and 3b expression was identified along melan-a

anchorage blockade. LG-Nitro-L-arginine methyl esther

(L-NAME), known as a nitric oxide synthase (NOS) in-

hibitor, and N-acetyl-L-cysteine (NAC) prevented the

increase in global DNA methylation, as well as the in-

crease in dnmt1 and 3b expression, observed during

melan-a detachment. Interestingly, both L-NAME and

NAC did not inhibit nitric oxide (NO) production in these

cells, but abrogated superoxide anion production during

anchorage blockade. In conclusion, oxidative stress ob-

served during melanocyte anchorage blockade seems

to modulate DNA methylation levels and may directly

contribute to the acquisition of an anoikis-resistant phe-

notype through an epigenetic mechanism.

Neoplasia (2007) 9, 1111–1121

Keywords: Anoikis, carcinogenesis, epigenetics, DNA methylation, oxida-tive stress.

Introduction

The interaction between cells and their surrounding extra-

cellular matrix is a major determinant of cell behavior by

modulating gene expression, cell growth, differentiation,

migration, and overall tissue architecture. Cell survival also

depends on anchorage to extracellular matrix and on cell–

cell contacts. Apoptosis induced by loss of appropriate

cell–matrix contact has been termed anoikis and plays an

essential role in regulating homeostasis, as it maintains the

correct cell number of high turnover tissues [1,2]. An important

feature of transformed cells is loss of anchorage-dependent

growth control, leading to increased survival time and facili-

tating an eventual reattachment. Thus, the ability of escaping

anoikis regulation is a critical step in oncogenesis [3].

Reduced substrate adhesion or lack of growth factors

represent adverse conditions that confer a dramatic rise in

cellular stress, characterized by damage to various cellular

constituents such as DNA, protein, and lipids that ultimately

triggers death signals [4,5]. Low or subtoxic levels of reactive

oxygen species (ROS) can act as potent second messengers

in signal transduction pathways that regulate cell growth and

transformation [6,7]. High levels of ROS have been considered

direct DNA-damaging agents that increase the mutation rate

and promote and maintain the oncogenic phenotype [8–10].

Neither superoxide (O2.�) nor hydrogen peroxide (H2O2) are

particularly toxic, but cells can greatly increase the toxicity of

superoxide by producing nitric oxide (NO) that may function as

an antiapoptotic or proapoptotic agent depending on concen-

tration and cell type [11]. Superoxide anion and NO react to

produce peroxynitrite (ONOO�) that can readily modify pro-

teins and other molecules [12]. In addition to causing genetic

changes, ROS may lead to epigenetic alterations that strongly

affect gene expression without changing the DNA base se-

quence [13–15].

Epigenetic changes, including alterations in DNA methyla-

tion status, have been implicated with malignant transformation

Abbreviations: ADMA, asymmetric dimethylarginine; DAF-2DA, diaminofluorescein-2 diace-

tate; DHE, dihydroethidium; Dnmt, DNA methyltransferase; GSH, glutathione; Hcy, homo-

cysteine; L-NAME, LG-nitro-L-arginine methyl esther; MTT, methyl thiazol tetrazolium; NAC,

N-acetyl-L-cysteine; NO, nitric oxide; NOS, nitric oxide synthase; PCR, polymerase chain reac-

tion; ROS, reactive oxygen species; SAM, S-adenosylmethionine; SAH, S-adenosylhomocysteine

Address all correspondence to: Miriam G. Jasiulionis, Departamento de Farmacologia, Univer-

sidade Federal de Sao Paulo – UNIFESP, Rua Botucatu, 862 4j andar, 04023-900, Sao Paulo,

SP, Brazil. E-mail: miriamleon@ecb.epm.br1This work was supported by Fundacao de Amparo a Pesquisa do Estado de Sao Paulo

(FAPESP; grants 02/06935-7 and 06/61293-1 to M.G.J. and 97/0184-7 to V.A.) and

by Coordenacao de Aperfeicoamento de Pessoal de Nıvel Superior (CAPES; grant

33009015003P3 to M.G.J.).2These authors share first authorship.

Received 8 August 2007; Revised 2 October 2007; Accepted 3 October 2007.

Copyright D 2007 Neoplasia Press, Inc. All rights reserved 1522-8002/07/$25.00

DOI 10.1593/neo.07712

Neoplasia . Vol. 9, No. 12, December 2007, pp. 1111 –1121 1111

www.neoplasia.com

RESEARCH ARTICLE

and progression of numerous tumor types. The addition of

methyl (CH3) radicals to the cytosine nucleotide is catalyzed

in mammals mainly by three different DNA methyltrans-

ferases (Dnmt), namely DNMT 1, 3a, and 3b. DNMT3 group

comprises two enzymes with catalytic activity (DNMT 3a and

3b) and DNMT 3L, which has a regulatory role [16,17].

Neoplastic cells present simultaneously regional DNA

hypermethylation and global hypomethylation. Hypermethyl-

ation of promoter regions is associated with tumor sup-

pressor gene silencing by interfering with the binding of

transcription factors or by recruiting corepressor complexes

containing, for example, histone deacetylases. Global DNA

hypomethylation can result in oncogene expression, ge-

nomic instability, and loss of imprinting. Alterations in meth-

ylation patterns can thus determine the gene expression

profile, which is crucial for comprehension of carcinogen-

esis [18–20].

Recently, an in vitro transformation model of murine

melanocytes has been developed in our laboratory, after

submitting a nontumorigenic melanocyte lineage, melan-a,

to sequential cycles of anchorage blockade [21,22]. The aim

of the present study was to determine whether anchorage

blockade results in altered ROS and/or NO levels, and the

resulting effect on DNA methylation, which may contribute to

melanocyte malignant transformation.

Materials and Methods

Cell Culture

Murine nontumorigenic melanocyte lineage melan-a [23],

a kind gift from Dr. Michel Rabinovitch (Discipline of Parasi-

tology, Universidade Federal de Sao Paulo – UNIFESP),

was maintained in RPMI 1640 (Gibco, Carlsbad, CA), pH 6.9,

containing 5% fetal bovine serum (Gibco), 40 mg/l gentami-

cin, and 200 nM phorbol 12-myristate 13-acetate (Sigma, St.

Louis, MO) at 37jC in 5% CO2. For anchorage blockade

assays, adherent melan-a cells were removed from plates

by trypsin treatment (D0) and plated (105 cells/ml) on 1%

agarose-coated dishes for 1 to 24 hours (D1h to D24h) in the

conditions described above. In these conditions, melan-a

cells do not adhere to the plastic and remain viable in sus-

pension for at least 24 hours, as demonstrated by the Trypan

blue exclusion assay (data not shown).

Measurement of Superoxide Anion (O2.�) by Flow Cytometry

Relative concentrations of intracellular O2.� were deter-

mined as described previously [24]. Control adherent cells

(D0) and cells submitted to anchorage blockade for different

periods of time (D1h, D3h, D5h, and D24h) were assayed

for O2.� detection using dihydroethidium (DHE; Molecular

Probes, Carlsbad, CA). Briefly, cells were washed in phos-

phate-buffered saline (PBS) and resuspended in PBS con-

taining 10 mM DHE at 37jC for 30 minutes. After washing,

cells were resuspended in PBS and analyzed (10,000 events

per sample) by flow cytometry (FACScalibur; Becton Dickinson,

San Juan, CA) (excitation wavelength = 480 nm; emission

wavelength = 567 nm).

Glutathione Assay

Total glutathione (GSH) content was measured from cell

lysates obtained during adhesion (D0) and deadhesion con-

ditions (D1h, D5h, and D24h). Cells were mixed with the

same volume of 2 M perchloric acid with 4 mM EDTA. After

pH neutralization with K3PO4 and centrifugation, superna-

tants were collected for reaction with nicotinamide adenine

dinucleotide phosphate (4 mg/ml in 0.5% NaHCO3 buffer),

5,5V-dithiobis(2-nitro-benzoic acid) (1.5 mg/ml in 0.5%

NaHCO3 buffer), and GSH reductase (6 U/ml in 0.1 M

KPO4, pH 7, with 1 mM EDTA). Total GSH levels were

obtained spectrophotometrically at 412 nm [25] and all

determinations were normalized to the protein content [26].

Total GSH contents were expressed as nanomole per milli-

gram of protein.

Nitric Oxide Detection

The fluorescent NO indicator, diaminofluorescein-2 diace-

tate (DAF-2DA), was used to measure intracellular [NO]

[27] in adherent (D0) and suspended cells (D1h, D3h, D5h,

and D24h). DAF-2DA readily enters the cells and it is

hydrolyzed by cytosolic esterases to DAF-2, which is trapped

inside cells. In the presence of NO and oxygen, the relatively

nonfluorescent DAF-2 is converted into the highly green

fluorescent triazole form DAF-2T. Thus, increases in DAF-

2T fluorescence represent elevation of [NO]. Cells were

incubated with DAF-2DA (10 mM) in 0.5 ml of PBS at room

temperature for 30 minutes, rinsed with PBS, and analyzed

by flow cytometry in a FACScan (Becton Dickinson) (excita-

tion wavelength = 495 nm; emission wavelength = 515 nm).

Alternatively, extracellular NO levels were also determined

by a gas-phase chemiluminescence reaction of NO with

ozone using a NO Analyzer (NOA 280; Sievers Instruments,

Inc., Boulder, CO). NO-related species (nitrite, nitrate, S-

nitrosothiols, and so on) are converted to NO in the purge

vessel of the analyzer. The released NO is carried by an inert

gas to the detector where it reacts with ozone to produce a

chemiluminescence signal proportional to the concentration.

A standard curve was established with a set of serial dilutions

(0.1–100 mM) of sodium nitrate. The concentrations of NO

metabolites in the samples were determined by comparing

with the standard curve and expressed as micromole per

liter. Data collection and analysis were performed using the

NOAnalysis software (version 3.21; Sievers) [28].

Lipid Peroxidation Assay

Lipid peroxidation was measured by quantifying thiobarbi-

turic acid-reactive substances, mainly malondialdehyde

(MDA), formed during incubation using the thiobarbiturate–

MDA adduct formation [29]. The product of the reaction

between cell lysates and thiobarbituric acid was measured

spectrophotometrically at 535 nm and values were expressed

as nanomole per milligram of protein.

Homocysteine and Cysteine Quantification

Intracellular homocysteine (Hcy) was measured during

adhesion (D0) and deadhesion conditions (D24h) by high-

1112 Oxidative Stress and DNA Methylation Campos et al.

Neoplasia . Vol. 9, No. 12, 2007

performance liquid chromatography (HPLC) with fluorimet-

ric detection and isocratic elution. This methodology was

adapted from Pfeiffer et al. [30] and it involves three steps,

namely reduction of thiol groups using tris(carboxyethyl)-

phosphine, protein precipitation with trichloroacetic acid,

and derivatization with 7-fluorobenzene-2-oxy-1,3-diazolic-

4-ammonium sulfate. The HPLC system used was a Shimadzu

apparatus with a SIL-10ADvp automatic sample injector and

a RF-10AXL fluorescence detector (Shimadzu, Tokyo, Japan).

Chromatographic separation was performed using a C18

model Shim-pack CLC–ODS column (4.6 � 150 mm2, with

5.0-mm microparticles; Shimadzu). The fluorescence was ana-

lyzed with a detector adjusted for excitation at 385 nm and

emission at 515 nm. Total Hcy and cysteine (Cys) content,

expressed as nanomole per milligram of protein, were calcu-

lated with a calibration curve using known Hcy, Cys, and

cystamine concentrations as the internal standards.

5-Methylcytosine Content

Global DNA methylation was evaluated by staining cells

with a specific monoclonal antibody against 5-methylcytosine

(5-MeC; Oncogene, La Jolla, CA), as previously described

[31]. Cells in adherent (D0) or nonadherent (D1h, D3h, and

D24h) conditions were washed with PBS supplemented with

0.1% Tween 20 and 1% bovine serum albumin (PBS–TB),

fixed with 0.25% paraformaldehyde at 37jC for 10 minutes,

followed by 88% methanol at �20jC for at least 30 minutes.

After washing, cells were treated with 2 N HCl at 37jC for

30 minutes, neutralized with 0.1 M sodium borate (pH 9.0),

and blocked with 10% mouse serum for 20 minutes at 37jC.

Then, cells were incubated with anti–5-MeC antibody at a

final concentration of 1 mg/ml for 45 minutes at 37jC,

followed by incubation with goat anti–mouse IgG conjugated

with fluorescein (Kirkegaard & Perry Laboratories Inc. (KPL),

Gaithersburg, MD) for 30 minutes at 37jC. Finally, cells were

analyzed by flow cytometry in a FACScan. For nitric oxide

synthase (NOS) inhibition and antioxidant assays, adhered

melan-a cells were treated for 18 hours with 1 mM LG-nitro-L-

arginine methyl esther (L-NAME), 5 mM N-acetyl-L-cysteine

(NAC), or 1% dimethylsulphoxide (DMSO), submitted to the

anchorage blockade protocol as described above in the

presence of inhibitors, and analyzed for 5-MeC content.

The NOS inhibitor and antioxidants were used at noncyto-

toxic concentrations, estimated by methyl thiazol tetrazolium

(MTT) assays.

Cytotoxicity Assays

MTT assay was performed to determine noncytotoxic

concentrations of the NO inhibitor L-NAME and the antiox-

idants. Briefly, cells were seeded at a density of 2.5 �105 cells/ml in 96-well plates (in a final volume of 200 ml) in

complete medium and replicates of three. After adhesion,

cells were incubated with various concentrations of L-NAME

(0.5, 1, 2, 4, and 8 mM), NAC (0.5, 1, 5, and 10 mM), cata-

lase (5, 10, 50, and 100 U/ml), peroxidase (10, 50, 100, and

200 U/ml), and DMSO (0.5, 1, and 2%) in serum-free me-

dium. After 24 hours of incubation, 20 ml of MTT (5 mg/ml;

Sigma) was added and incubated for 1 hour at 37jC.

Supernatant was then removed, and 100 ml of isopropanol

was added. Culture plates were incubated for 15 minutes at

room temperature to dissolve MTT crystals. Absorbance

values were determined by an Multiskan MS (Labsystems,

Vantaa, Finland) at a wavelength of 570 nm. Each experi-

ment was repeated twice.

Western Blot Analysis

Protein extracts (50 mg) from adherent (D0) and sus-

pended (D1h, D3h, D5h, and D24h) melan-a cells, treated

or not with the nonspecific NOS inhibitor L-NAME (1 mM),

were submitted to Western blot analysis using rabbit poly-

clonal antibodies against dnmt3b (Abcam, Cambridge, MA)

and dnmt1 (Abcam), followed by incubation with peroxidase-

conjugated anti–rabbit antibody (KPL) and developed using

an enhanced chemiluminescence (ECL) detection reagent

(GE Healthcare, Buckinghamshire, UK).

Reverse Transcription–Polymerase Chain Reaction

Total RNA was extracted from adherent and deadherent

melan-a cells with TRIzol reagent (Invitrogen, Carlsbad, CA),

according to the manufacturer’s instructions. One microgram

of RNA was reverse-transcribed to cDNA with Superscript III

(Invitrogen). The resulting single-strand cDNAs were am-

plified by polymerase chain reaction (PCR) as follows: initial

5 minutes at 94jC, followed by 42 cycles of denaturing at

94jC for 30 seconds, with combined annealing at 56.5jC

for 30 seconds, and extension at 72jC for 60 seconds. The

b-actin mRNA was used to normalize the amounts of RNA

in the cell samples, and the intensities of the resulting PCR

bands were used to calculate the ratio of endothelial NOS

(eNOS)/b-actin intensities. PCR fragment amplification was

confirmed by agarose gel staining with ethidium bromide.

PCR detection of eNOS and actin mRNA was carried out by

using the primers: eNOS F 5V CATGGAAATGTCAGGCCCG

3V; eNOS R 5V TTCCACAGAGAGGATTGTAGC 3V; actin F 5V

CGAGGCCCAGAGCAAGAGAG 3V; actin R 5V AGGAAGA-

GGATGCGGCAGTGG 3V.

Statistical Analysis

GraphPad Prism 3.03 software (San Diego, CA) was used

for statistical analysis. One-way analysis of variance test was

initially performed to analyze sample groups and unpaired t

tests were used to compare suspended cells samples to ad-

herent cells controls. All experiments were performed at least

three times, each one in triplicates, and one representative ex-

periment is shown.

Results

Anchorage Blockade Induces Oxidative and

Nitrosative Stress

Several types of environmental stress induce ROS and

reactive nitrogen species production, but few studies ad-

dress the relationship of forced anchorage impediment and

free radicals levels in melanocytes. To investigate the effect

of anchorage blockade on ROS production, adherent (D0)

Oxidative Stress and DNA Methylation Campos et al. 1113

Neoplasia . Vol. 9, No. 12, 2007

and deadherent melan-a cells (D1h, D3h, D5h, and D24h)

were assayed for intracellular superoxide anion (O2.�). Intra-

cellular O2.� levels, which have been shown to be increased

in human metastatic melanomas compared to normal mela-

nocytes [32], become elevated progressively along melan-a

anchorage blockade. In adherent conditions (D0), 1% of cells

are positive for the O2.� marker, whereas 30% of cells

maintained in suspension for 5 (D5h) to 24 hours (D24h)

showed positivity (Figure 1).

Oxidized and reduced GSH levels are commonly used as

a measurement of intracellular redox state [33], and total

GSH levels were investigated during exposure of melan-a

cells to anchorage blockade. The ratio of intracellular GSH

relative to total protein content was not significantly in-

creased during the first hours in suspension (D1h, P = .064

and D5h, P = .159), when H2O2 levels were maximum (data

not shown), but became elevated in a statistically significant

manner only after 24 hours in detached cells (D24h, P = .020;

Figure 2A), when H2O2 levels returned to concentrations

found in adherent cells (data not shown), suggesting that

increased glutathione levels could be acting in the removal of

excessive H2O2 through reduction.

ROS production has been associated also with that of

NO, whose derivatives (N2O3, NO2�, peroxynitrite, and

others) possess a strong oxidative capacity [34]. We esti-

mated intracellular NO concentration in adherent (D0) and

deadherent (D1h, D8h, and D24h) melan-a (Figures 2B and

4C); NO levels are higher in samples collected from sus-

pended cell cultures than from adherent melan-a cells (D0),

peaking around 5 hours in suspension and decreasing after

24 hours in deadherent conditions (Figure 2B). In addition,

exposure of melan-a melanocytes to anchorage blockade re-

sulted in a significant expression of eNOS (type III), different

from adherent cells (D0) that did not express this enzyme

(Figure 2F ). Neither adherent nor suspended melan-a cells

expressed neuronal NOS (nNOS) (type I) (data not shown).

Lipid hydroperoxides are the initial products of unsaturated

fatty acid oxidation caused by peroxynitrite, the reaction prod-

uct of NO with O2.� [35]. One of the major aldehyde products

of lipid peroxidation is MDA and, as shown in Figure 2C, its lev-

els increase progressively, soon after melanocyte anchorage

blockade. These results clearly show that anchorage impedi-

ment in melanocytes results initially in increased levels of ROS

and NO, later followed by accumulation of total glutathione.

Anchorage Blockade Induces Hcy Depletion

Approximately half of the intracellular GSH pool in cells is

derived from Hcy through the transsulfuration pathway [36].

Hcy is a metabolite in the methionine cycle and has two

major fates: 1) transsulfuration catalyzed by cystathionine

b-synthase leading to cystathionine and 2) remethylation

catalyzed by methionine synthase or by betaine Hcy meth-

yltransferase. In the former pathway, cystathionine is subse-

quently converted to Cys, a precursor of GSH [37]. Cells can

Figure 1. Anchorage blockade of nontumorigenic melanocytes (melan-a)

induces superoxide anion (O2.�) production. Intracellular O2

.� concentration

were analyzed by flow cytometry in suspended (D1h, D3h, D5h, and D24h)

and adherent (DO) melan-a cells using the nonfluorescent cell-permeant

probe DHE, which, in contact with O2.�, becomes highly fluorescent. Light

gray lines represent nonstained and black lines represent stained melan-a

cells. Numbers inside graphs represent percentage of positive cells relatively

to nonstained controls.

1114 Oxidative Stress and DNA Methylation Campos et al.

Neoplasia . Vol. 9, No. 12, 2007

make the necessary Cys from methionine, or they can take it

up from the surrounding fluids. Because the maintenance of

intracellular GSH pool is regulated by Cys concentrations,

which in vivo main source is the Hcy-dependent transsulfu-

ration pathway, we compared Hcy concentrations in adher-

ent (D0) and suspended (D24h) melan-a cells. Melan-a cells

maintained in suspension for 24 hours show a dramatic

decrease in intracellular Hcy concentrations compared to

Figure 2. Stress response to anchorage blockade induces nitric oxide production and alterations in homocysteine levels. Total cellular glutathione levels

(measured by colorimetry), indicating an antioxidative response, become significantly elevated after 24 hours of anchorage blockade (A). Intracellular nitric oxide

concentrations, analyzed by the NO fluorescent indicator, DAF (B), as well as one of the main lipid peroxidation products, malondialdehyde (MDA; C), also become

significantly elevated along anchorage blockade. Levels of the glutathione precursor homocysteine (Hcy), but not cysteine (Cys), determined by HPLC showed a

drastic reduction when maintained in suspension for 24 hours, compared to adhered control cells (D and E, respectively). Endothelial NO synthase (eNOS) mRNA

expression was strongly induced after melan-a anchorage blockade (F). The murine endothelial cell line L229 was used as an eNOS expression positive control.

Actin mRNA expression was used as an internal control and numbers below this figure show eNOS/actin ratio. Numbers inside flow cytrometry graphs (B)

represent percentage of stained positive cells (black lines) relatively to nonstained controls (light gray lines). Asterisks indicate statistical significance levels,

determined by unpaired t tests between each suspended cell sample (D1h, D3h, D5h, D8h, and D24h) compared to adhered control cells (D0). *P < .05, **P < .01,

***P < .0005.

Oxidative Stress and DNA Methylation Campos et al. 1115

Neoplasia . Vol. 9, No. 12, 2007

adherent melan-a cells (Figure 2D), whereas Cys levels

remain stable in this condition (Figure 2E ).

Anchorage Blockade Alters 5-MeC Content

In the second metabolic pathway, Hcy is remethylated to

methionine, which is further converted to S-adenosylmethio-

nine (SAM) by methionine adenosyltransferase. SAM, the

universal methyl donor, is demethylated by several enzymes,

such as DNA methyltransferases [38]. Alterations in Hcy

levels in deadherent melan-a cells led us to investigate

whether global DNA methylation was altered during melan-

a anchorage blockade. Figure 3A (CTRL) shows that global

DNA methylation is augmented in suspended melan-a cells

(D1h, D3h, and D24h) when compared to adherent ones (D0,

47.3% of 5-MeC–positive cells). 5-Methylcytosine levels are

elevated as soon as 1 hour (70.2% positive cells) and

become progressively higher up to 24 hours after adhesion

blockade (95.9% positive cells).

L-NAME and NAC Abrogate DNA Hypermethylation and the

Concomitant Increase in dnmt1 and 3b Expression during

Anchorage Blockade

Considering that the increase in reactive species produc-

tion and DNA methylation have a temporal association in this

model, we tested whether these phenomena share a causal

relationship. Figure 3A shows that L-NAME, a known NOS in-

hibitor, and the cell-permeant antioxidant NAC impair global

DNA hypermethylation observed during melan-a anchorage

blockade. L-NAME completely reversed 5-MeC levels in-

crease after 3 (D3h, 10.4% positive cells) and 24 hours (D24h,

7.3% positive cells) in suspension, compared to nontreated

control cells (CTRL) at the same time points (D3h, 84.6%

positive cells; D24h, 95.9% positive cells). NAC was also

able to exert a significant inhibitory effect over 5-MeC con-

tent elevation, at an earlier time point (D1h, 24.9% positive

cells) than L-NAME and in 24 hours after anchorage block-

ade (D24h, 41.8% positive cells).

Other antioxidants, such as catalase (Sigma), DMSO

(Sigma), and peroxidase (type II horseradish peroxidase,

Sigma), were unable to exert the inhibitory effect over 5-MeC

levels observed with L-NAME and NAC (Figure 3A, for

DMSO; and data not shown, for catalase and peroxidase).

Intriguingly, L-NAME–treated adherent cells (D0) showed a

marked elevation in 5-MeC content, not detected after treat-

ment with other compounds (NAC: Figure 3; DMSO, cata-

lase, and peroxidase: data not shown). This observation is

being further investigated in our laboratory, and may be

related to Ras activation status [39].

The DNA methyltransferases implicated in establishing

de novo methylation patterns are dnmt3a and 3b, whereas

maintenance of DNA methylation pattern is performed by

dnmt1 during DNA replication process. We analyzed protein

expression by Western blot at different time points (D0, D1h,

D3h, D5h, and D24h), and Figure 3B shows a marked in-

crease in dnmt3b expression along anchorage blockade. A

significant increase in dnmt1 expression was also observed

Figure 3. Total DNA methylation levels and dnmt1 and 3b expression become elevated during forced anchorage blockade, and this response is abrogated by the

L-NAME and NAC. 5-MeC content, analyzed by flow cytometry using a specific antibody (Oncogene), augments along melan-a adhesion blockade (D1–24h)

compared to the adherent counterpart (D0) and this increase is abolished when these cells are treated with 1 mM L-NAME or with the antioxidant NAC, but not with

DMSO (A). Numbers inside graphs represent percentage of positively stained cells (black lines) relative to control cells incubated in the absence of primary

antibody (light gray lines). Suspended melan-a cells (D1–24h) present elevated expression of dnmt1 (D) and 3b (B and C) along time compared to adherent control

cells (D0), as analyzed by Western blot using specific antibodies against dnmt1 and 3b (Abcam), and L-NAME treatment inhibits both dnmt1 and 3b expression in

suspension condition [D3h and D24h for dnmt3b (C); D5h for dnmt1 (D)]. D0: adhered melan-a; D1h, D3h, D24h: suspended melan-a cells. �: nontreated cells, +:

treated cells. Numbers below blots indicate dnmt/actin ratio.

1116 Oxidative Stress and DNA Methylation Campos et al.

Neoplasia . Vol. 9, No. 12, 2007

after anchorage impediment (D5h), as shown in Figure 3D.

Corroborating the hypothesis that oxidative stress regulates

DNA methylation, L-NAME was capable of abolishing the in-

crease both in dnmt1 and 3b expression, observed during an-

chorage blockade of melan-a cells (D3h and D24h, Figure 3C;

D5h, Figure 3D). In addition, L-NAME–treated adherent cells

(D0), which present higher levels of 5-MeC as shown above,

also present a much higher expression of dnmt3b protein, but

not dnmt1. Taken together, these data reinforce the proposi-

tion that oxidative stress regulates DNA methylation through

DNA methyltransferase expression modifications.

L-NAME and NAC Do Not Inhibit NO Levels in Melan-a

Melanocytes, But Totally Impair O2.� Production

Despite its known capacity of inhibiting NOS, L-NAME

failed to reduce intracellular NO levels in nonadherent

melan-a cells (Figure 4A), which, although unexpected, is

in accordance with previous data showing that L-NAME was

unable to inhibit NO production in different human melanoma

cell lines [40], and with results indicating that L-NAME can be

a source of nonenzymatically produced NO [41]. In addition,

the NAC and catalase antioxidants did not modify NO levels

in melan-a cells maintained in suspension (Figure 4A).

Furthermore, L-NAME and NAC, but not catalase, were able

to completely abrogate O2.� production in this condition

(Figure 4B ).

Discussion

Normal melanocytes depend on signals provided by both

keratinocytes (in the epidermal melanin unit) and extracellular

matrix to maintain their normal homeostasis, and their ectopic

localization, as in dysplastic nevi and melanomas, is associ-

ated with morphologic and functional alterations [42,43].

Our group has recently established a melanocyte trans-

formation model where several melanoma lineages were

derived from immortalized, but nontumorigenic, melanocytes

(melan-a cells) submitted to rounds of anchorage blockade

followed by reattachment during normal culture conditions

[21,22]. This model allows the identification of biochemical,

genetic, and epigenetic alterations involved in homeostatic

control loss and the carcinogenic process.

A significant increase in oxidative stress, as shown di-

rectly by elevated intracellular levels of O2.� (Figure 1) and

indirectly by GSH (Figure 2A) and MDA concentrations

Figure 4. L-NAME and NAC do not inhibit NO production, but abrogate O2.�

generation during melan-a anchorage blockade. Melan-a cells submitted to

anchorage blockade (D3h) produced significant amounts of NO, estimated by

NO analyzer, compared to adherent melan-a cells (D0). NO generation was

not affected by either L-NAME (LN), NAC, or catalase (Cat) treatment (A).

Intracellular O2.� levels were determined by flow cytometry (FACScan;

Becton Dickinson) using DHE staining. L-NAME and NAC, but not catalase

(Cat), treatment strongly inhibited O2.� generation by deadhered melan-a

cells (D3h) (B). C: nontreated melan-a cells. Numbers inside graphs repre-

sent percentage of positive stained cells (black lines) relatively to control cells

incubated in the absence of DHE (light gray lines). ***P < .0005.

Oxidative Stress and DNA Methylation Campos et al. 1117

Neoplasia . Vol. 9, No. 12, 2007

(Figure 2C), is observed in melan-a cells submitted to

anchorage blockade, beginning as soon as 1 hour. The

increase in GSH levels could also indicate a response to

oxidative stress [33,36] (Figure 5) because we observed a

significant increase in GSH levels only 24 hours after adhe-

sion blockade (Figure 2A), when H2O2 production returns to

basal levels (data not shown). Increased ROS intracellular

levels induced by anchorage blockade have been implicated

as mediators of anoikis of human endothelial cells [44] and

colorectal carcinoma cells [45]. However, elevated levels of

O2.� have also been associated with protection from apop-

totic death induced by cytotoxic agents or CD95 activation

[46,47]. Nair et al. [48] showed that the decision to commit to

programmed cell death during oxidative stress is, at least for

neuronal murine cells, determined stochastically by each

cell. This mutually exclusive decision involves either extra-

cellular-regulated kinase or p53 activation pathways. It is

probable that such life or death choice is also taken by

melan-a cells maintained in forced deadherent culture con-

ditions, and preliminary results from our laboratory demon-

strate that p53 expression is increased in premalignant cell

lines, but is lost in cell lines with full malignant phenotype

(manuscript in preparation).

Oxidative stress is also commonly associated with rela-

tively high levels of reactive nitrosative species and reac-

tive oxygen nitrogen species [49]. NO is synthesized by a

family of enzymes termed NOS. Two of them, the so-called

endothelial (eNOS) and neuronal (nNOS) isoforms, are ex-

pressed constitutively and generate NO for cell signaling

purposes. The inducible isoform releases NO in large

amounts during inflammatory or immunologic reactions and

is involved in host tissue damage responses. NO production

(Figures 2B and 4A) and MDA levels (Figure 2C) are clearly

amplified in deadherent melan-a cells (D1–D24h), com-

pared to their adherent counterparts (D0). In addition, an-

chorage blockade induced eNOS expression by melan-a

cells (Figure 2F ), but not nNOS expression (data not shown).

Intracellular Hcy concentration was shown to fall dras-

tically in melan-a submitted to anchorage blockade for

24 hours (Figure 2D). Interestingly, the concentration of

Cys, a product of Hcy metabolism and a GSH precursor,

did not change after anchorage blockade (Figure 2E). The

observed low levels of intracellular Hcy suggest that both

metabolic pathways in which it is involved (transsulfuration

and remethylation) could be overly active. DNA molecules

are one of the possible targets of methylation reactions [50]

and elevated plasma levels of Hcy are associated with DNA

hypomethylation [51]. Our results show that global DNA

methylation, estimated by 5-MeC content, is clearly aug-

mented in the first hours after melan-a detachment (Figure 3A;

CTRL) when the Hcy level is significantly decreased (Fig-

ure 2D). The expression of both dnmt1 and 3b were also in-

creased along melan-a anchorage blockade (Figure 3, B–D),

providing a functional explanation for the observed rise in

5-MeC content.

Some groups have shown that both ROS and NO can

affect DNA methylation status [15,52–54]. In our work,

treatment of melan-a cells with L-NAME or NAC, but not with

other antioxidants (DMSO, catalase, and peroxidase),

resulted in inhibition of 5-MeC content (Figure 3A), as well

as in dnmt1 and 3b expression increase (Figure 3C) along

melan-a anchorage blockade. This effect does not seem to

evolve NO production because both L-NAME and NAC were

unable to inhibit NO synthesis (Figure 4A), but rather seems

related to O2.� levels, whose production was abrogated by

these inhibitors (Figure 4B). Absence of nitric oxide produc-

tion inhibition by a fairly known NOS inhibitor L-NAME has

already been described previously in melanoma cells [40], as

well as in other cell types [41]. As an L-arginine analog, L-

NAME itself seems to be a source of nonenzymatically

produced NO [41], which could explain the observed main-

tenance of NO levels after L-NAME addition to culture media.

Hydrogen peroxide scavenger antioxidants, such as DMSO

(Figure 3A), catalase, and peroxidase (data not shown), did

not alter either 5-MeC, dnmt1 and 3b expression or O2.�

production. Conversely, NAC can specifically induce the

expression [55] and the activity [56] of manganese superox-

ide dismutase (MnSOD), apart from its role as a precursor of

GSH, which could explain its effects on reducing O2.� levels

in melan-a cells submitted to anchorage blockade.

A very interesting feature of the NOS enzymes is that

they not only generate NO but also produce O2.� themselves

[57–59]. This phenomenon is referred to as the uncoupled

state of NOS and has been associated with risk factors

for some pathologies and considered as an abnormality of

NOS function [60,61]. As mentioned above, eNOS expres-

sion was significantly induced during melan-a anchorage

blockade (Figure 2F ), as well as superoxide anion produc-

tion (Figure 1). The exposure of eNOS to oxidants, including

peroxynitrite, may cause increased enzymatic uncoupling

and generation of superoxide anion [62] (Figure 5). Exoge-

nous NOS inhibitor L-NAME can impair the transfer of

electrons to molecular oxygen, inhibiting O2.� production

Figure 5. O2.� production and its possible relation to methionine cycle. Lower

levels of Hcy may result in lower levels of ADMA and higher NOS activity and/

or expression. The concomitant local generation of NO and O2.� can result in

peroxynitrite production, which, in turn, may lead to eNOS uncoupling and pro-

duction of higher O2.� levels. Activated Ras, in the presence of high O2

.� con-

centrations, may induce the dnmt’s expression and, consequently, increase

global DNA methylation. Met, methionine; SAM, S-adenosylmethionine; Cys,

cysteine; GSH, glutathione; DDAH, dimethylarginine dimethylaminohydrolase;

ADMA, asymmetric dimethylarginine; eNOS, endothelial NO synthase; CH3,

methyl radical; NO, nitric oxide; O2.�, superoxide anion; dnmt, DNA methyl-

transferases. Adapted from Laurent et al. [47] and Nair et al. [48].

1118 Oxidative Stress and DNA Methylation Campos et al.

Neoplasia . Vol. 9, No. 12, 2007

[58], which could explain the abrogation of O2.� production

in our model (Figure 5). In a similar way, asymmetric

dimethylarginine (ADMA), an endogenous NOS inhibitor,

can regulate the balance of NO and O2.� production from

NOS. ADMA is indirectly stimulated by Hcy [63] (Figure 5)

and elevated plasma levels of the latter are associated with

DNA hypomethylation [51]. In this context, lower Hcy con-

centrations could be indirectly related to NOS uncoupling

and increased O2.� production, which, in turn, might directly

contribute to DNA methylation regulation through modulation

of dnmt’s expression (Figure 5).

In our model, Ras activation is strongly induced few hours

after melan-a anchorage blockade (Machado, J. Jr., personal

communication). Aberrant activation of this oncogene has

been implicated in many aspects of the malignant pheno-

type, including uncontrolled proliferation and functional and

morphologic alterations [64,65]. MacLeod et al. [66] showed

that DNA methylation may be regulated by the Ras signaling

pathway by activating the Jun transcription factor, which in

turn transactivates the dnmt promoter by interacting with AP-

1 sites. The expression of either dnmt1, 3a, or 3b has already

been shown to be upregulated by activated Ras in different

experimental conditions [67–69] (Figure 5). Interestingly,

Sephashvili et al. [70] demonstrated that L-NAME increases

the production of S-adenosylhomocysteine (SAH), leading to

the reduction in SAM/SAH ratio and in methylation reactions,

only in cells presenting mutated oncogenic RasH, possibly

through enhancement of superoxides. Otherwise, these au-

thors showed that L-NAME–treated wild-type Ras-expressing

cells present increased SAM/SAH ratio, indicative of aug-

mented methylation reactions. In our work, increased 5-MeC

content and dnmt1 and 3b expression were abrogated by L-

NAME during melan-a anchorage blockade, when Ras is ac-

tivated, suggesting that this dnmt’s upregulated expression

may be related to Ras activation status. Curiously, L-NAME

treatment of adherent melan-a cells, which present nonacti-

vated Ras, leads to increases both in global DNA methylation

and in dnmt3b, but not dnmt1 expression. This fact may be

related to the experimental conditions, because dnmt1, and

not dnmt3b expression, is cell cycle–dependent. In most

studies, the expression of dnmts induced by Ras has been

found to depend on the cell type and context [67]. The impact

of Ras activation status and oxidative stress in DNA methyl-

ation is under intensive investigation in our laboratory.

Anchorage-independent growth (anoikis resistance) has

traditionally been described as an acquired in vitro charac-

teristic, which is well correlated with in vivo tumorigenic

capacity [71,72] but the acquisition of this phenotype is not

considered a causative event in carcinogenesis. Neverthe-

less, using basically the same deadhesion protocol used in

our work, Rak et al. [73] obtained tumorigenic variants after

enforced anchorage-independent growth of a nontumori-

genic immortalized epithelial cell line. Using a similar ap-

proach, Zhu et al. [74] obtained a melanoma cell line with

greater metastatic potential compared to the parental cell line.

More interestingly, Seftor et al. [75] showed that adhesion of

normal human melanocytes to a modified extracellular matrix

could induce the expression of several genes associated

with a malignant phenotype. This cancer-associated expres-

sion profile was reverted after several days in physiological

adherent conditions, and the authors suggest that melano-

cyte phenotype is controlled by epigenetic mechanisms that

include DNA methylation.

In our model of melanocyte transformation, cell–substrate

adhesion blockade is the only induced modification in cul-

ture conditions, which resulted in full malignant transformed

cell lines after several anchorage blockade cycles [22]. The

first hours of this process, as described in this work, present

a significant increase in oxidative/nitrosative stress, and this

metabolic imbalance may have a causal role in modifications

of DNA methylation status and dnmt1 and 3b expression, as

shown by L-NAME and NAC inhibition assays. These results

begin to unveil important clues about the initial events in the

carcinogenic process related to microenvironmental changes.

Acknowledgements

We thank Elisa Mieko Suemitsu Higa and Margaret Gori

Mouro for help with NO analyzer assays. We also thank

Heraldo Possolo for his helpful advice.

References[1] Frisch SM and Screaton RA (2001). Anoikis mechanisms. Curr Opin

Cell Biol 13, 555 – 562.

[2] Grossmann J (2002). Molecular mechanisms of ‘‘detachment-induced

apoptosis—anoikis’’. Apoptosis 7, 247 – 260.

[3] Cheng TL, Symons M, and Jou TS (2004). Regulation of anoikis by

Cdc42 and Rac1. Exp Cell Res 295, 497 – 511.

[4] Kawanishi S, Hiraku Y, and Oikawa S (2001). Mechanism of guanine-

specific DNA damage by oxidative stress and its role in carcinogenesis

and aging. Mutat Res 488, 65 – 76.

[5] Eu JP, Liu L, Zeng M, and Stamler JS (2000). An apoptotic model for

nitrosative stress. Biochemistry 39, 1040 – 1047.

[6] Cavelier G (2000). Theory of malignant cell transformation by super-

oxide fate coupled with cytoskeletal electron-transport and electron-

transfer. Med Hypotheses 54, 95– 98.

[7] Deng X, Gao F, and May WS (2003). Bcl2 retards G1/S cell cycle

transition by regulating intracellular ROS. Blood 102, 3179 –3185.

[8] Zimmerman R and Cerutti P (1984). Active oxygen acts as a promoter

of transformation in mouse embryo C3H/10T1/2/C18 fibroblasts. Proc

Natl Acad Sci USA 81, 2085 – 2087.

[9] Irani K, Xia Y, Zweier JL, Sollott SJ, Der CJ, Fearon ER, Sundaresan M,

Finkel T, and GoldschmidtClermont PJ (1997). Mitogenic signaling

mediated by oxidants in ras-transformed fibroblasts. Science 275,

1649 –1652.

[10] Behrend L, Henderson G, and Zwacka RM (2003). Reactive oxygen spe-

cies in oncogenic transformation. Biochem Soc Trans 31, 1441–1444.

[11] Brune B, von Knethen A, and Sandau KB (1999). Nitric oxide (NO): an

effector of apoptosis. Cell Death Differ 6, 969 –975.

[12] Ischiropoulos H and Beckman JS (2003). Oxidative stress and nitration

in neurodegeneration: cause, effect, or association? J Clin Invest 111,

163 – 169.

[13] Creppy EE, Traore A, Baudrimont I, Cascante M, and Carratu MR

(2002). Recent advances in the study of epigenetic effects induced by

the phycotoxin okadaic acid. Toxicology 181–182, 433 – 439.

[14] Marnett LJ, Riggins JN, and West JD (2003). Endogenous generation of

reactive oxidants and electrophiles and their reactions with DNA and

protein. J Clin Invest 111, 583 –593.

[15] Valinluck V, Tsai H, Rogstad DK, Burdzy A, Bird A, and Sowers LC

(2004). Oxidative damage to methyl-CpG sequences inhibits the bind-

ing of the methyl-CpG binding domain (MBD) of methyl-CpG binding

protein 2 (MeCP2). Nucleic Acids Res 32, 4100 – 4108.

[16] Gowher H, Liebert K, Hermann A, Xu G, and Jeltsch A (2005). Mech-

anism of stimulation of catalytic activity of Dnmt3A and Dnmt3B DNA-

(cytosine-C5) – methyltransferases by Dnmt3L. J Biol Chem 280,

13341 – 13348.

Oxidative Stress and DNA Methylation Campos et al. 1119

Neoplasia . Vol. 9, No. 12, 2007

[17] Suetake I, Shinozaki F, Miyagawa J, Takeshima H, and Tajima S (2004).

DNMT3L stimulates the DNA methylation activity of Dnmt3a and

Dnmt3b through a direct interaction. J Biol Chem 279, 27816 – 27823.

[18] Jones PA and Baylin SB (2002). The fundamental role of epigenetic

events in cancer. Nat Rev Genet 3, 415 –428.

[19] Feinberg AP, Ohlsson R, and Henikoff S (2006). The epigenetic pro-

genitor origin of human cancer. Nat Rev Genet 7, 21 –33.

[20] Wang Y, Yu Q, Cho AH, Rondeau G, Welsh J, Adamson E, Mercola D,

and McClelland M (2005). Survey of differentially methylated promoters

in prostate cancer cell lines. Neoplasia 7, 748 –760.

[21] Correa M, Machado J Jr, Carneiro CR, Pesquero JB, Bader M,

Travassos LR, Chammas R, and Jasiulionis MG (2005). Transient

inflammatory response induced by apoptotic cells is an important me-

diator of melanoma cell engraftment and growth. Int J Cancer 114,

356– 363.

[22] Oba-Shinjo SM, Correa M, Ricca TI, Molognoni F, Pinhal MA, Neves IA,

Marie SK, Sampaio LO, Nader HB, Chammas R, et al. (2006). Melano-

cyte transformation associated with substrate adhesion impediment.

Neoplasia 8, 231 – 241.

[23] Bennett DC, Cooper PJ, and Hart IR (1987). A line of non-tumorigenic

mouse melanocytes, syngeneic with the B16 melanoma and requiring a

tumour promoter for growth. Int J Cancer 39, 414 – 418.

[24] Zhao H, Kalivendi S, Zhang H, Joseph J, Nithipatikom K, Vasquez-Vivar

B, and Kalyanaraman B (2003). Superoxide reacts with hydroethidine

but forms a fluorescent product that is distinctly different from ethidium:

potential implications in intracellular fluorescence detection of super-

oxide. Free Radic Biol Med 34, 1359 –1368.

[25] Tietze F (1969). Enzymic method for quantitative determination of nano-

gram amounts of total and oxidized glutathione: applications to mam-

malian blood and other tissues. Anal Biochem 27, 502 –522.

[26] Lowry OH, Rosebrough NJ, Farr AL, and Randall RJ (1951). Pro-

tein measurement with the Folin phenol reagent. J Biol Chem 193,

265 – 275.

[27] Kojima H, Nakatsubo N, Kikuchi K, Urano Y, Higuchi T, Tanaka J, Kudo

Y, and Nagano T (1998). Direct evidence of NO production in rat hippo-

campus and cortex using a new fluorescent indicator: DAF-2 DA. Neu-

roreport 9, 3345 – 3348.

[28] Hampl V, Waters CL, and Archer SL (1996). Determination of nitric

oxide by the chemiluminescence reaction with ozone. In Feelisch, M,

Stamler, JS (Eds.), Methods in Nitric Oxide Research, pp. 309 –318

John Wiley & Sons, Chichester.

[29] Ohkawa H, Ohishi N, and Yagi K (1979). Assay for lipid peroxides

in animal tissues by thiobarbituric acid reaction. Anal Biochem 95,

351 –358.

[30] Pfeiffer CM, Huff DL, and Gunter EW (1999). Rapid and accurate HPLC

assay for plasma total homocysteine and cysteine in a clinical labora-

tory setting. Clin Chem 45, 290 – 292.

[31] Milutinovic S, Zhuang Q, Niveleau A, and Szyf M (2003). Epigenomic

stress response. Knockdown of DNA methyltransferase 1 triggers an

intra – S-phase arrest of DNA replication and induction of stress re-

sponse genes. J Biol Chem 278, 14985 – 14995.

[32] Meyskens FL Jr, McNulty SE, Buckmeier JA, Tohidian NB, Spillane TJ,

Kahlon RS, and Gonzalez RI (2001). Aberrant redox regulation in hu-

man metastatic melanoma cells compared to normal melanocytes. Free

Radic Biol Med 31, 799 –808.

[33] Tchantchou F, Graves M, Ashline D, Morin A, Pimenta A, Ortiz D,

Rogers E, and Shea TB (2004). Increased transcription and activity

of glutathione synthase in response to deficiencies in folate, vitamin E,

and apolipoprotein E. J Neurosci Res 75, 508 –515.

[34] Zorov DB, Bannikova SY, Belousov VV, Vyssokikh MY, Zorova LD,

Isaev NK, Krasnikov BF, and Plotnikov EY (2005). Reactive oxygen and

nitrogen species: friends or foes? Biochemistry (Mosc) 70, 215 – 221.

[35] Warner DS, Sheng H, and Batinic-Haberle I (2004). Oxidants, anti-

oxidants and the ischemic brain. J Exp Biol 207, 3221 – 3231.

[36] Mosharov E, Cranford MR, and Banerjee R (2000). The quantitatively

important relationship between homocysteine metabolism and gluta-

thione synthesis by the transsulfuration pathway and its regulation by

redox changes. Biochemistry 39, 13005 –13011.

[37] Dimitrova KR, DeGroot K, Myers AK, and Kim YD (2002). Estrogen and

homocysteine. Cardiovasc Res 53, 577– 588.

[38] Caudill MA, Wang JC, Melnyk S, Pogribny IP, Jernigan S, Collins MD,

Santos-Guzman J, Swendseid ME, Cogger EA, and James SJ (2001).

Intracellular S-adenosylhomocysteine concentrations predict global

DNA hypomethylation in tissues of methyl-deficient cystathionine b-

synthase heterozygous mice. J Nutr 131, 2811 –2818.

[39] Irani K, Xia Y, Zweier JL, Sollott SJ, Der CJ, Fearon ER, Sundaresan M,

Finkel T, and GoldschmidtClermont PJ (1997). Mitogenic signaling

mediated by oxidants in ras-transformed fibroblasts. Science 275,

1649 – 1652.

[40] Salvucci O, Carsana M, Bersani H, Tragni G, and Anichini A (2001).

Antiapoptotic role of endogenous nitric oxide in human melanoma cells.

Cancer Res 61, 318 – 326.

[41] Moroz LL, Norby SW, Cruz L, Sweedler JV, Gillete R, and Clarkson RB

(1998). Non-enzymatic production of nitric oxide (NO) from NO syn-

thase inhibitors. Biochem Biophys Res Commun 253, 571 –576.

[42] Kincannon J and Boutzale C (1999). The physiology of pigmented nevi.

Pediatrics 104, 1042 –1045.

[43] Postovit LM, Seftor EA, Seftor RE, and Hendrix MJ (2006). Influence of

the microenvironment on melanoma cell fate determination and pheno-

type. Cancer Res 66, 7833 – 7836.

[44] Li N, Oberley TD, Oberley LW, and Zhong W (1998). Inhibition of cell

growth in NIH/3T3 fibroblasts by overexpression of manganese super-

oxide dismutase: mechanistic studies. J Cell Physiol 175, 359 – 369.

[45] Laguinge LM, Lin S, Samara RN, Salesiotis AN, and Jessup JM (2004).

Nitrosative stress in rotated three-dimensional colorectal carcinoma cell

cultures induces microtubule depolymerization and apoptosis. Cancer

Res 64, 2643 – 2648.

[46] Pervaiz S, Cao J, Chao OS, Chin YY, and Clement MV (2001). Activa-

tion of the RacGTPase inhibits apoptosis in human tumor cells. Onco-

gene 20, 6263 – 6268.

[47] Laurent A, Nicco C, Chereau C, Goulvestre C, Alexandre J, Alves A,

Levy E, Goldwasser F, Panis Y, Soubrane O, et al. (2005). Controlling

tumor growth by modulating endogenous production of reactive oxygen

species. Cancer Res 65, 948 – 956.

[48] Nair VD, Yuen T, Olanow CW, and Sealfon SC (2004). Early single cell

bifurcation of pro- and antiapoptotic states during oxidative stress. J Biol

Chem 279, 27494 – 27501.

[49] Haddad JJ (2004). Redox and oxidant-mediated regulation of apoptosis

signaling pathways: immuno –pharmaco-redox conception of oxidative

siege versus cell death commitment. Int Immunopharmacol 4, 475 – 493.

[50] Ulrey CL, Liu L, Andrews LG, and Tollefsbol TO (2005). The impact of

metabolism on DNA methylation. Hum Mol Genet 14 Spec No 1,

R139 –R147.

[51] Yi P, Melnyk S, Pogribna M, Pogribny IP, Hine RJ, and James SJ

(2000). Increase in plasma homocysteine associated with parallel in-

creases in plasma S-adenosylhomocysteine and lymphocyte DNA hy-

pomethylation. J Biol Chem 275, 29318 – 29323.

[52] Weitzman SA, Turk PW, Milkowski DH, and Kozlowski K (1994). Free

radical adducts induce alterations in DNA cytosine methylation. Proc

Natl Acad Sci USA 91, 1261 – 1264.

[53] Cerda S and Weitzman SA (1997). Influence of oxygen radical injury on

DNA methylation. Mutat Res 386, 141 – 152.

[54] Hmadcha A, Bedoya FJ, Sobrino F, and Pintado E (1999). Methylation-

dependent gene silencing induced by interleukin 1b via nitric oxide pro-

duction. J Exp Med 190, 1595 –1604.

[55] Nagata K, Iwasaki Y, Yamada T, Yuba T, Kono K, Hosogi S, Ohsugi S,

Kuwahara H, and Marunaka Y (2007). Overexpression of manganese

superoxide dismutase by N-acetylcysteine in hyperoxic lung injury.

Respir Med 101, 800 – 807.

[56] Xia Z, Guo Z, Nagareddy PR, Yuen V, Yeung E, and McNeill JH (2006).

Antioxidant N-acetylcysteine restores myocardial Mn-SOD activity and

attenuates myocardial dysfunction in diabetic rats. Eur J Pharmacol

544, 125.

[57] Rabelink TJ and Luscher TF (2006). Endothelial nitric oxide synthase.

Host defense enzyme of the endothelium? Arterioscler Thromb Vasc

Biol 26, 267 – 271.

[58] Cardounel AJ, Xia Y, and Zweier JL (2005). Endogenous methylargi-

nines modulate superoxide as well as nitric oxide generation from neu-

ronal nitric-oxide synthase. J Biol Chem 280, 7540 –7549.

[59] Pou S, Keaton L, Surichamorn W, and Rosen GM (1999). Mechanism of

superoxide generation by neuronal nitric-oxide synthase. J Biol Chem

274, 9573 – 9580.

[60] Meininger CJ, Cai S, Parker JL, Channon KM, Kelly KA, Becker EJ,

Wood MK, Wade LA, and Wu G (2004). GTP cyclohydrolase I gene

transfer reverses tetrahydrobiopterin deficiency and increases nitric ox-

ide synthesis in endothelial cells and isolated vessels from diabetic rats.

FASEB J 18, 1900 –1902.

[61] Stroes E, Kastelein J, Cosentino F, Erkelens W, Wever R, Koomans H,

Luscher TF, and Rabelink TJ (1997). Tetrahydrobiopterin restores en-

dothelial function in hypercholesterolemia. J Clin Invest 99, 41– 46.

[62] Zou MH, Shi C, and Cohen RA (2002). Oxidation of the zinc – thiolate

complex and uncoupling of endothelial nitric synthase by peroxynitrite.

J Clin Invest 109, 817 – 826.

[63] Stuhlinger MC, Tsao PS, Her JH, Kimoto M, Balint RF, and Cooke JP

1120 Oxidative Stress and DNA Methylation Campos et al.

Neoplasia . Vol. 9, No. 12, 2007

(2001). Homocysteine impairs the nitric oxide synthase pathway: role of

asymmetric dimethylarginine. Circulation 104, 2569 –2575.

[64] Barbacid M (1987). Ras genes. Annu Rev Biochem 56, 779 – 827.

[65] Derouet M, Xou X, May L, Hoon Yoo B, Sasazuki T, Shirasawa S, Rak J,

and Rosen KV (2007). Acquisition of anoikis resistance promotes the

emergence of oncogenic K-ras mutations in colorectal cancer cells and

stimulates their tumorigenicity in vivo. Neoplasia 9, 536 –545.

[66] MacLeod R, Rouleau J, and Szyf M (1995). Regulation of DNA meth-

ylation by the Ras signaling pathway. J Biol Chem 270, 11327 –11337.

[67] Chang H, Cho C, and Hung W (2006). Silencing of the metastasis

suppressor RECK by RAS oncogene is mediated by DNA methyltrans-

ferase 3b-induced promoter methylation. Cancer Res 66, 8413– 8420.

[68] Soejima K, Fang W, and Rollins BJ (2003). DNA methyltransferase 3b

contributes to oncogenic transformation induced by SV40T antigen and

activated Ras. Oncogene 22, 4723 – 4733.

[69] Pruitt K, Ulku AS, Frantz K, Rojas RJ, Muniz-Medina VM, Rangnekar

VM, Der CJ, and Shields JM (2005). Ras-mediated loss of the pro-

apoptotic response protein Par-4 is mediated by DNA hypermethylation

through Raf-independent and Raf-dependent signaling cascades in epi-

thelial cells. J Biol Chem 280, 23363 – 23370.

[70] Sephashvili M, Zhuravliova E, Barbakadze T, Khundadze M, Narmania

N, and Mikeladze DG (2006). L-NAME has opposite effects on the

productions of S-adenosylhomocysteine and S-adenosylmethionine in

V12-H-Ras and M-CR3B-Ras pheochromocytoma cells. Neurochem

Res 31, 1205 – 1210.

[71] Baserga R (1997). The price of independence. Exp Cell Res 236, 1– 3.

[72] Song J, Xie H, Lian J, Yang G, Du R, Du Y, Zou X, Jin H, Gao J, Liu J,

et al. (2006). Enhanced cell survival of gastric cancer cells by a novel

gene URG4. Neoplasia 8, 995 –1002.

[73] Rak J, Mitsuhashi Y, Sheehan C, Krestow J, Florenes V, Filmus J, and

Kerbel R (1999). Collateral expression of proangiogenic and tumorigenic

properties in intestinal epithelial cell variants selected for resistance to

anoikis. Neoplasia 1, 23–30.

[74] Zhu Z, Sanchez-Sweatman O, Huang X, Wiltrout R, Khokha R, Zhao Q,

and Gorelik E (2001). Anoikis and metastatic potential of cloudman S91

melanoma cells. Cancer Res 61, 1707 – 1716.

[75] Seftor EA, Brown KM, Chin L, Kirschmann DA, Wheaton WW, Protopopov

A, Feng B, Balagurunathan Y, Trent JM, Nickoloff BJ, et al. (2005). Epi-

genetic transdifferentiation of normal melanocytes by a metastatic mela-

noma microenvironment. Cancer Res 65, 10164–10169.

Oxidative Stress and DNA Methylation Campos et al. 1121

Neoplasia . Vol. 9, No. 12, 2007