Atherosclerosis 145 (1999) 239–251

Mouse very low-density lipoprotein receptor (VLDLR): genestructure, tissue-specific expression and dietary and developmental

regulation�

Oliver Tiebel a, Kazuhiro Oka a,*, Kathy Robinson a, Merry Sullivan a, Julie Martinez a,Makoto Nakamuta a, Kazumi Ishimura-Oka b,c, Lawrence Chan a

a Departments of Cell Biology and Medicine, Baylor College of Medicine, One Baylor Plaza, Houston TX 77030, USAb Department of Pediatrics, Baylor College of Medicine, Houston TX 77030, USA

c USDA/ARS Children’s Nutrition Research Center, HoustonTX 77030, USA

Received 4 September 1998; received in revised form 11 January 1999; accepted 27 January 1999

Abstract

The very low density lipoprotein receptor (VLDLR) is a multifunctional apolipoprotein (apo) E receptor that shares a commonstructural feature as well as some ligand specificity to apo E with members of the low density lipoprotein receptor gene family.We have isolated and characterized the mouse VLDLR gene. The mouse VLDLR gene contains 19 exons spanning approximately50 kb. The exon-intron organization of the gene is completely conserved between mouse and human. Since the 5%-flanking regionof the mouse VLDLR gene contains two copies of a sterol regulatory element-1 like sequence (SRE-1), we next studied regulationof the VLDLR mRNA expression in heart, skeletal muscle and adipose tissue in C57BL/6, LDLR-/-, apo E-/- and LDLR-/-apo E-/-

mice fed normal chow or atherogenic diet. The VLDLR mRNA expression was down-regulated 3-fold by feeding atherogenic dietin heart and skeletal muscle only in LDLR-/- mice. In contrast, VLDLR mRNA expression was up-regulated by atherogenic dietin adipose tissue in all animal models except double knockout mice. These results suggest that SRE-1 may be functional andVLDLR plays a role in cholesterol homeostasis in heart and skeletal muscle when LDLR is absent and that apo E is required forthis modulation. Developmental regulation of the VLDLR mRNA expression was also tissue-specific. VLDLR mRNA expressionin heart displayed significant up and down regulation during development. Maximal level was detected on post-natal day 3.However, the VLDLR mRNA levels in skeletal muscle remained relatively constant except a slight dip on post-natal day 7. Inkidney and brain, VLDLR mRNA also peaked on post-natal day 3 but remained relatively constant thereafter. In liver, VLDLRmRNA expression was very low; it was barely detectable at day 19 of gestation and was decreased further thereafter. In adiposetissue, the VLDLR mRNA level showed an increase on post-natal day 13, went down again during weaning and then continuedto increase afterwards. This developmental pattern as well as dietary regulation in adipose tissue supports the notion that VLDLRplays a role in lipid accumulation in this tissue. Although the primary role of VLDLR in heart, muscle and adipose tissue is likelyin lipid metabolism, developmental pattern of this receptor in other tissues suggests that VLDLR has functions that are unrelatedto lipid metabolism. © 1999 Elsevier Science Ireland Ltd. All rights reserved.

Keywords: Very low-density lipoprotein receptor; Mouse gene structure; Dietary regulation; Developmental regulation

www.elsevier.com/locate/atherosclerosis

1. Introduction

Receptor-mediated endocytosis of plasma lipo-proteins plays a pivotal role in cholesterol homeostasis[1]. Apolipoprotein (apo) E and apo B-100 are impor-tant ligands for this process. The very low densitylipoprotein receptor (VLDLR) is an apo E receptorthat was isolated from rabbit heart cDNA library bycross-hybridization to the cDNA corresponding to the

� The sequence data from this article has been deposited with theGenBank/EMBL Data Bank under Accession No. AF026064.

* Corresponding author. Tel.: +1-713-798-7381; fax: +1-713-798-8764.

E-mail address: kazuhiro@bcm.tmc.edu (K. Oka)

0021-9150/99/$ - see front matter © 1999 Elsevier Science Ireland Ltd. All rights reserved.PII: S 0 0 2 1 -9150 (99 )00068 -4

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251240

ligand binding domain of low density lipoprotein recep-tor (LDLR) [2]. The VLDLR belongs to the expandingmammalian LDLR gene family that also includesLDLR, LDLR-related protein (LRP), glycoprotein 330(gp330)/megalin [3,4], apo E receptor-2 (apo ER2) [5]/LR8B [6], and LR11 [7]. All members are characterizedby common structural features which include: (1) cys-teine-rich repeats consisting of �40 amino acidresidues in the ligand binding domain or in comple-ment-type domain; (2) epidermal growth factor (EGF)precursor-type repeats; (3) module of �50 amino acidresidues with a consensus tetrapeptide, YWTD; (4) asingle transmembrane domain; and (5) a cytoplasmicdomain containing an NPXY sequence required forclustering of the receptor into coated pits. The VLDLRis structurally more closely related to LDLR and apoER2/LR8 than the other members. A major differencein the domain structure of VLDLR, LDLR and apoER2 is the number of cysteine-rich repeats in the ligandbinding domain, in which the LDLR and apo ER2have seven repeats, and VLDLR has eight repeats inthis domain. This distinguishing feature is not absolute,however, because variant forms of the VLDLR and apoER2 lacking one cysteine-rich repeats have been iden-tified [8,9]. The ligand specificity for rabbit b-VLDLalso distinguishes the VLDLR, LDLR, apo ER2 andLR11 from LRP and gp330/megalin. There is sufficientapo E on b-VLDL that allows its binding to VLDLR,LDLR, apo ER2 and LR11, but additional enrichmentwith exogenous apo E appears to be necessary for it tobind efficiently to LRP and gp330/megalin [2,5,7,10].

It has been hypothesized that the primary role of theVLDLR is the delivery of triglycerides in triglyceride-rich apo E-containing lipoproteins to extrahepatic tis-sues that are active in fatty acid metabolism [2]. Thetissue- and cell type-specific expression of the VLDLRmRNA support this hypothesis [2,11–15]. The VLDLRprotein is present in the endothelium of capillaries andsmall arterioles. Disruption of this gene in mice leads toa mild reduction in the size of adipose depots [16]. Inspontaneously hypertensive stroke-prone rats, VLDLRmRNA was lower in the heart than in control rats at 4weeks and was further reduced at 13 weeks whencardiac hypertrophy is established. This developmentalpattern of the VLDLR gene expression was associatedwith a switch in energy substrate from lipid to glucose[17]. However, the role of the VLDLR in energymetabolism remains unclear. VLDLR mRNA levels inrats are not regulated by fasting and re-feeding [8].Human VLDL itself has been reported to be a poorligand for this receptor [18]. Intermediate density lipo-proteins, but not VLDL, appear to be the ligand inVLDLR ectopically expressed in liver in vivo [19].Although sterol regulatory element 1 (SRE-1) like se-quence is present in the 5%-flanking region of theVLDLR gene, the expression of the VLDLR gene was

not affected by sterols in the human monocytic cell line,THP-1 [20] or in rabbit resident alveolar macrophages[21]. VLDLR was expressed in endothelial cells as wellas in macrophage-derived foam cells, which suggests apotential role for this receptor in foam cell formationand atherogenesis [14,15]. In addition, VLDLR hasbeen reported to bind to Lp(a) [22], and may play a rolein modulating the effects of this atherogenic lipoproteinon the vascular wall.

In this report, we have isolated and characterized themouse VLDLR gene and its 5%-flanking region andstudied the effects of atherogenic diet feeding onVLDLR mRNA expression in wild type mice and othergenetic mouse models. We also studied the developmen-tal regulation of VLDLR mRNA expression in varioustissues around birth and during early post-nataldevelopment.

2. Materials and methods

2.1. Isolation of mouse genomic clones for VLDLR

A 3.0-kb cDNA for mouse VLDLR [13] was used toscreen a genomic library constructed in lFIX II(Stratagene). For further screening, a 1.0-kb genomicfragment located in the 5%-region of the clone 8-1 wasused to rescreen the library. Four overlapping cloneswere characterized by restriction enzyme digestion andsubsequently subcloned into the pBluescript KS vector.The sequence analysis was performed on double-stranded circular plasmid DNA using a Sequenase se-quencing kit (Amersham) or Cyclist Exo- Pfu DNAsequencing kit (Stratagene).

2.2. Northern blot analysis

Total cellular RNA was prepared from mouse heartand brain using Ultraspec RNA isolation kits (BiotecxLab.). The RNA (20 mg) was electrophoresed on a 1%agarose/6% formaldehyde gel and transferred to a Hy-bond N+ membrane (Amersham). The membrane wasthen hybridized to either a 32P-labeled 1.6-kb cDNAcorresponding to nucleotides (nt) 1–1581 of the mouseVLDLR cDNA or the 1.0-kb BamHI/EcoRI genomicfragment contained in the 3%-flanking region of themouse VLDLR gene and with mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA probe(Ambion).

2.3. Mapping the 5 % end of the gene

RNase protection assay (RPA) was performed byusing the RPA II kit (Ambion). An antisense RNAprobe corresponding to nt −159 to +111 was pro-duced by T7 RNA polymerase using P6uII digested

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251 241

0.8-kb SstI/Hind III fragment in the presence of [32P]-UTP. RNA probe was hybridized to 20 mg of totalRNA from heart or yeast tRNA at 42oC overnight. Themixture was digested with RNase A and RNase T1 andfractionated by electrophoresis on a 6% sequencing gel.

2.4. RNA analysis

We quantified VLDLR mRNA by RPA. The mouseVLDLR mV13 [19] was digested with SmaI to removent 1–1227 and self-ligated to obtain mV13SmaI clone.A 32P-labeled 354 nt antisense RNA probe correspond-ing to nt 1228 to 1581 covering exon 8–11 was gener-ated by T7 RNA polymerase from BamHI linearizedmV13SmaI plasmid DNA. We subcloned mouseGAPDH cDNA corresponding to nt 426–660 thatextend exon 5–8 by polymerase chain reaction (PCR)using pTR1-mouse-GAPDH (Ambion) as a template.The PCR primers used were 5%-ATTACCCTCAC-TAAAGGG -3% for a sense primer and 5%-GAAGGGATCCATGTTTGTGATGGGTGTGAAC-3% for an antisense primer. The 3% down stream primercontained an artificial BamHI site (underlined) forcloning purpose. The PCR products were subclonedinto the BamHI/EcoRI sites of pBluescript KS. A32P-labeled 318 nt antisense probe was generated by T3RNA polymerase reaction using the BamHI digestedplasmid DNA. 20 mg of total RNA were hybridized to1×105 cpm VLDLR probe and 1×104 cpm GAPDHprobe at 65oC overnight using RPAII kit (Ambion)according to the manufacturer’s instructions. The pro-tected RNA probes (354 nt for VLDLR and 235 nt forGAPDH) were electrophoresed on a 6% sequencing gel.The gel was dried and radioactive bands werequantified by exposure to a phophor screen (MolecularDynamics) using Quant program.

2.5. Diet study

C57BL/6 mice were purchased from Jackson Labora-tories. In order to obtain mice lacking both LDLR andapo E, apo E knockout mice [23] were cross-bred withLDLR knockout mice [24]. The progeny heterozygousfor both mutant alleles were mated each other and thenext generation was screened for double knockout bySouthern blot analysis for the LDLR knockout alleleand by polymerase chain reaction (PCR) for apo Eknockout allele. Mice were maintained on a normalchow diet (Teklad 4% mouse/rat diet 7001 from HarlenTeklad Premier Laboratory Diets) that contained 4%(w/w) animal fat and B0.04% (w/w) cholesterol. Forthe atherogenic diet groups, mice were switched to a1.25% cholesterol/atherogenic diet that contained1.25% cholesterol, 7.5% (w/w) cocoa butter, 7.5% ca-sein and 0.5% (w/w) sodium cholate [25] and main-tained for 3 weeks on the diet. Mice were kept on 12 h

dark/12 h light cycles and were allowed free access tofood and water.

2.6. Lipid analysis

After 5 h fasting, blood was obtained by puncture ofthe retro-orbital plexus from anesthetized animals andcollected into EDTA-treated Pasteur pipettes. Thecholesterol and triglyceride content were determined byusing kits from Sigma.

2.7. De6elopmental study

ICR mice (timed-pregnancy females and females atvarious ages) were purchased from SASCO. Animalswere housed in an animal facility with a 12 h/12 hlight/dark cycle and given free access to chow andwater for several days before manipulation. Pregnantfemales were kept in separate cages. Birth occurred onday 21 of gestation which was defined as post-natal day1 for this study. Litter size varied between 10 and 15.Nursing animals were weaned on day 21 after birth.Mice were sacrificed between 10:00 and 12:00 a.m. tominimize diurnal variation in expression. All animalswere studied in the fed state, verified by the presence ofmilk in the stomach of nursing mice and chow in thestomach of weaned animals [26]. We dissected brainstarting with the 17th gestational day. A clean isolationof adequate amounts of tissue from heart, kidney andliver was possible following the 19th gestational day.We were able to separate muscle tissue starting with the1st and adipose with the 3rd postnatal day.

2.8. Statistical analysis

Statistical analyses were performed using the non-paired Student t-test with SigmaStat program andgraphs were created with SigmaPlot program (JandelScientific).

3. Results

3.1. Mouse VLDLR gene structure

The VLDLR gene was isolated from a 129Sv mousegenomic library. The 3.0-kb mouse VLDLR cDNA [13]was used for the initial screening, which yielded threeoverlapping clones containing exons 2–19, but missingexon 1. Therefore, a second round of screening wasperformed with a 1.0-kb DNA fragment located in the5%-region of the clone 8–1 (Fig. 1). We obtained threeadditional clones and characterized one of them, whichcontained exon 1 and the 5%-flanking region. The genespans approximately 50 kb. The overlapping clonesused for characterization and the gene structure are

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251242

shown in Fig. 1. Exon-intron organization (Table 1)was completely conserved between mouse and human[20]. The imperfect cysteine-rich repeats 1, 2, 3, 7 and 8in the ligand binding domain are each encoded by adifferent exon, whereas repeats 4–6 are encoded by asingle exon. The fifth repeat of the VLDLR contains 10extra amino acid residues. It is noteworthy that repeats3–5 in the binding domain of LDLR are also encodedby a single exon [27]. EGF precursor-type repeats A, Band C are encoded by different exons. The non-re-

peated sequence in the EGF precursor homology regionis encoded by exons 10–14. The O-linked sugar do-main, the least conserved domain between VLDLR andLDLR [13], is encoded by a single short exon which hasbeen shown to undergo tissue- and cell type-specificalternative splicing [8,20,28]. The transmembrane do-main is encoded by two separate exons number 17 and18, and the last exon contains the codon for the last 11amino acids in the C-terminus as well as the 3%-untrans-lated region. Thus, the gene organization of the

Fig. 1. Structure and organization of the mouse VLDLR gene. The gene map was established for the restriction endonucleases BamHI and EcoRI.Four overlapping clones that were used for characterization of the VLDLR gene are shown below the map. Boxes represent exons and open areasindicate untranslated regions. Exons are numbered 1–19. A shaded box indicates the 3%-probe used for Northern blot analysis.

Table 1Exon and intron organization of the mouse VLDL receptor genea

Exon Intron (kb)Exon size (bp) 3%-splice acceptorPosition on cDNA* (bp) 5%-splice donor

14.0 TTCCTCCTAGGGAAGA1 645 1–101 CAAGCGGTGAGTGGGG2 ACGTTTATAGTAAAGA4.8ACTGTGGTAAGCTCTT102–221120

1.5AGTGCCGTGAGTGTGC TCATCAACAGATATGA222–34412331.6 CCTCTAACAGGCAACA4 123 345–467 ACTGTGGTAAGAAGAC

372 468–8395 ACTGCCGTAAGTAACT 0.4 TCTTTCGTAGCTTCTC6 840–962123 CGGAAAATAGTCAATC0.1AAAACGGTGAGGTTCT7 TTTATTCCAGATATCA0.2963–1085123 AATGCCGTAAGTGGAG

1086–1205120 GTGGAGGTGAGTTGAA8 0.1 TTTCCCCTAGATATTG0.3 TGTCTTGCAGGCAAAG9 126 1206–1331 CAGTAGGTAAATAGAC

CTTCAGGTAACTTCCA172 0.8 ATCTGTTCAGTGCCTC1332–150310CTCTTCCCAGCTTTGT1.6GTCGGGGTTTGTATTC11 1504–1722219

12 1723–1841119 0.6 TCCTGCCTAGACCTTGCACTCGGTATGTATGT1842–198113 140 TTTGAGGTAAGACTCG TCTGTTTTAGGATCGC0.3

142 CGTCAGGTAACATGGA14 CCCCAACTAGGTAAAA1982–2123 1.20.9 TATAATCCAGGTACTT15 147 2124–2270 GTCAAAGTAAGGCTTT0.3 GTCCTTGTAGGGATCA16 84 2271–2354 CTGGAGGTATTGGGTC

TTTTTTTCAGTGCTCT0.8CTCTCTGTAAGTAAAT17 2355–243581CCAGCAGTAAGTATAC170 1.2 TTCTCTGCAGATATCA2436–260518

2606–313419 \4.0k

a The sequences of the mouse VLDLR gene splice junctions are shown. The intron sequences are underlined.* Positions on cDNA are numbered according to the published sequence [13].

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251 243

Fig. 2. Nucleotide sequence of the 5%-flanking region of the mouse VLDLR gene. The figure displays 714 bp of 5%-flanking region of the gene(negative numbering) and 647 bp of exon 1. Sequence data have been deposited with the EMBL/GenBank Data Libraries under Accession No.AF026064. The coding amino acid containing region is shown by capital letter. The closed circles above the sequence indicate transcriptioninitiation sites identified by RPA. Consensus sequences for putative transcription factor-binding sites are marked beneath (for sense strand) orabove (for antisense strand) each site. Nucleotides that differ from the consensus sequence are indicated in parentheses. Potential transcriptionfactor binding sites for AP-2, Sp-1, SRE-1, E2A, NF-IL6 and PU.1 are shown.

VLDLR is similar to that of LDLR, which is consistentwith the hypothesis that the two genes have evolvedfrom a common ancestral gene [13,20].

3.2. Northern blot analysis of VLDLR mRNA

Multiple mRNA species have been reported forVLDLR [2,8,11–13,29]. Three major species of mR-NAs (9.7, 4.5 and 3.9-kb) for mouse VLDLR arepresent in heart, whereas the 9.7 kb mRNA was themajor mRNA species in brain [13]. The probe corre-sponding to the 3%-untranslated region hybridized onlyto the high molecular size mRNA (data not shown),suggesting that high and low molecular size mRNAspecies may be generated by utilization of differentpolyadenylation signals.

3.3. Characterization of the 5 %-flanking region of themouse VLDLR gene

The start site of transcription was mapped by RPA.Multiple protected fragments were detected by this

method. The first base of the predominant protectedfragment was assigned +1. The nucleotide sequence ofthe 5%-flanking region of the mouse VLDLR gene isshown in Fig. 2. This part of the sequence is lessconserved between human and mouse than the codingregion. As in the human gene [20], we could not iden-tify a typical TATA box or CCAAT box in the mouseVLDLR gene, though an inverted CCAAT box wasfound at nt +104. Although several conserved poten-tial regulatory elements are present in the 5%-flankingregion of mouse and human VLDLR gene, their loca-tions are not well conserved and their functional signifi-cance is unknown. Two copies of a potential sterolregulatory element-1 (SRE-1) [30], which is present inthe promoters of HMG-CoA synthase, HMG-CoA re-ductase and the LDLR receptor genes, and mediatesregulation of the LDL receptor gene by sterols, arepresent, separated from each other by 20 nucleotides.Other potential regulatory elements include: a bindingsite for Sp-1 [31]; a binding site for NF-IL6, a memberof C/EBP, which appears to be ubiquitous but mostabundant in liver, heart and muscle [32]; two copies of

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251244

Fig. 3. Quantitation of VLDLR mRNA in various mouse tissues. Total RNA from various tissues was hybridized to 32P-labeled antisense VLDLRand GAPDH probes in solution. After RNase digestion, RNA was precipitated, redissolved in a loading buffer and separated on a 6% sequencinggel. The radioactive bands were quantified by PhospharImager. The values are expressed as band volume of VLDLR mRNA/band volume ofGAPDH. Each value represents mean of five animals 9S.D. Statistical analysis was performed on each tissue and results are shown in the Fig.3.

a binding site for AP-2 [33]; a binding site for E2A,another factor that is present ubiquitously and is re-lated to myocytes or B-cell specific E2-box bindingfactors [34]; and a binding site for macrophage and Bcell-specific PU.1 [35].

3.4. Distribution of VLDLR mRNA in adult mousetissues

Since the relative concentrations of VLDLR mRNAin various tissues have not been reported, we deter-mined VLDLR mRNA level in adult mice by quantita-tive RPA. We used an RNA probe corresponding to nt426–660 in this study and normalized the results to thelevel of GAPDH mRNA. The VLDLR mRNA wasmost abundant in heart. Moderate VLDLR mRNAexpression was detected in muscle, kidney, adiposetissue and brain. It was barely detectable in liver (Fig.3).

3.5. Regulation of VLDLR mRNA expression by highfat diet

C57BL/6J, LDLR-/-, apo E-/- and LDLR-/-apo E-/-

mice were fed normal chow or atherogenic diet for 3weeks and plasma lipids were measured. Plasma choles-terol levels in mice fed atherogenic diets were signifi-cantly higher than those fed normal chows. Plasmacholesterol levels in apo E-/-LDLR-/- mice increased to4120 mg/dl, which were higher than those in single geneknockout mice as has been reported previously [25]. Incontrast, triglyceride levels were not affected by feeding

atherogenic diet (Table 2).Feeding atherogenic diet didnot change VLDLR mRNA expression in heart andmuscle in C57BL/6, apo E-/- or apo E-/-LDLR-/- mice.However, VLDLR mRNA expression was down-regu-lated 3-fold in both tissues in LDLR-/- mice (Fig. 4). Incontrast, VLDLR mRNA expression was up-regulatedin adipose tissue in all genetic models except in doubleknockout mice. In these animals, VLDLR mRNA ex-pression was down-regulated by 40%.

3.6. Expression of VLDLR mRNA in mouse tissuesduring early post-natal de6elopment

We next studied VLDLR mRNA expression at vari-ous developmental stages by quantitative RPA. TotalRNA was prepared from various mouse tissues, start-ing on day 17 of gestation and ending on post-natal day

Table 2Effects of atherogenic diet on plasma lipida,c

Mouse Triglyceride (mg/dl)Cholesterol (mg/dl)

NHCbNb HC

7494C57BL/6J 159920* 53921 3695259942 18993124289515*LDLR-/- 1869324979211 12692122849757**Apo E-/- 174949

8891010992441209963*LDLR-/-Apo 7769181E-/-

a Each value is expressed as mean of five animals 9S.D.b N, normal chow; HC, high cholesterol/high fat atherogenic diet.c *PB0.0001; **PB0.001.

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251 245

Fig. 4. Regulation of VLDLR mRNA expression by high cholesterol diet. Mice were fed with normal chow or atherogenic diet for 3 weeks andVLDLR mRNA expression was determined by RPA. Each value represents mean 9S.D. of five animals. (A) C57BL/6, (B) LDLR-/-, (C) ApoE-/- and (D) LDLR-/-Apo E-/- mice. The open bars show the results from mice fed normal chow and the closed bars show the results from micefed high cholesterol/high fat atherogenic diet. (E) RNase protection assay for VLDLR mRNA expression in heart of C57BL/6 or LDLR-/- micefed either normal chow or atherogenic diet. Arrows indicate protected antisense RNA probes. The bands corresponding to protected VLDLR orGAPDH RNA probes were quantified by PhospharImager.

60. In most experiments we used GAPDH, a house-keeping gene, as an internal standard [36] to establishthe relative amount of VLDLR mRNA in each sample.We found only minimal variations in GAPDH mRNAlevels during neonatal development in most tissues ex-cept in muscle and liver. For these two tissues, we havedirectly used integrated band volume of VLDLRmRNA without normalization by GAPDH mRNA.VLDLR mRNA level in heart increased about 3-fold atbirth followed by an additional 3-fold increase on day 3after birth. It decreased 6-fold on day 7 and continuedto increase thereafter (Fig. 5A). There was no signifi-cant change in muscle VLDLR mRNA level eitherduring or following the weaning period, except for a

mild decline on day 7 after birth (Fig. 5B). VLDLRmRNA level in kidney increased about 4-fold at birthand another �40% on day 3 before returning to day 1level thereafter (Fig. 5C).

Adipose tissue was obtained from epididymal fat,which was not detectable until day 3 (Fig. 5D). Weobserved a significant peak of VLDLR mRNA in thistissue on post-natal day 13, followed by a decline onday 20 before weaning. After weaning, the VLDLRmRNA levels went up and maintained an upward trendto day 60. The VLDLR mRNA level in brain is abouthalf that in kidney, but the developmental patterns inthe two tissues are quite similar (Fig. 5C,E). VLDLRmRNA in brain was detected on day 17 of gestation. It

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251246

increased slightly in the last 4 days of gestation, andmarkedly (�2-fold) immediately after birth. There wasa peak on day 3 and levels fluctuated until day 24 whenthey remained steady until day 60. The expression ofthe VLDLR mRNA in the liver is very low in adult

mice (Fig. 5F). The mRNA level in the fetal liver wasabout 3-fold higher than in adults on days 19 and 20 ofgestation. During the first 2 weeks of birth, there was agradual decline in expression, and the adult level wasreached shortly after weaning.

Fig. 4. (Continued)

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251 247

Fig. 5. VLDLR mRNA expression in mouse tissues at various developmental stages. Concentrations of VLDLR mRNA were determined by RPAas described in Section 2 and normalized to GAPDH mRNA (panel A, C, D and E). (A) Heart, (B) Muscle, (C) Kidney, (D) Adipose tissue, (E)Brain and (F) Liver. The values are expressed as band volume of VLDLR mRNA/band volume of GAPDH. Each value represents mean of fivesamples 9S.D. Statistical analysis was performed on each developmental stage and results are shown in the Fig. 5. Because of significant variationof GAPDH mRNA expression in muscle and liver during neonatal development, VLDLR mRNA levels are expressed as integrated band volumein these tissues (panel B and F). Statistical analysis was performed on each developmental stage and the results are shown above each column.(G) RNase protection assay for VLDLR mRNA expression in heart at various developmental stages.

4. Discussion

In this report, we have characterized the mouseVLDLR gene and studied the regulation of VLDLRmRNA expression during prenatal and early postnataldevelopment. The exon-intron organization of theVLDLR gene was completely conserved and the codingregion was highly conserved between species, but the5%-flanking region was poorly conserved. The humanVLDLR gene contains polymorphic CGG triplet re-peats in the 5%-untranslated region and the allele fre-quencies of the 5-repeat have been reported to be

significantly higher in Japanese patients withAlzheimer’s disease [37], a finding that has not beenconfirmed in Caucasian patients [38,39]. The CGGtriplet repeats were absent in the mouse VLDLR gene.We have identified potential regulatory elements suchas binding sites for transcription factors AP-2, E2A,NF-IL6, Sp-1, SRE-1 and PU.1 in the 5%-flanking re-gion of the mouse VLDLR gene. The functional signifi-cance of these sites remains to be elucidated.Macrophage-derived foam cells express VLDLRmRNA, which was not regulated by cholesterol despitethe presence of SRE-1-like sequence in the human gene

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251248

[15,21]. LDLR-deficient CHO-ldlA7 cells transfectedwith VLDLR exhibited intracellular lipid accumulationby incubation with b-VLDL [21], suggesting thatVLDLR may play a role in foam cell formation.VLDLR has been detected in endothelial cells andmacrophage-derived foam cells [14,15]. Unregulation ofVLDLR expression by sterols has been postulated toplay a role in normal and pathophysiological vascularprocesses [15]. Here we showed that the VLDLRmRNA expression is regulated by atherogenic diets inheart and skeletal muscle in LDLR-/- mice. Thus,VLDLR may play a role in cholesterol homeostasis in

these tissues under certain pathological conditions. Themost striking dietary regulation of VLDLR mRNAexpression by 1.25% cholesterol/atherogenic diets oc-curred in adipose tissue, which stimulated expression by60–190%. These results are consistent with the slightlyreduced body weight of mice lacking VLDLR [16] andsuggest that VLDLR may contribute to lipid accumula-tion in adipose tissue and potentially play a role inobesity.

VLDLR mRNA is essentially undetectable in adultmouse liver. However, we detected a three-fold higheramount of VLDLR in the neonatal liver (Fig. 5F).

Fig. 5. (Continued)

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251 249

Since we showed that hepatic VLDLR expression in-duced by adenovirus-mediated gene transfer is func-tional and mediates the hepatic uptake of IDL [19], wespeculate that the transient hepatic expression ofVLDLR might play a role in the lipoprotein homeosta-sis of neonatal mice.

It has been reported that VLDLR binds to lipo-protein lipase (LPL), the key enzyme involved in theremodeling of triglyceride-rich lipoproteins. LPL alsoenhances the binding of these lipoproteins to VLDLR[18,40]. The tissue-specific expression of the VLDLRgene is similar but not identical to that of LPL [26,41].LPL mRNA in adult mice was most abundant inadipose tissue, heart, skeletal muscle and kidney. LPLmRNA in brain has been localized in the hippocampusin same studies [42,43]. In other reports it was too lowin concentration to be detected in RNA prepared fromwhole brain [12,41,44]. In contrast, VLDLR gene tran-scripts were detectable in cerebral cortex, hippocampusand cerebellum [5,45]. The significant difference in tis-sue expression of LPL and VLDLR suggests thatVLDLR has functions that are independent of LPLaction including those that may be unrelated to lipidmetabolism.

Since developmental studies on LPL mRNA expres-sion have not been reported for mice, we compared thepattern of tissue specific expression of VLDLR to thatof LPL in rats [26]. We observed substantial differencesin their expression patterns. For example, in mouseheart VLDLR mRNA expression rapidly increasedpost-natally, with a peak on day 3 of birth that washigher than the adult level. It decreased somewhatafterwards, but the adult level was reached within sev-eral weeks of birth. However, in rat heart, LPL mRNAwas barely detectable at birth. It increased steadily over20-fold as the animal grew into adulthood. Similarly,differences in VLDLR and LPL mRNA expressionduring the post-natal period were also observed in theother tissues (Fig. 5 and Semenkovich et al., 1989) [26].LPL plays an important role in normal lipoproteinmetabolism, being the key enzyme responsible for thecatabolism of the triglyceride-rich lipoproteins. LPLdeficiency in mice leads to early post-natal death result-ing from severe chylomicronemia and a fat emboli-likesyndrome [46,47]. The function of VLDLR, in contrast,is not well understood. VLDLR deficiency in mice isnot associated with any significant lipoprotein pheno-type. These animals are fertile and grossly healthy. Theonly abnormality seems to be a modest decrease inbody mass index and adipose tissue mass [16]. Ourobservations indicate that while LPL and VLDLR mayhave synergistic function as suggested previously [18],the fact that their expression shows substantial diver-gence suggests that VLDLR has functions independentto LPL.

Majority of members of LDLR gene family reportedto date bind apo E-enriched lipoproteins, which isimplicated for physiological roles of these receptors inlipid metabolism. However, it has also become evidentthat these members bind many non-lipoprotein ligandsand play diverse roles in other than lipid metabolism.The VLDLR binds many non-lipoprotein ligands in-cluding serine proteinase/serpin complex [40,48,49] andexhibits substantial overlap in ligand specificity withLRP [4,49]. In agreement with potential role of LRP inmetabolism of lipoproteins and proteinase/inhibitorcomplexes, LRP is highly expressed in liver duringembryonal as well as postnatal development, whereasVLDLR expression is minimal in this tissue. LRP isexpressed in brain throughout all embryonic stages andduring post-natal development, where scavengingproteinase/inhibitor complexes may be an importantrole for LRP [44,50]. Similarly, VLDLR is expressedthroughout life in brain (Fig. 5E, [51]). In contrast,LR11 expression was highly dependent on neuronal celltypes and peaked at 2 weeks, which suggests its role inneuronal development [51]. The present study suggeststhat VLDLR like LRP may play a role in metabolismof proteinase/inhibitor complexes in some tissues.

Acknowledgements

The authors wish to thank Dr John B. Anderson forhis helpful suggestions for this manuscript and CelesteArden for her technical assistance. O.T. was a recipientof German Academic Exchange Service Award. Thiswork was supported in part by Alzheimer’s Associa-tion/The William T. Morris Foundation Pilot ResearchGrant (PRG-95-179) to K.O. and a grant (HL51586)from the National Institutes of Health to L.C.

References

[1] Brown MS, Goldstein JL. A receptor-mediated pathway forcholesterol homeostasis. Science 1986;232:34–47.

[2] Takahashi S, Kawarabayasi Y, Nakai T, Sakai J, Yamamoto T.Rabbit very low density lipoprotein receptor: a low densitylipoprotein receptor-like protein with distinct ligand specificity.Proc Natl Acad Sci USA 1992;89:9252–6.

[3] Jingami H, Yamamoto T. The VLDL receptor: wayward brotherof the LDL receptor. Curr Opin Lipidol 1995;6:104–8.

[4] Strickland DK, Kounnas MZ, Argraves WS. LDL receptor-re-lated protein: a multiligand receptor for lipoprotein andproteinase catabolism. FASEB J 1995;9:890–8.

[5] Kim DH, lijima H, Goto K, Sakai J, Ishii H, Kim HJ, Suzuki H,Kondo H, Saeki S, Yamainoto T. Human apolipoprotein Ereceptor 2. A novel lipoprotein receptor of the low densitylipoprotein receptor family predominantly expressed in brain. JBiol Chem 1996;271:8373–80.

[6] Novak S, Hiesberger T, Schneider WJ, Nimpf J. A new lowdensity lipoprotein receptor homologue with 8 ligand bindingrepeats in brain of chicken and mouse. J Biol Chem1996;271:11732–6.

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251250

[7] Yamazaki H, Bujo H, Kusunoki J, Seimiya K, Kanaki T,Morisaki N, Schneider WJ, Saito Y. Elements of neural adhesionmolecules and a yeast vacuolar protein sorting receptor arepresent in a novel mammalian low density lipoprotein receptorfamily member. J Biol Chem 1996;271:24761–8.

[8] Jokinen EV, Landschulz KT, Wyne KL, Ho YK, Frykman PK,Hobbs HH. Regulation of the very low density lipoproteinreceptor by thyroid hormone in rat skeletal muscle. J Biol Chem1994;269:26411–8.

[9] Kim DH, Magoori K, Inoue TR, Mao CC, Kim HJ, Suzuki H,Fujita T, Endo Y, Saeki S, Yamamoto T. Exon/intron organiza-tion, chromosome localization, alternative splicing, and tran-scription units of the human apolipoprotein E receptor 2 gene. JBiol Chem 1997;272:8498–504.

[10] Willnow TE, Goldstein JL, Orth K, Brown MS, Herz J. Lowdensity lipoprotein receptor-related protein and gp330 bind simi-lar ligands, including plasminogen activator-inhibitor complexesand lactoferrin, an inhibitor of chylomicron remnant clearance. JBiol Chem 1992;267:26172–80.

[11] Gafvels ME, Caird M, Britt D, Jackson CL, Patterson D,Strauss JF III. Cloning of a CDNA encoding a putative humanvery low density lipoprotein/apolipoprotein E receptor and as-signment of the gene to chromosome 9pter-p23. Som Cell MolGenet 1993;19:557–69.

[12] Gafvels ME, Paavola LG, Boyd CO, Nolan PM, Wittmaack F,Chawla A, Lazar MA, Bucan M, Angelin BO, Strauss JF III.Cloning of a complementary deoxyribonucleic acid encoding themurine homolog of the very low density lipoprotein/apolipo-protein-E receptor: expression pattern and assigmnent of thegene to mouse chromosome 19. Endocrinology 1994;135:387–94.

[13] Oka K, Ishimura-Oka K, Chu MJ, Sullivan M, Krushkal J, LiYM, Chan L. Mouse very-low-density-lipoprotein receptor(VLDLR) cDNA cloning, tissue-specific expression and evolu-tionary relationship with the low-density-lipoprotein receptor.Eur J Biochem 1994;224:975–82.

[14] Wyne KL, Pathak K, Seabra MC, Hobbs HH. Expression of theVLDL receptor in endothelial cells. Arterioscler Thromb VascBiol 1996;16:407–15.

[15] Multhaupt HA, Gafvels ME, Kariko K, Jin H, Arenas-Elliot C,Goldman BI, Strauss JF III, Angelin B, Warhol MJ, McCraeKR. Expression of very low density lipoprotein receptor in thevascular wall. Analysis of human tissues by in situ hybridizationand immunohistochemistry. Am J Pathol 1996;148:1985–97.

[16] Frykman PK, Brown MS, Yamamoto T, Goldstein JL, Herz J.Normal plasma lipoproteins and fertility in gene-targeted micehomozygous for a disruption in the gene encoding very lowdensity lipoprotein receptor. Proc Natl Acad Sci USA1995;92:8453–7.

[17] Masuzaki H, Jingami H, Matsuoka N, Nakagawa O, Ogawa Y,Mizuno M, Yoshimasa Y, Yamamoto T, Nakao K. Regulationof very-low-density lipoprotein receptor in hypertrophic ratheart. Circ Res 1996;78:8–14.

[18] Takahashi S, Suzuki J, Kohno M, Oida K, Tamai T, Miyabo S,Yamamoto T, Nakai T. Enhancement of the binding of triglyce-ride-rich lipoproteins to the very low density lipoprotein receptorby apolipoprotein E and lipoprotein lipase. J Biol Chem1995;270:15747–54.

[19] Kobayashi K, Oka K, Forte T, Ishida B, Teng B, Ishimura-OkaK, Nakamuta M, Chan L. Reversal of hypercholesterolemia inlow density lipoprotein receptor knockout mice by adenovirus-mediated gene transfer of the very low density lipoprotein recep-tor. J Biol Chem 1996;271:6852–60.

[20] Sakai J, Hoshino A, Takahashi S, Miura Y, Ishii H, Suzuki H,Kawarabayasi Y, Yamamoto T. Structure, chromosome loca-tion, and expression of the human very low density lipoproteinreceptor gene. J Biol Chem 1994;269:2173–82.

[21] Suzuki J, Takahashi S, Oida K, Shimada A, Kohno M, TamaiT, Miyabo S, Yamamoto T, Nakai T. Lipid accumulation andfoam cell formation in Chinese hamster ovary cells overexpress-ing very low density lipoprotein receptor. Biochem Biophys ResCommun 1995;206:835–42.

[22] Argraves KM, Kozarsky KF, Fallon JT, Harpel PC, StricklandDK. The atherogenic lipoprotein Lp(a) is internalized and de-graded in a process mediated by the VLDL receptor. J ClinInvest 1997;100:2170–81.

[23] Zhang SH, Reddick RL, Burkey B, Maeda N. Diet-inducedatherosclerosis in mice heterozygous and homozygous forapolipoprotein E gene disruption. J Clin Invest 1994;94:937–45.

[24] Ishibashi S, Brown MS, Goldstein JL, Gerard RD, Hammer RE,Herz J. Hypercholesterolemia in low density lipoprotein receptorknockout mice and its reversal by adenovirus-mediated genedelivery. J Clin Invest 1993;92:883–93.

[25] Ishibashi S, Herz J, Maeda N, Goldstein JL, Brown MS. Thetwo-receptor model of lipoprotein clearance: tests of the hypoth-esis in ‘knockout’ mice lacking the low density lipoproteinreceptor, apolipoprotein E, or both proteins. Proc Natl Acad SciUSA 1994;91:4431–5.

[26] Semenkovich CF, Chen SH, Wims M, Luo CC, Li WH, Chan L.Lipoprotein lipase and hepatic lipase mRNA tissue specificexpression, developmental regulation, and evolution. J Lipid Res1989;30:423–31.

[27] Sudhof TC, Goldstein JL, Brown MS, Russell DW. The LDLreceptor gene: a mosaic of exons shared with different proteins.Science 1985;228:815–22.

[28] Martensen PM, Oka K, Christensen L, Rettenberger PM, Pe-tersen HH, Christensen A, Chan L, Heecaard CW, AndreasenPA. Breast carcinoma epithelial cells express a very low-densitylipoprotein receptor variant lacking the O-linked glycosylationdomain encoded by exon 16, but with full binding activity forserine proteinase serpin complexes and Mr-40 000 receptor-asso-ciated protein. Eur J Biochem 1997;248:583–91.

[29] Webb JC, Patel DD, Jones MD, Knight BL, Soutar AK. Char-acterization and tissue-specific expression of the ‘human very lowdensity lipoprotein (VLDL) receptor’ mRNA. Hum Mol Genet1994;3:531–7.

[30] Smith JR, Osbome TF, Goldstein JL, Brown MS. Identificationof nucleotides responsible for enhancer activity of sterol regula-tory element in low density lipoprotein receptor gene. J BiolChem 1990;265:2306–10.

[31] Dynan WS, Tjian R. Control of eukaryotic messenger RNAsynthesis by sequence-specific DNA-binding proteins. Nature1985;316:774–8.

[32] Majello B, Arcone R, Toniatti C, Ciliberto G. Constitutive andIL-6-induced nuclear factors that interact with the human C-re-active protein promoter. EMBO J 1990;9:457–65.

[33] Williams T, Tjian R. Analysis of the DNA-binding and activa-tion properties of the human transcription factor AP-2. GenesDevelop 1991;5:670–82.

[34] Murre C, McCaw PS, Baltimore D. A new DNA binding anddimerization motif in immunoglobulin enhancer binding, daugh-terless, MyoD, and myc proteins. Cell 1989;56:777–83.

[35] Klemsz MJ, McKercher SR, Celada A, Van Beveren C, MakiRA. The macrophage and B cell-specific transcription factorPU.1 is related to the ets oncogene. Cell 1990;61:113–24.

[36] Bosma PJ, Kooistra T. Different induction of two plasminogenactivator inhibitor 1 mRNA species by phorbol ester in humanhepatoma cells. J Biol Chem 1991;266:17845–9.

[37] Okuizumi K, Onodera O, Namba Y, Ikeda K, Yamainoto T,Seki K, Ueki A, Nanko S, Tanaka H, Takahashi H, et al.Genetic association of the very low density lipoprotein (VLDL)receptor gene with sporadic Alzheimer’s disease. Nature Genet1995;11:207–9.

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251 251

[38] Okuizumi K, Onodera O, Seki K, Tanaka H, Namba Y, IkedaK, Saunders AM, Pericak-Vance MA, Roses AD, Tsuji S. Lackof association of very low density lipoprotein receptor genepolymorphism with Caucasian Alzheimer’s disease. Ann Neurol1996;40:251–4.

[39] Chung H, Roberts CT, Greenberg S, Rebeck GW, Christie R,Wallace R, Jacob HJ, Hyman BT. Lack of association oftrinucleotide repeat polymorphisms in very-low-density lipo-protein receptor gene with Alzheimer’s disease. Ann Neurol1996;39:800–3.

[40] Argraves KM, Battey FD, MacCalman CD, McCrae KR,Gafvels M, Kozarsky KF, Chappell DA, Strauss JF III, Strick-land DK. The very low density lipoprotein receptor mediates thecellular catabolism of lipoprotein lipase and urokinase-plasmino-gen activator inhibitor type I complexes. J Biol Chem1995;270:26550–7.

[41] Kirchgessner TG, Svenson KL, Lusis AJ, Schotz MC. Thesequence of cDNA encoding lipoprotein lipase. A member of alipase gene family. J Biol Chem 1987;262:8463–6.

[42] Goldberg IJ, Soprano DR, Wyatt ML, Vanni TM, KircheessnerTG, Schotz MC. Localization of lipoprotein lipase mRNA inselected rat tissues. J Lipid Res 1989;30:1569–77.

[43] Yaeoub LK, Vanni TM, Goldberg IJ. Lipoprotein lipase mRNAin neonatal and adult mouse tissues: comparison of normal andcombined lipase deficiency (cld) mice assessed by in situ hy-bridization. J Lipid Res 1990;31:1845–52.

[44] Lorent K, Overbergh L, Moechars D, De Strooper B, VanLeuven F, Van den Berghe H. Expression in mouse embryos andin adult mouse brain of three members of the amyloid precursorprotein family, of the alpha-2-macroglobulin receptor/low den-sity lipoprotein receptor-related protein and of its ligandsapolipoprotein E, lipoprotein lipase, alpha-2-macroglobulin andthe 40 000 molecular weight receptor-associated protein. Neuro-science 1995;65:1009–25.

[45] Christie RH, Chung H, Rebeck GW, Strickland DK, HymanBT. Expression of the very low-density lipoprotein receptor

(VLDL-r), an apolipoprotein-E receptor, in the central nervoussystem and in Alzheimer’s disease. J Neuropathol Exp Neurol1996;55:491–8.

[46] Coleman T, Deip RL, Gimble JM, Lee D, Maeda N, Se-menkovich CF. COOH-terminal disruption of lipoprotein lipasein mice is lethal in homozygotes, but heterozygotes have elevatedtriglycerides and impaired enzyme activity. J Biol Chem1995;270:12518–25.

[47] Weinstock PH, Bisgaier CL, Aalto-Setala K, Radner H, Ra-makrishnan R, Levak-Frank S, Essenburg AD, Zechner R,Breslow JL. Severe hypertriglyceridemia, reduced high densitylipoprotein, and neonatal death in lipoprotein lipase knockoutmice. Mild hypertriglyceridemia with impaired very low densitylipoprotein clearance in heterozygotes. J Clin Invest1995;96:2555–68.

[48] Heegaard CW, Simonsen ACW, Oka K, Kjoller L, ChristensenA, Madsen B, Ellgaard L, Chan L, Andrease PA. Very lowdensity lipoprotein receptor binds and mediates endocytosis ofurokinase-type plasminogen activator-type-1 plasminogen activa-tor inhibitor complex. J Biol Chem 1995;270:20855–61.

[49] Kasza A, Petersen HH, Heegaard CW, Oka K, Christensen A,Dubin A, Chan L, Andreasen PA. Specificity of serineproteinase/serpine complex binding to very-low-density lipo-protein receptor and a2-macroglobulin receptor/low-density-lipo-protein-receptor-related protein. Eur J Biochem1997;248:270–81.

[50] Lorent K, Overbergh L, Delabie J, Van Leuven F, Van denBerghe H. Distribution of mRNA coding for alpha-2-macroglobulin, the murinoglobulins, the alpha-2-macroglobulinreceptor and the alpha-2-macroglobulin receptor associatedprotein during mouse embryogenesis and in adult tissues. Differ-entiation 1994;55:213–23.

[51] Kanaki T, Bujo H, Hirayama S, Tanaka K, Yamazaki H,Seimiya K, Morisaki N, Schneider WJ, Saito LY. Developmen-tal regulation of LR11 expression in murine brain DNA. CellBiol 1998;17:647–57.

.

.