ORIGINAL PAPER

Dwight Barnes Æ Scott Franklin Æ Jason Schultz

Ryan Henry Æ Emma Brown Æ Anna Coragliotti

Stephen P. Mayfield

Contribution of 5¢- and 3¢-untranslated regions of plastid mRNAsto the expression of Chlamydomonas reinhardtii chloroplast genes

Received: 14 July 2005 / Accepted: 5 September 2005 / Published online: 18 October 2005� Springer-Verlag 2005

Abstract Expression of chloroplast genes is primarilyregulated posttranscriptionally, and a number of RNAelements, found in either the 5¢- or 3¢-untranslated re-gions (UTRs) of plastid mRNAs, that impact geneexpression have been identified. Complex regulatory andfeedback mechanisms influence both translation andprotein accumulation, making assignment of roles forspecific RNA elements difficult. To identify specificcontributions made by various UTRs on translation ofplastid mRNAs, we used a heterologous gfp reportergene that is fused combinatorially to chloroplast 5¢- and3¢-UTRs. In general, the 5¢-UTR, including the pro-moter, of the plastid atpA and psbD genes produced thehighest levels of chimeric mRNA and protein accumu-lation, while the 5¢-UTR of the rbcL and psbA genesproduced less mRNA and protein. Varying the 3¢-UTRhad little impact on mRNA and protein accumulation,as long as a 3¢-UTR was present. Overall, accumulationof chimeric mRNAs was proportional to protein accu-mulation, with a few notable exceptions. Light-regulatedtranslation continues to operate in chimeric mRNAscontaining the 5¢-UTR of either the psbA or psbD

mRNAs, despite translation of these two chimericmRNAs at very different efficiencies, suggesting thattranslational efficiency and light-regulated translationare separate events. Translation of some chimericmRNAs was much more efficient than others, suggestingthat interactions between the untranslated and codingsequences can dramatically impact translational effi-ciency.

Keywords 5¢-UTR Æ 3¢-UTR Æ Chloroplast Æ Geneexpression

Introduction

The chloroplast genomes of higher plants and algaeencode a number of genes required for photosynthesis,as well as the machinery necessary for the transcriptionand translation of these genes (Goldschmidt-Clermont1998). Chloroplast protein accumulation has beenshown to be impacted by transcription, RNA process-ing, message stability, translation, and protein turnover(Allison 2000; Monde et al. 2000; Rochaix 1996; Sugitaand Sugiura 1996; Zerges 2000). The regulation oftranslation has been identified as the key rate-limitingstep in adjusting chloroplast protein accumulation inresponse to both developmental and environmentalchanges (Bruick and Mayfield 1999; Eberhard et al.2002). The study of translation in the chloroplast hasfocused on identifying the components, both cis-actingRNA elements and trans-acting protein factors, requiredfor plastid translation.

The 5¢-UTRs of several chloroplast mRNAs havebeen shown to contain cis-acting RNA elements that arerequired for translation of the downstream coding re-gion (Anthonisen et al. 2001; Fargo et al. 1998; Higgset al. 1999; Hirose and Sugiura 2004; Klein et al. 1994;Mayfield et al. 1994; Nickelsen et al. 1999; Ossenbuhland Nickelsen 2000; Rochaix 1996; Salvador et al. 1993;Sugita and Sugiura 1996; Zou et al. 2003). In addition,ribosome binding sequences have been reported for

Communicated by R. Herrmann

D. Barnes Æ S. Franklin Æ J. Schultz Æ R. Henry Æ E. BrownA. Coragliotti Æ S. P. Mayfield (&)Department of Cell Biology and The Skaggs Institute for ChemicalBiology, The Scripps Research Institute, 10550 N. Torrey PinesRoad, La Jolla, CA 92037, USAE-mail: mayfield@scripps.eduTel.: +1-858-7849848Fax: +1-858-7849840

Present address: S. Franklin Æ J. SchultzRincon Pharmaceuticals Inc., 505 Coast Blvd. South,La Jolla, CA 92037, USA

Present address: E. BrownDepartment of Medicine, University of Cambridge,Addenbrooke’s Hospital, Cambridge, CB2 2QQ, UK

Present address: A. CoragliottiSolazyme Inc., 3475-T Edison Way, Menlo Park, CA 94025, USA

Mol Gen Genomics (2005) 274: 625–636DOI 10.1007/s00438-005-0055-y

several plastid mRNAs (Hirose and Sugiura 2004; Kimand Mullet 1994; Mayfield et al. 1994; Sugiura et al.1998), but appear to be lacking or nonessential forothers (Fargo et al. 1998; Hirose and Sugiura 2004;Sugiura et al. 1998). Most chloroplast mRNAs have anAU-rich 3¢-UTR with a terminal inverted repeat that hasbeen shown to function in mRNA processing and sta-bility, and in promoting translation initiation andpolysome association (Hayes et al. 1996; Memon et al.1996; Monde et al. 2000; Rott et al. 1998). Interactionsbetween the 5¢- and 3¢-UTRs have also been shown toimpact chloroplast translation (Katz and Danon 2002).

Trans-acting protein factors that affect chloroplastmRNA accumulation and translation have been identi-fied, and a number of nuclear-encoded genes requiredfor processing and stability of chloroplast mRNAs havebeen identified (Boudreau et al. 2000; Fisk et al. 1999;Meierhoff et al. 2003; Vaistij et al. 2000). Genetic anal-yses have also identified nuclear loci that affect transla-tion of specific chloroplast mRNAs, and several of thesenuclear genes have been cloned (Auchincloss et al. 2002;Barkan and Goldschmidt-Clermont 2000; Dauvilleeet al. 2003; Fisk et al. 1999; Rattanachaikunsopon et al.1999; Somanchi et al. 2005; Zerges 2000). To date, thespecific biochemical function of any of these factors re-mains unknown. Collectively, these data show thatchloroplast mRNA translation is regulated by interac-tions between cis-acting RNA elements, trans-actingprotein factors, and plastid ribosomes. Identifying all ofthe different RNA and protein components, and howthese components interact to impact chloroplast trans-lation, will be essential to understanding chloroplastgene expression.

Reporter genes have greatly enhanced our ability tomonitor gene expression in a number of biologicalorganisms, and recently we have achieved high levels ofreporter gene expression in C. reinhardtii chloroplast byoptimizing codon usage of gfp and luxCt reporter genes(Franklin et al. 2002; Mayfield and Schultz 2004). Tobetter understand the roles of specific RNA elements inchloroplast translation, we used the codon-optimizedgfp reporter gene to assay the impact of different 5¢- and3¢-UTRs on the expression of chloroplast genes.

The promoter and 5¢-UTRs of five C. reinhardtiichloroplast genes, atpA, rbcL, psbA, psbD and 16SrRNA, were fused to the gfp coding region, followed bythe 3¢-UTR of either the atpA, rbcL, psbA or tRNAarg

genes, in a combinatorial fashion to generate an array ofchimeric genes. By assembling this suite of expressioncassettes, all expressing the same reporter protein, wecould assay the effect of different UTRs on the accu-mulation of a single reporter protein, thus eliminatingany impact from protein turnover or other feedbackinfluences associated with endogenous protein se-quences. Examination of mRNA accumulation fromthis set of reporter constructs showed that each of thedifferent promoters and 5¢/3¢-UTRs drive accumulationof chimeric mRNAs at very different levels. Accumula-tion of chimeric mRNA was largely independent of the

3¢-UTR used, suggesting that mRNA accumulation isprimarily determined by the promoter and 5¢-UTR.Protein accumulation was in general proportional tomRNA accumulation. GFP protein accumulation wasvery different between chimeric mRNAs containingeither the psbA or psbD 5¢-UTR, while both chimerasretained light-regulated translation in a manner similarto their endogenous counterparts. This data suggeststhat translational efficiency and light-regulated transla-tion are separable events, and that while coding region/5¢-UTR interactions greatly influence the former, theyhave little impact on the latter.

Materials and methods

C. reinhardtii strains, transformation and growthconditions

Cultivation of C. reinhardtii transformants for analysisof GFP expression was carried out in TAP medium at23�C under constant illumination. Transformationswere carried out on C. reinhardtii strain 137c (mt+).Cells were grown to late log phase (approximately7 days) in the presence of 40 mM 5-Fluorodeoxyuridinein TAP medium at 23�C under constant illumination of4,000 lux (high light) on a rotary shaker set at 100 rpm.Fifty milliliters of cells were harvested by centrifugationat 4,000g at 4� for 5 min. The supernatant was decantedand cells resuspended in 4 ml TAP medium for sub-sequent chloroplast transformation by particle bom-bardment, as described previously in Cohen et al. (1998).All transformations were under spectinomycin selection(150 lg/ml), in which resistance was conferred by co-transformation with the spectinomycin resistance ribo-somal gene of plasmid p228 (Chlamydomonas StockCenter, Duke University).

Plasmid construction

All DNA and RNA manipulations were carried outessentially as described in Sambrook et al. (1989) andCohen et al. (1998). The coding region of codon optimizedgfp gene was synthesized as described (Franklin et al.2002). The 5¢ and 3¢ terminal primers used in this assemblycontained restriction sites for Nde I and Xba I, respec-tively. The rbcL promoter, 5¢- and 3¢-UTR used in thisstudy were previously described (Franklin et al. 2002).The atpA promoter and 5¢-UTR were generated asdescribed (Mayfield et al. 2003). The psbA promoter and5¢-UTR were generated as described (Mayfield andSchultz 2004). The atpA 3¢-UTR (371nt) was generated byPCR with forward (plus XbaI) and reverse (plusBamHI) primers, TCTAGATTTTAATTAAGTA-GGAACTCGGTATATGC and GGATCCCTGTAT-AAACAAAAATTTTTAATGTTAAC, respectively(CBA# X60298, nucleotides 1,366–1,395 and 1,765–1,737, respectively). The psbD promoter and 5¢-UTR was

626

made by PCR using a 5¢ oligo with a BamHI restrictionsite (GGATCCATGAAATTAAATGGGATATTTGG)and a 3¢ oligo containing a NdeI restriction site (CAT-ATGGTGTATCTCCAAAATAAAAAAAC). ThetRNAarg 3¢-UTR was generated by PCR using forwardand reverse primers, TCTAGATTATAATACATTA-AAATTGTAACGCC and GGATCCACTGGCGTC-CCAAATATATTAAAATG, respectively. The 16Spromoter and 5¢ UTR (400 nt) were generated by PCRusing the forward primer, GGATCCGTTGGCA-GGCAACAAATT, and the reverse primer, TCTA-GAACATATGTTTAAAGTTTAAATTTTG. Each ofthese chimeric genes was ligated into chloroplast trans-formation plasmid p322, as described in Franklin et al.(2002).

Southern and Northern blots

Southern blots and 32P labeling of DNA for use asprobes were carried out as previously described in Co-hen et al. (1998) and Sambrook et al. (1989). Radioac-tive probes used on Southern blots include the 0.7 kbNde I/Xba I gfp coding region (gfp probe, Fig. 1b), andthe 2.0 kb BamH I/Xho I fragment of p322 (p322 Bam-Xho probe, Fig. 1b). A 0.6 kb psbA cDNA probe and a

probe specific to the 16S rRNA were used to detect theirrespective messages on Northern blots. Northern andSouthern blots were visualized utilizing a PackardCyclone Storage Phosphor System equipped with Opti-quant software.

Normalization and analysis of mRNA visualized onNorthern blots

Triplicate gels were transferred to nylon membranesand hybridized with either gfp, psbA, or 16S radiola-beled probes. Signals were visualized followinghybridization with the gene-specific probes. UsingOptiquant software, total digital light units (DLU)were measured for regions of the same area in eachlane of the blot as well as an arbitrary space forbackground subtraction. The 16S message served as aninternal control to which chimeric gfp signals werenormalized. The levels of gfp mRNA accumulation areexpressed as percentages of the highest signal ob-tained, which is represented as 100. The values corre-spond to three sets of experiments. The standarderrors in Table 1 represent the deviations from theaverage of these three experiments for each transgenicstrain assayed.

Fig. 1 Schematic diagram ofchimeric genes used for theanalysis of 5¢- and 3¢-UTRs inplastid gene expression. a 5¢-UTRs (including promoterelements) were fused to acodon-soptimized gfp reportergene, and then to 3¢-UTRs. bThe site of integration into theC. reinhardtii chloroplastgenome of the chimeric genesspans the 5.7 kb EcoR I to XhoI fragment of the invertedrepeat region. The relevantrestriction enzyme sites areindicated and the double blackarrows represent the probesused for southern blot analysis

627

Western blots

Proteins were isolated from C. reinhardtii utilizing abuffer containing 750 mM TrisÆCl, pH 8.0, 15% sucrose(wt/vol), 100 mM b mercaptoethanol, 1 mM phen-ylmethylsulfonylfluoride (PMSF). Samples were thencentrifuged 20,000g for 30 min at 4�C. Twenty micro-grams of total soluble proteins was used in Western blotanalysis. Regions from duplicate 12% SDS-PAGE gelswere blotted onto the same nitrocellulose membrane.Western blots were carried out as described in Cohenet al. (1998) using a rabbit anti-GFP primary antibody(Sigma) and an alkaline phosphatase-conjugated goatanti-rabbit secondary antibody (Sigma). The blots weresubsequently decorated with a rabbit anti-Rubiscoantibody followed again by an alkaline phosphatase-conjugated goat anti-rabbit secondary antibody.

Normalization and analysis of protein visualizedon Western blots

Gels were transferred to nitrocellulose membranes anddecorated with GFP antisera first, followed by Rubiscoantisera. GFP and Rubisco protein signals were quan-tified and background subtracted using an AlphaInnotech Corporation AlphaImager system andaccompanying imaging software (FC8000). The Rubiscosignals served as internal controls to which chimericGFP protein accumulation in each strain was normal-ized. The levels of GFP protein accumulation are ex-pressed as percentages of the highest signal obtained,which is represented as 100. The values correspond tothree sets of experiments. The standard errors in Table 1represent the deviations from the average of these threeexperiments for each transgenic strain assayed.

Dark to light shift of psbA- and psbD-gfp strains

Approximately equal cells of the psbA-gfp and psbD-gfpstrains were inoculated into liquid TAP media and

grown for 7 days in the dark. One sixth of the cell vol-ume was harvested by centrifugation and the remainderplaced under constant illumination of 6,000 lux. Equalvolumes of cells were harvested after 1, 3, 6, 24, and 48 hof growth. Following harvest, cells were lysed by soni-cation in protein extraction buffer, membrane proteinswere removed by centrifugation, and equal amounts ofsoluble proteins were separated by SDS-PAGE. Proteinswere either stained with Coomassie blue or subjected toWestern blot analysis using GFP antisera as describedabove.

Results

Construction of gfp reporter genes containingthe 5¢- and 3¢-UTRs of chloroplast genes

To determine the contribution of individual 5¢- and 3¢-UTRs in chloroplast gene expression, we generated anarray of gfp reporter constructs. As diagrammed inFig. 1a, we made these constructs using a combinatorialapproach in which the promoter and 5¢-UTRs from theatpA, rbcL, psbA, psbD and 16S rRNA were fused tothe gfp coding region (Franklin et al. 2002) followed bythe 3¢-UTR of the atpA, rbcL, psbA or tRNAarg genes togenerate an array of chimeric genes. A total of 10 dif-ferent constructs were generated (listed in Table 1),including a set that contained the atpA 5¢-UTR withthree different 3¢-UTRs, a set that contained the psbA 3¢-UTR with four 5¢-UTRs, and another set that containedthe rbcL 3¢-UTR with four different 5¢-UTRs. Owing tothe fact that all of these reporter constructs contain theidentical coding regions, we can assess the cumulativeimpact exerted by combinations of 5¢- and 3¢-UTRs onboth mRNA and protein accumulation independent ofany influences exerted by endogenous coding sequences.In an indirect way, we can also infer the translationalefficiency exerted by these 5¢- and 3¢-UTR sequences asGFP protein turnover should be the same in each strain,and thus net GFP accumulation can be assumed to bethe result of the efficiency with which each 5¢-UTR-gfp-3¢-UTR mRNA is translated. These chimeric mRNAsthus allowed us to compare the relative impact of dif-ferent 5¢- and 3¢-UTRs on mRNA accumulation andtranslation. Table 1 contains the complete list of con-structs examined in this study.

Southern blot analysis of gfp transformants

As shown in Fig. 1b, each of the reporter constructslisted in Table 1 were ligated into the BamHI site of thechloroplast transformation vector p322 (Franklin et al.2002). The constructs were transformed individually intowt C. reinhardtii chloroplasts by particle bombardmentalong with the p228 plasmid (confers spectinomycinresistance) as a means of selection. Insertion of any

Table 1 Relative accumulation of gfp RNA and GFP protein inthe transgenic strains. The levels of RNA and protein accumulationwere normalized to 16S and Rubisco, respectively. The numbersrepresent percentages of the highest levels of RNA and proteinaccumulation, psbD-gfp-psbA and atpA-gfp-psbA, respectively

Construct RNA Protein

atpA-gfp-atpA 53±3 77±5atpA-gfp-rbcL 72±3 65±3atpA-gfp-psbA 94±5 100rbcL-gfp-rbcL 51±2 14±7rbcL-gfp-psbA 11±1 18±1rbcL-gfp-tRNA 2±1 5±1psbA-gfp-psbA 27±2 10±5psbA-gfp-rbcL 9±2 0psbD-gfp-psbA 100 72±716S-gfp-rbcL 71±5 0

628

reporter gene proceeds via homologous recombination,and all of the reporter constructs were integrated at thesame location within the chloroplast genome, thus pre-venting any variation in gene expression due to positioneffects. Primary transformants were screened for thepresence of the gfp gene by Southern blot analysis. Po-sitive transformants were taken through additionalrounds of selection to isolate homoplasmic lines inwhich all copies of the chloroplast genome contained theintroduced chimeric gfp gene. Genomic DNA from wtand each of the gfp transformants was digested withEcoRI and XhoI, resolved on agarose gels, transferredto nylon membranes, and subjected to Southern blotanalysis. As shown in Fig. 2 (left panel), each of thetransformants contains a gfp hybridizing band of thepredicted size, while the wild-type strain shows no signalwith the gfp coding region probe (gfp probe, Fig. 1b).Hybridization with a BamHI–XhoI fragment from thep322 plasmid (Bam-Xho probe, Fig. 1b) identifies asingle band in wt and each of the transformants (Fig. 2right panel), showing that each strain is homoplasmicfor a correctly integrated gfp gene. Each of these bandsis of the predicted size for integration of the gfp gene atthe p322 site in the chloroplast genome. The failure todetect a wt band of 5.7 kb in DNA isolated from any ofthe transgenic lines indicates that they are all homo-plasmic. At least four transformants were examined foreach transgene and a single transgenic strain represent-ing an average of the lines was characterized in thisstudy.

Accumulation of chimeric gfp mRNA in transgenicstrains

The accumulation of chimeric gfp mRNAs in transgenicC. reinhardtii chloroplasts was measured by Northernblot analysis of total RNA. Ten micrograms of totalRNA isolated from wt and each of the transgenic lineswas resolved on denaturing agarose gels and transferredto nylon membranes. Uniform transfer of RNA wasconfirmed by Methylene blue staining of the membrane

(Fig. 3, stain panel). Duplicate blots were hybridizedwith either a [32P]-labeled probe specific to gfp (Fig. 3gfp probe), or a 16S rRNA probe (Fig. 3 16S probe) fornormalization. Each of the strains accumulate totalRNA (stained bands) and 16S rRNA to similar levels,demonstrating that equal amounts of RNA were loadedfor each lane and that mRNA accumulation is normal inthe transgenic lines. Gfp mRNA signals were quantifiedand normalized using Optiquant software (described inMethods), and the counts obtained were expressed aspercentages of accumulation relative to the highest gfpsignal (100%, psbD-gfp-psbA).

Hybridization with the gfp-specific probe showed thatthe transgenic lines accumulate gfp mRNA to differentlevels. The variation in transcript sizes are due to thedifferent lengths of the untranslated regions (UTRs) thatflank gfp. The highest levels of mRNA accumulationwere achieved using the atpA, psbD, and 16S rRNApromoter and 5¢-UTRs to drive GFP expression (Fig. 3lanes 2–4, 10 and 11). The atpA promoter and 5¢-UTRconstructs all produced high levels of gfp mRNA accu-mulation regardless of the 3¢-UTR used (Fig. 3 lanes2–4). The corresponding levels of mRNA accumulationwere 53%, 72%, and 94% (relative to psbD-gfp-psbA)for atpA-gfp-atpA, atpA-gfp-rbcL, and atpA-gfp-psbA,respectively. Accumulation of gfp mRNA from con-structs that contained the rbcL promoter and 5¢-UTRvaried more than those containing the atpA 5¢-UTR, andall of the rbcL 5¢-UTR chimeric mRNAs accumulated tolower levels than the atpA 5¢-UTR mRNAs (Fig. 3,lanes 5–7). The levels of mRNA accumulation for rbcL-gfp-rbcL, rbcL-gfp-psbA, and rbcL-gfp-tRNA were 51%,11%, and 2% (relative to psbD-gfp-psbA), respectively.The psbA promoter and 5¢-UTR resulted in fairly lowgfp mRNA accumulation (Fig. 3, lanes 8 and 9), anddifferences in mRNA accumulation were also observedbetween the different 3¢-UTRs, psbA (27%) and rbcL(9%). Message accumulation for both psbA and rbcL 5¢-UTRs was greatest when their respective 3¢-UTRs werepresent in the same construct. Accumulation of chimericgfp mRNA from the psbD and 16S promoter and5¢-UTR constructs was quite good (100% and 71%,

Fig. 2 Southern blot analysis ofchimeric gfp chloroplasttransformants. C. reinhardtiiDNA was prepared asdescribed in experimentalprocedures, digestedsimultaneously with EcoR I andXho I, and subjected toSouthern blot analysis. Filterswere hybridized with either agfp cDNA probe (left panel) orwith a chloroplast genomicDNA fragment locatedadjacent to the integration site(right panel)

629

respectively) (lanes 10 and 11). No variation in 3¢ endswas assayed for these two promoter and 5¢-UTR con-structs.

Analysis of GFP protein accumulation in transgenicC. reinhardtii chloroplasts

To determine whether GFP protein accumulation cor-related with gfp mRNA levels in the transgenic lines, wemeasured GFP accumulation by Western blot analysis.Twenty micrograms of total soluble protein (tsp) fromwt and the transgenic lines was separated by SDS-PAGE. The Coomassie stain gel (Fig. 4, top panel)shows that equal amounts of protein were loaded in eachlane, and that the transgenic lines accumulate a similarset of proteins as compared to wt. The SDS-PAGE gels(15–115 kDa) were transferred to nitrocellulose mem-brane and hybridized with GFP antisera first, and thenwith Rubisco antisera as an internal control. GFP Sig-nals were quantified and normalized to Rubisco usingimaging software (Alpha Innotech Corporation), andthe counts obtained were expressed as percentages ofaccumulation relative to the highest signal (100%, atpA-gfp-psbA).

Western blot analysis using Rubisco antisera indi-cated that all strains accumulate Rubisco (Rubiscopanel) to similar levels. Analysis using GFP antiserashowed varying levels of GFP accumulation in each of

the transgenic strains assayed (Fig 4, GFP panel). NoGFP signal was observed in the wt C. reinhardtii lane, asexpected. GFP accumulated to similar high levels ineach of the atpA 5¢-UTR constructs (Fig 4, lane 2–4),with corresponding values of 77%, 65%, and 100%(relative to atpA-gfp-psbA) for atpA-gfp-atpA, atpA-gfp-rbcL, and atpA-gfp-psbA, respectively. High levels ofGFP accumulation (72%) was also observed in thepsbD-gfp-psbA construct (Fig. 4, lane 12), whereas GFPaccumulation in the rbcL constructs (Fig 4, lanes 5–7)was significantly lower; 14%, 18%, and 5% for rbcL-gfp-rbcL, rbcL-gfp-psbA, and rbcL-gfp-tRNAarg,respectively. These levels are consistent with the reducedmRNA accumulation observed for these strains. Like-wise, low levels of GFP accumulation were observed forthe psbA-gfp-psbA and psbA-gfp-rbcL constructs (10%and 0%, respectively; relative to atpA-gfp-psbA). The16S ribosomal RNA promoter showed no proteinaccumulation, as expected, because the 5¢ end of rRNAis not expected to contain any of the elements requiredfor translation.

Levels of gfp mRNA correlate with GFP proteinaccumulation

Quantitatively, it appeared that high message levels, asseen in the atpA 5¢-UTR and promoter constructs, resultin high GFP protein accumulation. Conversely, low

Fig. 3 Detection of gfp mRNAaccumulation in transgenic C.reinhardtii strains. Total RNAisolated from untransformed(wt) and gfp transformants wasseparated on denaturingagarose gels and blotted tonylon membrane. Themembranes were stained withmethylene blue (rRNA) andhybridized with either a gfpcDNA or 16S probe asindicated on the right of thepanel

630

message levels, as observed in the rbcL and psbA 5¢-UTRs and promoters, result in low proteinaccumulation. In order to determine whether there was acorrelation between chimeric gfp mRNA accumulationand GFP protein, we plotted the normalized values foreach transgene combination. As seen in Fig. 5A, thereappears to be a linear relationship between message andprotein accumulation in these chimeras, with a trendliner2 value of 0.8 for the observed data. It is quite clear thatthe linear relationship is better represented by the atpA5¢-UTR transgenic strains, while the other lines show adecreased correlation. The circled point corresponds tothe 16S-gfp-psbA transgenic strain, which does not makeany GFP protein and was excluded from the correlationcalculation because 16S rRNA chimeric mRNAs are notexpected to be translated.

GFP message and protein accumulation in chimericstrains is dependent on the 5¢-UTR

The combinatorial assembly of chimeric genes allowedus to examine the specific contribution of individual 5¢-UTRs and 3¢-UTRs. In order to determine the relativeeffects of a 5¢-UTR and promoter on gfp accumulation,we examined mRNA (left bar, light gray) and proteinaccumulation (right bar, dark gray) in three strains witha common 5¢-UTR and different 3¢-UTRs; atpA-gfp-atpA, atpA-gfp-rbcL, and atpA-gfp-psbA. To investigatethe effect of a common 3¢-UTR on mRNA and proteinaccumulation, we measured mRNA and protein accu-mulation in three transgenic strains with a common

3¢-UTR and four different 5¢-UTRs (rbcL-gfp-rbcL,atpA-gfp-rbcL, psbA-gfp-rbcL, and 16S-gfp-rbcL).Maintaining the 5¢-UTR and varying the 3¢-untranslatedregion had little effect on both gfp mRNA and proteinaccumulation (Fig. 5b, left side), with the levels ofmessage and protein changing 1.3-fold, and 1.7-fold,respectively. However, when the 3¢-UTR was main-tained and the 5¢-UTR was varied, we observed a dra-matic change in both message and protein accumulation(Fig. 5b, right side). The levels of gfpmessage showed an8-fold difference while GFP protein accumulation variedmore than 65-fold. Similar results were obtained withthe four constructs containing the psbA 3¢-UTR, inwhich protein accumulation showed a 75-fold difference.These data suggest that the 5¢-UTR has a significantlygreater impact on heterologous message and proteinaccumulation than the 3¢-UTR.

Chimeric mRNAs respond to environmental changessimilar to endogenous mRNAs

Both the endogenous psbA and psbD mRNAs showlight-regulated translation, and we have previouslyshown that luciferase driven by the psbA 5¢-UTR accu-mulates in a light-dependent manner (Mayfield andSchultz 2004). The accumulation of GFP protein fromthe chimeric psbA and psbD 5¢ -UTRs is dramaticallydifferent, while protein accumulation from the endoge-nous psbA and psbD mRNAs is very similar (Herrinet al. 1986). Therefore, we wanted to see whether the twochimeric genes retained an ability to be light-regulated in

Fig. 4 Detection of GFPprotein accumulation intransgenic C. reinhardtii strains.Twenty micrograms of totalsoluble protein from wt and gfptransgenic lines was separatedon 12% SDS PAGE andstained with Coomassie blue(lower panel), or blotted tonitrocellulose membranes anddecorated with both GFP(upper panel) and Rubisco(lower panel) antisera. Proteinswere visualized on Westernblots by alkaline phosphataseactivity. A dilution series ofpsbD-gfp-psbA is loaded at theright to assist in GFPquantitation

631

spite of the dramatic differences between the two interms of translation efficiency.

The chimeric psbA-gfp-psbA and psbD-gfp-psbAtransformants were grown in liquid TAP media for7 days in the dark. One sixth of the cells were harvestedand the remaining were shifted into bright light. Anequal volume of cells was harvested at 1, 3, 6, 24 and48 h of light growth. The cells were harvested as de-scribed in the Methods, and total soluble proteins wereseparated by SDS-PAGE and analyzed by Western blotfor GFP protein accumulation. The psbA strain showedmuch less GFP protein accumulation than the psbDstrain; therefore, four times the amount of protein wasloaded for the psbA samples compared to the psbDsamples. As shown in Fig. 6, cells grown in the dark for7 days have relatively low levels of GFP accumulationfor both the psbA and psbD lines. Shifting cells into lightresulted in the rapid accumulation of GFP protein forboth strains, with GFP accumulation increasing at least6-fold after 48 h of light exposure. These data demon-strate that the chimeric mRNAs retain their ability forlight-activated translation, even though the chimericmRNAs are not translated at the same rate, nor at thesame rate as their endogenous counterparts.

Discussion

Plastid gene expression is primarily regulated duringtranslation, and genetic and biochemical analyses haveidentified a number of cis-acting RNA elements andtrans-acting protein factors that are essential compo-nents of this process (Rochaix 1996; Sugita and Sugiura1996; Zerges 2000). Regulatory and feedback mecha-nisms are integral to chloroplast gene expression andfunction to insure stoichiometric accumulation of pro-teins within plastids to maintain photosynthetic effi-ciency. Assigning specific roles to individual RNAelements is difficult because of these complex interac-tions and feedback mechanisms. To better understandthe roles of untranslated regions in chloroplast transla-tion, and to separate the influence of RNA elementsfrom downstream feedback mechanisms, we utilized re-porter gene technology and a combinatorial approach todefine the relative impact of 5¢- and 3¢-UTRs in chlo-roplast translation, independent of internal mechanismsthat would normally act on endogenous proteins toregulate their accumulation. Using this system, we as-sayed the relative impact of five different promoters and

Fig. 5 Analysis of GFP mRNAand protein accumulation.Message and protein levels werenormalized to 16S and Rubisco,respectively. Correspondingvalues represent fractions of thehighest signal measured. a Thetrendline r2 value is 0.8indicating a linear relationshipbetween message and proteinaccumulation. b Bar graphdisplays GFP mRNA andprotein levels with either thesame 5¢- or 3¢-UTR combinedwith different 3¢- and 5¢-UTRs,respectively

632

5¢-UTRs, and four different 3¢-UTRs, on chloroplastmRNA accumulation and translation.

The general conclusion from this study is thattranslation and mRNA accumulation are determinedprimarily by the promoter and 5¢-UTR. The 3¢-UTRcontributes relatively little to recombinant proteinaccumulation, provided a 3¢-untranslated region ispresent. We observed that recombinant message accu-mulation correlates well with recombinant proteinaccumulation, with a few notable exceptions. It is alsoapparent that translational efficiency and light-regulatedtranslation are separable events.

There are several factors that may contribute to re-combinant protein accumulation including gene copynumber, transcription, message stability, translation,and protein turnover. Recent work investigating factorsthat affect the accumulation of endogenous proteins inC. reinhardtii chloroplast showed that translation is rate-limiting (Choquet and Wollman 2002), and that mRNAaccumulation has relatively little correlation with pro-tein accumulation (Eberhard et al. 2002). Previousobservations in which expression of reporter genes weredriven by three different 5¢-UTRs also showed thatprotein accumulation did not parallel accumulation ofthe corresponding mRNAs (Blowers et al. 1990; Ishik-ura et al. 1999; Kasai et al. 2003; Salvador et al. 1993).Here, we show a fairly good correlation between mRNAaccumulation and protein accumulation, best repre-sented by the atpA 5¢-UTR transgenic strains. Theseobservations may not be contradictory. While synthesisof endogenous chloroplast proteins shows little sensi-tivity to mRNA levels, it is plausible that recombinantprotein synthesis shows an increased sensitivity tomRNA levels due to their poor translational efficiency.Increasing recombinant message levels may be necessaryto overcome the poor translation of chimeric mRNAs.This translatability issue might stem from a competitionfor endogenous translation factors, or may reflect effects

of interactions between coding regions and UTRs onplastid mRNA translation. The insertion of chimericprotein coding regions for endogenous ones may changethe overall fold of the RNA and disrupt essential RNA–RNA interactions, thereby leading to a reduced trans-lation (Singh et al. 2001). Alternative splicing of the rbcL5¢-UTR of barley chloroplasts has been shown to impactthe availability of translatable rbcL mRNA (Reinbotheet al. 1993). The transcript extension was hypothesizedto inhibit translation initiation due to competition withother cis-acting elements in the 5¢-UTR that limitedribosomal subunit binding. We have examined each ofthe chimeric mRNAs using the Zuker mfold program(Zuker 2003) to identify whether novel RNA structuresare formed in the chimeric mRNAs, but this analysis hasnot revealed any new RNA–RNA interactions thatcould account for the observed differences in translationefficiency of the chimeric mRNAs compared to wtmRNAs.

It has previously been reported that efficient trans-lation of chimeric messages in tobacco chloroplast isdependent on the 5¢ leader rather than the 3¢trailer (Eiblet al. 1999). In C. reinhardtii plastids, we show thatdifferent 5¢-UTRs result in significant differences in re-combinant message and protein accumulation, whereasthe 3¢-UTR appears to impact mRNA and proteinaccumulation relatively little. An authentic mRNA 3¢-UTR appears to be required for mRNA accumulation,because no message accumulation was observed whenwe fused a 3¢ region from a tRNA gene downstream ofrbcL-gfp. RNA secondary structures in the 3¢-UTR havebeen shown to function in mRNA stabilization, 3¢ for-mation, transcription termination, and message accu-mulation in C. reinhardtii chloroplasts (Blowers et al.1993; Rott et al. 1998; Stern et al. 1991). The findingsthat deletion of the 3¢ stem-loop structure of the atpBmRNA resulted in a significant decrease of atpBmRNA,but not in elimination of the protein (Stern et al. 1991),

Fig. 6 Accumulation of GFP inpsbA and psbD driventransgenic lines following a shiftfrom dark into light growth.Equal amounts of protein wereloaded for each sample. Fourtimes the amount of protein wasloaded for the psbAtransformants, and the Westernblot was allowed to developlonger so that a similar signalwas obtained in each panel,even though the psbAtransformants contain less than1/10 of the GFP as compared tothe psbD transformants

633

suggests that 3¢-UTRs may not be required for proteinsynthesis. We also observe protein accumulation in therbcL-gfp-tRNA construct, suggesting again that the 3¢-UTRs are not essential for protein synthesis even thoughthey may influence mRNA accumulation. In our studies,the atpA promoter and 5¢-UTR, in combination withthree different 3¢-UTRs, had similar amounts of messageand protein accumulation for each transgenic strainexamined. This was also true for the rbcL 5¢-UTR incombination with three different 3¢-UTRs, showing thatvarying the 3¢-UTR had little impact on mRNA orprotein accumulation. Differences in mRNA accumula-tion do not appear to be associated with differences inpromoter strength, as previous observations showed thatthe transcription rates for endogenous chloroplast genesare very similar (Blowers et al. 1990). Conversely,maintaining the rbcL 3¢-UTR in combination with fourdifferent 5¢-UTRs (atpA, rbcL, psbA, and 16S) resultedin dramatic changes in GFP message and protein accu-mulation. Together, these data show that the 5¢-UTRimpacts mRNA and protein accumulation of chimerictransgenes to a much greater degree than do 3¢-UTRs.

It is not difficult to imagine the coding regions ofrespective mRNAs influencing RNA secondary struc-ture, thereby affecting protein or ribosome binding tothe mRNA. Work in our laboratory has shown that asingle 5¢-UTR, in combination with different proteincoding regions, directs translation of each coding regionat different efficiencies, resulting in uneven proteinaccumulation from a single promoter and 5¢-UTR(Franklin et al. 2002; Mayfield et al. 2003; Mayfield andSchultz 2004). Kuroda and Maliga (2001) demonstratedthat sequences downstream of the translation initiationcodon could be important determinants of translationefficiency in chloroplasts. This was also true for trans-formants containing chimeric genes fused to the codingregion of endogenous genes in C. reinhardtii, in whichincreased levels of chimeric uidA mRNA were achievedwhen protein coding sequences were added, in contrastto chimeric fusions that contained the promoter and 5¢-UTR alone (Blowers et al. 1990; Kasai et al. 2003). Thehighest levels of GFP expression in our transgenicstrains were obtained with the atpA and psbD promotersand 5¢-UTRs, and much lower protein accumulationwas observed under control of rbcL and psbA. Kasai andcolleagues showed that using atpA and psbD proteincoding sequences in chimeric transgenes did not affectheterologous gene expression, whereas transgenic con-structs containing psbA and rbcL coding regions showedmore of a dependence on these sequences (Kasai et al.2003). Perhaps the rbcL and psbA UTRs interact withthe GFP or GUS coding regions in such a way as to limittranslation of these chimeric mRNAs. For example,these heterologous coding sequences may prevent theformation of RNA secondary structures that are rec-ognized by translation factors or that position theribosome at the initiation codon. Whatever be themolecular mechanisms for altered translation, our dataclearly show that interactions between coding regions

and 5¢-UTR can dramatically impact chloroplast trans-lation.

Translational regulation in response to light has beenobserved for the endogenous psbA and psbD mRNAs(Herrin et al. 1986; Malnoe et al. 1988), and the psbA 5¢-UTR confers light-regulated translation on a reportergene in C. reinhardtii (Mayfield and Schultz 2004) andtobacco chloroplasts (Staub and Maliga 1993). We showhere that both the chimeric psbA and psbD 5¢-UTRsdrive accumulation of GFP protein in a similar light-dependent manner (Fig. 6). However, unlike theirendogenous counterparts (Herrin et al. 1986; Malnoeet al. 1988), the chimeric mRNAs are not translated atthe same rate, with psbD-gfp synthesized almost 20 timesgreater than psbA-gfp. These data show that the psbAand psbD 5¢-UTRs contain the necessary elements torespond to external cues, and also show that light-reg-ulated translation is independent of translation effi-ciency. The uncoupling of light-regulated translationfrom translation rate suggests that the two processes areseparable events, perhaps acting independent of oneanother or perhaps sequentially, but clearly not acting asa single event.

Interactions between 5¢- and 3¢-UTRs mediated byRNA binding proteins has been shown to play impor-tant roles in the translation and stabilization of tran-scripts (Gallie 1998; Wells et al. 1998). Oftentimes, thecircularization of mRNAs by translation initiation fac-tors and RNA binding proteins, such as poly (A) bind-ing protein (PABP), serve as prerequisites for efficienttranslation initiation. Combining different 5¢- and 3¢-UTRs, as well as coding regions, may disrupt these long-range interactions, leading to decreased message andprotein accumulation. Moreover, chloroplast promotersmay be incompatible with certain coding sequences andmay lack elements to efficiently drive foreign genetranscription. To fully understand the rules governingrecombinant protein accumulation in chloroplast, theidentification of all the factors influencing translation ofplastid messages will be essential. Future studies toexamine the connections between the 5¢-UTR and cod-ing region, mediated by these RNA–RNA and RNA–protein interactions, should shed light on endogenousand recombinant protein expression in chloroplast, andallow us to better understand the molecular mechanismsthat regulate plastid translation.

Acknowledgements We thank Veronica Beligni for a critique of themanuscript. This work was supported by funds from the U.S.Department of Energy (93ER70116) and the National Institutes ofHealth (GM54659). Dwight Barnes was supported by BauceFoundation and Skaggs Fellowships. The work has been carriedout in compliance with the current laws governing genetic experi-mentation in the USA.

References

Allison LA (2000) The role of sigma factors in plastid transcription.Biochimie 82:537–548

634

Anthonisen IL, Salvador ML, Klein U (2001) Specific sequenceelements in the 5¢ untranslated regions of rbcL and atpB genemRNAs stabilize transcripts in the chloroplast of Chlamydo-monas reinhardtii. RNA 7:1024–1033

Auchincloss AH, Zerges W, Perron K, Girard-Bascou J, RochaixJD (2002) Characterization of Tbc2, a nucleus-encoded factorspecifically required for translation of the chloroplast psbCmRNA in Chlamydomonas reinhardtii. J Cell Biol 157:953–962

Barkan A, Goldschmidt-Clermont M (2000) Participation of nu-clear genes in chloroplast gene expression. Biochimie 82:559–572

Blowers AD, Ellmore GS, Klein U, Bogorad L (1990) Transcrip-tional analysis of endogenous and foreign genes in chloroplasttransformants of Chlamydomonas. Plant Cell 2:1059–1070

Blowers AD, Klein U, Ellmore GS, Bogorad L (1993) Functionalin vivo analyses of the 3¢ flanking sequences of the Chlamydo-monas chloroplast rbcL and psaB genes. Mol Gen Genet238:339–349

Boudreau E, Nickelsen J, Lemaire SD, Ossenbuhl F, Rochaix JD(2000) The Nac2 gene of Chlamydomonas encodes a chloroplastTPR-like protein involved in psbD mRNA stability. Embo J19:3366–3376

Bruick RK, Mayfield SP (1999) Light-activated translation ofchloroplast mRNAs. Trends Plant Sci 4:190–195

Choquet Y, Wollman FA (2002) Translational regulations asspecific traits of chloroplast gene expression. FEBS Lett529:39–42

Cohen A, Yohn CB, Bruick RK, Mayfield SP (1998) Translationalregulation of chloroplast gene expression in Chlamydomonasreinhardtii. Methods Enzymol 297:192–208

Dauvillee D, Stampacchia O, Girard-Bascou J, Rochaix JD (2003)Tab2 is a novel conserved RNA binding protein required fortranslation of the chloroplast psaB mRNA. Embo J 22:6378–6388

Eberhard S, Drapier D, Wollman FA (2002) Searching limitingsteps in the expression of chloroplast-encoded proteins: rela-tions between gene copy number, transcription, transcriptabundance and translation rate in the chloroplast of Chla-mydomonas reinhardtii. Plant J 31:149–160

Eibl C, Zou Z, Beck A, Kim M, Mullet J, Koop HU (1999) In vivoanalysis of plastid psbA, rbcL and rpl32 UTR elements bychloroplast transformation: tobacco plastid gene expression iscontrolled by modulation of transcript levels and translationefficiency. Plant J 19:333–345

Fargo DC, Zhang M, Gillham NW, Boynton JE (1998) Shine-Dalgarno-like sequences are not required for translation ofchloroplast mRNAs in Chlamydomonas reinhardtii chloroplastsor in Escherichia coli. Mol Gen Genet 257:271–282

Fisk DG, Walker MB, Barkan A (1999) Molecular cloning of themaize gene crp1 reveals similarity between regulators of mito-chondrial and chloroplast gene expression. Embo J 18:2621–2630

Franklin S, Ngo B, Efuet E, Mayfield SP (2002) Development of aGFP reporter gene for Chlamydomonas reinhardtii chloroplast.Plant J 30:733–744

Gallie DR (1998) A tale of two termini: a functional interactionbetween the termini of an mRNA is a prerequisite for efficienttranslation initiation. Gene 216:1–11

Goldschmidt-Clermont M (1998) Coordination of nuclear andchloroplast gene expression in plant cells. Int Rev Cytol177:115–180

Hayes R, Kudla J, Schuster G, Gabay L, Maliga P, Gruissem W(1996) Chloroplast mRNA 3¢-end processing by a high molec-ular weight protein complex is regulated by nuclear encodedRNA binding proteins. Embo J 15:1132–1141

Herrin DL, Michaels AS, Paul AL (1986) Regulation of genesencoding the large subunit of ribulose-1,5-bisphosphate car-boxylase and the photosystem II polypeptides D-1 and D-2during the cell cycle of Chlamydomonas reinhardtii. J Cell Biol103:1837–1845

Higgs DC, Shapiro RS, Kindle KL, Stern DB (1999) Small cis-acting sequences that specify secondary structures in a chloro-plast mRNA are essential for RNA stability and translation.Mol Cell Biol 19:8479–8491

Hirose T, Sugiura M (2004) Functional Shine-Dalgarno-like se-quences for translational initiation of chloroplast mRNAs.Plant Cell Physiol 45:114–117

Ishikura K, Takaoka Y, Kato K, Sekine M, Yoshida K, ShinmyoA (1999) Expression of a foreign gene in Chlamydomonasreinhardtii chloroplast. J Biosci Bioeng 87:307–314

Kasai S, Yoshimura S, Ishikura K, Takaoka Y, Kobayashi K,Kato K, Shinmyo A (2003) Effect of coding regions on chlo-roplast gene expression in Chlamydomonas reinhardtii. J BiosciBioeng 95:276–282

Katz YS, Danon A (2002) The 3¢-untranslated region of chloro-plast psbA mRNA stabilizes binding of regulatory proteins tothe leader of the message. J Biol Chem 277:18665–18669

Kim J, Mullet JE (1994) Ribosome-binding sites on chloroplastrbcL and psbA mRNAs and light-induced initiation of D1translation. Plant Mol Biol 25:437–448

Klein U, Salvador ML, Bogorad L (1994) Activity of the Chla-mydomonas chloroplast rbcL gene promoter is enhanced by aremote sequence element. Proc Natl Acad Sci U S A 91:10819–10823

Kuroda H, Maliga P (2001) Sequences downstream of the trans-lation initiation codon are important determinants of transla-tion efficiency in chloroplasts. Plant Physiol 125:430–436

Malnoe P, Mayfield SP, Rochaix JD (1988) Comparative analysisof the biogenesis of photosystem II in the wild-type and Y-1mutant of Chlamydomonas reinhardtii. J Cell Biol 106:609–616

Mayfield SP, Cohen A, Danon A, Yohn CB (1994) Translation ofthe psbA mRNA of Chlamydomonas reinhardtii requires astructured RNA element contained within the 5¢ untranslatedregion. J Cell Biol 127:1537–1545

Mayfield SP, Franklin SE, Lerner RA (2003) Expression andassembly of a fully active antibody in algae. Proc Natl Acad SciUSA 100:438–442

Mayfield SP, Schultz J (2004) Development of a luciferase reportergene, luxCt, for Chlamydomonas reinhardtii chloroplast. Plant J37:449–458

Meierhoff K, Felder S, Nakamura T, Bechtold N, Schuster G(2003) HCF152, an Arabidopsis RNA binding pentatricopep-tide repeat protein involved in the processing of chloroplastpsbB-psbT-psbH-petB-petD RNAs. Plant Cell 15:1480–1495

Memon AR, Meng B, Mullet JE (1996) RNA-binding proteins of37/38 kDA bind specifically to the barley chloroplast psbA 3¢-end untranslated RNA. Plant Mol Biol 30:1195–1205

Monde RA, Schuster G, Stern DB (2000) Processing and degra-dation of chloroplast mRNA. Biochimie 82:573–582

Nickelsen J, Fleischmann M, Boudreau E, Rahire M, Rochaix JD(1999) Identification of cis-acting RNA leader elements re-quired for chloroplast psbD gene expression in Chlamydomonas.Plant Cell 11:957–970

Ossenbuhl F, Nickelsen J (2000) cis- and trans-Acting determinantsfor translation of psbD mRNA in Chlamydomonas reinhardtii.Mol Cell Biol 20:8134–8142

Rattanachaikunsopon P, Rosch C, Kuchka MR (1999) Cloningand characterization of the nuclear AC115 gene of Chlamydo-monas reinhardtii. Plant Mol Biol 39:1–10

Reinbothe S, Reinbothe C, Heintzen C, Seidenbecher C, Parthier B(1993) A methyl jasmonate-induced shift in the length of the 5¢untranslated region impairs translation of the plastid rbcLtranscript in barley. Embo J 12:1505–1512

Rochaix JD (1996) Post-transcriptional regulation of chloroplastgene expression in Chlamydomonas reinhardtii. Plant Mol Biol32:327–341

Rott R, Liveanu V, Drager RG, Stern DB, Schuster G (1998) Thesequence and structure of the 3¢-untranslated regions of chlo-roplast transcripts are important determinants of mRNAaccumulation and stability. Plant Mol Biol 36:307–314

635

Salvador ML, Klein U, Bogorad L (1993) 5¢ sequences areimportant positive and negative determinants of the longevityof Chlamydomonas chloroplast gene transcripts. Proc NatlAcad Sci U S A 90:1556–1560

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: alaboratory manual. Cold Spring Harbor Laboratory Press,New York

Singh M, Boutanaev A, Zucchi P, Bogorad L (2001) Gene elementsthat affect the longevity of rbcL sequence-containing transcriptsin Chlamydomonas reinhardtii chloroplasts. Proc Natl Acad SciU S A 98:2289–2294

Somanchi A, Barnes D, Mayfield SP (2005) A nuclear gene ofChlamydomonas reinhardtii, tba1, encodes a putative oxidore-ductase required for translation of the chloroplast psbAmRNA. Plant J 42:341–352

Staub JM, Maliga P (1993) Accumulation of D1 polypeptide intobacco plastids is regulated via the untranslated region of thepsbA mRNA. Embo J 12:601–606

Stern DB, Radwanski ER, Kindle KL (1991) A 3¢ stem/loopstructure of the Chlamydomonas chloroplast atpB gene regulatesmRNA accumulation in vivo. Plant Cell 3:285–297

Sugita M, Sugiura M (1996) Regulation of gene expression inchloroplasts of higher plants. Plant Mol Biol 32:315–326

Sugiura M, Hirose T, Sugita M (1998) Evolution and mechanism oftranslation in chloroplasts. Annu Rev Genet 32:437–459

Vaistij FE, Boudreau E, Lemaire SD, Goldschmidt-Clermont M,Rochaix JD (2000) Characterization of Mbb1, a nucleus-en-coded tetratricopeptide-like repeat protein required forexpression of the chloroplast psbB/psbT/psbH gene cluster inChlamydomonas reinhardtii. Proc Natl Acad Sci U S A97:14813–14818

Wells SE, Hillner PE, Vale RD, Sachs AB (1998) Circularization ofmRNA by eukaryotic translation initiation factors. Mol Cell2:135–140

Zerges W (2000) Translation in chloroplasts. Biochimie 82:583–601

Zou Z, Eibl C, Koop HU (2003) The stem-loop region of the to-bacco psbA 5¢UTR is an important determinant of mRNAstability and translation efficiency. Mol Genet Genomics269:340–349

Zuker M (2003) Mfold web server for nucleic acid folding andhybridization prediction. Nucleic Acids Res 31:3406–3415

636