Molecular cloning and functional characterization ... - doi@nrct

MOLECULAR CLONING AND FUNCTIONAL

CHARACTERIZATION OF CALRETICULIN

FROM THE HUMAN LIVER FLUKE,

OPISTHORCHIS VIVERRINI

BY

MISS WANLAPA CHAIBANGYANG

A DISSERTATION SUBMITTED IN PARTIAL FULFILLMENT

OF THE REQUIREMENTS FOR THE DEGREE OF

THE DOCTOR OF PHILOSOPHY (BIOMEDICAL SCIENCES)

GRADUATE PROGRAM IN BIOMEDICAL SCIENCES

FACULTY OF ALLIED HEALTH SCIENCES

THAMMASAT UNIVERSITY

ACADEMIC YEAR 2017

COPYRIGHT OF THAMMASAT UNIVERSITY

Ref. code: 25605412330010EAN

(1)

Dissertation Title MOLECULAR CLONING AND FUNCTIONAL

CHARACTERIZATION OF CALRETICULIN

FROM THE HUMAN LIVER FLUKE,

OPISTHORCHIS VIVERRINI

Author Miss Wanlapa Chaibangyang

Degree Doctor of Philosophy in Biomedical Sciences

Department/Faculty/University Graduate Program in Biomedical Sciences

Faculty of Allied Health Sciences

Thammasat University

Dissertation Advisor Associate Professor Hans Rudi Grams, Dr. rer. nat.

Dissertation Co‐Advisor Professor Peter Smooker, Ph.D.

Dissertation Co‐Advisor Associate Professor Smarn Tesana, Ph.D.

Dissertation Co‐Advisor Associate Professor Suksiri Vichasri Grams, Dr.

rer. nat.

Dissertation Co‐Advisor Assistant Professor Amornrat Geadkaew Krenc,

Ph.D.

Academic Year 2017

ABSTRACT

Opisthorchis viverrini (Ov), a human liver fluke endemic in parts of

Thailand, causes opisthorchiasis and is associated with cholangiocarcinoma, a serious

health problem in the country. Calreticulin (CALR) is an endoplasmic reticulum‐

resident multifunctional protein in mammals that is involved in various biological

functions inside and outside the cell including calcium homeostasis, chaperoning,

apoptotic cell clearance, cell adhesion, as well as angiogenesis. In this study, RNA

expression and protein distribution of O. viverrini calreticulin (OvCALR) were

analyzed, and its intracellular and extracellular functions were investigated. A cDNA

encoding OvCALR was cloned from total RNA of the adult parasite. The deduced

amino acid sequence of OvCALR contains various characteristics of calreticulin

including the calreticulin family signature 1 and 2, a signal peptide, an ER retention

Ref. code: 25605412330010EAN

(2)

signal, three functional and structural domains (N‐, P‐, and C‐domain), three

conserved cysteine residues, and three each of two tandem repeated motifs.

Additionally, it has very high sequence conservation at 96.6% identity to Clonorchis

sinensis calreticulin and significantly less to blood fluke calreticulin, Schistosoma

mansoni (57.5%) and S. japonicum (53.6%), and mammalian calreticulin, Mus

musculus (50.7%) and Homo sapiens (50.9%), respectively. OvCALR mRNA was

detected by reverse transcription PCR in all analyzed developmental stages from the

newly excysted juvenile to the mature parasite. Western blot analyses using mouse

anti‐rOvCALR antiserum detected native protein in soluble and insoluble crude

parasite extracts as well as in the excretory/secretory product of the adult parasite.

Moreover, rOvCALR was recognized by Ov‐infected hamster sera starting eight

weeks postinfection. Immunohistochemical detection of OvCALR in adult

O. viverrini revealed its presence in several tissues and cell types, including

tegumental cell bodies, cecal epithelium, testes, ovary, prostate gland, Mehlis’ gland,

vitelline cells, eggs, and lining of seminal vesicle. OvCALR was not detected in liver

tissue of Ov‐infected hamster. Recombinant OvCALR demonstrated in vitro

protection of citrate synthase from thermal‐induced aggregation. Recombinant

OvCALR C‐domain showed a mobility shift in native‐PAGE in the presence of

calcium. Recombinant OvCALR was shown to bind to human C1q in a dose‐

dependent manner and to suppress C1q‐mediated hemolysis of human sensitized red

blood cells. In addition, it also was shown to inhibit proliferation, migration, and

sprouting of human endothelial cells in vitro. The observed effects were similar to

those observed in rMmCALR. However, transacetylase activity of rOvCALR as

previously reported for Haemonchus contortus calreticulin could not be observed. In

conclusion, OvCALR has ER‐functions including chaperoning and calcium binding

that are comparable to human calreticulin. Moreover, OvCALR is a released protein

from the parasite with potential to modulate the host immune system and

cholangiocarcinoma development from its anti‐angiogenesis activity and C1q‐

mediated interference of the host immune system. OvCALR is an interesting molecule

that might be a target for opisthorchiasis control and diagnosis.

Ref. code: 25605412330010EAN

(3)

Keywords: Platyhelminthes, CALR, calcium-binding, chaperone, transacetylase, cell

proliferation, cell motility, endothelial sprouting, angiogenesis, complement C1q

Ref. code: 25605412330010EAN

(4)

ACKNOWLEDGEMENTS

This dissertation would not be accomplished without any supports and

collaboration of many persons and institutes. The most important person who gave me

an invaluable opportunity to do my Ph.D. is my major advisor, Associate Professor

Dr. Hans Rudi Grams. I would like to express my sincere gratitude and greatest

appreciation to him for the generous guidance and the endless support throughout of

my study in his laboratory at Thammasat University.

I am very thankful to all co‐advisors of my dissertation. I would like to

express my deep thankfulness to Associate Professor Dr. Smarn Tesana, Department

of Parasitology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand

for his valuable advice and generous support. Equally, I would like to express my

deep gratefulness to Associate Professor Dr. Suksiri Vichasri Grams for her

encouragement, valuable suggestions and comments. Likewise, my deepest

appreciation goes to Assistant Professor Dr. Amornrat Geadkaew Krenc for her

kindness support and guidance in my laboratory work.

I would like to offer my special thanks and deepest appreciation to my

foreign co‐advisor, Professor Dr. Peter Smooker, School of Science, Biosciences and

Food Technology, RMIT University, Australia who provided the great opportunity to

conduct my research in his laboratory for his encouragement, kindness, and support

throughout the ten months of my visit. I would like to thank Dr. Paul Ramsland and

Dr. Anna Walduck, School of Science, Biosciences and Food Technology, RMIT

University, Australia for their kind support and useful suggestions and comments.

Special thanks also to all students and staff at Biotechnology Laboratory, School of

Science, RMIT University for their help, encouragement, and marvelous time in

Melbourne, Australia.

I am deeply grateful to Professor Major General Dr. Oytip Nathalang and

Assistant Professor Dr. Potjanee Srimanote for their valuable suggestions and kindly

providing materials to complete my laboratory work. I would like to give my

appreciation to Associate Professor Dr. Ratchaneewan Aunpad for kindly providing

materials and the opportunity to use her laboratory facilities. I am also thankful to

Ref. code: 25605412330010EAN

(5)

Assistant Professor Dr. Tullayakorn Plengsuriyakarn, Graduate Studies, Chulabhorn

International College of Medicine, Thammasat University for kindly providing

paraffin‐embedded hamster liver and O. viverrini‐infected hamster liver.

I would like to express my gratitude to the members of my dissertation

defense committee, Associate Professor Dr. Smarn Tesana, Professor Dr. Peter

Smooker, Associate Professor Dr. Ratchaneewan Aunpad, and Associate Professor

Dr. Poom Adisakwattana, Faculty of Tropical Medicine, Mahidol University, for their

acceptance to be my dissertation defense committee and kindness to correct my

dissertation.

My study would have not been possible without financial support from

the Thailand Research Fund (TRF) and Thammasat University through the Royal

Golden Jubilee Ph.D. Program (RGJ-PHD) under the supervision of Associate

Professor Dr. Hans Rudi Grams.

I would like to thank all friends, instructors, and staff members of the

Graduate Program in Biomedical Sciences, Faculty of Allied Health Sciences,

Thammasat University for their support, especially all members of the Molecular

Biology and Parasitology Unit.

Last but not least, I would like to express my deepest appreciation to my

beloved family for their consistent support and the greatest encouragement.

Miss Wanlapa Chaibangyang

Ref. code: 25605412330010EAN

(6)

TABLE OF CONTENTS

Page

ABSTRACT (1)

ACKNOWLEDGEMENTS (4)

TABLE OF CONTENTS (6)

LIST OF TABLES (14)

LIST OF FIGURES (15)

LIST OF ABBREVATIONS (19)

CHAPTER 1 INTRODUCTION 1

CHAPTER 2 OBJECTIVES 3

CHAPTER 3 REVIEW OF LITERATURES 4

3.1 Opisthorchis viverrini 4

3.1.1 Taxonomy and typical characterization 4

3.1.2 Life cycle 4

3.1.3 Morphology 6

3.1.3.1 Adult 6

3.1.3.2 Egg 6

3.1.3.3 Miracidium 6

3.1.3.4 Sporocyst 7

3.1.3.5 Redia 7

Ref. code: 25605412330010EAN

(7)

TABLE OF CONTENTS (Cont.)

Page

3.1.3.6 Cercaria 7

3.1.3.7 Metacercaria 7

3.1.4 Geographical distribution 8

3.1.5 Clinical manifestation and pathogenesis 10

3.1.6 Diagnosis 12

3.1.7 Treatment and control 13

3.1.8 Opisthorchis viverrini‐associated cholangiocarcinoma 14

3.2 Calreticulin (CALR) 19

3.2.1 Genes and structure of calreticulin 20

3.2.2 Biological functions of calreticulin 25

3.2.2.1 Calreticulin functions inside of the ER 25

(1) Chaperone activity 25

(2) Calcium homeostasis 27

3.2.2.2 Calreticulin functions outside of the ER 29

(1) Cell adhesion 29

(2) Focal adhesion disassembly and cell migration 29

(3) Phagocytosis 30

(4) Wound healing 30

(5) Angiogenic activity 31

3.2.3 Calreticulin of pathogenic protozoans and helminths 33

3.2.3.1 Protozoans 33

3.2.3.2 Helminths 36

(1) Nematodes 36

(2) Cestode 37

(3) Trematodes 37

CHAPTER 4 MATERIALS AND METHODS 39

Ref. code: 25605412330010EAN

(8)


Page

4.1 Molecular cloning of Opisthorchis viverrini calreticulin 39

(OvCALR)

4.1.1 Preparation of total RNA 39

4.1.1.1 Isolation of adult O. viverrini total RNA 39

4.1.1.2 Separation of nucleic acids by agarose gel 39

electrophoresis

4.1.1.3 DNase I treatment of O. viverrini total RNA 40

4.1.2 Reverse transcription and PCR amplification of 40

OvCALR

4.1.3 Ligation of OvCALR cDNA into pGEM®‐T Easy 43

vector and transformation of Escherichia coli (E. coli)

cells with ligation product

4.1.4 Preparation of chemically competent E. coli cells 44

4.1.5 Transformation of E. coli cells 45

4.1.6 Isolation of plasmid DNA using alkaline extraction 46

method

4.1.7 Positive transformants screening by colony PCR 46

4.1.8 Sequence analysis 47

4.1.9 Storage of bacterial clones 48

4.2 Production of rOvCALR using a bacterial system 48

4.2.1 Construction of recombinant expression vector 48

4.2.1.1 Construction of pQE‐30‐OvCALR expression 48

vector

4.2.1.2 Construction of pET21b(+)‐OvCALR expression 49

vector

(1) DNA cloning of OvCALR 49

(2) Ligation of OvCALR into pET21b(+) vector 50

Ref. code: 25605412330010EAN

(9)


Page

4.2.2 Small‐scale expression and time‐course analysis 51

4.2.3 Determination of target‐protein solubility 52

4.2.4 Large‐scale expression of rOvCALR 52

4.2.4.1 Large‐scale expression of M15‐derived 52

rOvCALR

4.2.4.2 Large‐scale expression of Rosetta‐ 52

gami(DE3)pLysS‐derived rOvCALR

4.2.5 Protein analysis by sodium dodecyl sulfate‐ 53

polyacrylamide gel electrophoresis (SDS‐PAGE)

4.2.5.1 Gel casting, sample preparation and 53

electrophoresis

4.2.5.2 Staining of protein in polyacrylamide gel 54

4.2.6 Purification of rOvCALR using Ni‐NTA affinity 54

chromatography

4.2.6.1 Purification of rOvCALR under denaturing 54

conditions

4.2.6.2 Purification of rOvCALR under native 55

conditions

4.2.7 Concentration and dialysis of rOvCALR 55

4.2.7.1 Concentration of rOvCALR using centrifugal 55

concentrator

4.2.7.2 Dialysis of rOvCALR 55

4.2.8 Measurement of rOvCALR concentration using 56

Bradford’s assay

4.3 Production of polyclonal antibody in mice 56

4.3.1 Production of polyclonal mouse anti‐rOvCALR 56

antibody

4.3.2 Production of polyclonal mouse anti‐OvES antibody 57

Ref. code: 25605412330010EAN

(10)


Page

4.3.3 Determination of antibody titer by enzyme linked 57

immunosorbent assay (ELISA)

4.4 Preparation of parasite antigens 58

4.4.1 Parasite crude extracts 58

4.4.2 Excretory/secretory (ES) product 58

4.4.3 Measurement of protein concentration using BCA assay 59

4.5 Characterization of OvCALR expression 59

4.5.1 Preparation of different developmental stages of 59

O. viverrini

4.5.2 Stage‐specific reverse transcriptase polymerase chain 60

reaction (RT‐PCR)

4.5.3 Detection of native OvCALR using Western blot 61

analysis

4.5.3.1 Protein blotting by semi‐dry transfer 61

4.5.3.2 Detection of protein blotting 62

4.5.4 Immunohistochemical detection of OvCALR 63

4.6 Detection of rOvCALR by O. viverrini‐infected hamster sera 64

4.6.1 Blood collection from O. viverrini‐infected hamsters 64

4.6.2 Indirect ELISA 64

4.6.3 Western blot analysis 65

4.7 Functional analysis of rOvCALR 65

4.7.1 Production of experimental control proteins 65

4.7.1.1 Production of recombinant Mus musculus 65

calreticulin (rMmCALR)

(1) Isolation of mouse total RNA 65

(2) Molecular cloning of MmCALR 65

(3) Construction of pET21b(+)‐MmCALR 67

expression vector

Ref. code: 25605412330010EAN

(11)


Page

(4) Expression and purification of rMmCALR 68

4.7.1.2 Production of recombinant Fasciola gigantica 68

calcium‐binding protein 1 (rFgCaBP1)

4.7.1.3 Production of recombinant Schistosoma japonicum 68

glutathione S‐transferase (rSjGST)

4.7.2 Thermal induced protein aggregation assay 69

4.7.3 Calcium binding assay 69

4.7.3.1 Production of rOvCALR C‐domain 69

(1) Construction of pGEX‐5X‐1‐OvCALR C‐domain 69

expression vector

(2) Expression of rSjGST‐OvCALR C‐domain 71

(3) Purification of rSjGST‐OvCALR C‐domain 72

4.7.3.2 Determination of calcium‐binding activity using 72

native‐PAGE

4.7.4 Determination of transacetylase activity 73

4.7.4.1 Indirect transacetylase activity measurement 73

using GST assay

4.7.4.2 Western blot analysis of acetylated protein 74

4.7.5 C1q binding assay 75

4.7.6 Hemolytic assay 75

4.7.7 In vitro angiogenesis assays 76

4.7.7.1 Preparation of recombinant proteins for tissue 76

culture

4.7.7.2 Cell culture 77

4.7.7.3 MTT assay 77

4.7.7.4 Scratch assay 78

4.7.7.5 Tube formation assay 78

Ref. code: 25605412330010EAN

(12)


Page

CHAPTER 5 RESULTS 80

5.1 Molecular cloning of Opisthorchis viverrini calreticulin 80

(OvCALR) cDNA and its sequence analysis

5.2 Production of rOvCALR and other control proteins using a 88

bacterial system

5.2.1 Production of rOvCALR 88

5.2.1.1 Small‐scale expression of rOvCALR 88

5.2.1.2 Large‐scale expression and purification of 88

rOvCALR

5.2.2 Production of rOvCALR C‐domain 94

5.2.3 Production of recombinant Mus musculus calreticulin 95

(rMmCALR)

5.2.4 Production of recombinant Fasciola gigantica 99

calcium‐binding protein 1 (rFgCaBP1)

5.2.5 Production of recombinant Schistosoma japonicum 100


5.3 Production of polyclonal antibody in mice 101

5.3.1 Production of polyclonal mouse anti‐rOvCALR 101

antibody

5.3.2 Production of polyclonal mouse anti‐OvES antibody 102

5.4 Characterization of OvCALR expression in O. viverrini 103

5.4.1 Stage‐specific reverse transcriptase polymerase chain 103

reaction (RT‐PCR)

5.4.2 Western blot analyses 104

5.4.3 Immunohistochemical analyses 108

5.5 Analysis of OvCALR‐specific antibody response by 112

O. viverrini‐infected hamster sera

Ref. code: 25605412330010EAN

(13)


Page

5.6 Functional analysis of rOvCALR 114

5.6.1 Chaperoning activity 114

5.6.2 Calcium‐binding activity 116

5.6.3 Transacetylase activity 117

5.6.4 Human C1q binding 120

5.6.5 Inhibition of classical complement pathway 121

5.6.6 In vitro angiogenic properties 123

5.6.6.1 Endothelial cell proliferation 124

5.6.6.2 Endothelial cell migration 125

5.6.6.3 Endothelial cell sprouting 126

CHAPTER 6 DISCUSSION 128

CHAPTER 7 CONCLUSIONS 136

REFERENCES 138

APPENDICES 165

APPENDIX A SPECIFICATIONS OF DNA VECTORS 166

APPENDIX B REAGENT PREPARATIONS 170

APPENDIX C ANIMAL ETHICS PERMISSION 183

APPENDIX D HUMAN ETHICS PERMISSION 184

BIOGRAPHY 185

Ref. code: 25605412330010EAN

(14)

LIST OF TABLES

Table Page

4.1 List of primer 42

4.2 List of E. coli strains and appropriate antibiotic concentrations 46

Ref. code: 25605412330010EAN

(15)

LIST OF FIGURES

Figure Page

3.1 Life cycle of the liver fluke, Opisthorchis viverrini 5

3.2 The prevalence of O. viverrini and C. sinensis 9

3.3 Incidence of liver and bile duct cancer in different regions 15

of Thailand during the year 2010–2012

3.4 Incidence of cholangiocarcinoma worldwide reported 16

between 1977 and 2007

3.5 Proposed pathogenesis mechanisms of O. viverrini 18

infection‐induced cholangiocarcinoma (CCA)

3.6 Genes, mRNAs, and protein of calreticulin in human 21

3.7 Structure of calreticulin 23

3.8 Comparison of amino acids sequences of calreticulin from 24

different species

3.9 Calreticulin chaperone activity in glycoprotein folding 26

control

3.10 Functions of calreticulin and its dependent pathway 28

3.11 Schematic representation of calreticulin‐mediated 31

phagocytosis

3.12 The complement pathway 34

4.1 Timeline diagram of anti‐rOvCALR antisera production in 57

Mice

5.1 Agarose gel showing the RT‐PCR product of OvCALR 82

obtained from adult O. viverrini total RNA

5.2 Agarose gel showing the OvCALR cDNA product obtained 83

from transformant‐screening methods

5.3 Nucleic acid and deduced amino acid sequences of OvCALR 84

5.4 Signal peptide prediction of OvCALR by SignalP 4.1 85

Ref. code: 25605412330010EAN

(16)

LIST OF FIGURES (Cont.)

Figure Page

5.5 Multiple alignment of the deduced amino acid sequences 86

of calreticulin from O. viverrini (UniProt: A0A1P8P1U1),

C. sinensis (UniProt: K7NB00), S. mansoni

(UniProt: Q06814), S. japonicum (UniProt: O45034),

M. musculus (UniProt: P14211), H. sapiens (UniProt: P27797)

5.6 Time‐course and target‐protein solubility analyses of E. coli 89

M15/pQE30‐OvCALR

5.7 Protein expression and target‐protein solubility analyses 90

of E. coli Rosetta‐gami(DE3)pLysS/pET21b(+)‐OvCALR

5.8 Purification of rOvCALR using Ni‐NTA affinity 91

chromatography under denaturing conditions

5.9 Purification of rOvCALR using Ni‐NTA affinity 92

chromatography under native conditions

5.10 SDS‐PAGE showing purified rOvCALR (5 µg) obtained 93

from denaturing purification

5.11 Purification of rSjGST‐OvCALR C‐domain using glutathione 94

affinity chromatography

5.12 Agarose gel showing (A) total RNA isolated from mouse 96

(B) the RT‐PCR product obtained from mouse total RNA

with specific primers for MmCALR

5.13 Protein expression and target‐protein solubility analyses 97

of E. coli Rosetta‐gami(DE3)pLysS/pET21b(+)‐MmCALR

5.14 Purification of rMmCALR using Ni‐NTA affinity 98


5.15 Purification of rFgCaBP1 using Ni‐NTA affinity 99


5.16 Purification of rSjGST using glutathione affinity 100

Chromatography

Ref. code: 25605412330010EAN

(17)


Figure Page

5.17 Line graph showing antibody level of polyclonal 101

anti‐rOvCALR antibody (dilution 1:400) determined

by indirect ELISA

5.18 Line graph showing antibody level of polyclonal anti‐OvES 102

antibody (dilution 1:6,400) determined by indirect ELISA

5.19 Stage‐specific analysis of OvCALR from total RNA of 103

newly excysted juveniles (NEJ), 2‐, 4‐ and 8‐week‐old

parasites (2wk, 4wk and 8wk) by reverse transcription PCR

5.20 SDS‐PAGE of parasite extracts from adult O. viverrini 105

5.21 Western blot detection of OvCALR by anti‐rOvCALR 106

antisera from three mice

5.22 Western blot detection of OvCALR by anti‐rOvCALR 107

Antiserum

5.23 Immunohistochemical detection of OvCALR in adult 109

O. viverrini

5.24 Immunohistochemical detection of O. viverrini antigens 110

in infected hamster liver sections

5.25 Graph of the absorbance values (mean ± SD) of preinfection 112

and 12‐week postinfection hamster sera (n=10) against

rOvCALR detected by indirect ELISA

5.26 Indirect ELISA and immunoblot detection of rOvCALR by 113

pooled (n=10) preinfection and postinfection hamster sera

5.27 Line graph showing protective effect of OvCALR on citrate 115

synthase (CS) against thermal induced aggregation

5.28 Native PAGE showing shift in the migration of OvCALR in 116

the system presenting of calcium

5.29 Bar graph showing transacetylase activity of calreticulin 118

determined by GST activity assay

Ref. code: 25605412330010EAN

(18)


Figure Page

5.30 Immunoblot detection of protein acetylation by 119

anti‐acetylated lysine antibody

5.31 Graph showing human C1q binding of OvCALR obtained 120

by competitive ELISA

5.32 Bar graph showing effect of rOvCALR against classical 122

complement‐mediated hemolysis

5.33 Bar graph showing effect of rOvCALR on HUVECs 123

proliferation determined by MTT assay

5.34 Effect of rOvCALR on HUVECs migration determined 125

by scratch assay

5.35 Effect of rOvCALR on HUVECs sprouting determined by 127

tube formation assay

Ref. code: 25605412330010EAN

(19)

LIST OF ABBREVIATIONS

Symbols/Abbreviations Terms

%

% (v/v)

% (w/v)

Percent

Volume/volume percent

Weigh/volume percent

×g Gravitational acceleration

°C

α

β

γ

Degree Celsius

Alpha

Beta

Gamma

µg Microgram(s)

µl Microliter(s)

µm

1st

2nd

7‐AMC

8‐oxodG

AA

ABC

AEC

ANOVA

APS

ASR

BCA

BCIP/NBT

BiP

BLAST

bp

Micrometer(s)

First

Second

7‐Acetoxy‐4‐methylcoumarin

8-Hydroxydeoxyguanosine

Amino acid

Avidin‐biotin complex

3‐amino‐9‐ethylcarbazole

Analysis of variance

Ammonium persulfate

Age‐standardized incidence rates

Bicinchoninic acid

5‐Bromo‐4‐chloro‐3‐indolyl phosphate/ Nitro

blue tetrazolium chloride

Immunoglobulin heavy‐chain binding protein

The Basic Local Alignment Search Tool

Base pair(s)

Ref. code: 25605412330010EAN

(20)

LIST OF ABBREVIATIONS (Cont.)


BSA

C. sinensis

C1q

Ca

CaBP3

CALR

CAM

CCA

CD4+

CD47

CD91

cDNA

CDNB

cm2

CNX

CO2

CRP55

CRTase

CW

CYPR

DEPC

DMSO

DNA

DNase

Bovine serum albumin

Clonorchis sinensis

Complement component 1q

Calcium

Calcium binding protein 3

Calreticulin

Chick chorioallantoic membrane

Cholangiocarcinoma

T‐helper cell

Cluster of Differentiation 47 or Integrin‐

associated protein

Cluster of Differentiation 91 or Low‐density‐

lipoprotein‐related protein 1

Complementary deoxyribonucleic acid

1‐chloro‐2,4‐dinitrobenzene

Square centimeter

Calnexin

Carbon dioxide

55 kDa calcium binding protein of the ER

lumen

Calreticulin transacetylase

Crude worm extract

NADPH cytochrome c reductase

Diethyl pyrocarbonate

Dimethyl sulfoxide

Deoxyribonucleic acid

Deoxyribonuclease

Ref. code: 25605412330010EAN

(21)



dNTPs

dT

DTT

DW

E. coli

E. dispar

E. histolytica

e.g.

EBV

EDTA

EhCALR

ELISA

EMBOSS

eNOS

ER

ERAD

ERp57

ERp60

ES

FAK

FECT

FgCaBP1

FGF

Grp78

h

H. contortus

Deoxy nucleoside triphosphate(s)

Deoxythymine

Dithiothreitol

Distilled water

Escherichia coli

Entamoeba dispar

Entamoeba histolytica

Exempli gratia (for example)

Epstein‐Barr virus

Ethylenediaminetetraacetic acid

Entamoeba histolytica calreticulin

Enzyme‐linked immunosorbent assay

European Molecular Biology Open Software

Suite

Endothelial nitric oxide synthase

Endoplasmic reticulum

ER‐associated degradation

ER protein 57

Endoplasmic reticulum resident protein 60

Excretory/secretory products

Focal adhesion kinase

Formalin ethyl‐acetate concentration technique

Fasciola gigantica calcium‐binding protein 1

Fibroblast growth factor

Immunoglobulin heavy‐chain binding protein

Hour(s)

Haemonchus contortus

Ref. code: 25605412330010EAN

(22)



H2O2

HCC

HpCALR

HPCVE

HRP

HUVEC

IARC

IFN

Ig

IL

InsP3R

IPTG

Kb

KD

kDa

kg

L. donovani

L‐NAME

LAMP

Lao PDR

LB

LC‐MS/MS

LdCALR

LRP1

mA

MAC

MAPK

Hydrogen peroxide

Hepatocellular carcinoma

Heligmosomoides polygyrus calreticulin

Horseradish peroxidase

Human placenta chorionic villi explants

Human umbilical vein endothelial cell

International Agency for Research on Cancer

Interferon

Immunoglobulin

Interleukin

Inositol 1,4,5‐triphosphate receptor

Isopropyl‐1‐thio‐β‐D‐galactopyranoside

Kilobase(s)

Dissociation constant

Kilo Dalton

Kilogram(s)

Leishmania donovani

NG‐nitro‐L‐Arginine ethyl ester

Loop‐mediated isothermal amplification

Lao People's Democratic Republic

Luria Bertani

Liquid chromatography‐mass spectrometry

Leishmania donovani calreticulin

Low‐density‐lipoprotein‐related protein 1

Milliampere(s)

Membrane‐attack complex

Mitogen‐activated protein kinase

Ref. code: 25605412330010EAN

(23)


Symbols/Abbreviations

MEF

mg

MHC

MIF

min

ml

mm

mM

mRNA

n

N. americanus

NCBI

NF‐AT

Ni‐NTA

nm

NMR

NO

NOS

OD

O. felineus

OPD

Ov

O. viverrini

OvCALR

Ov‐GRN‐1

Ov‐Trx‐1

Terms

Myocyte‐enhancer factor

Milligram(s)

Major histocompatibility complex

Minute intestinal flukes

Minute(s)

Milliliter(s)

Millimeter(s)

Millimolar(s)

Messenger ribonucleic acid

Sample size

Necator americanus

National Center for Biotechnology Information

Nuclear factor of activated T‐cells

Nickle‐nitrilotriacetic acid

Nanometer(s)

Nuclear magnetic resonance

Nitric oxide

Nitric oxide synthase

Optical density

Opisthorchis felines

O‐Phenylenediamine dihydrochloride

Opisthorchis viverrini

Opisthorchis viverrini

Opisthorchis viverrini calreticulin

Opisthorchis viverrini granulin‐like growth

factor

Opisthorchis viverrini thioredoxin

Ref. code: 25605412330010EAN

(24)



PBS

PBST

PCR

PDI

PEDF

pH

PS

r

RNA

RNase

ROI

ROS

rpm

RT‐PCR

s

S. haematobium

S. japonicum

S. mansoni

SDS

SDS‐PAGE

SERCA

ShCALR

SjGST

Phosphate buffered saline

Phosphate buffered saline with Tween® 20

Polymerase chain reaction

Protein disulfide isomerase

Pigment epithelium‐derived factor

Negative logarithm of hydrogen ion

concentration

Phosphatidylserine

Recombinant

Ribonucleic acid

Ribonuclease

Reactive oxygen intermediates

Reactive oxygen species

Round per minute

Reverse transcriptase polymerase chain

reaction

Second(s)

Schistosoma haematobium

Schistosoma japonicum

Schistosoma mansoni

Sodium dodecyl sulfate

Sodium dodecyl sulfate‐Polyacrylamide gel

electrophoresis

Sarco/endoplasmic reticulum calcium ATPase

Schistosoma haematobium calreticulin

Schistosoma japonicum glutathione S‐

transferase

Ref. code: 25605412330010EAN

(25)


Symbols/Abbreviations

SR

SR‐A

T. solium

TBE

TBS

TcCALR

TEMED

TGF

TM

TMB

TNF

TsCALR

TSP

UDP

UGGT

UTR

UV

V

VEGF

WHO

Terms

Sarcoplasmic reticulum

Scavenger receptor type A

Taenia solium

Tris/Borate/EDTA

Tris buffered saline

Trypanosoma cruzi calreticulin

Tetramethylethylenediamine

Transforming growth factor

Melting temperature

3,3′,5,5′‐Tetramethylbenzidine

Tumor necrosis factor

Taenia solium calreticulin

Thrombospondin

Uridine diphosphate

UDP‐glucose/glycoprotein glucosyltransferase

Untranslated region

Ultraviolet

Volt(s)

Vascular endothelial growth factor

World Health Organization

Ref. code: 25605412330010EAN

(26)


Amino acid codes

Full name 1-letter abbreviation 3-letter abbreviation

Alanine A Ala

Arginine R Arg

Asparagine N Asn

Aspartic acid D Asp

Cysteine C Cys

Glutamic acid E Glu

Glutamine Q Gln

Glycine G Gly

Histidine H His

Isoleucine I Ile

Leucine L Leu

Lysine K Lys

Methionine M Met

Phenylalanine F Phe

Proline P Pro

Serine S Ser

Threonine T Thr

Tryptophan W Trp

Tyrosine Y Tyr

Valine V Val

Ref. code: 25605412330010EAN

1

CHAPTER 1

INTRODUCTION

Opisthorchiasis, a parasitic infection caused by the liver fluke

Opisthorchis viverrini, is an important public health problem in Thailand, especially

in North and Northeast Thailand, and other countries in Southeast Asia including Lao

People’s Democratic Republic (Lao PRD), Vietnam and Cambodia. In Thailand, it

can cause economic loss about $120 million annually for medical care and lost wage.1

Human, who is a definitive host, can be infected by ingestion of raw or undercooked

freshwater fish that are contaminated with metacercariae. The number of globally

O. viverrini infected people is estimated to be around ten million.2 Most of the

infected persons are asymptomatic and long‐term infection leads to severe symptoms

and serious complications including cholangiocarcinoma. The principal diagnosis is

microscopic identification of parasite eggs in stool specimen. Praziquantel, the only

one drug of choice for opisthorchiasis treatment, is still effective for the treatment. In

Thailand, the liver fluke control program operation at region‐wide scale started in

19873, however, the recent prevalence of O. viverrini infection in some areas is still

high.

O. viverrini infection is carcinogenic to human and chronic infection can

result in cholangiocarcinoma development. Cholangiocarcinoma, a cancer of the

biliary system, is difficult to diagnose and has very poor prognosis, with an average 5‐

year survival rate of 5–10%.4 It is relatively resistant to chemotherapy and radiation,

therefore, surgery is the only possibility of a cure. Cholangiocarcinoma has low

incidence worldwide but not in Thailand. It is the predominant type of cancer

incidence particularly in the north and northeast Thailand, where O. viverrini is

endemic. The mechanisms of O. viverrini infection‐involved cholangiocarcinoma

development are not fully understood. O. viverrini secreted molecules have been

thought to partly contribute to the microenvironment that promotes tumorigenesis. A

parasite‐secreted growth factor, O. viverrini granulin‐like growth factor (Ov‐GRN‐

1)5,6

, has been reported that might participate in development of cholangiocarcinoma

Ref. code: 25605412330010EAN

2

in chronic O. viverrini infection. However, a potential angiogenic molecule from the

parasite has not been studied yet.

Calreticulin is a well‐researched multifunctional protein that is involved

in various biological functions including calcium homeostasis, ER‐chaperoning,

apoptotic cells clearance, cell adhesion and migration, as well as angiogenic activity.

It is present in all nucleated cells of higher organism and has been described in a wide

range of organisms, such as mammals, higher plants, helminths and protozoans.

Calreticulin not only plays an important role in physiological conditions but is also

involved in various pathological conditions including cancer.

To understand how important O. viverrini calreticulin (OvCALR) is in the

parasite and in the host‐parasite interplay, this study molecular characterized its DNA,

RNA, and protein. Protein functions including chaperoning, calcium binding, acetyl

group transferring, C1q binding, and angiogenic properties were analyzed. This study

provides a part to fulfill the basic knowledge of host‐parasite interplay during

opisthorchiasis as well as O. viverrini infection‐associated cholangiocarcinoma that

could conduce to the new target molecule on diagnosis and vaccine development.

Ref. code: 25605412330010EAN

3

CHAPTER 2

OBJECTIVES

The main objective of this study is to investigate molecular and functional

properties of O. viverrini calreticulin (OvCALR), a potential angiogenic protein from

O. viverrini. The specific objectives are as follows:

1. To molecularly clone and characterize the cDNAs encoding

calreticulin from Opisthorchis viverrini

2. To produce recombinant OvCALR (rOvCALR) and its C‐domain as

soluble proteins

3. To produce mouse polyclonal antisera against rOvCALR

4. To identify native OvCALR in parasite antigen extracts and parasite

tissue

5. To determine the immunogenicity of OvCALR in O. viverrini‐

infected hamster sera

6. To investigate biochemical properties of rOvCALR including calcium

binding, chaperoning, acetyl group transferring, and C1q binding

7. To investigate in vitro angiogenic properties of rOvCALR

Ref. code: 25605412330010EAN

4

CHAPTER 3

REVIEW OF LITERATURE

3.1 Opisthorchis viverrini

3.1.1 Taxonomy and typical characterization

O. viverrini is a food‐borne trematode that is classified into the

phylum Platyhelminthes, class Trematoda, sub‐class Digenea, order Opisthorchiida

and family Opisthorchiidae. This family also includes two other closely related

species, which are medically important pathogens: Clonorchis sinensis and

O. felineus. The characteristics of adult digenean body are dorsoventrally flat and

bilaterally symmetrical, but varying in size according to the species. The typical

characteristics of trematodes are mostly hermaphroditic, an oral and a ventral suckers

presenting but lacking of respiratory and circulatory systems. Their body is covered

with the tegument that involved in nutrient absorption, sensory functions,

osmoregulation and also protection from host immune response.7

3.1.2 Life cycle

The life cycle of O. viverrini (Figure 3.1) is similar to those of

O. felineus and C. sinensis with differences in susceptible intermediate host species.

They undergo various larval stages in three different hosts with sexual and asexual

reproductions. The adult flukes of O. viverrini reside mainly in the bile ducts of the

liver and gall bladder of the definitive host including cat, dog and human. The flukes

lay a large number of embryonated eggs, which pass into the duodenum along with

the bile and release into the environment along with the feces. After reaching

freshwater reservoirs, these eggs are ingested by Bithynia snails and then miracidia

hatch in the gastrointestinal tract of the snail by mechanical and chemical

stimulations. The miracidia penetrate to the lymph spaces and transform to

sporocysts. The sporocysts reproduce to rediae and then cercariae by asexual

reproduction. Free‐swimming cercariae leave the snail, actively seek and attach to

susceptible cyprinid fish species. They penetrate the skin of the fish and encyst in the

flesh as metacercariae, which are the infective stage. The definitive host can be

Ref. code: 25605412330010EAN

5

infected with the parasite by ingesting undercooked or raw contaminated fishes. After

ingestion, metacercariae are digested by gastric and intestinal juices, respectively, and

are activated for hatching by the bile at the duodenum. Then the excysted juveniles

migrate through the ampulla of Vater to the hepatic biliary system where they attach

to the bile duct epithelium and develop to adults.8,9

Figure 3.1 Life cycle of the liver fluke, Opisthorchis viverrini.9

Ref. code: 25605412330010EAN

6

3.1.3 Morphology

3.1.3.1 Adult

The adult worms of O. viverrini are dorsoventrally flat, leaf‐

shaped and transparent. The average size of the mature worm in human is 7 (5.4–

10.2) mm in length and 1.5 (0.8–1.9) mm in width, slightly larger than that found in

cat and dog.10

There are two suckers, the oral sucker is sub‐terminal and the ventral

sucker is located at the anterior part about one‐fifth of the body length. The two

branches of the blind ending digestive tract, which are connected at the short

esophagus, run in parallel and end at the posterior part of the body.11

Cirrus sac and

cirrus are not present. The numerous follicles of the vitellaria are in the lateral part of

the body, situated beside the intestine between ventral sucker and testes. The

multilobated ovary is located in front of the anterior testis and behind the uterus,

which originates from this site and ends with an opening at the genital pore in front of

the ventral sucker. The seminal vesicle is long, slightly coiled and opening at the

genital pore via the ejaculatory duct. The two testes are deeply lobed, diagonal

situated at the posterior part and the excretory bladder, a long S‐shaped tube, runs

between them.8

3.1.3.2 Egg

The embryos develop to maturity while the eggs move along

the uterus. The fully developed miracidia present in the eggs at the distal uterus. The

young eggs at the proximal uterus are larger than the mature eggs at the distal

uterus.12

The mature eggs laid from the adult stage of O. viverrini are oval in shape,

yellowish brown in color, and approximately 27 µm × 15 µm in size. The operculum

is surrounded with a thickened eggshell, the so‐called shoulder. The shell surface is

rough with a muskmelon‐like appearance, and an abopercular knob is present. The

morphology of O. viverrini, O. felineus, C. sinensis eggs and those of heterophyid

flukes is similar and causes problems in identification. Eggs can be found in the feces

approximately four weeks after infection.8,13

In human, adult O. viverrini can lay eggs

in a range from 2,000 to 4,200 per day.10

3.1.3.3 Miracidium

The miracidium develops in the egg and hatches after

ingested by a Bithynia snail. The study of O. viverrini eggs using electron microscopy

Ref. code: 25605412330010EAN

7

showed that the miracidium larva in the fully developed egg has a conical anterior

end, and its entire body is covered with a ciliated tegument except at the anteriormost

end. Inside the body, it contains plenty of glands: anterior apical gland, large cephalic

gland, and posterior secretory glands. At the posterior part of body, it contains a small

germinal region composing of 3–13 germ cells and a pair of flame cells.12

3.1.3.4 Sporocyst

The body of the mature sporocyst is very thin‐walled,

generally coiled, and approximately 1.1 mm × 0.65 mm sized. It contains many

developing rediae.14

3.1.3.5 Redia

The redia has a mount on the top, a thick walled pharynx and

short gut. The average size of a redia is 520 µm in length and 90 µm in width.8 Each

redia contains as many as 15 developing cercariae.14

3.1.3.6 Cercaria

The developing cercariae leave from the brood chambers of

the rediae and mature in the hemolymph space of the snail. The free‐swimming

cercaria shed by the snail is pipe‐form, oculate, pleurolophocercus, geo‐ and photo‐

tropic. The body size and tail size in average are 154 µm by 75 µm and 392 µm by 26

µm, respectively. The two eye spots are situated laterally between oral sucker and

pharynx. The body is covered with minute spines and brownish pigment scattering

bilaterally throughout the body. It has at least five pairs of penetration glands and at

least ten sensory hairs on each side of the body. The ventral sucker is inconspicuous

located slightly anterior to the roughly spherical excretory bladder.8,14

3.1.3.7 Metacercaria

The metacercaria is contained in a double‐walled cyst, which

is usually oval shaped. The outer cyst wall is about 3 to 8 µm thick, while the inner

cyst wall is very thin that can be recognized following the parasite excysted only. The

encysted and excysted metacercariae are morphologically similar and have an average

size of 201 µm by 167 µm and 558 µm by 145 µm, respectively. The oral and ventral

suckers are obvious. The appearances of the excretory bladder is oval shaped

containing a dense mass of dark granules, and of the surface body is a scatter of

brownish‐yellow pigment throughout its body.8

Ref. code: 25605412330010EAN

8

3.1.4 Geographical distribution

O. viverrini infection has been reported in Southeast Asia from

Thailand, Lao PDR, Cambodia and Vietnam (Figure 3.2).9 In 1980–1981, the highest

prevalence of O. viverrini infection in Thailand based on the region was 34.60% in

the northeast, and the rate in other regions was 6.34% in the central, 5.59% in the

north, and 0.01% in the south. The overall prevalence was 14% or approximately 7

million people infected.15

Following intensive and continuous control programs, the

prevalence of infection in 2001 declined in the northeast (15.7%), central (3.8%) and

south (0%), while in the north increased to 19.3%.3 In 2009, the overall prevalence

declined to 8.7% with an unabated prevalence in the northeast (16.6%) and north

(10%).16

However, the prevalence rate reported during 2012–2013 in some provinces

in the northeast was as high as 40.9% (Nakhon Phanom)17

, 38.68% (Yasothon)18

and

over 78% in some villages such as Ankam (Sakon Nakhon) and Kongswang (Nakhon

Phanom).17

In Lao PDR, over 2 million people are infected with O. viverrini,

mostly in the south of the country. The national scale survey of prevalence rate in

primary schoolchildren estimated during 2000–2002 from 17 provinces and Vientiane

municipality was 10.9%, and the prevalence was higher in the regions along the

Mekong River, up to 32.2%, 25.9% and 21.5% in Khammuane, Savannakhet and

Saravane Province, respectively.19

In 2006–2007, the prevalences of O. viverrini

infection in Saravane20

, Khong21

and Mounlapamok21

District, where are located in

the south of Lao PDR, were reported up to 58.5%, 92.0% and 90.9%, respectively.

The problematic identification of O. viverrini egg from those of small intestinal

trematodes resulted in prevalent report as Opisthorchis‐like eggs or

O. viverrini/minute intestinal fluke eggs in some surveys. However, several reports

confirmed O. viverrini infection by morphological and molecular analyses from

collected adult worms. They found that multiple trematodes infection is common in

Lao PDR, and Haplorchis taichui, a small intestinal trematode, usually found along

with O. viverrini.21-23

In 2002–2003, the prevalences of O. viverrini and minute

intestinal fluke (MIF) infections in inhabitant were 67.1% in Savannakhet Province23

and 81.1% in Khammouane Province22

. The prevalences in five provinces along the

Mekong River estimated during 2009–2011 as Ov/MIF revealed that the prevalence in

Ref. code: 25605412330010EAN

9

the villages that far from the river were lower (15.4% in Luang Prabang and 4.4% in

Xieng Khouang), while very high prevalence found again in Khong Island (85.4%),

Saravane (72.0%), and Vientiane (68.8%), where are close to the river.24

Figure 3.2 The prevalence of O. viverrini and C. sinensis. Endemicity level is defined

by the prevalence of infections; low: 0–5%, medium: 5.1–15%, high: higher than

15%.25

Ref. code: 25605412330010EAN

10

There are few data about O. viverrini infection in Cambodia.

However, over 600,000 people in Cambodia have been estimated to be infected with

O. viverrini.2 A small survey of O. viverrini infection in primary schoolchildren in

Kampongcham conducted in 2002 from 251 stool specimens was 4%.26

The national

scale survey conducted between 2006 and 2011 based on the Kato‐Katz thick smear

technique showed an overall prevalence of O. viverrini/MIF infection of 5.7%. The

central and southern regions, especially in Takeo and Kampongcham Provinces,

showed the highest prevalence of O. viverrini/MIF infection at 23.8–24%.27

Meanwhile, another survey in Takeo Province revealed 47.5% prevalence of

O. viverrini/MIF infection found in riverside villages of the Ang Svay Chek in the

Prey Kabas District.28

In Vietnam, both O. viverrini and C. sinensis infections have been

reported and estimated at 2 million people infected.2 Endemic areas of O. viverrini

have been reported in the central and southern regions including Nui Thanh, Mo Duc,

Phu My, Song Cau, Tuy An and Buon Don, whereas those of C. sinensis have been

reported in the northern region.29

The infection rates of O. viverrini reported from

three endemic southern provinces ranged from 15.2% to 36.9%.25

Recently, a small

survey in Phu My District from 254 stool samples revealed 11.4% of O. viverrini

infection based on the Kato‐Katz technique, and some of positive individuals were

confirmed by morphological and molecular analyses from collected adult worms.30

3.1.5 Clinical manifestation and pathogenesis

O. viverrini infection causes opisthorchiasis that often shows no

specific signs and symptoms. Only 5–10% of all infections show flatulence,

dyspepsia, fatigue, lost appetite, upper right quadrant abdominal pain and mild

hepatomegaly. Clinical symptoms are related to the intensity of infection, in severe

cases may be found with weakness, weight loss and ascites. Hematological and

biochemical features are not notable. In asymptomatic individuals, gallbladder

abnormalities including enlargement, sludge, gallstones and poor function can be

detected by ultrasonography. However, these abnormalities can be resolved after

treatment with praziquantel. Many complications can be found in opisthorchiasis

including obstructive jaundice, cholangitis, cholecystitis, intra‐abdominal mass,

gallbladder or intrahepatic stones, and cholangiocarcinoma, the most serious

Ref. code: 25605412330010EAN

11

complication. Cholangiocarcinoma is a malignant tumor of the biliary epithelium in

the intrahepatic biliary tree and may invade the sinusoids of the liver parenchyma.

The main clinical manifestation of opisthorchiasis associated cholangiocarcinoma is

jaundice that accounts for 60% of patients reported in northeast Thailand. The patients

may show obstructive jaundice alone or obstructive jaundice with either fever or acute

abdominal complications. Non‐jaundiced patients may suffer from dyspeptic pain,

anorexia, weight loss, upper right abdominal mass and distant metastasis.7,9,31

The pathological consequences of O. viverrini infection take mainly

place in the liver, extrahepatic bile ducts and gallbladder. Hepatomegaly, subcapsular

bile duct dilation and thick gallbladder are commonly found in infected animals and

humans. Histopathologic changes in opisthorchiasis include inflammation, epithelial

desquamation, epithelial and adenomatous hyperplasia, goblet cell metaplasia,

periductal fibrosis and granuloma formation. Gallstone can be found in up to 5% of

people in endemic areas.9

Pathogenesis of opisthorchiasis may be caused by mechanical or

chemical irritation from parasite and/or host immune response. The parasite’s suckers,

during feed and migration, cause mechanical injury and contribute to biliary

ulceration. The parasite eggs become entrapped through the ulcer and induce

granulomatous inflammation. The granulomata are usually found in experimental

hamster infections and occasionally found in human infection with bile duct

obstruction.32

Moreover, the metabolic products from the parasite that presented in the

excretory/secretory (ES) product can induce cell proliferation and may lead to the

biliary hyperplasia in opisthorchiasis. The host immune system responds to the

infection via inflammation that is mainly found around the bile ducts and periportal

areas. Severe inflammation can increase oxidative DNA damage and result in genetic

alteration. Furthermore, anthelmintic treatment with praziquantel leads to a

pronounced recruitment of inflammatory cells in the infected area and causes more

oxidative DNA damage. The effect of treatment combined with repeated infections

may enhance cholangiocarcinogenesis.9

Ref. code: 25605412330010EAN

12

3.1.6 Diagnosis

The gold standard for diagnosis of O. viverrini infection is

microscopic examination of eggs in feces, bile or duodenal fluid. For fecal sample,

formalin ethyl‐acetate concentration technique (FECT) is the current gold standard

method for O. viverrini detection.33

The fecal examination is widely used as routine

diagnosis. The methods for egg detection include the Kato‐Katz thick smear, Stoll’s

dilution and the quantitative formalin ethyl‐acetate concentration. However, the

sensitivity and accuracy of detection depend on the used method and the proficiency

of microscopist. Limitation of microscopic examination is morphological similarity of

trematode eggs, especially in the following families: Opisthorchiidae, Heterophyidae

and Lecithodendriidae. Hence, the diagnosis of opisthorchiasis, clonorchiasis and

minute intestinal flukes in co‐endemic areas such as Lao PDR and northern Thailand

are problematic.9

Immunodiagnostic approaches have been developed for

opisthorchiasis including immunoelectrophoresis, indirect‐hemagglutination, radio‐

immunoprecipitation, enzyme‐linked immunosorbent assay (ELISA), and dot‐

ELISA.34

Various parasite antigen extracts, including somatic crude extract, surface

tegumental extract and excretory/secretory product, have been used in antibody

detection assay. The promising one is enzyme‐linked immunosorbent assay using

partially purified antigens. Five fractions of adult O. viverrini were obtained from

chemical extraction and gel filtration chromatography: tegumental extract, somatic

extract and fraction 1 to 3. This assay showed 100% sensitivity of tegumental extract,

somatic extracts and fraction 1, whereas 94.9%, 84.0% and 57.1% specificity,

respectively, when tested against infected human sera compared to FECT method.35

Research focus then switched to specific parasite antigens for diagnosis. For example,

purified O. viverrini oval antigen was used in dot‐ELISA to detect antibodies in serum

samples. The assay showed 100% sensitivity and specificity compared to the modified

Kato‐Katz method and adult worm detection following praziquantel treatment.36

However, most antigens of this parasite are not species‐specific leading to cross‐

reactivity with sera from other parasitic infections. In addition, antibody levels show

no considerable decrease after 12 months of praziquantel treatment. For antigen

detection using copro‐ELISA, monoclonal antibodies were developed to detect the

Ref. code: 25605412330010EAN

13

parasite antigens in stool samples; however, obtained sensitivity and specificity were

unsatisfactory.34

Recently, monoclonal antibody against excretory/secretory antigen

of adult O. viverrini has been developed to detected O. viverrini urinary antigens in

urine sample using ELISA. This assay showed 81% sensitivity and 70% specificity

compared to FECT method, meanwhile the assay result showed cross reactivity with

some individuals who infected with Strongyloides stercoralis and hookworm. In

addition, the efficacy of this assay to detect the infection depended on the intensity of

infection.33

A new approach for O. viverrini detection, polymerase chain

reaction (PCR)‐based approach, has been developed to enhance the capability and

accuracy of detection. PCR‐based diagnosis focused on detection of O. viverrini egg

DNA in fecal specimens with the aim to increase sensitivity of O. viverrini detection

in light infection cases.37

Several DNA fragments from mitochondrial DNA38

and

ribosomal DNA39

of O. viverrini have been used as the target in molecular diagnosis.

Moreover, colorimetric loop‐mediated isothermal amplification (LAMP) assays have

been developed to detect O. viverrini with potentially used for point‐of‐care

diagnosis.40,41

3.1.7 Treatment and control

Praziquantel is the only drug currently recommended by World

Health Organization (WHO) for treatment of O. viverrini infection. There are two

optional recommended regimens: 3 times daily at oral dose of 25 mg/kg for 2–3

consecutive days or single oral dose of 40 mg/kg.42

In Thailand, the studies in 1980–

1983 showed that the treatment with a single oral dose of 40 mg praziquantel per 1 kg

body weight was effective for opisthorchiasis, with a cure rate as high as 91–95.5%.3

This regimen has been used in a large‐scale control program in Thailand. The adverse

effects including headache, vertigo, nausea, fatigue, vomiting, and abdominal pain are

common; however, all of these are transient and relatively minor severe.9,43

Concerning about the development of drug resistance resulted in several attempts to

find optional drugs for opisthorchiasis treatment.44

The promising one is

tribendimidine, which is effective drug for treatment of soil‐transmitted helminth

infections that approved in China. It showed very high cure and egg reduction rates in

Ref. code: 25605412330010EAN

14

opisthorchiasis treatment of clinical phase 2 trial; however, non‐inferiority compared

to praziquantel treatment was not shown.43,45

Prevention and control of O. viverrini infection comprise three main

strategies: (1) elimination of human host and animal reservoirs by treatment, (2)

interruption of disease transmission by improved sanitation, and (3) interruption of

infection by health education.3

3.1.8 Opisthorchis viverrini‐associated cholangiocarcinoma

Primary liver cancer, comprising two major types based on

histological characteristics and origin: hepatocellular carcinoma (HCC) and

cholangiocarcinoma (CCA), is a predominant type of cancer in Thailand.46

Liver

cancer causes high mortality rates, with total 27,500 deaths reported in Thailand in

2004. Moreover, liver cancer is the disease that caused the highest burden of

premature death in both sexes.47

It was the first leading cancer in men with an ASR of

33.9, and the third in women with an ASR of 12.9 during the year 2010–2012 (Figure

3.3).46

The incidence rate of liver cancer reported in 2008 as ASR from cancer

registries in Thailand ranged between 14.3 and 83.1 in men and between 5.0 and 43.2

in women in Surat Thani and Nakhon Phanom Province, respectively. Based on the

histological types, cholangiocarcinoma accounted for more than 55% in some

provinces in the north and northeast, where O. viverrini is endemic, and up to 73–82%

in Ubon Ratchathani, Khon Kaen, and Nakhon Phanom.48

On the other hand,

cholangiocarcinoma is relatively rare worldwide, hepatocellular carcinoma accounting

for 70% to 85% of the total cancer burden worldwide. In 2008, low rates of liver

cancer were found in several parts of Asia (southern, central and western) and Europe

(central, northern and eastern), with ASR < 5 in both sexes. On the other hand, top

two highest rates were found in eastern Asia (ASR = 35.5 in men and 12.7 in women)

and south eastern Asia (ASR = 21.4 in men and 9.0 in women), where are the

endemic areas of the liver flukes O. viverrini and C. sinensis.49

The incidences of

cholangiocarcinoma worldwide are shown in Figure 3.4, and the highest rate was

reported in northeastern Thailand.

Ref. code: 25605412330010EAN

15

Figure 3.3 Incidence of liver and bile duct cancer in different regions of Thailand

during the year 2010–2012. The incidences were represented as age‐standardized

incidence rate (ASR) per 100,000 of world population.48

Ref. code: 25605412330010EAN

16

Figure 3.4 Incidence of cholangiocarcinoma worldwide reported between 1977 and

2007.50,51

In 1994, the International Agency for Research on Cancer (IARC),

a part of the World Health Organization (WHO), has classified O. viverrini as group 1

carcinogen; infection with this parasite is carcinogenic to humans.52

Until now, there

are many studies including epidemiology, human, and experimental animal that

demonstrated the positive relationship between O. viverrini infection and

cholangiocarcinoma. The data derived from cross‐sectional and case control studies

conducted in Thailand to evaluate the association between O. viverrini infection and

the risk of cholangiocarcinoma showed the range of odds ratios from 1.3–27.1,

whereas no significant association was found between O. viverrini infection and

hepatocellular carcinoma. In experimental animal studies, administration of N‐nitroso

compounds (N‐nitroso dimethylamine or N‐nitroso dihydroxy di‐n‐propylamine) in

combination with O. viverrini infection in hamsters increased the incidences of

cholangiocarcinoma. Such increase was not found in O. viverrini infection only. So

the IARC working group evaluated that chronic infection with O. viverrini causes

cholangiocarcinoma.2

Ref. code: 25605412330010EAN

17

There are three main mechanisms that have been proposed to

contribute to CCA: (1) mechanical damage to biliary epithelium caused by parasites,

(2) immunopathology due to inflammatory response to parasite infection, and (3)

toxic effects of the parasite excretory/secretory (ES) product (Figure 3.5). The

physical damage that occurs from parasite feeding and migratory activities leads to

incomplete wound repair. This constant cell division in the presence of exogenous

cofactors such as dietary nitrosamine may result in DNA damage and subsequent

oncogenesis. These carcinogenic properties were demonstrated in hamsters with

surgically ligated bile duct, followed by sub‐carcinogenic oral dose of nitrosamine

administration. The hamsters showed a significant development of biliary lesions

which was not found in controls that received either biliary ligation or nitrosamine.

Furthermore, DNA damage was revealed in biliary epithelial cells adjacent to

O. viverrini in chronically infected hamsters by staining with 8‐oxodG which is a

DNA damage marker.53

Nitric oxide (NO) is a product of the inflammatory response

to the parasite infection produced by macrophages, mast cells and other cell types.

Nitric oxide is not only cytotoxic but also genotoxic and mutagenic, resulting in the

release of endogenous nitrosamine that is carcinogenic. In a dietary nitrosamine

control study, opisthorchiasis patients had increased levels in plasma and urinary

nitrate compared to uninfected persons. The elevated nitrate level indicates a high

endogenous nitrosamine production, as nitrates are excretory metabolite of

nitrosamines. This condition can be abolished by co‐administration of ascorbic acid

with proline or treatment with praziquantel.54,55

The molecules that are released by the

parasite have become of interest and widely studied as factors facilitating to

cholangiocarcinogenesis. The results of co‐culture between adult O. viverrini and

NIH‐3T3 mouse fibroblasts in a Transwell chamber showed a marked increase in

NIH‐3T3 cell proliferation when compared to that without parasites. The O. viverrini

ES product promoted cell proliferation by stimulating the expression of cyclin D1 and

phosphorylated retinoblastoma (pRB) that resulted in driving the cell through the

G1/S transition point into the S‐phase of the cell cycle. In addition, a gene microarray

approach revealed that mRNAs encoding growth‐promoting proteins such as

Ref. code: 25605412330010EAN

18

Figure 3.5 Proposed pathogenesis mechanisms of O. viverrini infection‐induced

cholangiocarcinoma (CCA).53

Three major factors contributed by O. viverrini

infection lead to cholangiocarcinogenesis including (1) mechanical damage, (2) host

immune response, and (3) excretory/secretory (ES) product.

Ref. code: 25605412330010EAN

19

transforming growth factor were found to be overexpressed in NIH‐3T3 cells co‐

cultured with O. viverrini ES product.54

A notable growth factor that is present in the

O. viverrini ES product is a homolog of human granulin. O. viverrini granulin‐like

growth factor (Ov‐GRN‐1) is a secreted protein by the adult flukes and detected on

the biliary epithelial cells of infected hamsters.5 Recombinant Ov‐GRN‐1 promoted

proliferation of NIH‐3T3 mouse fibroblast and human CCA cell lines via the mitogen‐

activated protein kinase (MAPK).54

In addition, it promoted in vitro angiogenesis in

human endothelial cells.56

Thioredoxin is another molecule that presented in

O. viverrini ES product.57

In vitro study of the effect of O. viverrini thioredoxin (Ov‐

Trx‐1) on human cholangiocyte found that recombinant Ov‐Trx‐1 suppressed bile

duct epithelial cells from oxidative stress‐induced apoptosis by downregulating

apoptotic genes in MAPK pathway and upregulated anti‐apoptosis‐related genes.58

Novel oxysterol derivatives, bile aldehyde and bile alcohol, were found in O. viverrini

extracts using a liquid chromatography‐mass spectrometry (LC‐MS/MS) approach.

Oxysterols, which is oxygenated derivatives of cholesterol, can be mutagenic and

genotoxic. Moreover, it possesses pro‐oxidative and pro‐inflammation properties that

can promote carcinogenesis. A study of binding domains in human genes

demonstrated an association between different types of oxysterols and the

development and progression of various cancers: colon, lung, breast and bile ducts.59

All of the proposed mechanisms may act in concert to create a unique

microenvironment that stimulates cholangiocarcinogenesis.

3.2 Calreticulin (CALR)

Calreticulin was first isolated as a high affinity calcium‐binding protein

found in the rabbit skeletal muscle sarcoplasmic reticulum (SR) in 1974.60

It had been

discovered and described under various names including calregulin, CRP55, CaBP3,

ERp60 and calsequestrin‐like protein. Following an advance in molecular biology, it

was later proved that they are all the same protein, namely calreticulin, and it is not

only present in skeletal muscle sarcoplasmic reticulum but also abundant in non‐

muscle endoplasmic reticulum (ER). The non‐muscle endoplasmic reticulum lumen

contains many calcium‐binding proteins including protein disulfide isomerase (PDI),

Ref. code: 25605412330010EAN

20

immunoglobulin heavy‐chain binding protein (BiP; Grp78), endoplasmin (Grp94), but

the major one is calreticulin. The name of calreticulin, widely accepted then, is from

calcium binding protein localized to the endoplasmic/sarcoplasmic reticulum

membranes.61

Over four decades since first identified, calreticulin has been identified

extensively in diverse organisms including vertebrates (e.g., human, mouse, bovine,

dog, porcine, chicken, fish, and frog)62-68

, invertebrates (e.g., shrimp, mollusks,

roundworms, blood flukes, tapeworms, fruit fly, and protozoans)69-82

, and as well as

plants83

. Moreover, it is widely recognized that it is not restricted only in the

endoplasmic/sarcoplasmic reticulum but ubiquitous. It is also localized in

intracellular, at the cell surface, and extracellular compartments in various kinds of

cell and tissue as a multifunctional protein involved in many physiological and

pathological conditions.84

3.2.1 Genes and structure of calreticulin

Mammalian calreticulin (CALR) had been previously described as

one gene, one protein, and one mRNA, no evidence for RNA alternative splicing.85

On the other hand, at least two isoforms of calreticulin have been reported in plants.83

Recently, the second isoform of calreticulin, CALR386

, has been discovered in human

and mouse.87

However, this novel isoform of calreticulin has not been characterized

further, providing limited information. Both of human CALR and CALR3 genes are

located in the region 13 on the short arm of chromosome 19 and consist of nine exons,

with 4.2 kb and 17 kb in length, respectively (Figure 3.6A).87,88

In mouse, CALR gene

is located on chromosome 8 with a length of 4.8 kb and is organized into nine exons

similar to human calreticulin.89,90

The northern blot detection of calreticulin mRNA in

various human tissues revealed CALR mRNA at 1.9 kb approximately sized in all

tested tissues (spleen, thymus, prostate, testis, ovary, small intestine, colon, and

peripheral blood leucocyte), while CALR3 mRNA was detected only in testis at 1.3

kb approximately sized. The CALR mRNA contains an extensive 3′ UTR, about 600

base pairs, resulted in larger than CALR3 mRNA, whereas their 5′ UTR length are

comparable (Figure 3.6B).87

Human CALR3 isoform, 384 amino acids in length,

shared only about 50% homology with human CALR, 417 amino acids in length,

Ref. code: 25605412330010EAN

21

Figure 3.6 Genes, mRNAs, and protein of calreticulin in human. (modified from Jia

et al., 2009)83

Schematics represent the genomic organization of human calreticulin

genes, calreticulin mRNAs, and domain structure of the protein. (A) Exon and intron

configuration of CALR and CALR3. Exons encoding the N‐domain (including the

signal sequence), the P‐domain and the C‐domain of calreticulin are in red, green, and

navy, respectively. The exon numbers are indicated below. (B) Schematic drawing of

the mRNAs encoding CALR and CALR3. Colored areas and grey bars represent the

open reading frame regions and the UTR regions, respectively. (C) Structural

prediction of CALR has three distinct structural and functional domains.91

The N‐, P‐

and C‐domains are also presented in red, green, and navy, respectively. The protein

contains an N‐terminal amino acid signal sequence (orange box) and a C‐terminal ER

retention signal (blue box). The location of the disulfide bond is indicated. Repeats A

and B are indicated by green ellipses and orange diamonds, respectively.85

Ref. code: 25605412330010EAN

22

likewise in mouse calreticulin isoforms.87

At amino acid level, calreticulin has a

typical structure comprising of three distinct structural and functional domains: N‐, P‐

and C‐domains. It carries a signal sequence preceded the N‐domain and an ER

retention signal at the end of the C‐domain (Figure 3.6C).85

The N‐domain (N‐terminal domain, residues 18–197) is highly

conserved between species. It is usually contains the three‐conserved cysteine, which

a pair of them forms an intramolecular disulfide bridge that essential for the correct

folding of calreticulin (Figure 3.7).92

In addition, it contains two patterns of

calreticulin family signature motif: calreticulin family signature 1 and 2 with

consensus pattern [KRHN]‐x‐[DEQN]‐[DEQNK]‐x(3)‐C‐G‐G‐[AG]‐[FY]‐[LIVM]‐

[KN]‐[LIVMFY](2) and [LIVM](2)‐F‐G‐P‐D‐x‐C‐[AG], respectively.93

This domain

plays an important role in chaperone activity, and it can bind zinc, rubella virus RNA,

α‐integrin, protein disulfide‐isomerase (PDI), ER protein 57 (ERp57) and also

interacts with the DNA‐binding domain of the glucocorticoid receptor.85

In order to

work as chaperone, the N‐domain, providing the oligosaccharide‐ and polypeptide‐

binding regions, and the P‐domain, providing another binding site, require to work

together forming the folding unit. The amino acids residues involved with sugar

binding in the N‐domain have been identified, including Tyr109, Lys111, Asp135,

Tyr128, and as well as Asp317 in the C‐domain. The changed conformation of

calreticulin was observed in a mutation of His170 resulted in calreticulin loosed its

chaperone function.94

Moreover, the N‐domain of calreticulin, named vasostatin, was

shown to inhibit angiogenesis and suppress tumor growth.95,96

Recently,

crystallographic studies of human97

and mouse98

calreticulin uncovered a single of the

high‐affinity but low‐capacity calcium‐binding site in the globular domain that was

previously mapped in the P‐domain based on biochemical study99

.

The P‐domain (residues 198–308) is a proline rich region, which

also takes part in chaperone activity.85

Nuclear magnetic resonance (NMR) studies of

the P‐domain of calreticulin revealed an extended‐arm like structure and ERp57

binding sites in this region100

(Figure 3.7). The mutation of some amino acid residues

in the ERp57 binding sites at the tip of the P‐domain, Glu239, Asp241, Glu243 and

Trp244, leaded to binding disruption of ERp57.94

The P‐domain has two sets of three

repeats, so called repeat A (amino acid sequence PXXIXDPDAXKPEDWDE) and B

Ref. code: 25605412330010EAN

23

(amino acid sequence GXWXPPXIXNP XYX), respectively (Figure 3.6). These

repeats are crucial for the lectin‐like chaperone activity of calreticulin as well as the

calcium‐binding activity.85

Figure 3.7 Structure of calreticulin.101

Schematic representation of three‐dimensional

model of the calreticulin based on the crystallographic structure of the N‐domain, the

NMR structure of the P‐domain, and de novo model of the C‐domain of calreticulin.

The structural and functional domains of calreticulin are indicated: the globular N‐

domain (green), the extended‐arm P‐domain (yellow), and the acidic C‐domain (red).

The yellow ball represents the calcium‐binding site.

Ref. code: 25605412330010EAN

24

The C‐domain (C‐terminal domain, residues 309–417) is acidic and

high negatively charged domain, which composed of aspartic and glutamic acid

residues clusters responsible for calcium buffering activity inside the ER (Figure 3.7).

This acidic region generates calcium‐binding sites with low‐affinity but high capacity

(25 mol Ca2+

/mol protein, Kd= ~ 250 µM).102,103

Several known calcium‐binding

proteins, such as PDI, BiP, and endoplasmin, contain similar clusters of acidic amino

acid residues.61

Moreover, this domain can bind to blood‐clotting factors, including

factor IX and X, and plays a key role in the regulation of calreticulin interaction with

PDI, and ERp57 through the binding of calcium.85

In mammalian calreticulin, the C‐

domain is usually followed by the sequence KDEL, an endoplasmic reticulum

retention signal. This ER retention signal sequence has been found to be varied

depending on species between the calreticulin homologs (Figure 3.8).

Figure 3.8 Comparison of amino acids sequences of calreticulin from different

species.85

Overall comparisons of different calreticulin are highly similar. The ER

retention signal sequences of calreticulin from selected species are shown. Gaps in the

amino acid sequence are indicated by the white area, and amino acid mismatches are

indicated by short vertical line.

Ref. code: 25605412330010EAN

25

3.2.2 Biological functions of calreticulin

Beside the calcium buffering and chaperoning, the primary roles of

calreticulin in the endoplasmic reticulum, calreticulin has multiple duties not only

inside but also outside of the ER, and is involved in a variety of cellular signaling

pathways.85,102

3.2.2.1 Calreticulin functions inside of the ER

(1) Chaperone activity

The ER is an essential compartment of the cell, where is a

factory of protein folding and modifying for secretory and membrane proteins that

accounted for one third of total cellular protein and a control center for calcium

storage and balance.104,105

The main function of calreticulin in the ER is in the folding

control of newly synthesized proteins and glycoproteins to prevent misfolded protein

aggregation by identifying and banning those proteins from the ER and sending to

ubiquitin‐mediated proteolysis (Figure 3.9). This folding chaperone activity of

calreticulin occurs mainly via its lectin site in the N‐domain by interacting with

ERp57 to form a folding unit.84

The glycoprotein folding control occurs in the

calreticulin/calnexin (CNX) cycle via recognized monoglucosylated N‐linked

oligosaccharides (GlcMan9GlcNAc2) by those lectin‐like chaperones.104

The

importance of calreticulin in chaperone activity is shown in major histocompatibility

complex (MHC) class I molecule production. Calreticulin is involved in folding

control and assembly of MHC class I through its lectin and peptide‐binding sites as

well as ERp57 interaction.101

The absence of calreticulin leads to an increase of

unstable MHC class I molecules exported from the ER, a decrease of MHC class I cell

surface expression and an impairment of antigen presentation.106

In addition,

calreticulin have been shown to suppress in vitro precipitation/aggregation of non–

and glycosylated protein at either physiological temperature or higher (42–50°C) in

calcium‐dependent and independent conditions.107-109

Therefore, calreticulin

deficiency impairs protein and glycoprotein quality control, resulting in accumulation

and export of misfolded proteins.110

Ref. code: 25605412330010EAN

26

Figure 3.9 Calreticulin chaperone activity in glycoprotein folding control.111

Calreticulin cooperating with ERp57 facilitates glycoprotein folding in the ER. The

natively folded glycoproteins can exit the ER and transit to their destination, while the

misfolded one can re‐glycosylated by UDP‐glucose/glycoprotein glucosyltransferase

(UGGT) to re‐interact with calreticulin/ERp57. Permanently misfolded proteins are

terminated through ER‐associated degradation (ERAD).

Ref. code: 25605412330010EAN

27

(2) Calcium homeostasis

Calcium plays an important role in signal transduction

pathways that involved with diverse cellular processes, including muscle contraction,

gene expression, protein synthesis and stress signaling. The ER is the major calcium

storage site and is essential in balancing cellular calcium homeostasis. Calcium

releasing from the ER is controlled by the inositol 1,4,5‐triphosphate receptor

(InsP3R) and the ryanodine receptor, while calcium restoring is operated by the

sarco/endoplasmic reticulum calcium ATPase (SERCA) pump (Figure 3.10).102

Inside ER, there are a number of calcium‐binding proteins, which serve as calcium‐

buffering and other responsibilities in ER lumen, including calreticulin, calnexin, BiP,

GRP94, calumenin, and the reticulocalbins.104

Calreticulin is a major calcium

buffering protein, which binds to over 50% of calcium stored in the ER and regulates

calcium storage and release within the ER. Calreticulin deficient cells exhibited a

reduction of calcium capacity and free calcium concentration in the ER lumen and an

inhibition of InsP3‐dependent calcium release from the ER.94,112

There was a report that calreticulin‐deficiency in mice

results in embryonic lethality because of impaired cardiac development.113

This

embryonic lethality can be rescued by the expression of activated calcineurin,

however, the mice showed growth retardation, hypoglycemia, and high level of blood

cholesterol and triglyceride.114

The mechanism of calreticulin and calcineurin‐

dependent embryonic lethality has been revealed that calreticulin‐dependent

calcineurin activation is essential for nuclear translocation of cardiac‐specific

transcription factors, nuclear factor of activated T‐cells (NF‐AT) and myocyte‐

enhancer factor (MEF) 2C.114,115

Therefore, the role of calreticulin in calcium release

is crucial in early stage of cardiac development through calcium and calcineurin‐

dependent pathways (Figure 3.10).

The calcium buffering homeostasis of calreticulin may

involve in adipocyte differentiation. The study of adipose‐derived mesenchymal stem

cell differentiation showed that high level of extracellular calcium and ionophore, a

chemical that facilitates calcium influx, inhibited mesenchymal stem cells

differentiation and upregulated calreticulin expression.116

Ref. code: 25605412330010EAN

28

Figure 3.10 Functions of calreticulin and its dependent pathway.102

Calreticulin (CRT

used only in this figure) is involved in the calreticulin/calnexin cycle to regulate

folding of glycoproteins by cooperated with ERp57. The MHC class I loading

complex comprised of CRT, CNX, ERp57, transporter associated with antigen

processing (TAP) and tapasin. It produces a proper functioning MHC class I molecule

by assembling the class I heavy chain and 2‐microglobulin with a stabilizing

peptide. CRT maintains homeostasis of cytosolic and ER calcium levels by regulating

calcium transport through InsP3R and SERCA. Cytoplasmic calcium level is essential

for calcineurin activation that allows nuclear translocation of the transcription factors

for cardiac development.

Ref. code: 25605412330010EAN

29

3.2.2.2 Calreticulin functions outside of the ER

There are many reports concerning the function of

calreticulin outside the ER. However, the mechanism of calreticulin translocation to

cell surface and extracellular release is not fully understood. A widely accepted

hypothesis is ER‐stress‐mediated apoptosis or cell dying, possibly caused by

oxidative stress induced by reactive oxygen species (ROS), UV irradiation, ER

calcium homeostasis disruption, as well as cell infection.84,101,117,118

There are three

major mechanisms have been proposed for cell surface exposure of calreticulin:

association of cytosolic calreticulin with phosphatidylserine (PS) via a membrane flip‐

flop mechanism during apoptosis and ERp57‐dependent or ‐independent translocation

through secretory pathway.84,101

The mechanism of cytoplasmic release of calreticulin

has been described through retrotranslocation from the ER. It can escape from signal

dependent ER‐retention to secretory pathway and avoid the ubiquitylation and

degradation after retrotranslocation.119

(1) Cell adhesion

Cytoplasmic calreticulin was shown to bind to the

KxGFFFKR amino acid sequence found in the cytoplasmic domains of the α subunits

of integrin possibly to stabilize integrin‐ligand binding and activate focal adhesion

kinase (FAK).84

Calreticulin deficient mouse embryo fibroblasts showed a reduction

collagen Ⅳ binding activity and the activity was restored when presenting of

cytosolic calreticulin.119

Cell surface calreticulin was shown to bind to glycosylated

forms of laminin to mediate spreading of laminin‐adherent melanoma cells.120

In

addition, murine embryonic stem cells lacking calreticulin exhibited severely

impaired integrin function.103

(2) Focal adhesion disassembly and cell migration

Cell surface calreticulin of endothelial cells and fibroblasts

has been shown to interact with the heparin‐binding domain at the N terminal of

thrombospondin 1 (TSP1) in association with the low‐density‐lipoprotein‐related

protein 1 (LRP1/CD91) to mediate focal adhesion disassembly, which is an important

process of cell migration. The binding site that is responsible for this activity is

located in the N‐domain of calreticulin, amino‐acid residues 19–36.84

Calreticulin

deficient mouse embryo fibroblasts showed a reduction in cell migration on

Ref. code: 25605412330010EAN

30

fibronectin and laminin as well as in migration chamber when compared to wild‐type

cells.84,119

Moreover, exogenous calreticulin can stimulate keratinocyte and fibroblast

migration using migration chamber and in vitro scratch assay.121

(3) Phagocytosis

Cell surface expression of calreticulin stimulates the

phagocytic ingestion of dead, ER‐stressed and cancer cells, so called eat‐me signal.

This mechanism is mediated by the binding of calreticulin to cell surface LRP1

(CD91) of phagocyte. In normal cell, the expression of anti‐phagocytic molecule,

CD47 (integrin‐associated protein), on the cell surface is higher than calreticulin,

while the cancer cell increases the expression of CD47 to evade the phagocytosis.101

Cell surface calreticulin in association with phosphatidylserine (PS) presented on

apoptotic cell has been shown to provide the recognition signal for apoptotic cells

clearance by phagocytes (Figure 3.11).84

Moreover, exogenous recombinant

calreticulin is capable to promote phagocytosis of normal bone marrow cells by

human macrophages.122

Additionally, calreticulin also plays an important role as a

bridging molecule through LRP1(CD91) in the recognition and removal of apoptotic

cells by binding directly to apoptotic cells‐recognized molecules, including C1q,

collectin, and ficolin.84

The C1q binding site on calreticulin is located spanning the N‐

and P‐domains of amino acid residues 160–283, specifically called the S‐domain.123

(4) Wound healing

The presence of calreticulin in the extracellular matrix is

associated with wound healing processes. Topically applied calreticulin significantly

increased the rate of wound repair in pig124

and mouse125

. Moreover, the applying of

calreticulin to wounds increased the expression of transforming growth factor β3, a

crucial wound healing factor, and increased cellular proliferation and migration of

keratinocytes and fibroblasts. The quality of wound healing was improved by both the

epidermal and dermal cutaneous repair process. Therefore, extracellular calreticulin

plays an important role in the process of tissue repair and remodeling.84,102,121

Ref. code: 25605412330010EAN

31

Figure 3.11 Schematic representation of calreticulin‐mediated phagocytosis.

(modified from Raghavan et al., 2013)101

Normal live cells (a) and cancer cells in the

absence of anti‐CD47 (b) are not phagocytosed, while cancer cells in the presence of

anti‐CD47 (b), drug‐induced stress cells (c) and apoptotic cells (d) upregulate cell

surface calreticulin expression resulting in phagocytosis.

(5) Angiogenic activity

Blood vessels are essential for supply of oxygen and

nutrients, waste disposal, and immune surveillance.126

New blood vessel formation,

termed neovascularization, can occur via two mechanisms: vasculogenesis and

angiogenesis. Vasculogenesis is the de novo formation of blood vessel from precursor

cells such as angioblasts, a cell type with potency to differentiate into endothelial cells

that are derived from hemangioblasts, differentiated from mesodermal stem cells.127

This process is driven by the recruitment of undifferentiated mesodermal cells to

become endothelial cells and the assembly of the cells into blood vessels. In contrast,

angiogenesis is the formation of new blood vessel from endothelial cells of existing

vasculature, a process driven by endothelial cell proliferation.128

In the embryo, a

primitive vessel network is created by vasculogenesis and followed by the process of

angiogenesis that is sprouting, branching and stabilization. These two mechanisms of

new blood vessel formation occur throughout life, from embryonic to adult stage, and

are involved in both physiological and pathological conditions.128,129

Angiogenesis is

required for physiological processes, such as wound healing and reproduction, as well

as pathological processes, such as invasive tumor growth. Therefore, it is tightly

Ref. code: 25605412330010EAN

32

regulated by a balance between pro‐angiogenic factors, such as vascular endothelial

growth factor (VEGF) and fibroblast growth factor (FGF), and anti‐angiogenic

factors, such as thrombospondin‐1 and pigment epithelium‐derived factor (PEDF).130

Initiation of blood vessel growth needs up‐regulation of pro‐angiogenic factors and

follows by down‐regulation of anti‐angiogenic factors.131

The curious finding in athymic mice that an Epstein‐Barr

virus‐immortalized cell line is not tumorigenic and promotes regression of

experimental Burkitt lymphoma, colon carcinoma, and other human malignancies

through vasculature‐based process leading to further studies of EBV‐immortalized

cells.132,133

Factors secreted from these cells were investigated, and one factor that was

purified from the supernatant of an EBV‐immortalized cell line was identified as an

NH2‐terminal fragment of human calreticulin (amino acids 1–180), named vasostatin.

Vasostatin was shown to inhibit the proliferation of endothelial cells induced by basic

fibroblast growth factor (bFGF or FGF‐2) but not cells of other lineages such as

human foreskin fibroblasts, Burkitt lymphoma cells, lung carcinoma cells, and colon

adenocarcinoma cells, and suppress angiogenesis in vivo. When recombinant

vasostatin was inoculated into athymic mice, it significantly reduced growth of human

Burkitt lymphoma and human colon carcinoma; however, tumor cells were not

growth‐inhibited by vasostatin in vitro.95

Further studies to identify a specific region responsible for

angiogenic activity in calreticulin have been reported. Calreticulin lacking the N‐

terminal 1–120 amino acids exhibited an inhibition of endothelial cell proliferation

in vitro and an inhibition of Burkitt tumor growth in vivo comparably to vasostatin.

Similar results were observed in a calreticulin fragment encompassing amino acid

residues 120–180. The results suggested that the anti‐angiogenic activity of vasostatin

and full‐length calreticulin is located on the N‐terminal amino acid residues 120–180

of calreticulin.134

In another study, it was shown that a vasostatin fragment,

encompassing amino acid residues 135–164, inhibited proliferation of endothelial

cells induced by bFGF comparably with vasostatin (amino acids 120–180). The

inhibitory effect in human endothelial cell proliferation and neovascularization in

chick embryo chorioallantoic membrane (CAM) were stronger when vasostatin was

Ref. code: 25605412330010EAN

33

fused with platelet factor‐4 (C‐13 fragment) by a nonpolar peptide bridge of Gly‐Pro‐

Gly.135

The mechanism of vasostatin to inhibit endothelial cell

proliferation, angiogenesis, and tumor growth is still unclear. However, it has been

reported that vasostatin specifically binds to α5 and γ1 chains of laminin, the

extracellular matrix protein expressed by endothelial cells. Laminins are high‐

molecular‐weight protein comprising polypeptides of α, β, and γ chains linked by

disulfide bonds. At least five α, three β, and three γ chains have been described to

assemble into twelve identified different laminin isoforms. The endothelial cell

attachment to laminin was inhibited after the addition of vasostatin to endothelial cell

cultures resulting in a reduction of endothelial cell proliferation.136

Moreover, an

in vivo study of plasmid‐encoding vasostatin effects on human hepatocellular

carcinoma xenograft in nude mice revealed an inhibitory effect of vasostatin on the

tumor growth and metastasis and an increase of survival time. In addition, the

histological result revealed that vasostatin treatment increased apoptosis and

suppressed angiogenesis.137

On the other hand, a pro‐angiogenic activity of calreticulin

has been reported that it can promote the proliferation, migration, and tube formation

of human umbilical vein endothelial cells through nitric oxide signaling pathway.

These effects were inhibited by a specific endothelial nitric oxide synthase (eNOS)

inhibitor, NG‐nitro‐L‐Arginine ethyl ester (L‐NAME). Pro‐angiogenic activity of

calreticulin might be involved in pathological angiogenesis event in rheumatoid

arthritis that found a significant increase calreticulin level in serum and synovial fluid

compared to healthy controls and osteoarthritis patients.138

Moreover, calreticulin has

been expressed in various cancers and it might be involved in tumorigenesis.139

3.2.3 Calreticulin of pathogenic protozoans and helminths

3.2.3.1 Protozoans

Pathogenic protozoan calreticulins are likely to implicate in a

mechanism of the parasite evading the host immune response. The complement

system is a part of innate immune system of host defense against common pathogenic

infection and complement activation results in pathogen opsonization, lysis, and

Ref. code: 25605412330010EAN

34

generation of potent proinflammatory anaphylatoxins leading to inflammatory

response (Figure 3.12).140

Figure 3.12 The complement pathway.140

Complement can be activated through three

pathways including classical, lectin, and alternative and finally results in

inflammation, lysis, and target opsonization and phagocytosis. Components‐mediated

complement pathways are indicated.

Ref. code: 25605412330010EAN

35

Calreticulin of Trypanosoma cruzi (TcCALR), one of a well‐

characterized calreticulin, is a 45‐kDa protein that is mainly located in the ER but also

found in the Golgi complex, reservosomes, flagellar pocket, cell surface, cytosol,

nucleus, and kinetoplast.141

TcCALR presented on the surface of infective‐stage

trypomastigotes can bind to host C1q; the first component participated in the

complement system, leading to inhibition of the classical complement pathway and

promotion of infectivity in macrophage as well as in human placenta chorionic villi

explants (HPCVE).142-144

The conserved C1q binding activity found in TcCALR

probably caused by a conserved C1q binding region of T. cruzi calreticulin (amino

acid residues 159–281), over 70% identity to the S‐domain of human calreticulin.142

Similar results also observed in Entamoeba histolytica and E. dispar, the parasite

calreticulins can bind to human C1q and inhibit classical complement pathway‐

mediated hemolysis in vitro. Moreover, pre‐incubated‐rEhCALR trophozoites were

significantly resistant to lysis by human serum that is a virulent indicator of

E. histolytica trophozoites.145

In Leishmania donovani, overexpression of either the P‐

domain of LdCALR or full‐length LdCALR in transfected L. donovani resulted in

significant reduction of survival ability inside human macrophage at 72 h after co‐

incubation with macrophage. The better result was observed in the P‐domain

overexpression, possibly caused by a disruption of virulent proteins trafficking

through an impaired secretory pathway from chaperone activity interfering.146

Beside the conserved lectin‐dependent activity, TcCALR and

its N‐terminal vasostatin‐like domain (N‐TcCALR) were shown to inhibit a capillary

growth in the rat aortic ring assay, an in vitro morphogenesis, proliferation and

chemotaxis of human umbilical vein endothelial cells (HUVECs), an endothelial cell

migration into Matrigel subcutaneous implanted in mice as well as an angiogenesis in

CAM assay.141,147

The anti‐angiogenic activity of TcCALR in these assays show

significantly higher activity than human calreticulin at equimolar concentration.148

Moreover, TcCALR also inhibits the growth of mammary tumor cells in mice.149

In

contrary, recombinant TcCALR was reported that it increased proliferation and

migration of human fibroblasts in vitro and promoted wound healing in a rat skin

model.150

Ref. code: 25605412330010EAN

36

High immunogenicity of calreticulin has been reported in

human parasitic infection; patients with either T. cruzi infection or amoebic liver

abscess (E. histolytica infection) were shown to develop high levels of serum

antibodies against the parasite calreticulin.151,152

3.2.3.2 Helminths

(1) Nematodes

Calreticulin in nematode was first identified in

Onchocerca volvulus, a causative agent of onchocerciasis or river blindness, as RAL1

antigen that induced a production of human calreticulin autoantibody in patients with

onchocerciasis.153,154

Immunogenicity of nematode calreticulins have been studied

and reported in Heligmosomoides polygyrus and Necator americanus. H. polygyrus is

a parasitic nematode of mice that is widely used as an experimental model to study

helminth associated immune mechanisms. Calreticulin of H. polygyrus (HpCALR) is

expressed in all stages, especially in tissue invasive larvae stage (L4) as a secreted

protein. Native HpCALR stimulated CD4+ T cells production of IL‐4 and IL‐10 in

H. polygyrus infected mice. Similarly, mice immunized with recombinant HpCALR

showed significant production of IL‐4 and specific IgG1 and IgE antibodies. These

results indicate the T helper 2‐related immune response against HpCALR. Moreover,

recombinant HpCALR can bind to scavenger receptor type A (SR‐A) on dendritic

cells leading to internalization of HpCALR.75

Calreticulin of N. americanus can

stimulate the production of histamine from basophils and is a strong immunogen that

is recognized by IgE antibodies from the infected patients.73,155

Moreover, it has been

a target for vaccine development, the application of the recombinant calreticulin of

N. americanus resulted in the reduction of worm burdens by 43–49% compared to

controls.156

Pathogenic nematode calreticulins are likely to implicate in

a host immunomodulation and a parasite survival as well. The nematode

Haemonchus contortus, a gastrointestinal parasite of sheep and goat, secrets

calreticulin which displays anti‐coagulation properties by binding to calcium and

clotting factors leading to prolong plasma coagulation time in vitro. Similar nematode

calreticulins of Brugia malayi157

and N. americanus73

, it can bind to C1q and inhibit

classical complement‐mediated hemolysis. Additionally, it can bind to host C‐reactive

Ref. code: 25605412330010EAN

37

protein, which is a marker for inflammatory response that can bind to complement

C1q and acts as pro‐coagulant protein.158

These functions of calreticulin in

H. contortus may facilitate the parasite to feed continuously on host blood and survive

by modulating the host immune response.74

(2) Cestode

Taenia solium is an intestinal tapeworm that can cause

taeniasis and cysticercosis, especially neurocysticercosis, which is a serious public

health in human. Calreticulin of T. solium was widely distributed and differential

expression was found during development, particularly in germ cell and

embryogenesis.159

Contrary to other reported parasite calreticulins, TsCALR was

poorly recognized by human and pig sera with cysticercosis.78

The ability of TsCALR

as vaccine candidate has been studied in hamster by oral administration with cholera

toxin as adjuvant. The results showed that immunization with rTsCALR induced IL‐4

and IFN‐γ expression leading to goblet cell hyperplasia in the mucosa surrounding the

parasite and resulted in a reduction of worm burden in infected hamster as well as a

decrease of genotoxicity‐induced tapeworm infection.160,161

In addition, fecal specific

IgA and serum specific IgG antibodies against TsCALR were detected after

immunization, and specific IgA antibody was more pronounced after the parasite

challenge.161

Anti‐inflammatory activity of TsCALR was studied in experimental

induced‐colitis in mouse model. Orally administered recombinant TsCALR prior

colitis induction significantly reduced the inflammatory parameters including IL‐6,

TNF‐α, and IL‐1β and increased the regulatory cytokines IL‐10 and TGF‐β leading to

less clinical and histopathological severity.162

(3) Trematodes

Calreticulin of Schistosoma japonicum was molecularly

cloned but only its calcium‐binding activity was determined.77,163

Calreticulin of

S. mansoni (62 kDa) is a good T‐ and B‐cell antigen and represents a potential vaccine

candidate.164

After stimulation with S. mansoni calreticulin, 20–30% of the

schistosomiasis resistant individuals showed detectable levels of IL‐2, IL‐4, and IFN‐

γ and 59% of them possessed anti‐S. mansoni calreticulin IgM specific antibodies.165

Moreover, S. mansoni calreticulin was assessed as a marker for schistosomiasis

diagnosis; however, cross‐reacting antibody was detected in healthy controls.166

In

Ref. code: 25605412330010EAN

38

S. haematobium, differential recognition of adult parasite detected by the infected

human serum showed that ShCALR was recognized by IgE and IgG1 antibodies but

not by IgA and IgG4 antibodies.167

Ref. code: 25605412330010EAN

39

CHAPTER 4

MATERIALS AND METHODS

4.1 Molecular cloning of Opisthorchis viverrini calreticulin (OvCALR)

4.1.1 Preparation of total RNA

4.1.1.1 Isolation of adult O. viverrini total RNA

Total RNA of adult O. viverrini was isolated using TRIzol™

Reagent (Invitrogen, Carlsbad, CA, USA). The parasites were homogenized in

TRIzol™

Reagent (1 ml reagent per 50–100 mg parasite wet weight) using a tissue

homogenizer (Ultra‐Turrax T25, IKA, Staufen, Germany). The homogenate was

centrifuged at 12,000×g for 10 min at 4°C. The clear supernatant was collected and

incubated at room temperature for 5 min. Chloroform (0.2 ml per 1 ml of TRIzol™

Reagent) was added, and the tube was shaken vigorously and further incubated at

room temperature for 2–3 min. The sample was centrifuged at 12,000×g for 15 min at

4°C, and the upper aqueous phase was carefully aspirated into a new tube. To

precipitate total RNA, 100% isopropanol (0.5 ml per 1 ml of TRIzol™

Reagent) was

added, incubated at room temperature for 10 min, and centrifuged at 12,000×g for 10

min at 4°C. The pellet was collected and subsequently washed with 75% (v/v) ethanol

(1 ml per 1 ml of TRIzol™

Reagent). The tube was centrifuged afterward at 7,500×g

for 5 min at 4°C, and the pellet was completely dried by air‐drying. Finally, the RNA

pellet was dissolved in RNase‐free water and stored at −80°C. The quality of isolated

total RNA was determined by 1% (w/v) agarose gel electrophoresis (see Section

4.1.1.2).

4.1.1.2 Separation of nucleic acids by agarose gel electrophoresis

Agarose gel was prepared by melting agarose (Ultrapure™

Agarose, Invitrogen, Carlsbad, CA, USA) in 0.5X TBE buffer (45 mM Tris‐base, 45

mM boric acid, 1 mM EDTA, pH 8.3), 0.5 µg/ml ethidium bromide using a

microwave oven. The agarose gel has been allowed to cool down before poured into

an assembled gel tray. After the gel was solidified, the comb was removed and the gel

was transferred into electrophoresis tank (Horizon®, Gibco‐BRL, Piscatawan, NJ,

Ref. code: 25605412330010EAN

40

USA). Agarose gel electrophoresis buffer (0.5X TBE buffer, 0.5 µg/ml ethidium

bromide) was poured into the tank until cover the gel. The samples were prepared by

mixing with sample loading solution (5% [v/v] glycerol, 0.025% [w/v] bromophenol

blue, 0.025% [w/v] xylene cyanol FF) and loaded into each well. The electrophoresis

condition was set at 80 V for 1 h, and then the gel was visualized under UV light

using gel documentation system.

4.1.1.3 DNase I treatment of O. viverrini total RNA

Contaminating DNA in the total RNA was eliminated by

DNase I treatment. The reaction mixture was prepared as shown below.

Components Volume (µl)

Total RNA

DNase 10X Reaction Buffer

RNase‐free water

RNase‐free DNase (1U/µl) (Promega, Fitchburg, WI, USA)

x (1 µg RNA)

2

17−x

1

Total volume 20

The reaction mixture was incubated at 37°C for 30 min, and

then 1 µl DNase Stop Solution (Promega, Fitchburg, WI, USA) was added to

terminate the reaction. Finally, the reaction tube was incubated at 65°C for 10 min to

inactivate the DNase.

4.1.2 Reverse transcription and PCR amplification of OvCALR

OvCALR cDNA was generated by reverse transcriptase PCR (RT‐

PCR) from total RNA of adult O. viverrini. One microgram of DNase‐treated RNA

was reverse transcribed using RevertAid Reverse Transcriptase (Thermo Scientific,

Vilnius, Lithuania) with Oligo(dT)20 primer. The reaction mixture was prepared as

shown on the next page.

Ref. code: 25605412330010EAN

41


Total RNA

DEPC‐treated ultrapure water

Oligo(dT)20 primer (100 µM)

5X Reaction Buffer

Thermo Scientific™ RiboLock RNase Inhibitor

Mixed dNTP (10 mM each)

RevertAid Reverse Transcriptase (200U/µl)

X

11.5−X

1

4

0.5

2

1

Total volume 20

Firstly, one microgram of DNase‐treated RNA was mixed with

Oligo(dT)20 primer, incubated at 70°C for 5 min and then the reaction tube was

chilled on ice. Subsequently, other components except RevertAid Reverse

Transcriptase (Thermo Scientific, Vilnius, Lithuania) were added into the reaction

tube and incubated at 37°C for 5 min. Reverse Transcriptase was added into the

reaction tube, followed by briefly spin and then incubated at 42°C for 1 h and 70°C

for 10 min, respectively. The reverse transcription reaction product was stored at

−20°C if not immediately used.

The first‐strand cDNA products were used as template for PCR

amplification of cDNA containing coding sequence of OvCALR. Specific primers

were designed based on an expressed sequence tag (Ov_Contig3944) of the encoding

gene (HRG303 forward primer and HRG304 reverse primer, see Table 4.1). These

primers introduced recognition sites for PaeI (SphI) and PstI restriction endonucleases

at 5′ and 3′ end, respectively, to facilitate the cloning into expression plasmid. The

PCR reaction mixtures were prepared as shown on the next page. The thermal cycling

conditions were set as follows: initial denaturation at 94°C for 3 min, 30 cycles of

denaturation at 95°C, annealing at 55°C, and extension at 72°C for 1 min each, and

final extension at 72°C for 10 min.

Ref. code: 25605412330010EAN

42

Table 4.1 List of primer

* RE: Restriction endonuclease

primer

name

Sequence (5′‐3′) Tm

(°C)

RE*

(underlined)

HRG303 GCATGCGAGGTTTACTTTTATGAAC 65.3 PaeI (SphI)

HRG304 CTGCAGTTAAAGTTCTTCATGGGTC 65.7 PstI

HRG312 GCTAGCGAGGTTTACTTTTATGAAC 62.1 NheI

HRG313

HRG320

HRG321

GCGGCCGCAAGTTCTTCATGGGTCTTCG

TTTCGGTGCCGCTCCTGCTTG

TGTGGCCTCTACAGCTCATC

81.9

75.4

63.1

NotI

-

-

HRG333 TCGAGAGAAGATGACACAGA 58.6 -

HRG334

HRG355

HRG356

GATATCACGCACGATTTCTC

CATATGGACCCTGCCATCTATTTC

CTCGAGCAGCTCATCCTTGGCTTGG

59.7

66.1

76.1

-

NdeI

XhoI

HRG384 CCGGACAACAAATTCAAGGT 63.6 -

HRG385

HRG517

HRG518

ATCAAACACGGATCCAGAGG

GAATTCGATGATATTGCTCATGTTG

GCGGCCGCTTAAAGTTCTTCATGGGTC

63.9

65.1

76.7

-

EcoRI

NotI

Ref. code: 25605412330010EAN

43


First‐strand cDNA products

HRG303 forward primer (10 µM)

HRG304 reverse primer (10 µM)

10X Taq Buffer with (NH4)2SO4

25 mM MgCl2


Taq DNA Polymerase (Thermo Scientific, Vilnius, Lithuania)

Sterile ultrapure water

2

1

1

5

3

1

0.5

36.5

Total volume 50

The PCR products was analyzed by 1% (w/v) agarose gel

electrophoresis as described in Section 4.1.1.2. The agarose gel containing expected

band was excised and extracted using the QIAquick Gel Extraction Kit (Qiagen,

Hilden, Germany) following the manufacturer’s instruction.

4.1.3 Ligation of OvCALR cDNA into pGEM®‐T Easy vector and

transformation of Escherichia coli (E. coli) cells with ligation

product

Purified OvCALR DNA fragments from previous section was

ligated into the pGEM®

‐T Easy vector (Promega, Fitchburg, WI, USA) using the

following ligation reaction.


2X Rapid Ligation Buffer, T4 DNA Ligase

Purified OvCALR DNA fragments

pGEM®‐T Easy vector

T4 DNA Ligase (3 Weiss units/µl)

5

3

1

1

Total volume 10

The reaction was incubated at room temperature for 1 h and

subsequently introduced into E. coli XL1‐Blue competent cells using a chemical

Ref. code: 25605412330010EAN

44

transformation method as described in Section 4.1.5. The transformants carrying

recombinant plasmid were identified by colony PCR as described in Section 4.1.7.

The plasmid DNA was isolated from positive clones using the AxyPrep Plasmid

Miniprep Kit (Axygen Biosciences, Union City, CA, USA) following manufacturer’s

instruction. The purified recombinant plasmid DNA was double‐digested with PaeI

(SphI) and PstI restriction enzymes (Thermo Scientific, Vilnius, Lithuania) to confirm

the insertion of target fragment. The double digestion reaction was prepared as shown

below.


10X Buffer B

Purified recombinant plasmid DNA

PaeI (SphI) (10 U/µl)

PstI (10 U/µl)

2

16.5

0.5

1

Total volume 20

The reaction was incubated at 37°C for 2 h and then inactivated at

80°C for 20 min. The digested and undigested recombinant plasmid DNA were

analyzed in parallel by agarose gel electrophoresis (see Section 4.1.1.2). The pGEM®‐

T Easy carrying OvCALR was sent to a commercial DNA sequencing service (1st

Base Asia, Singapore) to verify the nucleic acid sequence of OvCALR cDNA. A

verified plasmid DNA harboring the correct nucleic acid sequence of OvCALR

cDNA was used in the further experiments.

4.1.4 Preparation of chemically competent E. coli cells

The competent cells were prepared from the following E. coli

strains: XL1‐Blue, M15, BL21, and Rosetta‐gami(DE3)pLysS. These E. coli strains

were freshly grown on Luria‐Bertani (LB) agar plate containing appropriate antibiotic

as shown in Table 4.2. A single colony of each E. coli strain was grown at 37°C with

250 rpm shaking for 16–20 h in 5 ml LB broth containing appropriate antibiotic (see

Table 4.2). On the next day, 200 µl of fresh overnight culture was inoculated in 100

ml LB broth in 1 liter Erlenmeyer flask and incubated at 37°C with 250 rpm shaking.

A bacterial growing was monitored periodically by spectrophotometer at 600 nm.

Ref. code: 25605412330010EAN

45

When OD600 of 0.5 was reached, the culture was harvested by centrifugation at 6,000

rpm for 8 min at 4°C. The pellet was collected, resuspended in 20 ml of ice‐cold 0.1

M MgCl2, and then centrifuged at 6,000 rpm for 8 min at 4°C. The pellet was

collected and resuspended in 20 ml of ice‐cold 0.1 M CaCl2. After incubation on ice

for 20 min, the cell suspension was centrifuged at 6,000 rpm for 8 min at 4°C. The

pellet was collected and gently resuspended in 4.3 ml of 0.1 M CaCl2 and 0.7 ml of

glycerol. The competent cells were pipetted into 100 µl aliquots and then flash‐frozen

in liquid nitrogen. The cells were stored at −80°C until used in the experiment.

4.1.5 Transformation of E. coli cells

Either 10 µl of the ligation reaction or 1 µl of recombinant plasmid

DNA suspension was pipetted into a pre‐chilled 15 ml conical tube. Subsequently,

100 µl of competent cells that had been thawed on ice was transferred into the tube

and mixed gently. The tube was incubated on ice for 20 min and then heat‐shocked at

42°C for 45 s in a water bath. The tube was incubated on ice for 2 min afterward.

Nine hundred microliter of LB broth was added into the tube and incubated at 37°C

with shaking for 30 min. The transformation culture (100–200 µl) was plated on LB

agar plate containing appropriate antibiotics as follows: 100 µg/ml ampicillin for

XL1‐Blue and BL21, 100 µg/ml ampicillin and 25 µg/ml kanamycin for M15, and

100 µg/ml ampicillin, 34 µg/ml chloramphenicol, 12.5 µg/ml kanamycin and 3.125

µg/ml tetracycline for Rosetta‐gami(DE3)pLysS. The plates were incubated overnight

at 37°C.

Ref. code: 25605412330010EAN

46

Table 4.2 List of E. coli strains and appropriate antibiotic concentrations

E. coli strain Antibiotic Final concentration

(µg/ml)

XL1‐Blue tetracycline 12.5 (agar plate only)

M15 kanamycin 25

BL21 - -

Rosetta‐gami(DE3)pLysS kanamycin

tetracycline

chloramphenicol

12.5

3.125

34

4.1.6 Isolation of plasmid DNA using alkaline extraction method

A single colony of plasmid‐carrying E. coli was picked into 5 ml

LB broth and grown overnight in a 15 ml conical tube at 37°C with 250 rpm shaking.

The culture was harvested by centrifugation at 4,000 rpm for 5 min. The bacterial

pellet was collected, resuspended in 200 µl solution I (25 mM Tris pH 8.0, 50 mM

glucose, 10 mM EDTA), and transferred into a 1.5 ml microcentrifuge tube. Four

hundred microliters of solution Ⅱ (0.1 N NaOH, 1% [w/v] SDS) were added to the

tube, mixed by inverting, and incubated on ice for 5 min. The previous step was

repeated by adding 300 µl solution Ⅲ (2.7 M potassium acetate, pH 4.8). After

incubation, the tube was centrifuged at 12,000×g for 5 min at room temperature, and

the supernatant was collected to a new tube. To precipitate plasmid DNA, 0.6 volume

of isopropanol was added to the tube, mixed by inverting, and centrifuged at

12,000×g for 5 min at room temperature. The pellet was collected, washed with 70%

(v/v) ethanol, and centrifuged at 12,000×g for 5 min at room temperature. Finally, the

pellet was collected, air‐dried, and dissolved in 50 µl ultrapure water. Isolated‐

plasmid suspension was treated with RNAse A (Thermo Scientific, Vilnius,

Lithuania) as manufacturer’s instruction to eliminate RNA contamination before

restriction enzyme digestion.

Ref. code: 25605412330010EAN

47

4.1.7 Positive transformants screening by colony PCR

Single bacterial colonies growing on selective LB agar plate were

picked and each suspended in 50 µl sterile DW. These bacterial suspensions were

used as PCR template for PCR amplification using specific primers. The PCR

reaction mixtures were prepared as shown below. The thermal cycling conditions

were programmed with optimal conditions based on previous results. The PCR

products were analyzed by 1% (w/v) agarose gel electrophoresis as described in

Section 4.1.1.2.


Bacterial suspension




25 mM MgCl2




5

0.5

0.5

2.5

1.5

0.5

0.25

14.25

Total volume 25

4.1.8 Sequence analysis

Obtained DNA sequencing results were analyzed using

bioinformatics tools. The EMBOSS program168

was used to analyze nucleic acid and

amino acid sequences. A signal peptide was predicted by SignalP 4.1 server169

(http://www.cbs.dtu.dk/services/SignalP/). Motifs in deduced amino acid sequence

were screened by ScanProsite tool170

. Jemboss, pepstats (Jemboss version 1.5;

http://emboss.sf.net/Jemboss/) was used to calculate molecular weight and isoelectric

point of protein. BLAST® (https://blast.ncbi.nlm.nih.gov/Blast.cgi), which is a

powerful alignment search tool, was used to search for homologous nucleotide and

protein sequences. Multiple sequence alignment was performed by Jalview171

(Jalview version 2.10.3; http://www.jalview.org/Download) and SeaView172

(SeaView version 4.6.3; http://doua.prabi.fr/software/seaview). Jemboss, needle

Ref. code: 25605412330010EAN

48

(Jemboss version 1.5; http://emboss.sf.net/Jemboss/) was used to analyze pairwise

sequence conservation.

4.1.9 Storage of bacterial clones

To prepare bacterial glycerol stock for long‐term storage, an

overnight culture in liquid medium was grown. Seven hundred and fifty microliter of

the overnight culture was mixed thoroughly with 250 microliter of 60% (v/v) glycerol

in a 1.5 ml microcentrifuge tube. The tube was frozen in liquid nitrogen and stored at

−80°C.

4.2 Production of rOvCALR using a bacterial system

4.2.1 Construction of recombinant expression vector

4.2.1.1 Construction of pQE‐30‐OvCALR expression vector

The verified pGEM®‐T Easy‐OvCALR plasmid (from

previous section) and pQE‐30 expression vector (Qiagen, Hilden, Germany) were

double‐digested with PaeI (SphI) and PstI restriction enzymes (Thermo Scientific,

Vilnius, Lithuania) to create sticky‐end DNA products. The digestion reactions and

conditions were prepared and processed as described in Section 4.1.3. The digestion

products were analyzed by 1% (w/v) agarose gel electrophoresis (see Section 4.1.1.2).

After that, the expected bands were excised from the agarose gel and extracted using

the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) following the

manufacturer’s instruction. The OvCALR DNA fragment and pQE‐30 vector were

joined by T4 DNA ligase (Thermo Scientific, Vilnius, Lithuania) using the ligation

reaction as shown on the next page.

Ref. code: 25605412330010EAN

49


10X T4 DNA Ligase Buffer


Digested pQE‐30

T4 DNA Ligase (5 Weiss U/µl)


1

3

1

1

4

Total volume 10

The ligation proceeded overnight at 4°C and the product was

then introduced into E. coli XL1‐Blue competent cells by chemical transformation

(see Section 4.1.5). Colony PCR and restriction enzyme digestion were performed to

confirm the clone harboring pQE‐30‐OvCALR recombinant plasmid as described in

Section 4.1.7 and Section 4.1.3, respectively. After getting a verified clone, the

recombinant plasmid DNA was isolated from positive clones using alkaline extraction

method (see Section 4.1.6) and introduced into the expression host, E. coli M15 (see

Section 4.1.5). Colony PCR was performed to identify the positive clones as

described in Section 4.1.7.

4.2.1.2 Construction of pET21b(+)‐OvCALR expression vector

(1) DNA cloning of OvCALR

The verified OvCALR (from previous section) was used as a

template for PCR amplification. The forward and reverse primers (HRG312 forward

primer and HRG313 reverse primer, see Table 4.1) introduced recognition sites for

NheI and NotI restriction endonucleases, respectively, to facilitate the cloning into

pET21b(+) vector. The PCR reaction was prepared as shown on the next page.

Ref. code: 25605412330010EAN

50






25 mM MgCl2




2

1

1

5

3

1

0.5

36.5

Total volume 50

The thermal cycling conditions were set as follows: initial

denaturation at 95°C for 5 min, 30 cycles of denaturation at 95°C, annealing at 55°C,

and extension at 72°C for 1 min each, and final extension at 72°C for 10 min. The

PCR products were analyzed by 1% (w/v) agarose gel electrophoresis (see Section

4.1.1.2), and the agarose gel containing expected band was excised and extracted

using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) following the

manufacturer’s instruction. The purified OvCALR DNA fragment was inserted into

the pGEM®‐T Easy vector (Promega, Fitchburg, WI, USA), introduced into E. coli

XL1‐Blue, screened for positive clones, and the DNA sequence verified as described

in Section 4.1.3.

(2) Ligation of OvCALR into pET21b(+) vector

After getting the verified recombinant plasmid, pGEM®

‐T

Easy‐OvCALR and pET21b(+) expression vector (Novagen, Darmstadt, Germany)

were double‐digested with NheI and NotI restriction enzymes (Thermo Scientific,

Vilnius, Lithuania). The double digestion reaction was prepared into two steps as

shown on the next page.

Ref. code: 25605412330010EAN

51

Step Components Volume (µl)

1

10X Tango Buffer

pGEM®‐T‐OvCALR or pET21b(+) vector

NheI (10 U/µl)

2

17.5

0.5

2 10X Tango Buffer

NotI (10 U/µl)


6

4

10

Total volume 40

All components in the first step were incubated at 37°C for 2

h. After that, the components in the second step were added and further incubated at

37°C for 2 h. The reaction was inactivated by incubation at 65°C for 20 min and

analyzed by 1% (w/v) agarose gel electrophoresis (see Section 4.1.1.2). The expected

bands was excised from the agarose gel and extracted using the QIAquick Gel

Extraction Kit (Qiagen, Hilden, Germany). The purified OvCALR DNA fragment and

digested‐pET‐21b(+) were ligated and further processed as described above for pQE‐

30‐OvCALR expression vector construction. After getting a verified clone, the

recombinant plasmid DNA was isolated from positive clones using alkaline extraction

method (see Section 4.1.6) and introduced into the expression host, E. coli Rosetta‐

gami(DE3)pLysS (see Section 4.1.5). Colony PCR was performed to identify the

positive clones as described in Section 4.1.7.

4.2.2 Small‐scale expression and time‐course analysis

Three positive colonies were randomly selected to determine the

time‐course expression. A single colony was inoculated in 5 ml LB broth containing

100 µg/ml ampicillin and other appropriate antibiotics (see Table 4.2), and incubated

overnight at 37°C with 250 rpm shaking. On the next day, 20 ml LB broth containing

appropriate antibiotics as previously mentioned was inoculated with 1 ml of the

overnight culture, and incubated at 37°C with 250 rpm shaking until the OD600 of 0.6

was reached. One milliliter of the culture was collected as non‐induced sample, and

then Isopropyl‐β‐D‐1‐thiogalactopyranoside (IPTG) (Fermentas, Vilnius, Lithuania)

was added into the culture to a final concentration of 1 mM. For M15/pQE‐30‐

OvCALR, the cultures were further grown in the previous conditions for 4 h, and 1 ml

Ref. code: 25605412330010EAN

52

of the culture was collected every hour following induction as induced samples. For

Rosetta‐gami(DE3)pLysS/pET‐21b(+)‐OvCALR, the cultures were further grown

overnight at 28°C with 250 rpm shaking, and then 1 ml of each culture was collected

on the next day as induced sample. Additional 1‐ml samples were hourly collected for

protein solubility analysis. All samples were centrifuged at 12,000×g for 1 min. The

pellet was resuspended in 50 µl of denaturing lysis buffer (100 mM NaH2PO4, 10 mM

Tris‐HCl, 8 M Urea, pH 8.0) and then analyzed by SDS‐PAGE (see Section 4.2.5).

4.2.3 Determination of target‐protein solubility

Additional collected samples at pre‐ and post‐induction were

centrifuged at 12,000×g for 1 min. The supernatant was discarded, and the pellet was

resuspended in 100 µl of native lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10

mM imidazole, pH 8.0). The bacterial cells were lysed by sonication (six 9.9 s bursts

with 9.9 s pauses) at 27% amplitude. The lysate was centrifuged at 12,000×g for 20

min at 4°C. The supernatant was collected as soluble fraction, and the pellet was

resuspended in 50 µl of denaturing lysis buffer as insoluble fraction. Then soluble and

insoluble fractions of each time point were analyzed by SDS‐PAGE as described in

Section 4.2.5.

4.2.4 Large‐scale expression of rOvCALR

4.2.4.1 Large‐scale expression of M15‐derived rOvCALR

A single positive colony verified by small‐scale screening

was cultured overnight at 37°C with shaking in 5 ml LB broth containing 100 µg/ml

ampicillin, 25 µg/ml kanamycin. On the next day, 100 ml LB broth containing

appropriate antibiotics as previously mentioned was inoculated with 5 ml of the

overnight culture. The culture was grown at 37°C, 250 rpm shaking until the OD600 of

0.6 was reached, and then the expression was induced by IPTG at a final

concentration of 1 mM. The culture was further incubated at 37°C, 250 rpm shaking

for 4 h. The bacterial cells were harvested by centrifugation at 4,000×g for 20 min at

4°C and stored at −20°C.

4.2.4.2 Large‐scale expression of Rosetta‐gami(DE3)pLysS‐

derived rOvCALR

A single positive colony verified by small‐scale screening

was cultured overnight at 37°C with shaking in 5 ml LB broth containing 100 µg/ml

Ref. code: 25605412330010EAN

53

ampicillin, 34 µg/ml chloramphenicol, 12.5 µg/ml kanamycin and 3.125 µg/ml

tetracycline. On the next day, 100 ml LB broth containing appropriate antibiotics as

mentioned above was inoculated with 5 ml of the overnight culture. The culture was

grown at 37°C, 250 rpm shaking until the OD600 of 0.6 was reached, and then the

expression was induced by IPTG at a final concentration of 1 mM. The culture was

further incubated overnight at 28°C, 250 rpm shaking. On the next day, the culture

was harvested by centrifugation at 4,000×g for 20 min at 4°C and stored at −20°C.

4.2.5 Protein analysis by sodium dodecyl sulfate‐polyacrylamide gel

electrophoresis (SDS‐PAGE)

4.2.5.1 Gel casting, sample preparation and electrophoresis

The discontinuous Tris‐glycine SDS‐PAGE system was used

for protein electrophoresis. Gel casting components of Hoefer SE260 Mini‐gel

System (Amersham biosciences, GE Healthcare, Piscatawan, NJ, USA) were

assembled following the manufacturer’s manual. A single gel of 12.5% resolving gel

was prepared by pipetting the following solutions into a 50 ml conical tube: 2.5 ml

30% (w/v) polyacrylamide/Bis solution 29:1 (Bio‐Rad, Shanghai, China), 1.5 ml 1.5

M Tris‐HCl pH 8.8, 60 µl 10% (w/v) SDS, 1.88 ml ultrapure water, 60 µl 10% (w/v)

ammonium persulfate (APS), and 2.5 µl TEMED. All components were mixed by

gently swirling and immediately poured into between a glass plate and an alumina

plate up to 2/3 of the glass plate. Distilled water was overlaid on the top of the

resolving gel, and the gel was allowed to polymerize for 1 h. After the gel

polymerizing, the water was discarded and totally removed using paper towel. To

prepare a single 4% stacking gel, the following components were mixed by gently

swirling in a 50 ml conical tube: 270 µl 30% (w/v) polyacrylamide/Bis solution 29:1

(Bio‐Rad, Shanghai, China), 500 µl 0.5 M Tris‐HCl pH6.8, 20 µl 10% (w/v) SDS,

1.18 ml ultrapure water, 20 µl 10% (w/v) APS, 2 µl TEMED. The mixed solution was

topped on the resolving gel by pipetting, and a comb was inserted promptly. The gel

was allowed to polymerize for 1 h. After that, the comb had been removed, and the

wells were washed with ultrapure water. The gel apparatus was assembled following

the manual, and electrophoresis buffer (25 mM Tris‐base, 202 mM glycine, 0.1%

[w/v] SDS) was filled into the upper and lower chamber.

Ref. code: 25605412330010EAN

54

The samples were prepared by mixing with 2X sample

electrophoresis buffer (0.125 M Tris‐HCl pH 6.8, 0.2 M DTT, 0.02% [w/v]

bromophenol blue, 4% [w/v] SDS, 20% [v/v] sterile glycerol), heating at 95°C for 5

min, putting on ice for 1 min, and briefly spinning. The Broad Range Molecular

Weight Standards (Bio‐Rad Laboratories, Hercules, CA, USA) and the samples were

loaded into each well, and a power was applied at 20 mA/gel. The run was finished

when the tracking dye reached the bottom of the gel. The gel was carefully removed

from the gel cassette, and the stacking gel was discarded. The remaining gel was

washed several times in distilled water afterward.

4.2.5.2 Staining of protein in polyacrylamide gel

The gel (resolving gel) was stained with Coomassie dye

staining solution (0.025% [w/v] Coomassie Blue R‐250, 40% [v/v] methanol, and 7%

[v/v] glacial acetic acid) by soaking the gel overnight with gently shaking. After that,

the gel was destained by soaking in high‐methanol destaining solution (40% [v/v]

methanol, 7% [v/v] glacial acetic acid) and low‐methanol destaining solution (5%

[v/v] methanol, 7% [v/v] glacial acetic acid), respectively. The protein bands in the

gel were visualized and photographed using a scanner (Canon CanoScan LiDE 700F).

For long‐term storage, the gel was laid between two sheets of cellophane membrane

on a glass plate and allowed to dry at room temperature for 2 days.

4.2.6 Purification of rOvCALR using Ni‐NTA affinity

chromatography

4.2.6.1 Purification of rOvCALR under denaturing conditions

The cell pellet was resuspended in 5 ml denaturing lysis

buffer (100 mM NaH2PO4, 10 mM Tris‐HCl, 8 M urea, pH 8.0) and incubated on a

rotary mixer at room temperature for 1 h. The cell lysate was centrifuged at 10,000×g

for 30 min at 4°C, and the supernatant was collected. The Ni‐NTA slurry (QIAGEN,

Hilden, Germany) was mixed with the clear supernatant on a rotary mixer at 4°C for 1

h before loading into a polypropylene column. The resin was allowed to settle for 15

min. The column’s bottom cap was removed afterward, and the flow‐through was

collected. The column was washed twice with 4 ml wash buffer (100 mM NaH2PO4,

10 mM Tris‐HCl, 8 M urea, pH 6.3) and eluted four times each with 500 µl elution

buffer at pH 5.9 and pH 4.5, respectively (100 mM NaH2PO4, 10 mM Tris‐HCl, 8 M

Ref. code: 25605412330010EAN

55

urea, pH 5.9 or pH 4.5). All fractions were collected and analyzed by SDS‐PAGE as


4.2.6.2 Purification of rOvCALR under native conditions

The cell pellet was resuspended in native lysis buffer (50

mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0) using 5 ml per gram wet

weight. After that, the bacterial cells were broken by ultrasonication (Sonics vibra

cell™ VC 750, Sonics and Materials, Inc., Newtown, CT, USA) using 6×9.9 s with

9.9 s pauses at 27% amplitude. The total cell lysate was centrifuged at 10,000×g for

30 min at 4°C, and supernatant was collected as cell lysate. One milliliter of Ni‐NTA

slurry (QIAGEN, Hilden, Germany) was mixed with the cell lysate on a rotary mixer

at 4°C for 1 h. Afterward, the mixture was loaded into a polypropylene column, and

the resin was allowed to settle for 15 min. The column’s bottom cap was removed,

and the flow‐through was collected. The column was washed twice with 4 ml of wash

buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0) and eluted four

times with 500 µl of elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM

imidazole, pH 8.0). All fractions were collected and analyzed by SDS‐PAGE as


4.2.7 Concentration and dialysis of rOvCALR

4.2.7.1 Concentration of rOvCALR using centrifugal

concentrator

The eluates containing rOvCALR (from Section 4.2.6) were

pooled and concentrated using Amicon Ultra‐15 Centrifugal Filter Units (Merck

Millipore, County Cork, Ireland). The pooled sample was filled into the concentrator

and then centrifuged at 5,000×g for 30 min at 4°C using Sorvall Legend RT+

centrifuge (Thermo Scientific, Osterode, Germany). This centrifugation step was

repeated several times until the volume of sample reached the desired volume.

4.2.7.2 Dialysis of rOvCALR

To remove some chemicals which interfere the subsequent

assays, the sample was dialyzed against 10 mM PBS pH 7.2 using 3 Spectra/Por®

dialysis membrane tubing (Spectrumlabs, Rancho Dominguez, CA, USA). The

dialysis membrane was prepared by soaking in distilled water for 30 min and then

rinsing thoroughly with distilled water. The dialysis tubing was tightly closed at the

Ref. code: 25605412330010EAN

56

bottom, and the sample was loaded into the dialysis bag. Subsequently, the bag was

tightly closed at the top and submerged in dialysate (10 mM PBS pH 7.2). The

volume of dialysate was 1,000 times of the sample volume. The dialysis was

performed with stirring at 4°C, and the dialysate was changed at 2 h and 16 h

following the dialysis start. The sample was collected following 24 h of dialysis.

The quality and quantity of rOvCALR were determined by

SDS‐PAGE and Bradford’s assay as described in Section 4.2.5 and Section 4.2.8,

respectively. After that, the quantified rOvCALR was aliquoted and stored at −20°C.

4.2.8 Measurement of rOvCALR concentration using Bradford’s

assay

The recombinant protein concentration was measured by a

Bradford’s assay (Bio‐Rad, Hercules, CA, USA). Bovine serum albumin (BSA)

(Sigma Aldrich, St. Louis, MO, USA) was used as protein standard at following

concentrations: 0.1, 0.2, 0.3, 0.4 and 0.5 mg/ml. The dye reagent was prepared by

dilution of one part of dye reagent concentrate with four parts of ultrapure water. Ten

microliters of each protein standard and sample were pipetted into separate microtiter

plate wells (NUNC, Jiangsu, China) in duplicate. The protein diluent such as 10 mM

PBS, pH 7.2 was used as a blank. Two hundred microliters of diluted dye reagent

were added into each well, and the plate was mixed by tapping and then incubated at

room temperature for 5 min. The absorbance was measured at 595 nm using a

microplate reader. A standard protein curve of BSA was plotted, and a linear equation

was used to calculate the concentration of sample.

4.3 Production of polyclonal antibody in mice

4.3.1 Production of polyclonal mouse anti‐rOvCALR antibody

Three female 6–8 week‐old ICR mice were immunized with E. coli

M15‐derived rOvCALR to produce polyclonal antisera. The pre‐immune sera were

collected one week before immunization as control sera. The amount of antigen for

immunization was prepared at 30 µg/mouse for priming and at 20 µg/mouse for

boosting. The antigen preparation was processed as follows: resolving rOvCALR in

12.5% polyacrylamide gel (see Section 4.2.5), staining the gel with 0.5% (w/v)

Ref. code: 25605412330010EAN

57

Coomassie Blue G‐250 (USB Corporation, Cleveland, OH, USA), destaining with

distilled water, excising the target band, and grinding the gel with 10 mM PBS pH 7.2

by glass homogenizer. The mice were intraperitoneally injected with 100 µl prepared

antigen, three times every 3‐week intervals: priming, first and second boosting. The

blood was collected from their tail using heparinized capillary tubes every 2 weeks

after immunization. The capillary tubes were centrifuged at 10,000×g for 5 min at

room temperature, and the serum was kept at −20°C. The timeline diagram of anti‐

rOvCALR antisera production is shown in Figure 4.1.

Figure 4.1 Timeline diagram of anti‐rOvCALR antisera production in mice. Black

arrowheads indicate blood collecting time points, and white arrowheads indicate

immunization time points.

4.3.2 Production of polyclonal mouse anti‐OvES antibody

Two female 6–8 weeks‐old BALB/c mice were immunized with 100

µl prepared antigen at 20 µg/mouse for priming and at 10 µg/mouse for boosting. The

antigen was prepared by mix equal volume of O. viverrini ES product and TiterMax

Gold Adjuvant (Sigma Aldrich, St. Louis, MO, USA) using 1‐ml insulin syringe with

21G needle. Mice were immunized and blood collected as described in Section 4.3.1.

4.3.3 Determination of antibody titer by enzyme linked

immunosorbent assay (ELISA)

To prepare the rOvCALR‐coated microtiter plate, rOvCALR was

prepared in carbonate buffer, pH9.6 (30 mM Na2CO3, 75 mM NaHCO3) and pipetted

into each well of a NUNC MaxiSorp 96‐well plate (NUNC, Roskide, Denmark) (150

ng/100 µl/well) and incubated overnight at 4°C. The wells were washed three times

with distilled water. To block unspecific protein binding, the wells were incubated

with 0.25% (w/v) BSA (Sigma Aldrich, St. Louis, MO, USA) in coating buffer at

Ref. code: 25605412330010EAN

58

room temperature for 30 min. The plate was washed afterward three times with

distilled water. Pre‐immune, priming, first boosting, and second boosting sera were

stepwise 2‐fold diluted in an antibody diluent (0.25% [w/v] BSA in 10 mM PBS, pH

7.2) starting from 1:100 to 1:204,800 and pipetted into each well in duplicate. The

plate was incubated at 37°C for 1 h and washed three times as before. Goat anti‐

mouse HRP conjugated antibody (Invitrogen, Frederick, MD, USA) at dilution

1:4,000 was added and incubated at 37°C for 1 h. The wells were washed afterward,

and 100 µl of o‐Phenylenediamine dihydrochloride (OPD) substrate (Sigma Aldrich,

St. Louis, MO, USA) was added, incubated in the dark at room temperature for 30

min. The reaction was stopped by adding 50 µl of 2 M H2SO4, and the absorbance

was measured at 492 nm.

4.4 Preparation of parasite antigens

4.4.1 Parasite crude extracts

Adult parasites (from Section 4.5.1) were homogenized on ice using

a tissue homogenizer (Ultra‐Turrax T25, IKA, Staufen, Germany) in homogenization

buffer (10 mM PBS, pH 7.2, 150 mM NaCl, 0.5% [v/v] Triton X‐100, 1 mM PMSF, 1

mM EDTA). The homogenate was centrifuged at 12,000×g for 15 min at 4°C to

remove insoluble material. The supernatant was collected as soluble crude worm

extract, and the pellet was further extracted as insoluble crude worm extract. The

pellet was solubilized in 50 mM Tris‐HCl, pH 8.0, 3% (w/v) SDS and incubated at

37°C for 1 h. After that, the sample was centrifuged at 12,000×g for 15 min, and the

supernatant was collected as insoluble crude worm extract. The parasite extracts were

determined quantity and quality using a bicinchoninic acid (BCA) assay (see Section

4.4.3) and SDS‐PAGE (see Section 4.2.5), respectively. The parasite crude extracts

were aliquoted and stored at −80°C.

4.4.2 Excretory/secretory (ES) product

Adult O. viverrini was freshly collected from experimentally

infected hamsters (from Section 4.5.1). Alive parasites were washed twice with

physiological saline solution (0.85% [w/v] sodium chloride) and washed once with 10

mM PBS, pH 7.2. The buffer was changed to fresh 10 mM PBS, pH 7.2 and the

Ref. code: 25605412330010EAN

59

parasites were incubated in CO2 incubator (Forma™ Steri‐Cycle™ CO2 Incubator,

Thermo Fisher Scientific, Marietta, OH, USA) at 37°C, 5% CO2 for 4 h. Then the

buffer was collected and centrifuged at 5,000×g for 20 min at 4°C to remove insoluble

materials and eggs. The supernatant was collected and concentrated using a

centrifugal concentrator with 3kDa cut‐off (GE Healthcare, Buckinghamshire, UK).

The concentrated ES product was determined quantity and quality using Bradford’s

assay (see Section 4.2.8) and SDS‐PAGE (see Section 4.2.5), respectively. The

concentrated OvES product was aliquoted and stored at −80°C.

4.4.3 Measurement of protein concentration using BCA assay

BCA protein assay is a detergent‐compatible quantitative protein

measurement. PierceTM

BCA Protein Assay Kit (Thermo Scientific, Rockford, IL,

USA) was used to determine protein concentration of parasite crude extracts using

microplate procedure. BSA (Sigma Aldrich, St. Louis, MO, USA) was used as protein

standard at following concentrations: 0.125, 0.25, 0.5, 0.75, 1.0, 1.5 and 2.0 mg/ml.

The BCA working reagent was prepared by mixing 50 parts of BCA reagent A with 1

part of BCA reagent B. Ten microliters of each protein standard and sample were

pipetted into separate microtiter plate wells (NUNC, Jiangsu, China) in duplicate. The

protein diluent such as 10 mM PBS, pH 7.2 was used as a blank. Two hundred

microliters of BCA working reagent were added into each well, and the plate was

mixed by tapping and then incubated at 37°C for 30 min. The absorbance was

measured at 562 nm using a microplate reader. A standard protein curve of BSA was

plotted, and a linear equation was used to calculate the concentration of sample.

4.5 Characterization of OvCALR expression

4.5.1 Preparation of different developmental stages of O. viverrini

O. viverrini metacercariae were isolated from naturally infected

cyprinoid fish in the northeast of Thailand. Newly excysted juveniles were obtained

from mechanically excysted metacercariae using a disposal needle. Other

developmental stages of O. viverrini were obtained from the liver of experimentally

infected hamsters. Syrian golden hamsters were infected with 50 metacercariae by

intragastric intubation. The juveniles and adults O. viverrini were harvested from

Ref. code: 25605412330010EAN

60

livers and bile ducts of infected hamsters at 2‐, 4‐ and 8‐week postinfection,

respectively. The parasites were washed in physiological saline solution (0.85% [w/v]

sodium chloride) and kept in liquid nitrogen for further experiments.

4.5.2 Stage‐specific reverse transcriptase polymerase chain reaction

(RT‐PCR)

Total RNA of newly excysted juvenile O. viverrini was isolated

using TRIzol™

Reagent with PureLink™ RNA Mini Kit (Ambion, Foster City, CA,

USA) following the manufacturer’s user manual. Total RNA of 2‐week juvenile, 4‐

week juvenile and adult O. viverrini (8‐week‐old) was isolated using TRIzol™

Reagent (Invitrogen, Carlsbad, CA, USA) as described in Section 4.1.1.1. The quality

of isolated total RNA was determined by 1% (w/v) agarose gel electrophoresis (see

Section 4.1.1.2). The concentration of isolated total RNA from each stage was

measured using a spectrophotometer, and followed by DNase I treatment as described

in Section 4.1.1.3.

To verify the expression of OvCALR from each developmental

stage of the parasite, 100 ng of DNase‐treated total RNA from each stage was used as

a template for reverse transcription. Two reverse specific primers were used to

generate cDNA in the same reaction: HRG385 reverse primer for OvCALR and

HRG334 reverse primer for OvActin as internal control (see Table 4.1). The reaction

mixture was prepared as shown below.


Total RNA (100 ng)




5X Reaction Buffer



RevertAid Reverse Transcriptase (200U/µl)

X

12.5−X

1

1

6

0.5

3

1

Total volume 30

Ref. code: 25605412330010EAN

61

The cDNA generation was processed as described in Section 4.1.2.

After that, the reverse transcription product was amplified by separate PCR reactions.

The PCR reactions were prepared as shown on the next page. The thermal cycling

conditions were set as follows: 5 min initial denaturation at 95°C, 34 cycles of

denaturation at 95°C, annealing at 55°C, and extension at 68°C for 1 min each, and 5

min final extension at 68°C. The PCR products were analyzed by 1% (w/v) agarose

gel electrophoresis (see Section 4.1.2.2).

Components Volume

(µl)


HRG303 (OvActin) or HRG384 (OvCALR) forward primer (10 µM)

HRG304 (OvActin) or HRG385 (OvCALR) reverse primer (10 µM)


25 mM MgCl2




2

0.5

0.5

2.5

1.5

0.5

0.2

17.3

Total volume 25

4.5.3 Detection of native OvCALR using Western blot analysis

4.5.3.1 Protein blotting by semi‐dry transfer

The parasite antigens (from Section 4.4.1 and Section 4.4.2),

10 µg each of insoluble, soluble crude worm extracts and ES product, and 100 ng of

rOvCALR were size‐separated by 12.5% SDS‐PAGE as described in Section 4.2.5.1.

The resolving gel was washed in distilled water and subsequently equilibrated in

semi‐dry transfer buffer (50 mM Tris, 40 mM glycine, 0.04% [w/v] SDS, 20% [v/v]

methanol) for 5 min. The nitrocellulose membrane (Immobilon‐NC Transfer

Membrane, Merck Millipore, Darmstadt, Germany) and filter paper (3 MM Chr filter

paper, Whatman®, GE healthcare, Buckinghamshire, UK) were cut to 8 × 8.5 cm

2 (1

sheet for membrane and 12 sheets for filter paper). Before blotting, the membrane was

equilibrated in semi‐dry transfer buffer for 15 min, and the filter paper was soaked in

Ref. code: 25605412330010EAN

62

semi‐dry transfer buffer for 2 min. A blotting tower was constructed by sequentially

placing down the following on the anode side of the blotting instrument (Fastblot

B33, Whatman Biometra, Goettingen, Germany): six sheets of filter paper,

nitrocellulose membrane, gel, and remaining six sheets of filter paper. The air bubble

between the blotting stack was removed by rolling a glass rod over the stack of filter

paper. The lid of the blotting instrument had been placed properly, and the power was

applied at 0.8 mA/cm2 for 50 min. After that, the membrane was stained with 0.1%

(w/v) Ponceau S (Sigma Aldrich, Steinheim, Germany), 5% (v/v) acetic acid for 3

min and then washed with distilled water until the protein bands were observed. The

membrane was allowed to dry and directly processed for immunodetection or be

stored at −20°C.

4.5.3.2 Detection of protein blotting

The nitrocellulose membrane was washed in distilled water

for 10 min to remove the remaining Ponceau S on the membrane. Afterward, the

membrane was equilibrated in TBS, pH 7.5 (20 mM Tris‐HCl, 150 mM NaCl) for 5

min. Unspecific binding sites on the membrane were blocked in 5% (w/v) skim milk

(Oxoid, Hants, UK) in TBS, pH 7.5 at room temperature for 1 h with gentle shaking.

The membrane‐bound antigens were probed with either mouse anti‐rOvCALR

antiserum or mouse pre‐immune serum at dilution 1:3,000 in antibody diluent (1%

[w/v] skim milk in TBS, pH 7.5) by incubation overnight at 4°C with gentle shaking.

On the following day, the membranes had been washed three times for 5 min each in

washing buffer (TBS, pH 7.5, 0.05% [v/v] Tween®

20) and followed by incubation

with goat anti‐mouse IgG (whole molecule) ‐alkaline phosphatase (Sigma Aldrich, St.

Louis, MO, USA) in antibody diluent (dilution 1:30,000) for 1 h at room temperature

with gentle shaking. The membranes were washed in washing buffer as before and

subsequently equilibrated in detection buffer (0.1 M Tris‐HCl, pH 9.5, 0.1 M NaCl,

50 mM MgCl2) for 5 min. The chromogenic substrate, 5‐bromo‐4‐chloro‐3‐indolyl

phosphate/nitro blue tetrazolium (BCIP/NBT) (Amresco, Solon, OH, USA), was

added to develop the signals as dark blue band by incubation in the dark. After

adequate signal strength had been observed, the developed membranes were washed

several times in distilled water to stop the reaction.

Ref. code: 25605412330010EAN

63

4.5.4 Immunohistochemical detection of OvCALR

Freshly collected O. viverrini adults (from Section 4.5.1) were

cleaned in physiological saline solution, fixed in methacarn solution, and embedded in

paraffin (Q Path Paraffin Normal, LABONORD SAS, Templemars, France). The

paraffin embedded parasite tissue was sectioned at 8 µm thickness on a microtome

(LEICA RM 2235, Nussloch, Germany) and mounted on gelatin‐coated microscope

slides. The slides were placed on a heating plate at 42°C overnight. The parasite

sections were deparaffinized twice in xylene for 10 min each and rehydrated in a

series of decreasing alcohol concentrations (absolute ethanol to 70% [v/v] ethanol) for

5 min each. Epitope retrieval was performed by heating parasite sections in sodium

citrate buffer (10 mM Sodium citrate, 0.05% [v/v] Tween®

20, pH 6.0) for 5 min in a

microwave oven. The parasite sections had been allowed to cool down before rinsed

in washing buffer (10 mM PBS, pH 7.2, 0.1% [v/v] Tween® 20). After that,

unspecific binding sites were blocked by incubation in 1% (w/v) glycine, 10 mM

PBS, pH 7.2 and then in 4% (w/v) BSA, 10 mM PBS, pH 7.2 for 30 min each at room

temperature. After blocking, the parasite sections were incubated overnight at 4°C

with either mouse anti‐rOvCALR antiserum or pre‐immune serum at dilution 1:2,000

in 1% (w/v) BSA in 10 mM PBS, pH 7.2. On the following day, the parasite sections

were washed three times in washing buffer for 5 min each with gentle shaking, and

the endogenous peroxidase activity was blocked by incubation of the sections in 3%

(v/v) hydrogen peroxide (Merck, Hohenbrunn, Germany) twice at room temperature

for 10 min each in the dark. After washing three times with washing buffer, the

parasite sections were incubated in polyclonal rabbit anti‐mouse immunoglobulin

biotinylated (dilution 1:200) (Dako, Glostrup, Denmark) at 37°C for 1 h. The parasite

sections were washed as before and subsequently incubated with avidin‐biotin

complex (ABC) peroxidase (ABC Peroxidase Standard Staining Kit, Thermo

Scientific, Rockford, IL, USA) at room temperature for 30 min. The parasite sections

were washed again, the chromogenic substrate, 3‐amino‐9‐ethylcarbazole (AEC)

(Vector Laboratories, Burlingame, CA, USA), was added and incubated at room

temperature in the dark until a signal developed. The reaction was stopped by washing

several times in PBST (10 mM PBS, pH 7.2, 0.1% [v/v] Tween® 20). The tissue

sections were mounted in mounting medium (10% (v/v) glycerol in 10 mM PBS, pH

Ref. code: 25605412330010EAN

64

7.2) and photographed using a microscopy camera (Olympus BX51, Japan

[microscope], PixeLINK, Ottawa, ON, Canada [digital camera]).

To detect OvCALR in O. viverrini‐infected hamster liver tissue, the

liver tissue embedded paraffin was sectioned at 5 µm thickness on a microtome

(LEICA RM 2235, Nussloch, Germany), mounted on gelatin‐coated microscope

slides and processed as described above. Antigen retrieval was performed by heating

liver sections in Tris‐EDTA buffer (10mM Tris‐Base, 1mM EDTA, 0.05% [v/v]

Tween® 20, pH 9.0). The tissue sections were counterstained with hematoxylin before

mounting. Normal hamster liver tissue was processed as above and used as negative

control for immunostaining at identical conditions.

4.6 Detection of rOvCALR by O. viverrini‐infected hamster sera

4.6.1 Blood collection from O. viverrini‐infected hamsters

Syrian golden hamsters (n=10) were experimentally infected with

50 metacercariae by intragastric intubation. Blood samples were collected by retro

orbital blood collection at preinfection and 2, 4, 8 and 12 weeks postinfection. The

blood samples were allowed to clot at room temperature for 2 h and then centrifuged

at 5,000×g for 10 min at room temperature. The hamster sera were collected,

aliquoted and kept at −20°C.

4.6.2 Indirect ELISA

An indirect ELISA technique was used to detect rOvCALR by

O. viverrini‐infected hamster sera as described in Section 4.3.2. Briefly, 100 ng of

rOvCALR was coated in each well of 96‐well plate (NUNC MaxiSorp, NUNC,

Roskide, Denmark). In washing step, the plate was stringently washed three times

with PBST (10 mM PBS, pH 7.2, 0.05% [v/v] Tween® 20). Unspecific protein

binding to the wells was blocked by incubation with 0.5% (w/v) skim milk (Oxoid,

Hants, UK) in 10 mM PBS, pH 7.2. Single serum of pre‐ and post‐infection (12

weeks) hamster sera, and pooled serum of pre‐ and post‐infection hamster sera (2, 4, 8

and 12 weeks) were diluted to 1:200 in 0.5% (w/v) skim milk in 10 mM PBS, pH 7.2

and assayed in duplicate. Goat anti‐hamster IgG (H+L) HRP antibody (Invitrogen,

Frederick, MD, USA) at dilution 1:3,000 was used as secondary antibody.

Ref. code: 25605412330010EAN

65

4.6.3 Western blot analysis

Western blot was used to detect rOvCALR by O. viverrini‐infected

hamster sera as described in Section 4.5.3. Briefly, 200 ng of rOvCALR per lane was

resolved in 12.5% SDS‐PAGE and transferred onto nitrocellulose membrane

(Immobilon‐NC Transfer Membrane, Merck Millipore, Darmstadt, Germany) by

semi‐dry blotting. Pooled preinfection hamster sera and pooled O. viverrini‐infected

sera at 2, 4, 8 and 12 weeks were prepared by dilution to 1:100 in antibody diluent.

The membrane was cut into strips, and each strip was submerged in each antibody

solution and incubated overnight at 4°C. Goat anti‐hamster IgG (H+L) HRP antibody

(Invitrogen, Frederick, MD, USA) at dilution 1:1,000 was used as secondary

antibody. AEC (Vector Laboratories, Burlingame, CA, USA) was used as

chromogenic substrate.

4.7 Functional analysis of rOvCALR

4.7.1 Production of experimental control proteins

4.7.1.1 Production of recombinant Mus musculus calreticulin

(rMmCALR)

(1) Isolation of mouse total RNA

Heart, lung and kidney were collected from an ICR mouse.

The organs were chopped into small pieces, weighed, and immediately immersed in

liquid nitrogen. TRIzol™

Reagent (Invitrogen, Carlsbad, CA, USA) was added

depending on their weight (1 ml per 50–100 mg tissue), and the tissue was

homogenized by a tissue homogenizer (Ultra‐Turrax T25, IKA, Staufen, Germany).

The RNA extraction was performed as described in Section 4.1.1.

(2) Molecular cloning of MmCALR

MmCALR cDNA was generated by AMV Reverse

Transcriptase (Fermentas, Vilnius, Lithuania) from heart‐isolated total RNA using

designed specific primers based on GenBank accession NM_007591. The reaction

mixture was prepared as shown on the next page. The reaction was incubated at 50°C

for 1 h.

Ref. code: 25605412330010EAN

66


DNase‐treated total RNA


HRG321 reverse specific primer (10 µM)

5X AMV RT Buffer



AMV Reverse Transcriptase (20 U/µl)

5

6.5

1

4

0.5

2

1

Total volume 20

The first‐strand cDNA products were used as template for

PCR amplification using the following primers: HRG320 forward primer and

HRG321 reverse primer (see Table 4.1). The conventional PCR mixture was prepared

as shown below.






25 mM MgCl2




2

1

1

5

3

1

0.5

36.5

Total volume 50


denaturation at 95°C for 5 min, 30 cycles of denaturation at 95°C, annealing at 60°C

and extension at 72°C for 1 min each, and final extension at 72°C for 5 min. The PCR

product was re‐amplified using HRG355 forward primer and HRG356 reverse primer

(see Table 4.1) that were introduced the recognition sites of NdeI and XhoI restriction

Ref. code: 25605412330010EAN

67

endonuclease, respectively, to facilitate the cloning into pET21b(+) vector. The PCR

mixture and conditions were set as shown above, except the annealing step at 55°C.

The PCR products were analyzed by 1% (w/v) agarose gel electrophoresis (see

Section 4.1.1.2). The agarose gel containing expected band was excised and extracted

using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) following the

manufacturer’s protocol.

The purified MmCALR cDNA was inserted into the

pGEM®‐T Easy vector (Promega, Fitchburg, WI, USA) and then introduced into

E. coli XL1‐Blue competent cells (see Section 4.1.3). Positive transformants were

identified by colony PCR (see Section 4.1.7) and restriction enzyme digestion. The

DNA sequence was verified by commercial DNA sequencing services (1st Base Asia,

Singapore).

(3) Construction of pET21b(+)‐MmCALR expression vector


‐T

Easy‐MmCALR and pET21b(+) expression vector (Novagen, Darmstadt, Germany)

were double‐digested with NdeI and XhoI restriction enzymes (Thermo Scientific,

Vilnius, Lithuania) to create sticky‐ends DNA products. The double digestion reaction

was prepared as shown below.


10X Buffer O

Plasmid DNA

NdeI (10 U/µl)

XhoI (10 U/µl)

2

16.5

0.5

1

Total volume 20

The reaction was incubated at 37°C for 2 h, inactivated at

80°C for 20 min, and then analyzed by 1% (w/v) agarose gel electrophoresis (see

Section 4.1.1.2). The expected bands were excised from the agarose gel and extracted

using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). The purified

MmCALR DNA fragments and digested pET‐21b(+) were jointed and introduced into

E. coli XL1‐Blue (see Section 4.2.1.2). After getting a verified clone, the recombinant

Ref. code: 25605412330010EAN

68

plasmid DNA, pET‐21b(+)‐MmCALR, was isolated from positive clones using

alkaline extraction method (see Section 4.1.6) and introduced into the expression

host, E. coli Rosetta‐gami(DE3)pLysS (see Section 4.1.5). Colony PCR was

performed to identify the positive clones carrying pET‐21b(+)‐MmCALR as


(4) Expression and purification of rMmCALR

Small‐scale expression to determine time‐course expression

(see Section 4.2.2) and target‐protein solubility (see Section 4.2.3) were performed to

find out the optimal conditions. After getting the conditions, rMmCALR was

expressed at large‐scale and purified using Ni‐NTA affinity chromatography under

native conditions as described in Section 4.2.4.2 and Section 4.2.6.2.

Purified rMmCALR was concentrated and dialyzed against

10 mM PBS, pH 7.2 (see Section 4.2.7). Its quality and quantity were determined

using SDS‐PAGE (see Section 4.2.5) and Bradford’s assay (see Section 4.2.8),

respectively. The qualified protein was aliquoted and stored at −20°C until used.

4.7.1.2 Production of recombinant Fasciola gigantica calcium‐

binding protein 1 (rFgCaBP1)

The constructed expression plasmid, pQE30‐FgCaBP1173

was introduced into E. coli M15 competent cells (see Section 4.1.5) and checked for

its expression (see Section 4.2.2 and Section 4.2.3). Recombinant FgCaBP1 was

purified using Ni‐NTA affinity chromatography under native conditions (see Section

4.2.6.2) and dialyzed against 10 mM PBS, pH 7.2 (see Section 4.2.7.2). Its quality

and quantity were determined using SDS‐PAGE (see Section 4.2.5) and Bradford’s

assay (see Section 4.2.8), respectively. The qualified protein was aliquoted and stored

at −20°C until used.

4.7.1.3 Production of recombinant Schistosoma japonicum


S. japonicum GST serves as a fusion protein of pGEX

vectors in the GST gene fusion system. To produce rSjGST, the pGEX‐5X‐1 vector

(GE Healthcare, Little Chalfont, UK) was introduced into E. coli BL21 competent

cells (see Section 4.1.5) and checked for its expression (see Section 4.2.2 and Section

4.2.3) to find out the optimal conditions. Recombinant SjGST was expressed at large‐

Ref. code: 25605412330010EAN

69

scale with 0.5 mM IPTG induction and purified using glutathione affinity

chromatography as described in Section 4.7.3.1 (2) and Section 4.7.3.1 (3),

respectively. After that, the protein was concentrated and dialyzed against 10 mM

PBS, pH 7.2 (see Section 4.2.7.2). Its quality and quantity were determined using

SDS‐PAGE (see Section 4.2.5) and Bradford’s assay (see Section 4.2.8),


4.7.2 Thermal induced protein aggregation assay

Citrate synthase, a non‐glycosylated protein, was used to

demonstrate the chaperoning activity of calreticulin174

. Citrate synthase (Sigma

Aldrich, St. Louis, MO, USA) was dissolved in 10 mM PBS, pH 7.2 at final

concentration of 1 mg/ml. Fixed molar concentration of citrate synthase (1 µM) was

mixed with various molar concentrations of rOvCALR (0.25–1 µM) in 200 µl total

volume of 10 mM PBS, pH 7.2. Recombinant MmCALR (1 µM) and BSA (Sigma

Aldrich, St. Louis, MO, USA) (1 µM) were used as positive and negative control,

respectively. All samples were pipetted into each well of 96‐well UV transparent

microplate (Thermo Scientific, Roskilde, Denmark) in duplicate. The plate was

incubated at 45°C, and the light scattering at 360 nm was measured every 10 min for

1 h using Varioskan Flash Spectral Scanning Multimode Reader (Thermo Scientific,

Waltham, MA, USA) to monitor citrate synthase aggregation.

4.7.3 Calcium binding assay

4.7.3.1 Production of rOvCALR C‐domain

(1) Construction of pGEX‐5X‐1‐OvCALR C‐domain

expression vector

The acidic OvCALR C‐domain was used to study the

calcium binding activity in native PAGE. Recombinant OvCALR C‐domain was

produced in E. coli in fusion with SjGST using pGEX‐5X‐1 vector (GE Healthcare,

Little Chalfont, UK). The verified OvCALR was used as a template for PCR

amplification. The HRG517 forward primer and HRG518 reverse primer (see Table

4.1) were designed to amplify the 321 bp (included stop codon) OvCALR C‐domain

fragment, and the recognition sites of EcoRI and NotI restriction endonuclease were

introduced into the forward and reverse primer, respectively, to facilitate the cloning

into pGEX‐5X‐1 vector. The PCR reaction was prepared as shown on the next page.

Ref. code: 25605412330010EAN

70


Purified OvCALR




25 mM MgCl2




2

1

1

5

3

1

0.5

36.5

Total volume 50


denaturation at 95°C for 5 min, 30 cycles of 1 min denaturation at 95°C, 30 s

annealing at 55°C, and 45 s extension at 72°C, and final extension at 72°C for 2 min.

The PCR products were analyzed by 2% (w/v) agarose gel electrophoresis as

described in Section 4.1.1.2, except the voltage applied at 60 V for 2 h. The agarose

gel containing expected band was excised and extracted using the GeneJET Gel

Extraction Kit (Thermo Scientific, Vilnius, Lithuania) following the manufacturer’s

instruction. The purified OvCALR C‐domain DNA fragments were inserted into the

pGEM®‐T Easy vector (Promega, Fitchburg, WI, USA) and then introduced into

E. coli XL1‐Blue (see Section 4.1.3). The positive transformants were identified by

colony PCR (see Section 4.1.7) and restriction enzyme digestion. DNA sequence of

OvCALR C‐domain was verified by commercial DNA sequencing services (1st Base

Asia, Singapore).


‐T

Easy‐OvCALR C‐domain and pGEX‐5X‐1 expression vector (GE Healthcare, Little

Chalfont, UK) were double‐digested with EcoRI and NotI restriction enzymes

(Thermo Scientific, Vilnius, Lithuania) to create sticky‐ends DNA products. The

double digestion reaction was prepared as shown on the next page.

Ref. code: 25605412330010EAN

71


10X Buffer O

Plasmid DNA

EcoRI (10 U/µl)

NotI (10 U/µl)

2

17

0.5

0.5

Total volume 20

The reaction was incubated at 37°C for 2 h, inactivated at

65°C for 20 min, and then analyzed by 2% (w/v) agarose gel electrophoresis at 60 V

for 2 h (see Section 4.1.1.2). The expected bands was excised from the agarose gel

and extracted using the GeneJET Gel Extraction Kit (Thermo Scientific, Vilnius,

Lithuania). The purified OvCALR C‐domain DNA fragment and digested pGEX‐5X‐

1 were ligated by T4 DNA ligase and introduced into E. coli XL1‐Blue as described

in Section 4.2.1.1. After getting a verified clone, the recombinant plasmid DNA,

pGEX‐5X‐1‐OvCALR C‐domain, was isolated from a positive clone using alkaline

extraction method (see Section 4.1.6) and introduced into the expression host, E. coli

BL21 (see Section 4.1.5). Colony PCR was performed to identify the positive clones

as described in Section 4.1.7.

(2) Expression of rSjGST‐OvCALR C‐domain

Small‐scale expression to determine time‐course expression

(see Section 4.2.2) and target‐protein solubility (see Section 4.2.3) were performed to

find out the optimal conditions.

To express in large‐scale, a single positive colony verified

by small‐scale screening was cultured overnight at 37°C with shaking in 5 ml LB

broth containing 100 µg/ml ampicillin. On the next day, 200 ml LB broth containing

100 µg/ml ampicillin was inoculated with 4 ml of the overnight culture and incubated

at 37°C with 250 rpm shaking. The expression was induced with 0.2 mM IPTG at

final concentration when OD600 of the culture was ~ 0.6. The culture was further

incubated for 4 h at 28°C, 250 rpm shaking. After that, the culture was harvested by

centrifugation at 4,000×g for 20 min at 4°C, and the bacterial pellet was stored at

−20°C.

Ref. code: 25605412330010EAN

72

(3) Purification of rSjGST‐OvCALR C‐domain

The GST‐fusion protein was purified by glutathione affinity

chromatography using the Glutathione Purification Kit (Clontech Laboratories,

Fitchburg, WI, USA). The cell pellet was resuspended in precooled extraction/loading

buffer (10 mM NaH2PO4, 1.8 mM KH2PO4, 140 mM NaCl, pH 7.5) at 4 ml per gram

wet weight. Then the bacterial cells were broken by ultrasonication (Sonics vibra

cell™ VC 750, Sonics and Materials, Inc., Newtown, CT, USA) using 6×9.9 s with

9.9 s pauses at 27% amplitude. The total cell lysate was centrifuged at 12,000×g for

20 min at 4°C, and supernatant was collected as cell lysate and kept on ice. The

following steps were performed in a refrigerator at 4°C. One milliliter of Glutathione‐

Superflow Resin (Clontech Laboratories, Fitchburg, WI, USA) was thoroughly mixed

with the cell lysate by pipetting and then transferred into a polypropylene column.

The resin was allowed to settle for 20 min. The column’s bottom cap was removed,

and the flow‐through was collected. The column was washed three times with 4 ml of

precooled extraction/loading buffer. After that, the column was eluted six times with 1

ml of elution buffer (33 mM reduced glutathione, 50 mM Tris‐HCl, pH 8.0). All

fractions were collected and analyzed by SDS‐PAGE as described in Section 4.2.5.

Purified rSjGST‐OvCALR C‐domain was dialyzed against

10 mM PBS, pH 7.2 (see Section 4.2.7). Its quality and quantity were determined

using SDS‐PAGE (see Section 4.2.5) and Bradford’s assay (see Section 4.2.8),


4.7.3.2 Determination of calcium‐binding activity using native‐

PAGE

In this assay, sample buffer, polyacrylamide gel, and

electrophoresis running buffer were added either 1 mM CaCl2 or EDTA. Gel casting

components of Hoefer SE260 Mini‐gel System (Amersham biosciences, GE

Healthcare, Piscatawan, NJ, USA) were assembled following the manufacturer’s

manual. The 8.5% native polyacrylamide gel was prepared by mixing the following

solutions: 1.98 ml 30% (w/v) polyacrylamide/Bis solution 29:1 (Bio‐Rad, Shanghai,

China), 1.75 ml 1.5 M Tris‐HCl pH 8.8, 3.181 ml ultrapure water, 70 µl 10% (w/v)

ammonium persulfate (APS), 5 µl TEMED, and 14 µl of either 0.5 mM CaCl2 or 0.5

mM EDTA. The mixed solution was poured between a glass plate and an alumina

Ref. code: 25605412330010EAN

73

plate by pipetting up to the top of the alumina plate, and a comb was inserted

immediately. The gel was allowed to polymerize for 1 h. After that, the comb was

removed, and the wells were washed with ultrapure water. The gel apparatus was

assembled following the manual, and electrophoresis buffer (25 mM Tris‐base, 202

mM glycine, 1 mM CaCl2 or 1 mM EDTA) was filled into the upper and lower

chamber.

The samples including rSjGST‐OvCALR C‐domain,

rFgCaBP1 (from Section 4.7.1.2) as positive control, and rSjGST (from Section

4.7.1.3) as negative control were prepared by incubating 5 µg each with either 1 mM

CaCl2 or 1 mM EDTA on ice for 20 min. After incubation, the samples were mixed

with 2X sample buffer (120 mM Tris‐HCl, pH 6.8, 20% [v/v] glycerol, 0.05% [w/v]

Bromophenol Blue, 01% [w/v] DTT, 2 mM CaCl2 or 2 mM EDTA) and loaded into

each well of 8.5% polyacrylamide gel. Power was applied at 20 mA/gel, 200 V, 90

min. Finally, the gel was removed carefully from the gel cassette and stained with

staining solution as described in Section 4.2.5.2.

4.7.4 Determination of transacetylase activity

4.7.4.1 Indirect transacetylase activity measurement using GST

assay

Transacetylase activity of CALR was indirectly determined

by inhibition of GST in the presence of acetyl derivative of 4‐methylcoumarins.175,176

To measure transacetylase activity of OvCALR, the assay was performed as

previously described with some modifications. The following solutions were freshly

prepared: 1 mM 7‐Acetoxy‐4‐methylcoumarin (7‐AMC) (Sigma Aldrich, Buchs,

Switzerland) in DMSO Hybri‐Max® (Sigma Aldrich, St. Louis, MO, USA), 100 mM

1‐chloro‐2,4‐dinitrobenzene (CDNB) (Sigma, Dorset, UK) in absolute ethanol, 200

mM reduced glutathione (Serva, Heidelberg, Germany). Samples were prepared by

mixing 0.5 µg rSjGST with 2 µg either rOvCALR or rMmCALR and 250 µM 7‐AMC

in 0.25 M potassium phosphate buffer pH 6.5, 1 mM EDTA at 20 µl of total volume.

These mixtures were incubated at 37°C in a Thermomixer (Eppendorf, Hamburg,

Germany) and then GST activity was measured in triplicate at 15, 30 and 45 min of

incubation. The GST activity was measured by pipetting 20 µl of the samples into UV

96‐well plate (Thermo Scientific, Roskilde, Denmark) and followed by adding 180 µl

Ref. code: 25605412330010EAN

74

of substrate solution (1 mM CDNB, 2 mM reduced glutathione in 0.25 M potassium

phosphate buffer, pH 6.5). The absorbance at 340 nm was read immediately and every

60 sec thereafter for 10 min on a Varioskan Flash Spectral Scanning Multimode

Reader (Thermo Scientific, Waltham, MA, USA). Meanwhile the sample containing

only DMSO (mock solution) and substrate solution were used to determine

background values at each time point, and the control samples containing either

rSjGST alone or rSjGST plus other components (7‐AMC, rOvCALR, rMmCALR)

were used to determine calreticulin transacetylase activity and the effect of those

components on GST activity. Linear regression was plotted between time and

background‐corrected absorbance values using Prism 6 (GraphPad Software, Inc.,

CA, USA). Relative GST activity of samples was calculated by comparison of slope

value against untreated‐rSjGST at each time point.

4.7.4.2 Western blot analysis of acetylated protein

The samples were prepared by mixing 0.5 µg rSjGST with or

without 2 µg rOvCALR in the presence of 7‐AMC (50–250 µM in 5 µL of DMSO) in

0.25 M potassium phosphate buffer pH 6.5, 1mM EDTA at 20 µL of total volume.

These mixtures were incubated at 37°C using Thermomixer (Eppendorf, Hamburg,

Germany) for 20 and 40 min. These samples were size‐separated by 12.5 % SDS‐

PAGE (see Section 4.2.5.1) and transferred onto a nitrocellulose membrane (Bio‐Rad,

Goettingen, Germany) by semi‐dry blotting (see Section 4.5.3.1). Western blot

detection was performed as described in Section 4.5.3.2. Polyclonal rabbit anti‐

acetylated lysine antibody (Cell signaling, Danvers, MA, USA) at dilution 1:1,000 in

5% (w/v) BSA in TBS pH 7.5, 0.1% (v/v) Tween®

20 was used as primary antibody.

Alkaline phosphatase conjugated goat anti rabbit IgG (Dako, Glostrup, Denmark) at

dilution 1:1,000 in 1% (w/v) BSA in TBS pH 7.5, 0.05% (v/v) Tween® 20 was used

as secondary antibody.

Acetylation of protein by 7‐AMC was also tested with BSA

and rFgCaBP1 by incubation with 250 µM 7‐AMC for 30 min at 37°C and analysis

by western blot as described above.

Ref. code: 25605412330010EAN

75

4.7.5 C1q binding assay

Competitive ELISA was used to determine the binding of

rOvCALR to human C1q. Each well of a 96‐well plate (NUNC MaxiSorp, NUNC,

Roskide, Denmark) was coated with 20 ng native human C1q protein (Abcam,

Cambridge, UK) in 100 µl carbonate buffer, pH 9.6 (30 mM Na2CO3, 75 mM

NaHCO3) by incubation overnight at 4°C. The wells were washed three times with

washing buffer (0.05% [v/v] Tween® 20 in 10 mM PBS, pH7.4). Unspecific binding

to the wells was blocked by incubation in 200 µl blocking solution (1% [w/v] skim

milk in 10 mM PBS, pH 7.4, 0.05% [v/v] Tween® 20) at room temperature for 90

min. After washing the wells as before, either rOvCARL (0–2 µg) alone or 1 µg

rOvCALR mixed with rMmCALR (0–2 µg) or 1 µg rOvCALR mixed with BSA

(Sigma Aldrich, St. Louis, MO, USA) (0–2 µg) in protein diluent (1:3 of 10 mM PBS,

pH 7.4 in ultrapure water) was added to the wells. The plate was incubated for 1 h at

37°C, and the wells were washed as before. Mouse anti‐rOvCALR antiserum diluted

at 1:10,000 in antibody diluent (1% [w/v] skim milk in 10 mM PBS, pH 7.4, 0.05%

[v/v] Tween®

20) was added into the wells and incubated for 90 min at 37°C. The

wells were washed as before, and sheep anti‐mouse IgG HRP conjugated (GE

Healthcare, Little Chalfont, UK) diluted at 1:3,000 in antibody diluent was added into

each well. The plate was incubated for 1 h at 37°C and the wells were washed again.

TMB substrate solution (Life Technologies, Carlsbad, CA, USA) was used at 100

µl/well, and the plate was incubated in the dark for 30 min at room temperature. The

reaction was stopped by adding 100 µl of 1 N HCl. The absorbance at 450 nm was

read on a POLARstar Omega plate reader (BMG Labtech, Ortenberg, Germany). This

assay was performed two times in duplicate. Curves fitted between mean of

absorbance values and amounts of protein were plotted in DataGraph 4.2 (Visual Data

Tools, Inc.)

4.7.6 Hemolytic assay

Hemolytic assay of classical pathway complement activation was

performed using sensitized human red blood cells. Human EDTA blood and serum of

blood group AB were used in this experiment. Red blood cells were washed twice in

gelatin veronal buffer (0.1% [w/v] gelatin in Calcium‐Magnesium‐Veronal buffer

[bioMérieux, Charbonnières les Bains, France]) by centrifugation at 1,000×g for 5

Ref. code: 25605412330010EAN

76

min. Red blood cells were sensitized with Anti‐B reagent (CE‐Immundiagnostika

GmbH, Eschelbronn, Germany) at dilution 1:50 in gelatin veronal buffer for 5 min at

4°C. The sensitized red blood cells were washed as before and prepared as 10%

sensitized red blood cells in gelatin veronal buffer. Normal human serum (dilution

1:10) alone or mixed with 10–50 µg of either rOvCALR, rMmCALR (positive

control), or BSA (negative control) in a total volume of 300 µl gelatin veronal buffer

were pre‐incubated at 37°C for 30 min. After that, 20 µl of sensitized red blood cell

suspension was added into each tube and further incubated at 37°C for 60 min. The

tubes were centrifuged at 1,500×g for 5min and supernatants were pipetted into each

well of a 96‐well plate. The hemolytic activity was determined by measuring the

absorbance at 540 nm on a Varioskan Flash spectral scanning multimode reader

(Thermo Scientific, MA, USA). Spontaneous hemolysis in the tube containing 10 mM

PBS, pH 7.2 in gelatin veronal buffer at identical conditions was measured and used

as background. This assay was performed two times in duplicate. The hemolytic

activity was expressed as percentage of relative hemolysis. Statistical analysis using

ANOVA with Dunnett’s multiple comparison test was accomplished by SPSS 16.0

(SPSS, Inc.).

4.7.7 In vitro angiogenesis assays

4.7.7.1 Preparation of recombinant proteins for tissue culture

Recombinant OvCALR, MmCALR and SjGST were

prepared as described previously, concentrated and dialyzed against 10 mM PBS, pH

7.4. Bacterial endotoxin was removed twice using a Pierce® High Capacity Endotoxin

Removal Spin Column (Thermo Scientific, Rockford, IL, USA). To equilibrate the

resin, the spin column had been equilibrated to room temperature, and the spin

column was inserted into a collection tube and centrifuged at 500×g for 1 min to

remove the storage solution. The resin was regenerated by mixing with 8 ml of 0.2 N

NaOH in a 15 ml conical tube on a rotary mixer, overnight at room temperature. On

the following day, the resin suspension was transferred into the spin column, and the

column was inserted into a collection tube and centrifuged at 500×g for 1 min to

remove the solution. Then the resin was mixed thoroughly with 8 ml of 2 M NaCl and

centrifuged as before. The resin was washed by mixing with 8 ml ultrapure water and

then centrifuged as before to remove the water. The resin was equilibrated in 10 mM

Ref. code: 25605412330010EAN

77

PBS, pH 7.4 by mixing the resin with 8 ml of 10 mM PBS, pH 7.4 and removing the

solution as before. This equilibrating step was repeated three times. The sample was

mixed with the resin in a 15 conical tube on a rotary mixer at 4°C overnight. On the

next day, the sample was collected by transferring the resin suspension into the spin

column and centrifugation at 500×g for 1 min. All endotoxin removal steps were

repeated with the collected sample to minimize the bacterial endotoxin in the sample.

4.7.7.2 Cell culture

Pre‐screened human umbilical vein endothelial cells

(HUVECs) were purchased from Lonza (Clonetics™ Cells, Lonza, Basel,

Switzerland) and grown in endothelial growth medium (EGM™‐2) (Lonza, Basel,

Switzerland). Cell passaging was done using ReagentPack™ Subculture Reagents

(Lonza, Basel, Switzerland). The instruction of Clonetics™ Endothelial Cell System

was followed for cell culture, cell maintenance, subculturing, and cell storage. In vitro

angiogenesis assays were performed using HUVECs passage number 3 to 6 with cell

viability greater than 80%. Cell viability was determined using Countess™

Automated Cell Counter (Invitrogen, Carlsbad, CA, USA) with trypan blue staining.

4.7.7.3 MTT assay

HUVECs were seeded at 1×104 cells/well into 96‐well cell

culture plate (Corning, Pittston, PA, USA). The plate was incubated in a humidified

CO2 incubator (37°C, 5% CO2) for 4 h to allow the cells to attach. One hundred

microliter of EGM™‐2 (Lonza, Basel, Switzerland) containing either 10 mM PBS pH

7.4, rOvCARL, rMmCALR (from Section 4.7.1.1) or rSjGST (from Section 4.7.1.3)

at 0.1, 1, 10 and 20 µM concentration were prepared and added into the wells. The

plate was incubated for 48 h in the humidified CO2 incubator. Afterward, 12 mM

Thiazolyl Blue Tetrazolium Bromide (MTT) (Sigma Aldrich, St. Louis, MO, USA)

was added at 20 µl/well, and then the plate was incubated in the incubator for 4 h.

Finally, the medium was removed, and 100 µl of solubilizing solution (0.1 N HCl in

isopropanol) was added to each well to dissolve formazan crystals. The absorbance at

570 nm was read with background wavelength at 690 nm on a POLARstar Omega

plate reader (BMG Labtech, Ortenberg, Germany). This assay was performed two

times in triplicate. A bar graph with mean and standard deviation values of relative

viability was plotted by comparison to untreated HUVECs (10 mM PBS, pH 7.4).

Ref. code: 25605412330010EAN

78

Statistical analysis using two‐way ANOVA with Tukey’s multiple comparison test

was accomplished by SPSS 16.0 (SPSS, Inc.).

4.7.7.4 Scratch assay

Scratch assay177

was performed with some modifications.

HUVEC cells were seeded into a 24‐well cell culture plate (Corning, Pittston, PA,

USA) and grown until confluence. Two straight‐line scratches were made

perpendicularly with a 200 µl pipette tip. Debris cells were removed, and the wells

were washed with 10 mM PBS, pH 7.4. Four hundred microliter of EGM™‐2 (Lonza,

Basel, Switzerland) containing either 10 mM PBS pH 7.4, rOvCARL, rMmCALR

(from Section 4.7.1.1) or rSjGST (from Section 4.7.1.3) at concentrations of 20 and

50 µM were prepared and replaced into the wells. Markings were made on the plate as

a reference point to get the same field during image captures. Pre‐incubation images

were captured using an inverted microscope (Nikon Eclipse TS100 [microscope],

Infinity3 Lumenera [digital camera]). The plate was incubated in the humidified CO2

incubator (37°C, 5% CO2) for 24 h, and post‐incubation images were captured by

matching with the reference point. A fixed area occupied by HUVECs was analyzed

by using ImageJ software (ImageJ version 1.51h, National Institutes of Health, USA;

http://imagej.nih.gov/ij/). This assay was performed four times. A bar graph with

mean and standard deviation values of relative migration area was plotted by

comparison to untreated HUVECs (10 mM PBS, pH 7.4). Statistical analysis using

two‐way ANOVA with Tukey’s multiple comparison test was accomplished by SPSS

16.0 (SPSS, Inc.).

4.7.7.5 Tube formation assay

Tube formation assay178

was performed with some

modifications. Matrigel Growth Factor Reduced (Corning, NY, USA) was thawed

overnight on ice at 4°C. In this experiment, pipette tips and 96‐well plate were

precooled before used and they were maintained on ice during the coating process. A

Matrigel‐coated plate was prepared by pipetting 60 µl of the Matrigel to each well of

a 96‐well cell culture plate (Corning, Pittston, PA, USA). The plate was incubated at

room temperature for 10 min and then moved into the humidified CO2 incubator for

30 min. Seventy‐five microliter of EGM™‐2 medium containing either 10 mM PBS

pH 7.4, rOvCARL, rMmCALR (from Section 4.7.1.1) or rSjGST (from Section

Ref. code: 25605412330010EAN

79

4.7.1.3) at two times concentrations of 20 and 50 µM were prepared and added into

the Matrigel pre‐coated wells. Freshly prepared HUVECs suspension was seeded into

each well at 2.5 × 103 cells/well in 75 µl of EGM™‐2 medium. The plate was

incubated in the incubator (37°C, 5% CO2) for 18 h. Formation of tube‐like structure

by HUVECs was observed under an inverted microscope (Nikon Eclipse TS100

[microscope], Infinity3 Lumenera [digital camera]). The tube length was measured by

ImageJ software with angiogenesis analyzer plug‐in (ImageJ version 1.51h, National

Institutes of Health, USA; http://imagej.nih.gov/ij/). This assay was performed three

times in duplicate. A bar graph with mean and standard deviation values of relative

viability was plotted by comparison to untreated HUVECs (10 mM PBS, pH 7.4).

Statistical analysis using two‐way ANOVA with Tukey’s multiple comparison test

was accomplished by SPSS 16.0 (SPSS, Inc.).

Ref. code: 25605412330010EAN

80

CHAPTER 5

RESULTS

5.1 Molecular cloning of Opisthorchis viverrini calreticulin (OvCALR) cDNA

and its sequence analysis

Based on the transcriptome data of O. viverrini179

, specific

oligonucleotide primers were designed for amplification of the uncharacterized

OvCALR cDNA not including the protein’s predicted signal peptide sequence. This

cDNA was reverse transcribed and amplified using PCR from total RNA of adult

O. viverrini as described in Section 4.1.2. The PCR products were resolved in 1%

(w/v) agarose gel, and the expected product showed as a major band at about 1,200 bp

(Figure 5.1A). This product was purified from the agarose gel, ligated into the

pGEM®‐T Easy vector and introduced into E. coli XL1‐Blue. Transformants were

screened by colony PCR (Figure 5.2A) and restriction enzyme double digestion

(Figure 5.2B). The recombinant plasmid was isolated from positive‐screened clones

and then the nucleic acid sequence of the insert determined using a commercial DNA

sequencing service (1st Base Asia, Singapore).

Comparison of the verified OvCALR cDNA sequence and the

transcriptome data of O. viverrini179

revealed the 1,248 bp open reading frame of

OvCALR cDNA. The complete coding sequence of OvCALR was submitted into the

NCBI database and is available under the GenBank accession number KX722539.

The sequence of the OvCALR cDNA was used to deduce the amino acid sequence of

OvCALR and revealed a protein of 415 amino acid residues of pre‐mature

O. viverrini calreticulin (Figure 5.3). The mature OvCALR protein (399 amino acids)

has a calculated molecular weight of 46.23 kDa and a theoretical isoelectric point of

4.3. Signal peptide prediction indicated a 16 amino acid residues signal peptide

(Figure 5.4) at the N terminus, and ScanProsite, a motifs scanning tool, indicated an

ER retention signal (HEEL) at the C terminus of OvCALR (Figure 5.3). Moreover,

ScanProsite analysis of the deduced amino acid sequence of OvCALR showed that

OvCALR has the conserved calreticulin family signature 1 at residues 99–114

Ref. code: 25605412330010EAN

81

(KYEQSVSCGGAYLKLL) (Figure 5.3). The calreticulin family signature 2

(consensus pattern: [LIVM](2)‐F‐G‐P‐D‐x‐C‐[AG], ProSite documentation

PDOC00636) is not found in OvCALR because of the first amino acid changing from

isoleucine in mammalian and blood fluke calreticulin to phenylalanine in OvCALR

and CsCALR (Figure 5.5). The other characteristics of calreticulin including three

functional domains (N‐, P‐, and C‐domain), a conserved disulfide bond, and three

each of two tandem repeated motifs (repeat A: PXXIXDPDAXKPEDWDE, repeat B:

GXWXPPXIXNPXYX) are present. So OvCALR can be classified as a novel

member of the calreticulin family. The other homologs of calreticulin were searched

through the NCBI database for multiple sequence alignment (Figure 5.5). The

deduced amino acid sequence of OvCALR has very high sequence conservation at

96.6% identity to C. sinensis calreticulin. The sequence conservation is significantly

less when compared to blood fluke calreticulin, S. mansoni (57.5%) and S. japonicum

(53.6%), and mammalian calreticulin, M. musculus (50.7%) and H. sapiens (50.9%),

respectively. Less conserved regions can be observed at the N‐ and C‐termini of these

sequences.

Ref. code: 25605412330010EAN

82

Figure 5.1 Agarose gel showing the RT‐PCR product of OvCALR obtained from

adult O. viverrini total RNA. Lane M: GeneRuler™ 100 bp Plus DNA Ladder

(Thermo Scientific, Vilnius Lithuania).

Ref. code: 25605412330010EAN

83

Figure 5.2 Agarose gel showing the OvCALR cDNA product obtained from

transformant‐screening methods. (A) Colony PCR presenting the 1,200 bp product of

OvCALR from bacterial clones 1–5 (lanes 1–5) and no product from negative control

(lane 6); lane M: GeneRuler™ 100 bp Plus DNA Ladder (Thermo Scientific, Vilnius

Lithuania). (B) Restriction enzyme analysis of pGEM®‐T Easy carrying the OvCALR

cDNA; lane M: GeneRuler™ 1 kb DNA Ladder (Thermo Scientific, Vilnius

Lithuania), lane 1: undigested pGEM®‐T Easy carrying the OvCALR cDNA, lane 2:

pGEM®‐T Easy carrying the OvCALR cDNA after PaeI (SphI) and PstI double‐

digestion. An arrowhead indicates the location of OvCALR.

A B

Ref. code: 25605412330010EAN

84

Figure 5.3 Nucleic acid and deduced amino acid sequences of OvCALR. Sequence

analysis and graphic were created with EMBOSS showorf. The boxed sequence

indicates the signal peptide and the underlined sequence indicates the ER retention

signal. The calreticulin family signature 1 is indicated by double‐underlined sequence.

Ref. code: 25605412330010EAN

85

# Measure Position Value Cutoff signal peptide?

max. C 17 0.623

max. Y 17 0.767

max. S 1 0.970

mean S 1-16 0.933

D 1-16 0.856 0.450 YES

Name=OvCALR SP='YES' Cleavage site between pos. 16 and 17: AYA-EV D=0.856 D-

cutoff=0.450 Networks=SignalP-noTM

Figure 5.4 Signal peptide prediction of OvCALR by SignalP 4.1. The prediction

indicates a cleavage site between amino acid position 16 (alanine) and 17 (glutamic

acid)

Ref. code: 25605412330010EAN

(Please see overleaf for figure legend)

86

Ref. code: 25605412330010EAN

Figure 5.5 Multiple alignment of the deduced amino acid sequences of calreticulin from O. viverrini (UniProt: A0A1P8P1U1),

C. sinensis (UniProt: K7NB00), S. mansoni (UniProt: Q06814), S. japonicum (UniProt: O45034), M. musculus (UniProt: P14211),

H. sapiens (UniProt: P27797). Characteristic N-, P-, C-domains, signal peptide, ER retention signal, repeat motifs A and B, and family

signatures 1 and 2 (red box) of calreticulin are indicated. Cysteine residues forming disulfide bond are indicated, and residues forming

high‐affinity calcium‐binding site based on mouse calreticulin98

are indicated by asterisks. Residues participate in carbohydrate‐

binding97,98

and polypeptide‐binding180

based on human and mouse calreticulin are indicated by black dots and black arrowheads,

respectively. The angiogenic active region as peptide vasostatin134

and region involved with oxidoreductase ERp57 interaction181

are

indicated. The C1q binding sites identified in human calreticulin182

are indicated by purple lines.

87

Ref. code: 25605412330010EAN

88

5.2 Production of rOvCALR and other control proteins using a bacterial system

5.2.1 Production of rOvCALR

5.2.1.1 Small‐scale expression of rOvCALR

The confirmed OvCALR cDNA was inserted into the pQE30

expression vector using the restriction endonuclease sites of PaeI and PstI. The

constructed recombinant plasmid pQE30‐OvCALR was introduced into the

expression host E. coli M15, and transformants were screened by direct colony PCR.

The positive screened colonies that carried the pQE30‐OvCALR plasmid were

checked for protein expression by small‐scale expression. Time‐course and target‐

protein solubility analyses were performed as described in Section 4.2.2 and Section

4.2.3 to find out the optimal expression conditions. Recombinant OvCALR in E. coli

M15 was already observed after the first hour and its amount increased over the

period of induction, however, it was mainly found in the insoluble fraction (Figure

5.6). To obtain soluble OvCALR, the expression vector pET21b(+) and host strain

E. coli Rosetta‐gami(DE3)pLysS were tried next. The OvCALR cDNA was

subcloned into the pET21b(+) expression vector using the restriction endonuclease

sites of NheI and NotI. Positive screened transformants were checked for time‐course

expression and target‐protein solubility. Expression of rOvCALR in E. coli Rosetta‐

gami(DE3)pLysS showed that rOvCALR existed in soluble fraction after overnight

induction at 28°C (Figure 5.7).

5.2.1.2 Large‐scale expression and purification of rOvCALR

Based on small‐scale expression, the optimal conditions for

rOvCALR expression in E. coli M15 were 1 mM IPTG induction at 37°C for 4 h

(Figure 5.6) and for rOvCALR expression in E. coli Rosetta‐gami(DE3)pLysS were 1

mM IPTG overnight induction at 28°C (Figure 5.7). These optimal conditions were

applied to large‐scale expression of rOvCALR as described in Section 4.2.4.

Recombinant OvCALR expressed in E. coli M15 was purified using Ni‐NTA affinity

chromatography under denaturing conditions (Figure 5.8), whereas rOvCALR

expressed in E. coli Rosetta‐gami(DE3)pLysS was purified under native conditions

(Figure 5.9). Eluates containing rOvCALR from the two purification conditions were

pooled separately and dialyzed against 10 mM PBS, pH 7.2 (Figure 5.10).

Ref. code: 25605412330010EAN

89

Figure 5.6 Time‐course and target‐protein solubility analyses of E. coli M15/pQE30‐

OvCALR. The culture was grown at 37°C until OD600 reached 0.6 and then the

expression was induced with 1 mM IPTG at final concentration. The culture was

further grown at 37°C for 4 h. Lane M: Broad Range Molecular Weight Standards

(Bio‐Rad, Hercules, CA, USA), lane 1: non‐induced total bacterial lysate, lanes 2–5:

IPTG‐induced total bacterial lysate at 1 h, 2 h, 3 h and 4 h, respectively, lane 6:

soluble fraction of the induced bacterial culture at 3 h, lane 7: insoluble fraction of the

induced bacterial culture at 3 h. The location of rOvCALR is indicated by an

arrowhead.

Ref. code: 25605412330010EAN

90

Figure 5.7 Protein expression and target‐protein solubility analyses of E. coli Rosetta‐

gami(DE3)pLysS/pET21b(+)‐OvCALR. Two clones of transformants were cultured

at 37°C until OD600 reached 0.6 and then the expression was induced with 1 mM

IPTG at final concentration. The cultures were further grown overnight at 28°C. Lane

M: Broad Range Molecular Weight Standards (Bio‐Rad, Hercules, CA, USA), lanes

1, 5: non‐induced bacterial lysate, lanes 2, 6: IPTG induced bacterial lysate, lanes 3,

7: soluble fraction of the induced bacterial culture, lanes 4, 8: insoluble fraction of the

induced bacterial culture. The location of rOvCALR is indicated by an arrowhead.

Ref. code: 25605412330010EAN

91

Figure 5.8 Purification of rOvCALR using Ni‐NTA affinity chromatography under

denaturing conditions. Lane M: Broad Range Molecular Weight Standards (Bio‐Rad,

Hercules, CA, USA), lane 1: total bacterial lysate, lane 2: flow‐through fraction, lanes

3, 4: first and second washing fractions, respectively, lanes 5–8: eluate fractions 1–4

in elution buffer pH 5.9, respectively, lanes 9–12: eluate fractions 1–4 in elution

buffer pH 4.5, respectively.

Ref. code: 25605412330010EAN

92

Figure 5.9 Purification of rOvCALR using Ni‐NTA affinity chromatography under

native conditions. Lane M: Broad Range Molecular Weight Standards (Bio‐Rad,


3, 4: first and second washing fractions, respectively, lanes 5–8: eluate fractions 1–4,

respectively.

Ref. code: 25605412330010EAN

93

Figure 5.10 SDS‐PAGE showing purified rOvCALR (5 µg) obtained from denaturing

purification. Lane M: Broad Range Molecular Weight Standards (Bio‐Rad, Hercules,

CA, USA)

Ref. code: 25605412330010EAN

94

5.2.2 Production of rOvCALR C‐domain

Recombinant OvCALR C‐domain was produced in E. coli in fusion

with SjGST using the pGEX‐5X‐1 vector. The 321 bp cDNA fragment encoding the

OvCALR C‐domain was amplified from the verified OvCALR cDNA and sent to a

commercial DNA sequencing service to verify the obtained DNA sequence as

described in Section 4.7.3.1. The verified OvCALR C‐domain was inserted into the

pGEX‐5X‐1 expression vector and then introduced into E. coli BL21. The

recombinant OvCALR C‐domain was expressed at large‐scale and purified using

glutathione affinity chromatography (Figure 5.11). Eluates containing rSjGST‐

OvCALR C‐domain were pooled, concentrated and dialyzed against 10 mM PBS, pH

7.2. This protein was used in calcium binding assay to determine calcium‐binding

activity of OvCALR.

Figure 5.11 Purification of rSjGST‐OvCALR C‐domain using glutathione affinity

chromatography. Lane M: Broad Range Molecular Weight Standards (Bio‐Rad,



respectively.

Ref. code: 25605412330010EAN

95

5.2.3 Production of recombinant Mus musculus calreticulin

(rMmCALR)

Total RNA isolated from mouse tissue was used as a template for

cloning of MmCALR (Figure 5.12A). The coding sequence of MmCALR was

amplified without the region encoding the predicted signal peptide using specific

primers as described in Section 4.7.1.1. The RT‐PCR products were analyzed by 1%

(w/v) agarose gel electrophoresis, and the expected product was observed at about

1,200 bp (Figure 5.12B). This product was purified from the agarose gel, ligated into

pGEM®‐T Easy vector and introduced into E. coli XL1‐Blue. The recombinant

plasmid DNA was extracted from positive screened transformants and sent to a

commercial DNA sequencing service (1st Base Asia, Singapore) to verify the obtained

cDNA sequence. The verified MmCALR cDNA was inserted into pET21b(+)

expression vector and then introduced into E. coli Rosetta‐gami(DE3)pLysS. The

positive screened colonies that carried pET21b(+)‐MmCALR plasmid were checked

for optimal protein expression by small‐scale expression. The result showed that

rMmCALR can be expressed in E. coli Rosetta‐gami(DE3)pLysS as soluble protein

with following induction conditions: 1 mM IPTG at final concentration, overnight at

28°C (Figure 5.13). Recombinant MmCALR was expressed at large‐scale and

purified using Ni‐NTA affinity chromatography under native conditions (Figure

5.14). Eluates containing rMmCALR were pooled, concentrated and dialyzed against

10 mM PBS, pH 7.2.

Ref. code: 25605412330010EAN

96

Figure 5.12 Agarose gel showing (A) total RNA isolated from mouse (B) the RT‐

PCR product obtained from mouse total RNA with specific primers for MmCALR.

Lane 1: Fasciola gigantica total RNA, lanes 2, 3: mouse total RNA isolated from

heart, lanes 4, 5: mouse total RNA isolated from lung, lanes 6–8: mouse total RNA

isolated from kidney, lane M: GeneRuler™ 1 kb DNA Ladder (Thermo Scientific,

Vilnius Lithuania). The location of MmCALR cDNA is indicated by an arrowhead.

Ref. code: 25605412330010EAN

97

Figure 5.13 Protein expression and target‐protein solubility analyses of E. coli

Rosetta‐gami(DE3)pLysS/pET21b(+)‐MmCALR. Two transformant clones were

cultured at 37°C until OD600 reached 0.6 and then the expression was induced with 1

mM IPTG at final concentration. The cultures were further grown overnight at 28°C.

(A) SDS‐PAGE of rMmCALR expression in E. coli Rosetta‐gami(DE3)pLysS; lane

M: Broad Range Molecular Weight Standards (Bio‐Rad, Hercules, CA, USA), lanes

1, 3: non‐induced bacterial lysate, lanes 2, 4: IPTG induced bacterial lysate from

clone number 1 and 2, respectively. (B) SDS‐PAGE of rMmCALR solubility

analysis; lane M: Broad Range Molecular Weight Standards (Bio‐Rad, Hercules, CA,

USA), lanes 1, 3: soluble fraction of the induced bacterial culture, lanes 2, 4: insoluble

fraction of the induced bacterial culture from clone number 1 and 2, respectively.

Arrowheads indicate the locations of rMmCALR.

Ref. code: 25605412330010EAN

98

Figure 5.14 Purification of rMmCALR using Ni‐NTA affinity chromatography under




respectively.

Ref. code: 25605412330010EAN

99

5.2.4 Production of recombinant Fasciola gigantica calcium‐binding

protein 1 (rFgCaBP1)

Recombinant FgCaBP1 was produced in transformed E. coli M15

carrying pQE30‐FgCaBP1 and then purified using Ni‐NTA affinity chromatography

under native conditions (Figure 5.15). Eluates containing rFgCaBP1 were pooled,

concentrated and dialyzed against 10 mM PBS, pH 7.2. This protein was used as a

positive control protein for calcium binding assay.

Figure 5.15 Purification of rFgCaBP1 using Ni‐NTA affinity chromatography under


Hercules, CA, USA), lane 1: total bacterial lysate, lane 2: flow‐through fraction, lane

3: washing fraction, lanes 4–7: eluate fractions 1–4, respectively.

Ref. code: 25605412330010EAN

100

5.2.5 Production of recombinant Schistosoma japonicum glutathione

S‐transferase (rSjGST)

Recombinant SjGST was expressed in transformant E. coli BL21

carrying pGEX‐5X‐1 plasmid and then purified using glutathione affinity

chromatography (Figure 5.16). Eluates containing rSjGST were pooled, concentrated

and dialyzed against 10 mM PBS, pH 7.2. This protein was used as a negative control

protein for in vitro angiogenesis assays and calcium binding assay.

Figure 5.16 Purification of rSjGST using glutathione affinity chromatography. Lane

M: Broad Range Molecular Weight Standards (Bio‐Rad, Hercules, CA, USA), lane 1:

total bacterial lysate, lane 2: flow‐through fraction, lane 3: washing fraction, lanes 4–

7: eluate fractions 1–4, respectively.

Ref. code: 25605412330010EAN

101

5.3 Production of polyclonal antibody in mice

5.3.1 Production of polyclonal mouse anti‐rOvCALR antibody

Anti‐rOvCALR antibody was produced as antiserum in three female

ICR mice by peritoneal immunization with rOvCALR purified under denaturing

conditions. The time points of serum collection are described in Section 4.3.1.

Indirect ELISA was used to determine specificity and titer of the obtained antisera.

The result showed that the antibody level against rOvCALR increased dramatically in

first boosting sera of all three mice and then gradually increased in second boosting

sera of mouse number 1 and 2 (Figure 5.17). These mouse anti‐rOvCALR antisera

were used to detect native OvCALR in extracts and tissue of the parasite in the next

experiments.

Figure 5.17 Line graph showing antibody level of polyclonal anti‐rOvCALR

antibody (dilution 1:400) determined by indirect ELISA.

Ref. code: 25605412330010EAN

102

5.3.2 Production of polyclonal mouse anti‐OvES antibody

Anti‐OvES antibody was produced as antiserum in two female

Balb/c mice by peritoneal immunization with excretory/secretory (ES) products from

adult O. viverrini and serum collection from each time point as described in Section

4.3.2. Indirect ELISA was used to determine the titer of the obtained antisera. The

result showed that the antibody level against ES products of adult O. viverrini from

mouse number 1 increased significantly in first and second boosting serum while the

antibody level in mouse number 2 remained low (Figure 5.18). So the pre‐immune

serum and anti‐OvES antiserum obtained from mouse number 1 were used for

immunohistochemistry in the next experiment.

Figure 5.18 Line graph showing antibody level of polyclonal anti‐OvES antibody

(dilution 1:6,400) determined by indirect ELISA.

Ref. code: 25605412330010EAN

103

5.4 Characterization of OvCALR expression in O. viverrini

5.4.1 Stage‐specific reverse transcriptase polymerase chain reaction

(RT‐PCR)

The expression of OvCALR at mRNA level in selected

developmental stages was verified by RT‐PCR, and the expression of OvActin was

used as internal control. The RT‐PCR products, 453 bp of OvCALR and 292 bp of

OvActin, were analyzed by 1% (w/v) agarose gel electrophoresis (Figure 5.19).

RNAs of OvCALR and OvActin were found in all analyzed stages However,

OvCALR RNA was less abundant in newly excysted juveniles while OvActin was

comparable in all analyzed stages.

Figure 5.19 Stage‐specific analysis of OvCALR from total RNA of newly excysted

juveniles (NEJ), 2‐, 4‐ and 8‐week‐old parasites (2wk, 4wk and 8wk) by reverse

transcription PCR. O. viverrini actin RNA (OvActin) was reverse transcribed in all

analyzed stages as internal control. Lane M: GeneRuler™ 100 bp DNA Ladder

(Thermo Scientific, Vilnius Lithuania).

Ref. code: 25605412330010EAN

104

5.4.2 Western blot analyses

Parasite antigens including excretory/secretory product (ES),

soluble and insoluble crude worm extracts were prepared as described in Section 4.4

(Figure 5.20). The parasite extracts were used to analyze spatial expression of

OvCALR using immunoblot with anti‐rOvCALR antisera. Pre‐immune sera and anti‐

rOvCALR antisera from three mice were used to detect OvCALR on the

nitrocellulose membranes. These mouse antisera could detect rOvCALR and native

OvCALR in soluble crude worm extract and excretory/secretory product while the

pre‐immune sera did not show any reactivity to those proteins (Figure 5.21). All

mouse antisera comparably detected OvCALR at dilution 1:3,000. However, only

antiserum from mouse number 1 was used for immunodetection of OvCALR in

further experiments. Anti‐rOvCALR antiserum was used to determine specificity and

cross‐reactivity to rMmCALR and rOvCALR C‐domain as well. The antiserum did

not show cross‐reactivity to rMmCALR while it could detect rOvCALR C‐domain in

fusion with GST and native OvCALR in both soluble and insoluble crude worm

extracts (Figure 5.22). The estimated molecular weight of OvCALR in SDS‐PAGE

was higher than the predicted size of 46 kDa and likewise found in rMmCALR (MW:

46.35 kDa).

Ref. code: 25605412330010EAN

105

Figure 5.20 SDS‐PAGE of parasite extracts from adult O. viverrini. Ten micrograms

each of parasite extracts were resolved by 12.5% SDS‐PAGE: (A) excretory/secretory

(ES) product, (B) soluble crude worm extract (CW), and (C) insoluble crude worm

extract. Lane M: Broad Range Molecular Weight Standards (Bio‐Rad, Hercules, CA,

USA).

Ref. code: 25605412330010EAN

106

Figure 5.21 Western blot detection of OvCALR by anti‐rOvCALR antisera from

three mice. Parasite extracts (10 µg each) and rOvCALR (100 ng) were resolved in

12.5% SDS‐PAGE and transferred onto nitrocellulose membrane. Membrane bound

proteins were probed with either (A) anti‐rOvCALR antisera or (B) pre‐immune sera

(1:3,000) and detected with BCIP/NBT substrate (blue‐purple precipitate). Lane M:

Broad Range Molecular Weight Standards (Bio‐Rad, Hercules, CA, USA), lane 1:

soluble crude worm extract, lane 2: excretory/secretory product, lane 3: rOvCALR.

Ref. code: 25605412330010EAN

107

Figure 5.22 Western blot detection of OvCALR by anti‐rOvCALR antiserum. (A)

Coomassie blue stained SDS‐PAGE of parasite extracts (15 µg each) and recombinant

proteins (1 µg each). Parasite extracts (10 µg each) and rOvCALR (100 ng) were

resolved by 12.5% SDS‐PAGE and transferred onto nitrocellulose membrane.

Membrane bound proteins were probed with either (B) anti‐rOvCALR antiserum or

(C) pre‐immune serum (1:3,000) and detected with BCIP/NBT substrate (blue‐purple

precipitate). Lane M: Broad Range Molecular Weight Standards (Bio‐Rad, Hercules,

CA, USA), lane 1: soluble crude worm extract, lane 2: insoluble crude worm extract,

lane 3: rOvCALR, lane 4: rMmCALR, lane 5: rSjGST‐OvCALR C domain.

Ref. code: 25605412330010EAN

108

5.4.3 Immunohistochemical analyses

Immunohistochemistry was used to investigate the distribution of

OvCALR in parasite tissue using anti‐rOvCALR antiserum. Pre‐immune serum did

not show any staining on adult stage O. viverrini tissue, whereas anti‐rOvCALR

antiserum led to staining of many parts of the parasite especially in the reproductive

system (Figure 5.23). Punctate staining was found in the parenchyma and intense

staining in tegumental cell bodies, cecal epithelium, gametocytes in testes and ovary,

prostate gland, Mehlis’ gland, vitelline cells, and lining of seminal vesicle (Figure

5.23 and Figure 5.24). Eggs in the proximal uterus were strongly stained and the

staining intensity decreased toward the distal uterus.

The O. viverrini‐infected hamster liver section detected with anti‐

rOvCALR antiserum showed only staining of parasite tissues but not of host tissues,

whereas anti‐OvES antiserum detected parasite antigens in the parasite tissue with

intense staining and in the host tissues surrounding the parasite (Figure 5.24). This

result suggests that some parasite antigens can be trapped in the bile duct epithelium

and connective tissue surrounding the bile duct of the host. Although OvCALR

presented in excretory/secretory products of the parasite, it could not be detected in

the host tissues with anti‐rOvCALR antiserum at appropriate conditions. The selected

dilution of the mouse antisera did not cause any staining in the normal hamster liver

sections at identical conditions (Figure 5.24).

Ref. code: 25605412330010EAN

Figure 5.23 Immunohistochemical detection of OvCALR in adult O. viverrini. Sagittal sections of the parasite were probed by either

mouse anti‐rOvCALR antiserum (A and B) or pre‐immune serum (C) at dilution 1:2,000 and detected with AEC substrate (red staining).

Tg: tegumental cell bodie (arrowheads), Sv: seminal vesicle, Pg: prostate gland cells, Eg: eggs, Mg: Mehlis’s gland, Ov: ovary, Sr:

seminal receptacle, Te: testis.

Anterior Posterior

Ventral

Dorsal

200 µm

A

B

C

109

Ref. code: 25605412330010EAN

110

Figure 5.24 Immunohistochemical detection of O. viverrini antigens in infected

hamster liver sections (Cont.). Upper panels: detection with mouse pre‐immune serum

(B) and anti‐OvES antiserum (C: low magnification, A: magnified region). Lower

panels: detection with mouse pre‐immune serum (E), anti‐rOvCALR antiserum (D),

and normal hamster liver tissue detection with anti‐rOvCALR antiserum (F).

A

D

C

B

F

E

Ref. code: 25605412330010EAN

111

Figure 5.24 Immunohistochemical detection of O. viverrini antigens in infected

hamster liver sections (Cont.). The infected hamster liver tissue sections were

detected with either mouse pre‐immune serum (inset) or anti‐rOvCALR antiserum

(G). Mouse pre‐immune serum and anti‐OvES antiserum were used at dilution

1:1,000 while mouse pre‐immune serum and anti‐rOvCALR antiserum were used at

dilution 1:750 that did not show any staining in normal hamster liver tissue (F).

Arrowheads: tegumental cells, arrows: vitelline cells, T: testis, O: ovary, E: eggs, C:

cecum, S: seminal vesicle, V: ventral sucker, scale bar: 200 µm.

G

Ref. code: 25605412330010EAN

112

5.5 Analysis of OvCALR‐specific antibody response by O. viverrini‐infected

hamster sera

Syrian golden hamsters (n=10) were infected with O. viverrini

metacercariae, and blood was collected at preinfection and 2, 4, 8, 12 weeks

postinfection. These sera were used to study the specific antibody response against

rOvCALR using indirect ELISA and immunoblot. Indirect ELISA result showed that

the mean absorbance value of 12‐week postinfection sera against rOvCALR was

significantly different from the mean absorbance value of preinfection sera (Figure

5.25). The trend of OvCALR‐specific antibody response was investigated with pooled

hamster sera, and the result demonstrated that the antibody response against

rOvCALR was observed since 8 weeks of infection (Figure 5.26A). The same result

was also observed in immunoblot (Figure 5.26B). The bands of detected rOvCALR

were observed in the lane that probed with 8‐ and 12‐week postinfection sera but not

with preinfection and 2‐, 4‐week postinfection sera.

Figure 5.25 Graph of the absorbance values (mean ± SD) of preinfection and 12‐

week postinfection hamster sera (n=10) against rOvCALR detected by indirect

ELISA. Two‐tailed student t‐test was used to test difference between the mean

absorbance value of pre‐ and post‐infection hamster sera.

p < 0.05

Ref. code: 25605412330010EAN

113

Figure 5.26 Indirect ELISA and immunoblot detection of rOvCALR by pooled

(n=10) preinfection and postinfection hamster sera. (A) Absorbance values at 492 nm

were plotted from pooled hamster sera collected at week 0 (preinfection) and weeks 2,

4, 8, 12 postinfection; error bars represent standard deviation. (B) Immunoblot of

rOvCALR detected with AEC substrate (red‐brown precipitate). Lane M: Broad

Range Molecular Weight Standards (Bio‐Rad, Hercules, CA, USA), lanes 1–5: 200

ng rOvCALR probed with pooled hamster sera (1:200) collected at weeks 0, 2, 4, 8

and 12, respectively. The location of rOvCALR is indicated by an arrowhead.

A B

Ref. code: 25605412330010EAN

114

5.6 Functional analysis of rOvCALR

5.6.1 Chaperoning activity

Citrate synthase, a non‐glycosylated protein, was used to

demonstrate the chaperoning activity of calreticulin determined by a thermal induced

protein aggregation assay as described in Section 4.7.2. The relative light scattering at

360 nm of each test and control protein was plotted against incubation time for total 1

hour (Figure 5.27). The result showed that the light scattering in the conditions

containing citrate synthase alone and BSA/citrate synthase (molar ratio 1:1) increased

over time. On the other hand, the light scattering in the conditions containing

rOvCALR /citrate synthase molar ratio of 1:1 did not change over time, likewise in

the rMmCALR/citrate synthase that was used as positive control. The light scattering

slightly increased over time when the molar ratio of rOvCALR/ citrate synthase was

changed to 1:2 and 1:4, respectively. This result suggested that rOvCALR suppressed

citrate synthase aggregation at high temperature similar to rMmCALR and suppressed

aggregation completely up to 1 hour at molar ratio of 1:1.

Ref. code: 25605412330010EAN

115

Figure 5.27 Line graph showing protective effect of OvCALR on citrate synthase

(CS) against thermal induced aggregation. Citrate synthase was incubated with or

without rOvCALR at different molar ratios and either BSA or rMmCALR as negative

and positive control, respectively. The measurement was performed at 45°C, and the

light scattering at 360 nm was recorded every 10 min for 1 hour. Error bars represent

standard deviation.

Ref. code: 25605412330010EAN

116

5.6.2 Calcium‐binding activity

Recombinant OvCALR C‐domain in fusion with S. japonicum

glutathione S‐transferase (rSjGST‐OvCALR C‐domain) was used to study calcium‐

binding activity using native PAGE in the presence of either calcium or EDTA

(Figure 5.28). Recombinant F. gigantica calcium‐binding protein 1 (rFgCaBP1) that

carries two calcium‐binding EF‐hands and rSjGST were used as positive and negative

control, respectively. The result showed that a shift in the migration of protein in

native PAGE containing calcium in the system was observed with rOvCALR C‐

domain and readily with rFgCaBP1 that served as positive control, but not with

rSjGST (Figure 5.28).

Figure 5.28 Native PAGE showing shift in the migration of OvCALR in the system

presenting of calcium. Lane 1: rSjGST‐OvCALR C‐domain, Lane 2: positive control

rFgCaBP1, Lane 3: negative control rSjGST. Arrowheads and lines indicate the

location of rSjGST.

Ref. code: 25605412330010EAN

117

5.6.3 Transacetylase activity

Transacetylase activity of calreticulin was indirectly determined by

inhibition of GST in the presence of 7‐Acetoxy‐4‐methylcoumarin (7‐AMC) as a

substrate. The result showed that GST activity was suppressed in the presence of

either rOvCALR or rMmCALR without 7‐AMC and slightly suppressed in the

presence of 7‐AMC alone (Figure 5.29). However, the suppression of GST activity

was enhanced in the combination of calreticulin and 7‐AMC. Further investigation by

immunoblot with antibody against acetylated‐lysine revealed that acetylation of GST

by 7‐AMC occurred without the presence of calreticulin (Figure 5.30A), and GST

without 7‐AMC treatment did not show any detected band (Figure 5.30B). In

addition, direct acetylation by 7‐AMC was observed for BSA and recombinant

F. gigantica calcium‐binding protein 1 (Figure 5.30B).

Ref. code: 25605412330010EAN

118

Figure 5.29 Bar graph showing transacetylase activity of calreticulin determined by

GST activity assay. Recombinant SjGST (0.5 µg) was incubated with either

calreticulin, 7‐AMC (250 µM), or combination of 7‐AMC and calreticulin. GST

activity was measured at 15, 30, and 45 min. GST alone was used to determine

relative GST activity of the treatments at each time point. Data are shown as mean ±

SD relative GST activity (%) and incubation of rSjGST with calreticulin served as

controls. Statistical analysis by two‐way ANOVA with Tukey’s multiple comparison

test; n=3, * p<0.05, ** p<0.01, *** p<0.001 versus control at each time point.

Ref. code: 25605412330010EAN

119

Figure 5.30 Immunoblot detection of protein acetylation by anti‐acetylated lysine

antibody. (A) Recombinant OvCALR (2 µg/lane) and rSjGST (0.5 µg/lane) after

incubation with 50–250 µM 7‐AMC for 40 min; G: GST incubation alone, G/C: GST

incubation with rOvCALR. (B) Other proteins (5 µg/lane) after incubation with or

without 250 µM 7‐AMC for 30 min. Lane M: Broad Range Molecular Weight

Standards (Bio‐Rad, Hercules, CA, USA), lane 1: incubation of rSjGST with 7‐AMC,

lane 2: incubation of rSjGST without 7‐AMC, lane 3: incubation of BSA with 7‐

AMC, lane 4: incubation of rFgCaBP1.

A B

Ref. code: 25605412330010EAN

120

5.6.4 Human C1q binding

Competitive ELISA was used to determine the interaction of

rOvCALR and human C1q. In this assay, mouse calreticulin and BSA were used as

positive and negative competitor, respectively. Binding of rOvCALR was measured

by indirect ELISA using anti‐rOvCALR antibody (Figure 5.31). The result

demonstrated that rOvCALR bound to human C1q in a dose‐dependent manner and

this specific binding was confirmed by rMmCALR, a mammalian calreticulin. Mouse

calreticulin inhibited the binding of rOvCALR to human C1q by competing for the

binding sites on C1q, whereas BSA did not significantly affect the binding of

rOvCALR to human C1q (Figure 5.31).

Figure 5.31 Graph showing human C1q binding of OvCALR obtained by competitive

ELISA. Mean and standard deviation values with fitted curves are shown for 20 ng

C1q incubated with either rOvCALR (0–2 µg), rOvCALR (1 µg)/rMmCALR (0–

2 µg) or rOvCALR (1 µg)/BSA (0–2 µg). Binding of rOvCALR was detected by a

mouse anti‐rOvCALR antiserum.

Ref. code: 25605412330010EAN

121

5.6.5 Inhibition of classical complement pathway

Hemolytic assay of sensitized human red blood cells was used to

determine the effect of rOvCALR against classical complement activation. In this

assay, mouse calreticulin and BSA were used as positive and negative control,

respectively. Pre‐incubated normal human serum with/without tested proteins was

mixed with sensitized red blood cells and observed for hemolysis. Classical

complement‐mediated hemolysis was determined by measuring hemoglobin release at

540 nm. All absorbance values were subtracted with spontaneous hemolysis

absorbance value, and pre‐incubated normal human serum alone was used to calculate

the relative hemolysis of treatments (Figure 5.32). The result showed significant

decrease in relative hemolysis of sensitized red blood cells in the conditions of either

rOvCALR or rMmCALR pre‐incubated normal human serum at 30 and 50 µg amount

of protein. BSA pre‐incubated normal human serum did not show significant decrease

in relative hemolysis at the same concentrations. This result indicated that rOvCALR

suppressed the classical complement‐mediated hemolysis in a dose‐dependent

manner.

Ref. code: 25605412330010EAN

122

Figure 5.32 Bar graph showing effect of rOvCALR against classical complement‐

mediated hemolysis. Data are shown as mean ± SD of relative hemolysis (%) and

normal human serum (NHS) served as a control. Statistical analysis by ANOVA with

Dunnett’s multiple comparison test; n=4, ** p<0.01, *** p<0.001 versus control.

Ref. code: 25605412330010EAN

123

5.6.6 In vitro angiogenic properties

5.6.6.1 Endothelial cell proliferation

MTT assay was used to determine the effect of rOvCALR on

endothelial cell proliferation. In this assay, mouse calreticulin and rSjGST were used

as positive and negative control, respectively. Human umbilical vein endothelial cells

(HUVECs) were grown in the presence of either rSjGST, rMmCALR, or rOvCALR at

different concentrations (0.1–20 µM), and untreated HUVECs were used to calculate

the relative viability of treatments (Figure 5.33). The result showed significant

decrease in relative viability of HUVECs in the conditions presenting of 10 and 20

µM rOvCALR concentration and of 1, 10 and 20 µM rMmCALR concentration.

HUVECs treated with rSjGST did not show significant difference in relative viability

at the same the concentrations. This result indicated that rOvCALR suppressed the

proliferation of HUVECs in a dose‐dependent manner.

Figure 5.33 Bar graph showing effect of rOvCALR on HUVECs proliferation

determined by MTT assay. Data are shown as mean ± SD of relative viability (%) and

rSjGST served as a control. Statistical analysis by two‐way ANOVA with Tukey’s

multiple comparison test; n=6, *** p<0.001 versus control.

Ref. code: 25605412330010EAN

124

5.6.6.2 Endothelial cell migration

Scratch assay, a simple method to measure migration of cells,

was used to study the effect of rOvCALR on HUVECs migration. The scratch was

made and the image was captured before and after incubation with proteins at

different concentrations. Figure 5.34A shows the images of scratches at 0 hour and

24 hour after incubation with either rOvCALR, rMmCALR (positive control), or

rSjGST (negative control). The migration area was measured, and the migration area

of untreated HUVECs was used to calculate relative migration area following

treatment (Figure 5.34B). The result showed significant decrease in relative migration

area of HUVECs in the conditions containing rOvCALR and rMmCALR at 20 and 50

µM concentration. HUVECs treated with rSjGST did not show significant difference

in relative migration area between the concentrations. This result indicated that

rOvCALR suppressed the migration of HUVECs in a dose‐dependent manner.

Ref. code: 25605412330010EAN

125

Figure 5.34 Effect of rOvCALR on HUVECs migration determined by scratch assay.

(A) HUVECs migration patterns captured at 0 h and 24 h of incubation in the

presence of 50 µM either rSjGST, rMmCALR or rOvCALR; scale bar: 250 µm. (B)

Bar graph showing the decrease of relative migration area of HUVECs in the presence

of calreticulin proteins. The migration area was measured by ImageJ software. Data

are shown as mean ± SD of relative migration area (%) and rSjGST served as a

control. Statistical analysis by two‐way ANOVA with Tukey’s multiple comparison

test; n=12, *** p<0.001 versus control.

A

B

Ref. code: 25605412330010EAN

126

5.6.6.3 Endothelial cell sprouting

Tube formation assay using Matrigel as an extracellular

basement membrane matrix for endothelial cell sprouting was used to study the effect

of rOvCALR on the sprouting of HUVECs. Figure 5.35A shows the tube‐like

structures formed by HUVECs following incubation with either PBS, rOvCALR,

rMmCALR (positive control), or rSjGST (negative control). HUVECs treated with

rSjGST showed sprouting comparable to untreated HUVECs (PBS), whereas

HUVECs treated with calreticulin showed less sprouting particularly at 50 µM

concentration. The tube length was measured by ImageJ angiogenesis analyzer, and

the tube length of untreated HUVECs (PBS) was used to calculate relative tube length

of treatments (Figure 5.35B). The result showed significant decrease in relative tube

length of HUVECs‐formed tube‐like structure in the conditions containing rOvCALR

and rMmCALR at 20 and 50 µM concentration. HUVECs treated with rSjGST did

not show significant difference in relative tube length between the concentrations.

This result indicated that rOvCALR suppressed the sprouting of HUVECs in a dose‐

dependent manner.

Ref. code: 25605412330010EAN

127

Figure 5.35 Effect of rOvCALR on HUVECs sprouting determined by tube formation

assay. (A) Tube‐like structure formation by HUVECs after incubated with proteins for

18 hour; scale bar: 250 µm. (B) Bar graph showing the decrease of relative tube

length of HUVECs‐formed tube‐like structure in the presence of calreticulin proteins.

Data are shown as mean ± SD of relative tube length (%) and rSjGST served as a

control. Statistical analysis by two‐way ANOVA with Tukey’s multiple comparison

test; n=6, * p<0.05, ** p<0.01, *** p<0.001 versus control.

A

B

Ref. code: 25605412330010EAN

128

CHAPTER 6

DISCUSSION

The present study elucidates molecular sequence, expression, distribution,

and functional roles of O. viverrini calreticulin to demonstrate how important it is

inside and outside the parasite, particularly in the host‐parasite interplay. This study

started with molecular cloning of OvCALR from adult parasite total RNA using

reverse transcription PCR that revealed the 1,248 bp open reading frame of the

OvCALR cDNA. The deduced amino acid sequence of OvCALR carries the

conserved calreticulin family signature 1 as well as the signature 2 with one amino

acid miss‐match, isoleucine in mammalian CALR is replaced by phenylalanine in

O. viverrini (Figure 5.5). This miss‐match is also found in the closely related species,

C. sinensis, however, phenylalanine has a hydrophobic sidechain like isoleucine. In

addition, the presence of other calreticulin characteristics in the OvCALR amino acid

sequence indicates that OvCALR is a novel member of the calreticulin family. These

characteristics are a N-terminal signal peptide, a C-terminal ER retention signal, three

structural domains (N‐, P‐, and C‐domain), three conserved cysteine residues, two of

which are used for disulfide bridge forming, and three each of two tandem repeated

motifs. At least two isoforms of calreticulin have been reported in higher plants83

and

animals, while only one isoform has been reported in lower animals87

. The published

O. viverrini genome data contains only one calreticulin gene.183

Recombinant OvCALR was expressed using bacterial systems and used

for functional studies and antibody production. At first, rOvCALR was expressed in

E. coli M15, it was already present since the first hour of IPTG induction but was

insoluble (Figure 5.6), whereas recombinant MmCALR, the selected positive control

for functional studies, could not be expressed at all at identical conditions (data not

shown). Moreover, the bacterial growth as observed by OD600 stopped after IPTG

induction, indicating that expression of MmCALR was toxic for E. coli M15.

Eventually, rOvCALR and rMmCALR were expressed as soluble proteins in E. coli

Rosetta‐gami(DE3)pLysS and purified by affinity chromatography. The purified

rOvCALR was used to produce polyclonal anti‐rOvCALR antibodies in mice, and the

Ref. code: 25605412330010EAN

129

obtained antisera were evaluated for specificity and titer against rOvCALR by indirect

ELISA. Because calreticulin is an immunodominant antigen184,185

, the obtained

antisera from three mice showed high specific antibody levels after first boosting by

immunization with crushed polyacrylamide gel as adjuvant (Figure 5.17).

The expression level of OvCALR RNA during development in the

experimental mammalian host (Mesocricetus auratus) was comparable high in 2‐, 4‐,

and 8‐week‐old parasites but RNA was less abundant in newly excysted juveniles

(Figure 5.19). The western analyses of parasite antigen extracts using anti‐rOvCALR

antisera revealed the presence of OvCALR in soluble and insoluble crude worm

extracts as well as excretory/secretory (ES) product of adult parasites (Figures 5.21

and 5.22) demonstrating that calreticulin is not only an intracellular but also an

extracellular protein. Calreticulin has been detected as soluble molecule in sera of

patients with autoimmune diseases186-188

and in parasite ES product189,190

.

Interestingly, the intensity of detected OvCALR was readily comparable in soluble

crude worm extract and ES product, while it was faint in insoluble crude worm extract

at the same total amount of protein. This result suggests that OvCALR is mainly

present as soluble protein with functions in- and outside of the parasite. Anomalous

migration of native OvCALR, rOvCALR, and rMmCALR in SDS‐PAGE, which was

slower than expected from their calculated molecular mass, had previously been

observed for mammalian calreticulin and was explained by its highly disorder in the

P‐domain and highly acidic character of the C‐domain leading to poor SDS-binding

and retaining of its tertiary structure.61,191

The cross‐reactivity between human anti‐

Onchocerca volvulus calreticulin in sera from patients with onchocerciasis and

autoantigen153,154

as well as between the sera of patients with systemic lupus

erythematosus and recombinant S. mansoni calreticulin192

has been reported. In this

study, the raised mouse anti‐rOvCALR antiserum specifically recognized native

OvCALR and rOvCALR C‐domain in fusion with GST but not rMmCALR,

indicating the lacking of cross‐reactivity between OvCALR and MmCALR that

shares 50% identity in their amino acid sequences. The immunohistochemical staining

by anti‐rOvCALR antiserum showed that OvCALR was widely distributed in adult

parasite tissue including tegumental cell bodies, cecal epithelium and particularly in

the genital organs (Figure 5.23). Similar findings were also observed in the tissue

Ref. code: 25605412330010EAN

130

distribution of calreticulin in S. mansoni76

and T. solium159

. The staining of

gametocytes in the gonads suggests a role of OvCALR in spermatogenesis and

oogenesis as well as in eggshell formation12

since the staining was also found in the

Mehlis’ gland, and vitelline cells. Interestingly, spermatogenic cells in the testes

showed intense staining, while the staining was absent in the spermatozoa found in

seminal vesicles and seminal receptacle (Figure 5.23). This finding might correlate

with the lack of an endoplasmic reticulum in mature spermatozoa.193

Moreover,

differential expression of OvCALR in eggs in different regions of the uterus was

found to correlate with embryogenesis12

. The developing miracidia found in the eggs

of the middle uterus showed high OvCALR expression while OvCALR was absent in

the fully mature miracidia found in the eggs of the distal uterus. This result suggests a

role of OvCALR during embryogenesis in O. viverrini. Overall, intense

immunostaining was found in highly active cells either undergoing rapid cell

divisions or with high protein output for example, gametocyte during gametogenesis,

fertilized egg during embryogenesis, and secretory cells. This might be correlated to

the conserved major role of calreticulin in protein/glycoprotein chaperoning in the

ER. Continuous tegumental membrane reparation194

, protease secretion from cecal

epithelium195-197

, and massive secretion from accessory glands to support the

unremitting reproductive process12

can explain the high expression of OvCALR in

these tissues. The low abundance of OvCALR RNA in the newly excysted juvenile

can be explained with the absence of developed reproductive organs198

(Figure 5.19).

This result corresponds to those findings in 18 h schistosomula and cercariae of

S. mansoni.76

Although OvCALR was detected in the ES product of the parasite and

rOvCALR recognized by O. viverrini‐infected hamster sera (Figures 5.25 and 5.26),

it was not detected in the liver tissue of O. viverrini‐infected hamster by anti‐

rOvCALR antiserum (Figures 5.24 and 5.25). Immunostaining of the host tissue at

least at the bile duct epithelium has been observed for other O. viverrini proteins, e.g.

granulin‐like growth factor5, tetraspanins

199, and cathepsin F cysteine protease

197. The

mechanism of internalization of parasite antigens by cholangiocytes is still not

clear.200

However, immunostaining of host tissue using an antiserum against

O. viverrini ES product demonstrated that released parasite antigens infiltrate

neighboring host tissue (Figure 5.25). Recently, the internalization of extracellular

Ref. code: 25605412330010EAN

131

vesicles secreted by O. viverrini and promoting proliferation of cholangiocytes has

been reported. The vesicles were found to contain various proteins, e.g. tetraspanins,

calcium‐binding proteins, and cathepsin D.201

OvCALR was not reported and it can be

assumed that it is released through an unrelated pathway. Unlike the antibody

responses against ES and somatic antigens of O. viverrini that were readily observed

after four weeks of infection202

, the response against rOvCALR was first detected in

hamster sera eight weeks after infection (Figure 5.26) indicating release of OvCALR

from mature parasites. The protein might be released from the reproductive system of

adult parasites.

Calreticulin plays a major role as soluble ER chaperone by binding to

monoglucosylated N‐linked oligosaccharides via its lectin site.104

However, it has

been reported that it can interact with non‐glycosylated proteins via its overlapping

polypeptide‐binding and lectin sites.97,180

In vitro protein aggregation assay, which has

been used to demonstrate the protective effect of calreticulin from various organisms

against thermal induced protein/glycoprotein aggregation174,203

was used to determine

chaperoning activity of rOvCALR. Recombinant OvCALR can protect citrate

synthase, a non‐glycosylated protein, from aggregation at high temperature similar to

rMmCALR (Figure 5.27) suggesting the capability of OvCALR as ER chaperone.

Mutagenesis180

and deletion‐analysis204

of calreticulin suppressing protein

aggregation have been used to map the polypeptide‐binding site on the globular lectin

domain including the N‐domain and proximal region of the C‐domains indicating the

correct folding of rOvCALR in the required globular domain. Additionally, multiple

alignment of calreticulin sequences revealed high sequence conservation of residues

participating in carbohydrate‐ and polypeptide‐binding as well as ERp57‐binding,

which is a co‐chaperone (Figure 5.5)97,180,181

, supporting the conserved chaperoning

property in OvCALR and other trematode orthologs.

The binding of calcium to maintain calcium homeostasis inside the ER is

another important role of calreticulin. Calreticulin contains a single high‐affinity, low‐

capacity calcium‐binding site within the globular domain and multiple low‐affinity,

high‐capacity calcium‐binding sites within the C‐domain.97,99

The low‐affinity, high‐

capacity calcium‐binding C‐domain of OvCALR in fusion with S. japonicum

glutathione S‐transferase (SjGST) was demonstrated to bind calcium resulting in

Ref. code: 25605412330010EAN

132

migration shifting on native‐PAGE (Figure 5.28). Calreticulin C-domain lacks high‐

affinity calcium‐binding EF‐hand motifs that are found in F. gigantica calcium‐

binding protein 1 (FgCaBP1) and binds calcium through its acidic amino acid

cluster.99

Hence, rOvCALR C‐domain required the presence of calcium in the

electrophoresis running buffer to show calcium-binding (data not shown), which

supports the low affinity binding reported in mammalian calreticulin.99,205

The C‐

domains of human calreticulin (HsCALR) and OvCALR have only 33% sequence

identity and OvCALR carries a smaller number of acidic residues (33.0%) than

HsCALR (42.6%). The high‐affinity, low‐capacity calcium‐binding property of

OvCALR was not analyzed in this study. However, multiple alignment of calreticulin

sequences showed conservation of the involved residues Gln26, Lys62, Lys64 that

provide backbone carbons and high conservation of Asp328 that provides the side

chain to form high‐affinity calcium‐binding site (Figure 5.5)98

, suggesting that high

affinity calcium‐binding is conserved in trematode calreticulins.

Calreticulin transacetylase (CRTase), an activity to transfer acetyl group

from polyphenolic acetates to certain receptor molecule, is a novel characterized

function of calreticulin mapped in the P‐domain.206,207

The possible receptor proteins

including GST, nitric oxide synthase (NOS), NADPH cytochrome c reductase

(CYPR), cytochrome P450 and various substrates including acetoxycoumarins and

acetyl coenzyme A have been identified for CRTase.208

Calreticulin‐mediated GST

acetylation resulting in reduction of GST activity has been developed as an indirect

measurement of CRTase activity.209

Transacetylase activity of rOvCALR was

analyzed by the same assay using 7‐Acetoxy‐4‐methylcoumarin (7‐AMC) as

substrate210-212

. Unlike calreticulin of H. contortus with its previously demonstrated

CRTase activity through inhibition of GST activity176,207

, both of rOvCALR and

rMmCALR demonstrated suppression of GST activity without the presence of 7‐

AMC (Figure 5.30A) and direct acetylation by 7‐AMC was observed in various

tested proteins (Figure 5.30B). The loss of GST activity might be explained by the

direct acetylation of GST by 7‐AMC and the direct interaction between GST and

calreticulin by its chaperoning function.

The complement system is a part of the innate immune system of the host

defense against common pathogenic infection. C1q is the complement component that

Ref. code: 25605412330010EAN

133

recognizes antigen‐bound antibodies and initiates classical complement pathway

activation. Recombinant OvCALR demonstrated human C1q binding as shown by

competitive ELISA with rMmCALR (Figure 5.31). In addition, rOvCALR inhibited

C1q‐mediated hemolysis of sensitized red blood cells (Figure 5.32) as previously

shown for human calreticulin.213

This is the first time to demonstrate the suppression

of human C1q‐mediated hemolysis of sensitized human red blood cells by a trematode

calreticulin. Interestingly, the inhibition effect of rOvCALR was significant stronger

than that of rMmCALR. C1q binding region has been mapped in the N‐ and P‐

domains of calreticulin213

, and the specific binding sites have been identified in

human calreticulin including IESKHKSDF, DEEKDFG, KDIRCKDD and

WDERAKID.182

Some motifs of HsCALR C1q binding sequence are absent or altered

in OvCALR and other trematode orthologs (Figure 5.5), however, the most conserved

motif is KEVRCKDD, which is KDIRCKDD in HsCALR that has been shown to

bind excellently to the globular head of C1q and inhibit complement‐mediated

hemolytic activity.182

Similarly, the absence of some HsCALR C1q binding motifs is

also observed in the H. contortus calreticulin sequence; nevertheless, two additional

binding sites mapped in the N‐domain of HcCALR have been identified.214

In case of

OvCALR, it might carry other unidentified C1q binding sites different from HsCALR

resulting in the stronger hemolytic inhibition. However, a difference in folding quality

of the recombinant proteins cannot be excluded but then again a significant difference

in chaperoning activity was not observed between rOvCALR and rMmCALR (Figure

5.27). Parasite interaction with the host complement is a double‐edged sword; killing

of parasites by complement system has been shown in various parasites including

O. viverrini215,216

but on the other side, mechanisms for host immune evasion and

infectivity have been reported as well.217

Accordingly, human C1q binding and

suppression of classical complement activation through OvCALR might support

parasite survival and decrease the consequences of complement activation including

the membrane‐attack complex (MAC) formation. The ability of parasite calreticulin to

bind to host C1q and inhibit C1q‐mediated hemolysis are found in various parasites

including T. cruzi142

, N. americanus73

, Trichinella spiralis218

indicating a conserved

function for host immune evasion and survival. The binding of calreticulin is not

limited only to the collagen‐like fragments but also takes place at the globular heads

Ref. code: 25605412330010EAN

134

of C1q.219

Hence, the binding of parasite calreticulin to the globular region of C1q

might affect to Fc receptor‐mediated phagocytosis220

as well as apoptotic cell

clearance221,222

of the host. Concerning the effect of C1q on tumor growth, there are

both positive and negative effects on tumor growth that have been reported depending

on the studied type of tumor. However, the presence of C1q in the microenvironment

of solid tumors growth has been reported with independent‐classical pathway

activation.223

This finding supports the upregulation of C1q during O. viverrini

infection induced CCA in hamster.224

The relationship between OvCALR and C1q‐

mediated tumor growth needs to be further investigated as well as any direct effect of

OvCALR on CCA development. Nevertheless, the angiogenic properties of OvCALR

have been investigated in this study. Recombinant OvCALR significantly suppressed

in vitro proliferation, migration, and sprouting of human endothelial cells similar to

rMmCALR but at lesser potency (Figures 5.33, 5.34, and 5.35) suggesting a role of

OvCALR as angiogenesis inhibitor. This finding is supported by the highly conserved

sequence of the peptide vasostatin134

present in the OvCALR sequence as well as in

other trematode orthologs (Figure 5.5).

Calreticulin is a well‐researched multifunctional protein involved in

various physiological and pathological conditions and has been highlighted since it

was found in a wide variety of cells and organisms. This study of calreticulin of

O. viverrini demonstrated the conservation of the basic properties of calreticulin

including chaperoning and calcium‐binding activities. OvCALR was detected in all

developmental stages in the host and found to be widely distributed in the mature

parasite especially in the reproductive organs indicating an important role in parasite

development and reproduction. It could be anticipated that suppression of OvCALR

will affect to parasite development and survival. However, calreticulin deficiency

observed in C. elegans demonstrated only a defect in reproduction in adult worms but

not embryonic lethality203

as reported in calreticulin‐deficient mouse.225

In addition,

compensation by upregulation of other proteins including heat shock protein‐70

family members (hsp70) and disulfide isomerase (PDI) as alternative chaperons was

found in calreticulin-deficient C. elegans.226

Similarly, the embryonic lethality found

in calreticulin‐deficient mouse was caused by cardiac development failure but other

embryonic organs were found to be normal developed suggesting that the lethal effect

Ref. code: 25605412330010EAN

135

resulted from calcium buffering but not chaperoning activity of calreticulin.94,225

The

additional investigation in calreticulin-deficient O. viverrini can benefit our

understanding on its importance for the parasite and eventually provide a new parasite

control strategy. The presence of OvCALR in the parasite ES product indicates that

the role of calreticulin is not limited to the ER as soluble calcium‐binding chaperone.

OvCALR is a parasite‐secreted antigen with potential to modulate the host immune

system through its C1q binding property as well as to intervene host angiogenesis via

its anti‐angiogenic properties. These host‐modulating properties found in OvCALR

might facilitate host immune evasion for their survival and indirectly affect to CCA

development, suppressing tumor growth via angiogenesis inhibition and C1q‐

mediated tumor growth.

Ref. code: 25605412330010EAN

136

CHAPTER 7

CONCLUSIONS

This section concludes molecular, biochemical, and biological properties

of the analyzed Opisthorchis viverrini calreticulin (OvCALR). The major findings are

summarized as follows:

1. In this study, OvCALR has been characterized. The complete coding

sequence of the OvCALR cDNA comprises 1,248 bp and encodes the 415 amino

acids pre‐mature OvCALR. The 399 amino acids mature OvCALR has a calculated

molecular weight of 46.23 kDa and a theoretical isoelectric point of 4.3.

2. The deduced amino acid sequence of OvCALR contains many

characteristics of calreticulin including the conserved calreticulin family signature 1

and 2, a 16‐amino‐acid‐residue signal peptide, an His‐Glu‐Glu‐Leu (HEEL) ER

retention signal, three functional and structural domains (N‐, P‐, and C‐domain), three

conserved cysteine residues, and three each of two tandem repeated motifs.

3. The deduced amino acid sequence of OvCALR has very high

sequence conservation at 96.6% identity to C. sinensis calreticulin and significantly

less to blood fluke calreticulin, S. mansoni (57.5%) and S. japonicum (53.6%), and

mammalian calreticulin, M. musculus (50.7%) and H. sapiens (50.9%), respectively.

4. A multiple amino acid sequence alignment of OvCALR and

calreticulin from other species showed high conservation in the P‐domain and less

conservation at the beginning of the N‐domain and almost all of the C‐domain. The

carbohydrate‐, peptide‐, ERp57‐binding sites involved in chaperoning activity, the

high‐affinity calcium‐binding site, and anti‐angiogenic vasostatin sequence based on

mammalian calreticulin were found highly conserved in the OvCALR sequence.

5. Soluble recombinant OvCALR and MmCALR were produced using a

bacterial system comprising expression vector pET21b(+) and host strain E. coli

Rosetta‐gami(DE3)pLysS and purified by Ni‐NTA affinity chromatography.

6. Mouse polyclonal anti‐rOvCALR antisera were produced and the

obtained antisera showed high antibody level and high specificity against rOvCALR

Ref. code: 25605412330010EAN

137

and rSjGST‐OvCALR C‐domain. Additionally, the antisera did not show cross‐

reactivity with rMmCALR.

7. OvCALR RNA was found in all analyzed developmental stages

including newly excysted, 2‐week‐old, 4‐week‐old juveniles and adult O. viverrini but

at lower abundance in newly excysted juveniles.

8. Native OvCALR was mainly detected as soluble protein and as a

released protein in the excretory/secretory product of the adult parasite.

9. Native OvCALR was found widely distributed in the adult parasite

including tegumental cell bodies, cecal epithelium, gametocytes in testes and ovary,

prostate gland, Mehlis’ gland, vitelline cells, eggs, and lining of seminal vesicle. It

was not detected infiltrating liver tissue of O. viverrini‐infected hamster.

10. Recombinant OvCALR was recognized by O. viverrini‐infected

hamster sera indicating the antigenic property of the protein.

11. Recombinant OvCALR protected citrate synthase from in vitro

thermal‐induced aggregation similar to rMmCALR indicating its chaperoning

property.

12. Recombinant OvCALR C‐domain in fusion with SjGST showed a

mobility shift in native‐PAGE in the presence of calcium indicating its calcium‐

binding property.

13. Recombinant OvCALR did not show transacetylase activity by

indirect GST inhibition with 7‐Acetoxy‐4‐methylcoumarin (7‐AMC) as substrate. In

addition, western blot analysis using anti‐acetylated lysine antibody demonstrated

direct acetylation by 7‐AMC in various proteins.

14. Recombinant OvCALR bound to human C1q in a dose‐dependent

manner and inhibited classical complement pathway‐mediated hemolysis of

sensitized‐human red blood cells similar to rMmCALR.

15. Recombinant OvCALR suppressed proliferation, migration, and

sprouting of human endothelial cells in vitro indicating its anti‐angiogenic properties.

Ref. code: 25605412330010EAN

138

REFERENCES

1. Kaewpitoon N, Kootanavanichpong N, Kompor P, Chavenkun W, Kujapun J,

Norkaew J, et al. Review and current status of Opisthorchis viverrini infection at the

community level in Thailand. Asian Pac J Cancer Prev. 2015;16(16):6825-30. doi:

10.7314/APJCP.2015.16.16.6825. PubMed PMID: 26514452.

2. WHO, International Agency for Research on Cancer Monograph Working

Group. A review of human carcinogens Part B: Biological agents [internet]. IARC:

Lyon (France); 2012 (cited 2018 Mar 13). Available from:

http://monographs.iarc.fr/ENG/Monographs/vol100B/mono100B-13.pdf.

3. Jongsuksuntigul P, Imsomboon T. Opisthorchiasis control in Thailand. Acta

Trop. 2003;88(3):229-32. doi: 10.1016/j.actatropica.2003.01.002. PubMed PMID:

14611877.

4. Anderson CD, Pinson CW, Berlin J, Chari RS. Diagnosis and treatment of

cholangiocarcinoma. Oncologist. 2004;9(1):43-57. doi: 10.1634/theoncologist.9-1-43

PubMed PMID: 14755014.

5. Smout MJ, Laha T, Mulvenna J, Sripa B, Suttiprapa S, Jones A, et al. A

granulin-like growth factor secreted by the carcinogenic liver fluke, Opisthorchis

viverrini, promotes proliferation of host cells. PLoS Pathog. 2009;5(10):e1000611.

doi: 10.1371/journal.ppat.1000611. PubMed PMID: 19816559.

6. Papatpremsiri A, Smout MJ, Loukas A, Brindley PJ, Sripa B, Laha T.

Suppression of Ov-grn-1 encoding granulin of Opisthorchis viverrini inhibits

proliferation of biliary epithelial cells. Exp Parasitol. 2015;148:17-23. doi:

10.1016/j.exppara.2014.11.004. PubMed PMID: 25450776.

7. Keiser J, Utzinger J. Food-borne trematodiases. Clin Microbiol Rev.

2009;22(3):466-83. doi: 10.1128/CMR.00012-09. PubMed PMID: 19597009.

8. Kaewkes S. Taxonomy and biology of liver flukes. Acta Trop.

2003;88(3):177-86. doi: 10.1016/j.actatropica.2003.05.001. PubMed PMID:

14611872.

9. Sripa B, Kaewkes S, Intapan PM, Maleewong W, Brindley PJ. Food-borne

trematodiases in Southeast Asia epidemiology, pathology, clinical manifestation and

Ref. code: 25605412330010EAN

139

control. In: Rollinson D, Stothard JR, editors. Advances in Parasitology. Important

helminth infections in Southeast Asia: diversity and potential for control and

elimination, part A. 72. London: Academic Press; 2010. p. 305-50.

10. Upatham ES. A review of experimental and field research on the human liver

fluke, Opisthorchis viverrini. JSciSocThailand. 1988;14:245-62.

11. Schuster RK. Opisthorchiidosis--a review. Infect Disord Drug Targets.

2010;10(5):402-15. doi: 10.2174/187152610793180902. PubMed PMID: 20701569.

12. Khampoosa P, Jones MK, Lovas EM, Srisawangwong T, Laha T, Piratae S, et

al. Light and electron microscopy observations of embryogenesis and egg

development in the human liver fluke, Opisthorchis viverrini (Platyhelminthes,

Digenea). Parasitol Res. 2012;110(2):799-808. doi: 10.1007/s00436-011-2557-3.


13. King S, Scholz T. Trematodes of the family Opisthorchiidae: a minireview.

Korean J Parasitol. 2001;39(3):209-21. doi: 10.3347/kjp.2001.39.3.209. PubMed

PMID: 11590910.

14. Wykoff DE, Harinasuta C, Juttijudata P, Winn MM. Opisthorchis viverrini in

Thailand: the life cycle and comparison with O. felineus. J Parasitol. 1965;51:207-14.

doi: 10.2307/3276083 PubMed PMID: 14275209.

15. Harinasuta C, Harinasuta T. Opisthorchis viverrini: life cycle, intermediate

hosts, transmission to man and geographical distribution in Thailand.

Arzneimittelforschung. 1984;34(9B):1164-7. PubMed PMID: 6542383.

16. Wongsaroja T, Nithikathkulb C, Rojkitikulc W, Nakaia W, Royal L,

Rammasutc P. National survey of helminthiasis in Thailand. Asian Biomedicine.

2014;8(6):779-83. doi: 10.5372/1905-7415.0806.357.

17. Thaewnongiew K, Singthong S, Kutchamart S, Tangsawad S, Promthet S,

Sailugkum S, et al. Prevalence and risk factors for Opisthorchis viverrini infections in

upper Northeast Thailand. Asian Pac J Cancer Prev. 2014;15(16):6609-12. doi:

10.7314/APJCP.2014.15.16.6609. PubMed PMID: 25169496.

18. Saengsawang P, Promthet S, Bradshaw P. Prevalence of OV infection in

Yasothon Province, Northeast Thailand. Asian Pac J Cancer Prev. 2012;13(7):3399-

402. doi: 10.7314/APJCP.2012.13.7.3399. PubMed PMID: 22994767.

Ref. code: 25605412330010EAN

140

19. Rim HJ, Chai JY, Min DY, Cho SY, Eom KS, Hong SJ, et al. Prevalence of

intestinal parasite infections on a national scale among primary schoolchildren in

Laos. Parasitol Res. 2003;91(4):267-72. doi: 10.1007/s00436-003-0963-x. PubMed

PMID: 14574555.

20. Sayasone S, Odermatt P, Phoumindr N, Vongsaravane X, Sensombath V,

Phetsouvanh R, et al. Epidemiology of Opisthorchis viverrini in a rural district of

southern Lao PDR. Trans R Soc Trop Med Hyg. 2007;101(1):40-7. doi:

10.1016/j.trstmh.2006.02.018. PubMed PMID: 16828134.

21. Sayasone S, Mak TK, Vanmany M, Rasphone O, Vounatsou P, Utzinger J, et

al. Helminth and intestinal protozoa infections, multiparasitism and risk factors in

Champasack province, Lao People's Democratic Republic. PLoS Negl Trop Dis.

2011;5(4):e1037. doi: 10.1371/journal.pntd.0001037. PubMed PMID: 21532735.

22. Chai JY, Han ET, Shin EH, Sohn WM, Yong TS, Eom KS, et al. High

prevalence of Haplorchis taichui, Phaneropsolus molenkampi, and other helminth

infections among people in Khammouane province, Lao PDR. Korean J Parasitol.

2009;47(3):243-7. doi: 10.3347/kjp.2009.47.3.243. PubMed PMID: 19724697.

23. Chai JY, Han ET, Guk SM, Shin EH, Sohn WM, Yong TS, et al. High

prevalence of liver and intestinal fluke infections among residents of Savannakhet

Province in Laos. Korean J Parasitol. 2007;45(3):213-8. doi:

10.3347/kjp.2007.45.3.213. PubMed PMID: 17876167.

24. Yoon HJ, Ki M, Eom K, Yong TS, Chai JY, Min DY, et al. Risk factors for

Opisthorchis viverrini and minute intestinal fluke infections in Lao PDR, 2009-2011.

Am J Trop Med Hyg. 2014;91(2):384-8. doi: 10.4269/ajtmh.13-0596. PubMed PMID:

24980495.

25. Sithithaworn P, Andrews RH, Nguyen VD, Wongsaroj T, Sinuon M, Odermatt

P, et al. The current status of opisthorchiasis and clonorchiasis in the Mekong Basin.

Parasitol Int. 2012;61(1):10-6. doi: 10.1016/j.parint.2011.08.014. PubMed PMID:

21893213.

26. Lee KJ, Bae YT, Kim DH, Deung YK, Ryang YS, Kim HJ, et al. Status of

intestinal parasites infection among primary school children in Kampongcham,

Cambodia. Korean J Parasitol. 2002;40(3):153-5. doi: 10.3347/kjp.2002.40.3.153.


Ref. code: 25605412330010EAN

141

27. Yong TS, Chai JY, Sohn WM, Eom KS, Jeoung HG, Hoang EH, et al.

Prevalence of intestinal helminths among inhabitants of Cambodia (2006-2011).


PMID: 25548418.

28. Yong TS, Shin EH, Chai JY, Sohn WM, Eom KS, Lee DM, et al. High

prevalence of Opisthorchis viverrini infection in a riparian population in Takeo

Province, Cambodia. Korean J Parasitol. 2012;50(2):173-6. doi:

10.3347/kjp.2012.50.2.173. PubMed PMID: 22711932.

29. WHO. Review on the epidemiological profile of helminthiases and their

control in the Western Pacific region, 1997-2008 [Internet]. MVP/WPRO, Western

Pacific Regional Office, World Health Organization. 2008 [cited 2018 Mar 13].

Available from: http://www.wpro.who.int/mvp/documents/docs/Helminths10Year

Review_reformattedv2_.pdf?ua=1.

30. Dao TT, Bui TV, Abatih EN, Gabriel S, Nguyen TT, Huynh QH, et al.

Opisthorchis viverrini infections and associated risk factors in a lowland area of Binh

Dinh Province, Central Vietnam. Acta Trop. 2016;157:151-7. doi:

10.1016/j.actatropica.2016.01.029. PubMed PMID: 26872984.

31. Mairiang E, Mairiang P. Clinical manifestation of opisthorchiasis and

treatment. Acta Trop. 2003;88(3):221-7. doi: 10.1016/j.actatropica.2003.03.001.


32. Sripa B, Kaewkes S, Sithithaworn P, Mairiang E, Laha T, Smout M, et al.

Liver fluke induces cholangiocarcinoma. PLoS Med. 2007;4(7):e201. doi:

10.1371/journal.pmed.0040201. PubMed PMID: 17622191.

33. Worasith C, Kamamia C, Yakovleva A, Duenngai K, Wangboon C,

Sithithaworn J, et al. Advances in the diagnosis of human opisthorchiasis:

development of Opisthorchis viverrini antigen detection in urine. PLoS Negl Trop

Dis. 2015;9(10):e0004157. doi: 10.1371/journal.pntd.0004157. PubMed PMID:

26485024.

34. Wongratanacheewin S, Sermswan RW, Sirisinha S. Immunology and

molecular biology of Opisthorchis viverrini infection. Acta Trop. 2003;88(3):195-

207. doi: 10.1016/j.actatropica.2003.02.002. PubMed PMID: 14611874.

Ref. code: 25605412330010EAN

142

35. Poopyruchpong N, Viyanant V, Upatham ES, Srivatanakul P. Diagnosis of

opisthorchiasis by enzyme-linked immunosorbent assay using partially purified

antigens. Asian Pac J Allergy Immunol. 1990;8(1):27-31. PubMed PMID: 2393450.

36. Wongsaroj T, Sakolvaree Y, Chaicumpa W, Maleewong W, Kitikoon V,

Tapchaisri P, et al. Affinity purified oval antigen for diagnosis of Opisthorchiasis

viverrini. Asian Pac J Allergy Immunol. 2001;19(4):245-58. PubMed PMID:

12009074.

37. Duenngai K, Sithithaworn P, Rudrappa UK, Iddya K, Laha T, Stensvold CR,

et al. Improvement of PCR for detection of Opisthorchis viverrini DNA in human

stool samples. J Clin Microbiol. 2008;46(1):366-8. doi: 10.1128/JCM.01323-07.


38. Le TH, Van De N, Blair D, Sithithaworn P, McManus DP. Clonorchis sinensis

and Opisthorchis viverrini: development of a mitochondrial-based multiplex PCR for

their identification and discrimination. Exp Parasitol. 2006;112(2):109-14. doi:

10.1016/j.exppara.2005.09.012. PubMed PMID: 16310774.

39. Sato M, Thaenkham U, Dekumyoy P, Waikagul J. Discrimination of O.

viverrini, C. sinensis, H. pumilio and H. taichui using nuclear DNA-based PCR

targeting ribosomal DNA ITS regions. Acta Trop. 2009;109(1):81-3. doi:


40. Arimatsu Y, Kaewkes S, Laha T, Hong SJ, Sripa B. Rapid detection of

Opisthorchis viverrini copro-DNA using loop-mediated isothermal amplification

(LAMP). Parasitol Int. 2012;61(1):178-82. doi: 10.1016/j.parint.2011.08.009.


41. Arimatsu Y, Kaewkes S, Laha T, Sripa B. Specific diagnosis of Opisthorchis

viverrini using loop-mediated isothermal amplification (LAMP) targeting parasite

microsatellites. Acta Trop. 2015;141(Pt B):368-71. doi:


42. WHO. Foodborne trematode infections Opisthorchiasis [Internet]. WHO. 2018

[cited 2018 Mar 16]. Available from:

www.who.int/foodborne_trematode_infections/opisthorchiasis/Opisthorchiasis_viverr

ini/en/.

Ref. code: 25605412330010EAN

143

43. Sayasone S, Keiser J, Meister I, Vonghachack Y, Xayavong S, Senggnam K,

et al. Efficacy and safety of tribendimidine versus praziquantel against Opisthorchis

viverrini in Laos: an open-label, randomised, non-inferiority, phase 2 trial. Lancet

Infect Dis. 2018;18(2):155-61. doi: 10.1016/S1473-3099(17)30624-2. PubMed

PMID: 29153938.

44. Soukhathammavong P, Odermatt P, Sayasone S, Vonghachack Y, Vounatsou

P, Hatz C, et al. Efficacy and safety of mefloquine, artesunate, mefloquine-artesunate,

tribendimidine, and praziquantel in patients with Opisthorchis viverrini: a

randomised, exploratory, open-label, phase 2 trial. Lancet Infect Dis. 2011;11(2):110-

8. doi: 10.1016/S1473-3099(10)70250-4. PubMed PMID: 21111681.

45. Duthaler U, Sayasone S, Vanobbergen F, Penny MA, Odermatt P, Huwyler J,

et al. Single-ascending-dose pharmacokinetic study of tribendimidine in Opisthorchis

viverrini-infected patients. Antimicrob Agents Chemother. 2016;60(10):5705-15. doi:

10.1128/AAC.00992-16. PubMed PMID: 27431234.

46. Pongnikorn D, Suwanrungruang K, Buasom R. Cancer incidence in Thailand.

In: Imsamran W, Chaiwerawattana A, Wiangnon S, Pongnikorn D, Suwanrungrung

K, Sangrajrang S, et al., editors. Cancer in Thailand VIII, 2010-2012. 8. Bangkok:

New Thammada Press (Thailand) Co., Ltd.; 2015. p. 5-72.

47. Bundhamcharoen K, Odton P, Phulkerd S, Tangcharoensathien V. Burden of

disease in Thailand: changes in health gap between 1999 and 2004. BMC Public

Health. 2011;11:53. doi: 10.1186/1471-2458-11-53. PubMed PMID: 21266087.

48. Attasara P, Sriplung H. Cancer incidence in Thailand. In: Khuhaprema T,

Attasara P, Sriplung H, Wiangnon S, Sangrajrang S, editors. Cancer in Thailand

Volume VII, 2007-2009. Bangkok: Ministry of Public Health; 2013. p. 8-73.

49. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer

statistics. CA Cancer J Clin. 2011;61(2):69-90. doi: 10.3322/caac.20107. PubMed

PMID: 21296855.

50. Bragazzi MC, Cardinale V, Carpino G, Venere R, Semeraro R, Gentile R, et

al. Cholangiocarcinoma: Epidemiology and risk factors. Transl Gastrointest Cancer.

2012;1:21-32. doi: 10.3978/j.issn.2224-4778.2011.11.04. PubMed PMID:

51. Bridgewater J, Galle PR, Khan SA, Llovet JM, Park JW, Patel T, et al.

Guidelines for the diagnosis and management of intrahepatic cholangiocarcinoma. J

Ref. code: 25605412330010EAN

144

Hepatol. 2014;60(6):1268-89. doi: 10.1016/j.jhep.2014.01.021. PubMed PMID:

24681130.

52. IARC. Schistosomes, liver flukes and Helicobacter pylori. IARC Working

Group on the Evaluation of Carcinogenic Risks to Humans. Lyon: The Agency; 1994.

53. Sripa B, Brindley PJ, Mulvenna J, Laha T, Smout MJ, Mairiang E, et al. The

tumorigenic liver fluke Opisthorchis viverrini--multiple pathways to cancer. Trends

Parasitol. 2012;28(10):395-407. doi: 10.1016/j.pt.2012.07.006. PubMed PMID:

22947297.

54. Smout MJ, Sripa B, Laha T, Mulvenna J, Gasser RB, Young ND, et al.

Infection with the carcinogenic human liver fluke, Opisthorchis viverrini. Mol

Biosyst. 2011;7(5):1367-75. doi: 10.1039/c0mb00295j. PubMed PMID: 21311794.

55. Watanapa P, Watanapa WB. Liver fluke-associated cholangiocarcinoma. Br J

Surg. 2002;89(8):962-70. doi: 10.1046/j.1365-2168.2002.02143.x. PubMed PMID:

12153620.

56. Haugen B, Karinshak SE, Mann VH, Popratiloff A, Loukas A, Brindley PJ, et

al. Granulin secreted by the food-borne liver fluke Opisthorchis viverrini promotes

angiogenesis in human endothelial cells. Front Med (Lausanne). 2018;5:30. doi:

10.3389/fmed.2018.00030. PubMed PMID: 29503819.

57. Suttiprapa S, Matchimakul P, Loukas A, Laha T, Wongkham S, Kaewkes S, et

al. Molecular expression and enzymatic characterization of thioredoxin from the

carcinogenic human liver fluke Opisthorchis viverrini. Parasitol Int. 2012;61(1):101-

6. doi: 10.1016/j.parint.2011.06.018. PubMed PMID: 21740981.

58. Matchimakul P, Rinaldi G, Suttiprapa S, Mann VH, Popratiloff A, Laha T, et

al. Apoptosis of cholangiocytes modulated by thioredoxin of carcinogenic liver fluke.

Int J Biochem Cell Biol. 2015;65:72-80. doi: 10.1016/j.biocel.2015.05.014. PubMed

PMID: 26007234.

59. Correia da Costa JM, Vale N, Gouveia MJ, Botelho MC, Sripa B, Santos LL,

et al. Schistosome and liver fluke derived catechol-estrogens and helminth associated

cancers. Front Genet. 2014;5:444. doi: 10.3389/fgene.2014.00444. PubMed PMID:

25566326.

Ref. code: 25605412330010EAN

145

60. Ostwald TJ, MacLennan DH. Isolation of a high affinity calcium-binding

protein from sarcoplasmic reticulum. J Biol Chem. 1974;249(3):974-9. PubMed

PMID: 4272851.

61. Michalak M, Milner RE, Burns K, Opas M. Calreticulin. Biochem J. 1992;285

( Pt 3):681-92. PubMed PMID: 1497605.

62. McCauliffe DP, Lux FA, Lieu TS, Sanz I, Hanke J, Newkirk MM, et al.

Molecular cloning, expression, and chromosome 19 localization of a human Ro/SS-A

autoantigen. J Clin Invest. 1990;85(5):1379-91. doi: 10.1172/JCI114582. PubMed

PMID: 2332496.

63. Smith MJ, Koch GL. Multiple zones in the sequence of calreticulin (CRP55,

calregulin, HACBP), a major calcium binding ER/SR protein. EMBO J.

1989;8(12):3581-6. PubMed PMID: 2583110.

64. Milner RE, Baksh S, Shemanko C, Carpenter MR, Smillie L, Vance JE, et al.

Calreticulin, and not calsequestrin, is the major calcium binding protein of smooth

muscle sarcoplasmic reticulum and liver endoplasmic reticulum. J Biol Chem.

1991;266(11):7155-65. PubMed PMID: 2016321.

65. Collins JH, Xi ZJ, Alderson-Lang BH, Treves S, Volpe P. Sequence homology

of a canine brain calcium-binding protein with calregulin and the human Ro/SS-A

antigen. Biochem Biophys Res Commun. 1989;164(1):575-9. doi: 10.1016/0006-

291X(89)91758-0. PubMed PMID: 2803321.

66. Khanna NC, Tokuda M, Waisman DM. Comparison of calregulins from

vertebrate livers. Biochem J. 1987;242(1):245-51. PubMed PMID: 3593237.

67. Kales S, Fujiki K, Dixon B. Molecular cloning and characterization of

calreticulin from rainbow trout (Oncorhynchus mykiss). Immunogenetics.

2004;55(10):717-23. doi: 10.1007/s00251-003-0631-4. PubMed PMID: 14669059.

68. Treveso S, Zorzato F, Chiozzi P, Melandri P, Volpe P, Pozzan T. Frog brain

expresses a 60 KDa Ca2+ binding protein similar to mammalian calreticulin.

Biochem Biophys Res Commun. 1991;175(2):444-50. doi: 10.1016/0006-

291X(91)91584-Y. PubMed PMID: 2018493.

69. Luana W, Li F, Wang B, Zhang X, Liu Y, Xiang J. Molecular characteristics

and expression analysis of calreticulin in Chinese shrimp Fenneropenaeus chinensis.

Ref. code: 25605412330010EAN

146

Comp Biochem Physiol B Biochem Mol Biol. 2007;147(3):482-91. doi:

10.1016/j.cbpb.2007.03.001. PubMed PMID: 17449312.

70. Kawabe S, Yokoyama Y. Molecular cloning of calnexin and calreticulin in the

Pacific oyster Crassostrea gigas and its expression in response to air exposure. Mar

Genomics. 2010;3(1):19-27. doi: 10.1016/j.margen.2010.01.002. PubMed PMID:

21798193.

71. Wang G, Jiang Z, Zhang M, Yang N, Zhu D. Identification of a new

calreticulin homolog from Yesso scallop (Patinopecten yessoensis) and its role in

innate immunity. Fish Shellfish Immunol. 2016;58:108-15. doi:

10.1016/j.fsi.2016.09.019. PubMed PMID: 27633681.

72. Smith MJ. A C. elegans gene encodes a protein homologous to mammalian

calreticulin. DNA Seq. 1992;2(4):235-40. doi: 10.3109/10425179209020808 PubMed

PMID: 1627827.

73. Kasper G, Brown A, Eberl M, Vallar L, Kieffer N, Berry C, et al. A

calreticulin-like molecule from the human hookworm Necator americanus interacts

with C1q and the cytoplasmic signalling domains of some integrins. Parasite

Immunol. 2001;23(3):141-52. doi: 10.1046/j.1365-3024.2001.00366.x PubMed

PMID: 11240905.

74. Suchitra S, Joshi P. Characterization of Haemonchus contortus calreticulin

suggests its role in feeding and immune evasion by the parasite. Biochim Biophys

Acta. 2005;1722(3):293-303. doi: 10.1016/j.bbagen.2004.12.020. PubMed PMID:

15716049.

75. Rzepecka J, Rausch S, Klotz C, Schnoller C, Kornprobst T, Hagen J, et al.

Calreticulin from the intestinal nematode Heligmosomoides polygyrus is a Th2-

skewing protein and interacts with murine scavenger receptor-A. Mol Immunol.

2009;46(6):1109-19. doi: 10.1016/j.molimm.2008.10.032. PubMed PMID: 19108896.

76. Khalife J, Liu JL, Pierce R, Porchet E, Godin C, Capron A. Characterization

and localization of Schistosoma mansoni calreticulin Sm58. Parasitology. 1994;108 (

Pt 5):527-32. doi: 10.1017/S0031182000077398. PubMed PMID: 8052508.

77. Scott JC, McManus DP. Molecular cloning and functional expression of a

cDNA encoding the major endoplasmic reticulum-associated calcium-binding protein,

Ref. code: 25605412330010EAN

147

calreticulin, from Philippine strain Schistosoma japonicum. Parasitol Int.

1999;48(1):35-46. doi: 10.1016/S1383-5769(98)00039-7. PubMed PMID: 11269324.

78. Mendlovic F, Ostoa-Saloma P, Solis CF, Martinez-Ocana J, Flisser A, Laclette

JP. Cloning, characterization, and functional expression of Taenia solium calreticulin.

J Parasitol. 2004;90(4):891-3. doi: 10.1645/GE-3325RN. PubMed PMID: 15357095.

79. Cabezon C, Cabrera G, Paredes R, Ferreira A, Galanti N. Echinococcus

granulosus calreticulin: molecular characterization and hydatid cyst localization. Mol

Immunol. 2008;45(5):1431-8. doi: 10.1016/j.molimm.2007.08.022. PubMed PMID:

17936905.

80. Smith MJ. Nucleotide sequence of a Drosophila melanogaster gene encoding a

calreticulin homologue. DNA Seq. 1992;3(4):247-50. doi:

10.3109/10425179209034025 PubMed PMID: 1296819.

81. Joshi M, Pogue GP, Duncan RC, Lee NS, Singh NK, Atreya CD, et al.

Isolation and characterization of Leishmania donovani calreticulin gene and its

conservation of the RNA binding activity. Mol Biochem Parasitol. 1996;81(1):53-64.

doi: 10.1016/0166-6851(96)02676-X. PubMed PMID: 8892305.

82. Labriola C, Cazzulo JJ, Parodi AJ. Trypanosoma cruzi calreticulin is a lectin

that binds monoglucosylated oligosaccharides but not protein moieties of

glycoproteins. Mol Biol Cell. 1999;10(5):1381-94. doi: 10.1091/mbc.10.5.1381.


83. Jia XY, He LH, Jing RL, Li RZ. Calreticulin: conserved protein and diverse

functions in plants. Physiol Plant. 2009;136(2):127-38. doi: 10.1111/j.1399-

3054.2009.1223.x. PubMed PMID: 19453510.

84. Gold LI, Eggleton P, Sweetwyne MT, Van Duyn LB, Greives MR, Naylor

SM, et al. Calreticulin: non-endoplasmic reticulum functions in physiology and

disease. FASEB J. 2010;24(3):665-83. doi: 10.1096/fj.09-145482. PubMed PMID:

19940256.

85. Michalak M, Corbett EF, Mesaeli N, Nakamura K, Opas M. Calreticulin: one

protein, one gene, many functions. Biochem J. 1999;344 Pt 2:281-92. PubMed PMID:

10567207.

Ref. code: 25605412330010EAN

148

86. NEXTPROT. CALR3-Function: SIB Swiss Institute of Bioinformatics; 2011-

2018 [updated 17 January 2018. Available from:

https://www.nextprot.org/entry/NX_Q96L12/.

87. Persson S, Rosenquist M, Sommarin M. Identification of a novel calreticulin

isoform (Crt2) in human and mouse. Gene. 2002;297(1-2):151-8. doi: 10.1016/S0378-

1119(02)00880-6. PubMed PMID: 12384296.

88. McCauliffe DP, Yang YS, Wilson J, Sontheimer RD, Capra JD. The 5'-

flanking region of the human calreticulin gene shares homology with the human

GRP78, GRP94, and protein disulfide isomerase promoters. J Biol Chem.

1992;267(4):2557-62. PubMed PMID: 1733953.

89. Rooke K, Briquet-Laugier V, Xia YR, Lusis AJ, Doolittle MH. Mapping of

the gene for calreticulin (Calr) to mouse chromosome 8. Mamm Genome.

1997;8(11):870-1. doi: 10.1007/s003359900599. PubMed PMID: 9337407.

90. Waser M, Mesaeli N, Spencer C, Michalak M. Regulation of calreticulin gene

expression by calcium. J Cell Biol. 1997;138(3):547-57. PubMed PMID: 9245785.

91. NEXTPROT. CALR Sequence 2011-2018 [updated 17 January 2018.

Available from: https://www.nextprot.org/entry/NX_P27797/sequence.

92. Matsuoka K, Seta K, Yamakawa Y, Okuyama T, Shinoda T, Isobe T. Covalent

structure of bovine brain calreticulin. Biochem J. 1994;298 ( Pt 2):435-42. doi:

10.1042/bj2980435. PubMed PMID: 8135753.

93. PROSITE. Calreticulin family signatures: SIB Swiss Institute Bioinformatics;

2018 [updated December 2004. Available from:

https://prosite.expasy.org/PDOC00636.

94. Michalak M, Groenendyk J, Szabo E, Gold LI, Opas M. Calreticulin, a multi-

process calcium-buffering chaperone of the endoplasmic reticulum. Biochem J.

2009;417(3):651-66. doi: 10.1042/BJ20081847. PubMed PMID: 19133842.

95. Pike SE, Yao L, Jones KD, Cherney B, Appella E, Sakaguchi K, et al.

Vasostatin, a calreticulin fragment, inhibits angiogenesis and suppresses tumor

growth. J Exp Med. 1998;188(12):2349-56. PubMed PMID: 9858521.

96. Cai KX, Tse LY, Leung C, Tam PK, Xu R, Sham MH. Suppression of lung

tumor growth and metastasis in mice by adeno-associated virus-mediated expression

Ref. code: 25605412330010EAN

149

of vasostatin. Clin Cancer Res. 2008;14(3):939-49. doi: 10.1158/1078-0432.CCR-07-

1930. PubMed PMID: 18245558.

97. Chouquet A, Paidassi H, Ling WL, Frachet P, Houen G, Arlaud GJ, et al. X-

ray structure of the human calreticulin globular domain reveals a peptide-binding area

and suggests a multi-molecular mechanism. PLoS One. 2011;6(3):e17886. doi:

10.1371/journal.pone.0017886. PubMed PMID: 21423620.

98. Kozlov G, Pocanschi CL, Rosenauer A, Bastos-Aristizabal S, Gorelik A,

Williams DB, et al. Structural basis of carbohydrate recognition by calreticulin. J Biol

Chem. 2010;285(49):38612-20. doi: 10.1074/jbc.M110.168294. PubMed PMID:

20880849.

99. Baksh S, Michalak M. Expression of calreticulin in Escherichia coli and

identification of its Ca2+

binding domains. J Biol Chem. 1991;266(32):21458-65. doi:


100. Ellgaard L, Riek R, Herrmann T, Guntert P, Braun D, Helenius A, et al. NMR

structure of the calreticulin P-domain. Proc Natl Acad Sci U S A. 2001;98(6):3133-8.

doi: 10.1073/pnas.051630098. PubMed PMID: 11248044.

101. Raghavan M, Wijeyesakere SJ, Peters LR, Del Cid N. Calreticulin in the

immune system: ins and outs. Trends Immunol. 2013;34(1):13-21. doi:

10.1016/j.it.2012.08.002. PubMed PMID: 22959412.

102. Wang WA, Groenendyk J, Michalak M. Calreticulin signaling in health and

disease. Int J Biochem Cell Biol. 2012;44(6):842-6. doi:

10.1016/j.biocel.2012.02.009.

103. Coppolino MG, Dedhar S. Calreticulin. Int J Biochem Cell Biol.

1998;30(5):553-8. PubMed PMID: 9693955.

104. Araki K, Nagata K. Protein folding and quality control in the ER. Cold Spring

Harb Perspect Biol. 2011;3(11):a007526. doi: 10.1101/cshperspect.a007526. PubMed

PMID: 21875985.

105. Hegde RS, Ploegh HL. Quality and quantity control at the endoplasmic

reticulum. Curr Opin Cell Biol. 2010;22(4):437-46. doi: 10.1016/j.ceb.2010.05.005.


106. Gao B, Adhikari R, Howarth M, Nakamura K, Gold MC, Hill AB, et al.

Assembly and antigen-presenting function of MHC class I molecules in cells lacking

Ref. code: 25605412330010EAN

150

the ER chaperone calreticulin. Immunity. 2002;16(1):99-109. doi: 10.1016/S1074-

7613(01)00260-6. PubMed PMID: 11825569.

107. Nauseef WM, McCormick SJ, Clark RA. Calreticulin functions as a molecular

chaperone in the biosynthesis of myeloperoxidase. J Biol Chem. 1995;270(9):4741-7.

doi: 10.1074/jbc.270.9.4741 PubMed PMID: 7876246.

108. Jeffery E, Peters LR, Raghavan M. The polypeptide binding conformation of

calreticulin facilitates its cell-surface expression under conditions of endoplasmic

reticulum stress. J Biol Chem. 2011;286(4):2402-15. doi: 10.1074/jbc.M110.180877.


109. Pocanschi CL, Kozlov G, Brockmeier U, Brockmeier A, Williams DB,

Gehring K. Structural and functional relationships between the lectin and arm

domains of calreticulin. J Biol Chem. 2011;286(31):27266-77. doi:

10.1074/jbc.M111.258467. PubMed PMID: 21652723.

110. Molinari M, Eriksson KK, Calanca V, Galli C, Cresswell P, Michalak M, et al.

Contrasting functions of calreticulin and calnexin in glycoprotein folding and ER

quality control. Mol Cell. 2004;13(1):125-35. doi: 10.1016/S1097-2765(03)00494-5.


111. Ellgaard L, Helenius A. Quality control in the endoplasmic reticulum. Nat Rev

Mol Cell Biol. 2003;4(3):181-91. doi: 10.1038/nrm1052. PubMed PMID: 12612637.

112. Nakamura K, Zuppini A, Arnaudeau S, Lynch J, Ahsan I, Krause R, et al.

Functional specialization of calreticulin domains. J Cell Biol. 2001;154(5):961-72.

doi: 10.1083/jcb.200102073. PubMed PMID: 11524434.

113. Lynch J, Michalak M. Calreticulin is an upstream regulator of calcineurin.

Biochem Biophys Res Commun. 2003;311(4):1173-9. doi:

10.1016/j.bbrc.2003.08.040. PubMed PMID: 14623303.

114. Guo L, Nakamura K, Lynch J, Opas M, Olson EN, Agellon LB, et al. Cardiac-

specific expression of calcineurin reverses embryonic lethality in calreticulin-deficient

mouse. J Biol Chem. 2002;277(52):50776-9. doi: 10.1074/jbc.M209900200. PubMed

PMID: 12377773.

115. Lynch J, Guo L, Gelebart P, Chilibeck K, Xu J, Molkentin JD, et al.

Calreticulin signals upstream of calcineurin and MEF2C in a critical Ca(2+)-

Ref. code: 25605412330010EAN

151

dependent signaling cascade. J Cell Biol. 2005;170(1):37-47. doi:

10.1083/jcb.200412156. PubMed PMID: 15998798.

116. Goudarzi F, Mohammadalipour A, Khodadadi I, Karimi S, Mostoli R,

Bahabadi M, et al. The role of calcium in differentiation of human adipose-derived

stem cells to adipocytes. Mol Biotechnol. 2018;60(4):279-89. doi: 10.1007/s12033-

018-0071-x. PubMed PMID: 29488128.

117. Gardai SJ, McPhillips KA, Frasch SC, Janssen WJ, Starefeldt A, Murphy-

Ullrich JE, et al. Cell-surface calreticulin initiates clearance of viable or apoptotic

cells through trans-activation of LRP on the phagocyte. Cell. 2005;123(2):321-34.

doi: 10.1016/j.cell.2005.08.032. PubMed PMID: 16239148.

118. Jo SH, Choi JA, Lim YJ, Lee J, Cho SN, Oh SM, et al. Calreticulin modulates

the intracellular survival of mycobacteria by regulating ER-stress-mediated apoptosis.

Oncotarget. 2017;8(35):58686-98. doi: 10.18632/oncotarget.17419. PubMed PMID:

28938588.

119. Afshar N, Black BE, Paschal BM. Retrotranslocation of the chaperone

calreticulin from the endoplasmic reticulum lumen to the cytosol. Mol Cell Biol.

2005;25(20):8844-53. doi: 10.1128/MCB.25.20.8844-8853.2005. PubMed PMID:

16199864.

120. White TK, Zhu Q, Tanzer ML. Cell surface calreticulin is a putative

mannoside lectin which triggers mouse melanoma cell spreading. J Biol Chem.

1995;270(27):15926-9. doi: 10.1074/jbc.270.27.15926 PubMed PMID: 7608143.

121. Gold LI, Rahman M, Blechman KM, Greives MR, Churgin S, Michaels J, et

al. Overview of the role for calreticulin in the enhancement of wound healing through

multiple biological effects. J Investig Dermatol Symp Proc. 2006;11(1):57-65. doi:

10.1038/sj.jidsymp.5650011. PubMed PMID: 17069011.

122. Chao MP, Jaiswal S, Weissman-Tsukamoto R, Alizadeh AA, Gentles AJ,

Volkmer J, et al. Calreticulin is the dominant pro-phagocytic signal on multiple

human cancers and is counterbalanced by CD47. Sci Transl Med. 2010;2(63):63ra94.

doi: 10.1126/scitranslmed.3001375. PubMed PMID: 21178137.

123. Stuart GR, Lynch NJ, Day AJ, Schwaeble WJ, Sim RB. The C1q and collectin

binding site within C1q receptor (cell surface calreticulin). Immunopharmacology.

1997;38(1-2):73-80. doi: 10.1016/S0162-3109(97)00076-3. PubMed PMID: 9476117.

Ref. code: 25605412330010EAN

152

124. Nanney LB, Woodrell CD, Greives MR, Cardwell NL, Pollins AC, Bancroft

TA, et al. Calreticulin enhances porcine wound repair by diverse biological effects.

Am J Pathol. 2008;173(3):610-30. doi: 10.2353/ajpath.2008.071027. PubMed PMID:

18753412.

125. Greives MR, Samra F, Pavlides SC, Blechman KM, Naylor SM, Woodrell

CD, et al. Exogenous calreticulin improves diabetic wound healing. Wound Repair

Regen. 2012;20(5):715-30. doi: 10.1111/j.1524-475X.2012.00822.x. PubMed PMID:

22985041.

126. Carmeliet P, Jain RK. Molecular mechanisms and clinical applications of

angiogenesis. Nature. 2011;473(7347):298-307. doi: 10.1038/nature10144. PubMed

PMID: 21593862.

127. Adair TH, Montani JP. Angiogenesis. San Rafael (CA): Morgan & Claypool

Life Sciences; 2010 [cited 2018 Mar 13]. Available from:

https://www.ncbi.nlm.nih.gov/books/NBK53242/.

128. Drake CJ. Embryonic and adult vasculogenesis. Birth Defects Res C Embryo

Today. 2003;69(1):73-82. doi: 10.1002/bdrc.10003. PubMed PMID: 12768659.

129. Clapp C, Thebault S, Jeziorski MC, Martinez De La Escalera G. Peptide

hormone regulation of angiogenesis. Physiol Rev. 2009;89(4):1177-215. doi:

10.1152/physrev.00024.2009. PubMed PMID: 19789380.

130. Nyberg P, Xie L, Kalluri R. Endogenous inhibitors of angiogenesis. Cancer

Res. 2005;65(10):3967-79. doi: 10.1158/0008-5472.CAN-04-2427. PubMed PMID:

15899784.

131. Nishida N, Yano H, Nishida T, Kamura T, Kojiro M. Angiogenesis in cancer.

Vasc Health Risk Manag. 2006;2(3):213-9. doi: 10.2147/vhrm.2006.2.3.21. PubMed

PMID: 17326328.

132. Tosato G, Sgadari C, Taga K, Jones KD, Pike SE, Rosenberg A, et al.

Regression of experimental Burkitt's lymphoma induced by Epstein-Barr virus-

immortalized human B cells. Blood. 1994;83(3):776-84. doi:

10.3109/10428199509107897 PubMed PMID: 8298139.

133. Angiolillo AL, Sgadari C, Sheikh N, Reaman GH, Tosato G. Regression of

experimental human leukemias and solid tumors induced by Epstein-Barr virus-

Ref. code: 25605412330010EAN

153

immortalized B cells. Leuk Lymphoma. 1995;19(3-4):267-76. doi:

10.3109/10428199509107897. PubMed PMID: 8535218.

134. Pike SE, Yao L, Setsuda J, Jones KD, Cherney B, Appella E, et al.

Calreticulin and calreticulin fragments are endothelial cell inhibitors that suppress

tumor growth. Blood. 1999;94(7):2461-8. doi: PubMed PMID: 10498619.

135. Li X, Jiang L, Wang Y, Xiao Y, Huang Y, Yao Q, et al. Inhibition of

angiogenesis by a novel small peptide consisting of the active fragments of platelet

factor-4 and vasostatin. Cancer Lett. 2007;256(1):29-32. doi:

10.1016/j.canlet.2007.05.002. PubMed PMID: 17574330.

136. Yao L, Pike SE, Tosato G. Laminin binding to the calreticulin fragment

vasostatin regulates endothelial cell function. J Leukoc Biol. 2002;71(1):47-53. doi:

10.1189/jlb.71.1.47 PubMed PMID: 11781379.

137. Peng XC, Wang M, Chen XX, Liu J, Xiao GH, Liao HL. Plasmid-encoding

vasostatin inhibited the growth and metastasis of human hepatocellular carcinoma

cells. Mol Cell Biochem. 2014;395(1-2):265-72. doi: 10.1007/s11010-014-2135-y.


138. Ding H, Hong C, Wang Y, Liu J, Zhang N, Shen C, et al. Calreticulin

promotes angiogenesis via activating nitric oxide signalling pathway in rheumatoid

arthritis. Clin Exp Immunol. 2014;178(2):236-44. doi: 10.1111/cei.12411. PubMed

PMID: 24988887.

139. Zamanian M, Veerakumarasivam A, Abdullah S, Rosli R. Calreticulin and

cancer. Pathol Oncol Res. 2013;19(2):149-54. doi: 10.1007/s12253-012-9600-2.


140. Dunkelberger JR, Song WC. Complement and its role in innate and adaptive

immune responses. Cell Res. 2010;20(1):34-50. doi: 10.1038/cr.2009.139. PubMed

PMID: 20010915.

141. Ramirez G, Valck C, Aguilar L, Kemmerling U, Lopez-Munoz R, Cabrera G,

et al. Roles of Trypanosoma cruzi calreticulin in parasite-host interactions and in

tumor growth. Mol Immunol. 2012;52(3-4):133-40. doi:

10.1016/j.molimm.2012.05.006. PubMed PMID: 22673211.

142. Ferreira V, Valck C, Sanchez G, Gingras A, Tzima S, Molina MC, et al. The

classical activation pathway of the human complement system is specifically inhibited

Ref. code: 25605412330010EAN

154

by calreticulin from Trypanosoma cruzi. J Immunol. 2004;172(5):3042-50. doi:


143. Ramirez G, Valck C, Molina MC, Ribeiro CH, Lopez N, Sanchez G, et al.

Trypanosoma cruzi calreticulin: a novel virulence factor that binds complement C1 on

the parasite surface and promotes infectivity. Immunobiology. 2011;216(1-2):265-73.

doi: 10.1016/j.imbio.2010.04.001. PubMed PMID: 20472323.

144. Castillo C, Ramirez G, Valck C, Aguilar L, Maldonado I, Rosas C, et al. The

interaction of classical complement component C1 with parasite and host calreticulin

mediates Trypanosoma cruzi infection of human placenta. PLoS Negl Trop Dis.

2013;7(8):e2376. doi: 10.1371/journal.pntd.0002376. PubMed PMID: 23991234.

145. Ximenez C, Gonzalez E, Nieves ME, Silva-Olivares A, Shibayama M,

Galindo-Gomez S, et al. Entamoeba histolytica and E. dispar calreticulin: inhibition

of classical complement pathway and differences in the level of expression in

amoebic liver abscess. Biomed Res Int. 2014;2014:127453. doi:

10.1155/2014/127453. PubMed PMID: 24860808.

146. Debrabant A, Lee N, Pogue GP, Dwyer DM, Nakhasi HL. Expression of

calreticulin P-domain results in impairment of secretory pathway in Leishmania

donovani and reduced parasite survival in macrophages. Int J Parasitol.

2002;32(11):1423-34. doi: 10.1016/S0020-7519(02)00134-0. PubMed PMID:

12350377.

147. Molina MC, Ferreira V, Valck C, Aguilar L, Orellana J, Rojas A, et al. An in

vivo role for Trypanosoma cruzi calreticulin in antiangiogenesis. Mol Biochem

Parasitol. 2005;140(2):133-40. doi: 10.1016/j.molbiopara.2004.12.014. PubMed

PMID: 15760653.

148. Toledo V, Ramirez G, Valck C, Lopez N, Ribeiro CH, Maldonado I, et al.

Comparative in vivo antiangiogenic effects of calreticulin from Trypanosoma cruzi

and Homo sapiens sapiens. Biol Res. 2010;43(3):287-9. doi: /S0716-

97602010000300004. PubMed PMID: 21249299.

149. Lopez NC, Valck C, Ramirez G, Rodriguez M, Ribeiro C, Orellana J, et al.

Antiangiogenic and antitumor effects of Trypanosoma cruzi Calreticulin. PLoS Negl

Trop Dis. 2010;4(7):e730. doi: 10.1371/journal.pntd.0000730. PubMed PMID:

20625551.

Ref. code: 25605412330010EAN

155

150. Ignacio Arias J, Sepulveda C, Bravo P, Hamilton-West C, Maldonado I,

Ferreira A. Comparative effect of human and Trypanosoma cruzi calreticulin in

wound healing. J Tissue Eng Regen Med. 2015;9(1):41-54. doi: 10.1002/term.1613.


151. Marcelain K, Colombo A, Molina MC, Ferreira L, Lorca M, Aguillon JC, et

al. Development of an immunoenzymatic assay for the detection of human antibodies

against Trypanosoma cruzi calreticulin, an immunodominant antigen. Acta Trop.

2000;75(3):291-300. doi: 10.1016/S0001-706X(00)00062-0. PubMed PMID:

10838212.

152. Gonzalez E, Rico G, Mendoza G, Ramos F, Garcia G, Moran P, et al.

Calreticulin-like molecule in trophozoites of Entamoeba histolytica HM1:IMSS

(Swissprot: accession P83003). Am J Trop Med Hyg. 2002;67(6):636-9. doi:

10.4269/ajtmh.2002.67.636. PubMed PMID: 12518855.

153. Lux FA, McCauliffe DP, Buttner DW, Lucius R, Capra JD, Sontheimer RD, et

al. Serological cross-reactivity between a human Ro/SS-A autoantigen (calreticulin)

and the lambda Ral-1 antigen of Onchocerca volvulus. J Clin Invest.

1992;89(6):1945-51. doi: 10.1172/JCI115801. PubMed PMID: 1602002.

154. Rokeach LA, Zimmerman PA, Unnasch TR. Epitopes of the Onchocerca

volvulus RAL1 antigen, a member of the calreticulin family of proteins, recognized by

sera from patients with onchocerciasis. Infect Immun. 1994;62(9):3696-704. PubMed

PMID: 7520419.

155. Pritchard DI, Hooi DS, Brown A, Bockarie MJ, Caddick R, Quinnell RJ.

Basophil competence during hookworm (Necator americanus) infection. Am J Trop

Med Hyg. 2007;77(5):860-5. doi: 10.4269/ajtmh.2007.77.860 PubMed PMID:

17984343.

156. Winter JA, Davies OR, Brown AP, Garnett MC, Stolnik S, Pritchard DI. The

assessment of hookworm calreticulin as a potential vaccine for necatoriasis. Parasite

Immunol. 2005;27(4):139-46. doi: 10.1111/j.1365-3024.2005.00756.x. PubMed

PMID: 15910422.

157. Yadav S, Gupta S, Selvaraj C, Doharey PK, Verma A, Singh SK, et al. In

silico and in vitro studies on the protein-protein interactions between Brugia malayi

Ref. code: 25605412330010EAN

156

immunomodulatory protein calreticulin and human C1q. PLoS One.

2014;9(9):e106413. doi: 10.1371/journal.pone.0106413. PubMed PMID: 25184227.

158. Suchitra S, Anbu KA, Rathore DK, Mahawar M, Singh BP, Joshi P.

Haemonchus contortus calreticulin binds to C-reactive protein of its host, a novel

survival strategy of the parasite. Parasite Immunol. 2008;30(6-7):371-4. doi:

10.1111/j.1365-3024.2008.01028.x. PubMed PMID: 18422872.

159. Mendlovic F, Carrillo-Farga J, Torres J, Laclette JP, Flisser A. Differential

expression of calreticulin in developmental stages of Taenia solium. J Parasitol.

2006;92(4):789-95. doi: 10.1645/GE-724R1.1. PubMed PMID: 16995397.

160. Salazar AM, Mendlovic F, Cruz-Rivera M, Chavez-Talavera O, Sordo M,

Avila G, et al. Genotoxicity induced by Taenia solium and its reduction by

immunization with calreticulin in a hamster model of taeniosis. Environ Mol

Mutagen. 2013;54(5):347-53. doi: 10.1002/em.21782. PubMed PMID: 23704053.

161. Leon-Cabrera S, Cruz-Rivera M, Mendlovic F, Romero-Valdovinos M,

Vaughan G, Salazar AM, et al. Immunological mechanisms involved in the protection

against intestinal taeniosis elicited by oral immunization with Taenia solium

calreticulin. Exp Parasitol. 2012;132(3):334-40. doi: 10.1016/j.exppara.2012.08.006.


162. Mendlovic F, Cruz-Rivera M, Diaz-Gandarilla JA, Flores-Torres MA, Avila

G, Perfiliev M, et al. Orally administered Taenia solium Calreticulin prevents

experimental intestinal inflammation and is associated with a type 2 immune

response. PLoS One. 2017;12(10):e0186510. doi: 10.1371/journal.pone.0186510.


163. Huggins MC, Gibbs J, Moloney NA. Cloning of a Schistosoma japonicum

gene encoding an antigen with homology to calreticulin. Mol Biochem Parasitol.

1995;71(1):81-7. doi: 10.1016/0166-6851(95)00038-3. PubMed PMID: 7630385.

164. El Gengehi N, El Ridi R, Tawab NA, El Demellawy M, Mangold BL. A

Schistosoma mansoni 62-kDa band is identified as an irradiated vaccine T-cell antigen

and characterized as calreticulin. J Parasitol. 2000;86(5):993-1000. doi:

10.1645/0022-3395(2000)086[0993:ASMKBI]2.0.CO;2. PubMed PMID: 11128523.

Ref. code: 25605412330010EAN

157

165. El Naglaa G, Zada S, El Demellawy MA. Immune response to Schistosoma

mansoni calreticulin in schistosomiasis resistant individuals. Egypt J Immunol.

2004;11(2):37-45. PubMed PMID: 16734116.

166. El Aswad Bel D, Doenhoff MJ, El Hadidi AS, Schwaeble WJ, Lynch NJ. Use

of recombinant calreticulin and cercarial transformation fluid (CTF) in the

serodiagnosis of Schistosoma mansoni. Immunobiology. 2011;216(3):379-85. doi:

10.1016/j.imbio.2010.06.014. PubMed PMID: 20691496.

167. Mutapi F, Bourke C, Harcus Y, Midzi N, Mduluza T, Turner CM, et al.

Differential recognition patterns of Schistosoma haematobium adult worm antigens by

the human antibodies IgA, IgE, IgG1 and IgG4. Parasite Immunol. 2011;33(3):181-

92. doi: 10.1111/j.1365-3024.2010.01270.x. PubMed PMID: 21204849.

168. Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology

Open Software Suite. Trends Genet. 2000;16(6):276-7. doi: 10.1016/S0168-

9525(00)02024-2. PubMed PMID: 10827456.

169. Petersen TN, Brunak S, von Heijne G, Nielsen H. SignalP 4.0: discriminating

signal peptides from transmembrane regions. Nat Methods. 2011;8(10):785-6. doi:

10.1038/nmeth.1701. PubMed PMID: 21959131.

170. de Castro E, Sigrist CJ, Gattiker A, Bulliard V, Langendijk-Genevaux PS,

Gasteiger E, et al. ScanProsite: detection of PROSITE signature matches and

ProRule-associated functional and structural residues in proteins. Nucleic Acids Res.

2006;34(Web Server issue):W362-5. doi: 10.1093/nar/gkl124. PubMed PMID:

16845026.

171. Waterhouse AM, Procter JB, Martin DM, Clamp M, Barton GJ. Jalview

Version 2--a multiple sequence alignment editor and analysis workbench.

Bioinformatics. 2009;25(9):1189-91. doi: 10.1093/bioinformatics/btp033. PubMed

PMID: 19151095.

172. Gouy M, Guindon S, Gascuel O. SeaView version 4: A multiplatform

graphical user interface for sequence alignment and phylogenetic tree building. Mol

Biol Evol. 2010;27(2):221-4. doi: 10.1093/molbev/msp259. PubMed PMID:

19854763.

173. Vichasri-Grams S, Subpipattana P, Sobhon P, Viyanant V, Grams R. An

analysis of the calcium-binding protein 1 of Fasciola gigantica with a comparison to

Ref. code: 25605412330010EAN

158

its homologs in the phylum Platyhelminthes. Mol Biochem Parasitol. 2006;146(1):10-

23. doi: 10.1016/j.molbiopara.2005.10.012. PubMed PMID: 16297461.

174. Saito Y, Ihara Y, Leach MR, Cohen-Doyle MF, Williams DB. Calreticulin

functions in vitro as a molecular chaperone for both glycosylated and non-

glycosylated proteins. EMBO J. 1999;18(23):6718-29. doi:

10.1093/emboj/18.23.6718. PubMed PMID: 10581245.

175. Kumar A, Ponnan P, Raj HG, Parmar VS, Saso L. Comparative specificities of

Calreticulin Transacetylase to O-acetyl, N-acetyl and S-acetyl derivative of 4-

methylcoumarins and their inhibitory effect on AFB1-induced genotoxicity in vitro

and in vivo. Food Chem Toxicol. 2013;52:216-24. doi: 10.1016/j.fct.2012.11.018.


176. Singh P, Ponnan P, Krishnan S, Tyagi TK, Priya N, Bansal S, et al. Protein

acyltransferase function of purified calreticulin. Part 1: characterization of

propionylation of protein utilizing propoxycoumarin as the propionyl group donor. J

Biochem. 2010;147(5):625-32. doi: 10.1093/jb/mvq002. PubMed PMID: 20071373.

177. Liang CC, Park AY, Guan JL. In vitro scratch assay: a convenient and

inexpensive method for analysis of cell migration in vitro. Nat Protoc. 2007;2(2):329-

33. doi: 10.1038/nprot.2007.30. PubMed PMID: 17406593.

178. Arnaoutova I, Kleinman HK. In vitro angiogenesis: endothelial cell tube

formation on gelled basement membrane extract. Nat Protoc. 2010;5(4):628-35. doi:

10.1038/nprot.2010.6. PubMed PMID: 20224563.

179. Young ND, Campbell BE, Hall RS, Jex AR, Cantacessi C, Laha T, et al.

Unlocking the transcriptomes of two carcinogenic parasites, Clonorchis sinensis and

Opisthorchis viverrini. PLoS Negl Trop Dis. 2010;4(6):e719. doi:

10.1371/journal.pntd.0000719. PubMed PMID: 20582164.

180. Lum R, Ahmad S, Hong SJ, Chapman DC, Kozlov G, Williams DB.

Contributions of the lectin and polypeptide binding sites of calreticulin to its

chaperone functions in vitro and in cells. J Biol Chem. 2016;291(37):19631-41. doi:

10.1074/jbc.M116.746321. PubMed PMID: 27413183.

181. Frickel EM, Riek R, Jelesarov I, Helenius A, Wuthrich K, Ellgaard L.

TROSY-NMR reveals interaction between ERp57 and the tip of the calreticulin P-

Ref. code: 25605412330010EAN

159

domain. Proc Natl Acad Sci U S A. 2002;99(4):1954-9. doi:

10.1073/pnas.042699099. PubMed PMID: 11842220.

182. Kovacs H, Campbell ID, Strong P, Johnson S, Ward FJ, Reid KB, et al.

Evidence that C1q binds specifically to CH2-like immunoglobulin gamma motifs

present in the autoantigen calreticulin and interferes with complement activation.

Biochemistry. 1998;37(51):17865-74. doi: 10.1021/bi973197p. PubMed PMID:

9922153.

183. Young ND, Nagarajan N, Lin SJ, Korhonen PK, Jex AR, Hall RS, et al. The

Opisthorchis viverrini genome provides insights into life in the bile duct. Nat

Commun. 2014;5:4378. doi: 10.1038/ncomms5378. PubMed PMID: 25007141.

184. Pekarikova A, Sanchez D, Palova-Jelinkova L, Simsova M, Benes Z,

Hoffmanova I, et al. Calreticulin is a B cell molecular target in some gastrointestinal

malignancies. Clin Exp Immunol. 2010;160(2):215-22. doi: 10.1111/j.1365-

2249.2009.04085.x. PubMed PMID: 20030668.

185. Nakhasi HL, Pogue GP, Duncan RC, Joshi M, Atreya CD, Lee NS, et al.

Implications of calreticulin function in parasite biology. Parasitol Today.

1998;14(4):157-60. doi: 10.1016/S0169-4758(97)01180-0. PubMed PMID:

17040734.

186. Sontheimer RD, Lieu TS, McCauliffe DP. Molecular characterization of the

Ro/SS-A autoimmune response. Semin Dermatol. 1991;10(3):199-205. doi:

10.1038/jid.1993.27. PubMed PMID: 1931569.

187. Kishore U, Sontheimer RD, Sastry KN, Zappi EG, Hughes GR, Khamashta

MA, et al. The systemic lupus erythematosus (SLE) disease autoantigen-calreticulin

can inhibit C1q association with immune complexes. Clin Exp Immunol.

1997;108(2):181-90. doi: 10.1046/j.1365-2249.1997.3761273.x PubMed PMID:

9158084.

188. Jorgensen CS, Hansen KB, Jacobsen S, Halberg P, Ullman S, Hansen D, et al.

Absence of high-affinity calreticulin autoantibodies in patients with systemic

rheumatic diseases and coeliac disease. Scand J Clin Lab Invest. 2005;65(5):403-12.

doi: 10.1080/00365510510013857. PubMed PMID: 16081363.

189. Guillou F, Roger E, Mone Y, Rognon A, Grunau C, Theron A, et al.

Excretory-secretory proteome of larval Schistosoma mansoni and Echinostoma

Ref. code: 25605412330010EAN

160

caproni, two parasites of Biomphalaria glabrata. Mol Biochem Parasitol.

2007;155(1):45-56. doi: 10.1016/j.molbiopara.2007.05.009. PubMed PMID:

17606306.

190. Mendlovic F, Cruz-Rivera M, Avila G, Vaughan G, Flisser A. Cytokine,

antibody and proliferative cellular responses elicited by Taenia solium calreticulin

upon experimental infection in hamsters. PLoS One. 2015;10(3):e0121321. doi:

10.1371/journal.pone.0121321. PubMed PMID: 25811778.

191. Varricchio L, Falchi M, Dall'Ora M, De Benedittis C, Ruggeri A, Uversky

VN, et al. Calreticulin: challenges posed by the intrinsically disordered nature of

calreticulin to the study of its function. Front Cell Dev Biol. 2017;5:96. doi:

10.3389/fcell.2017.00096. PubMed PMID: 29218307.

192. Khalife J, Trottein F, Schacht AM, Godin C, Pierce RJ, Capron A. Cloning of

the gene encoding a Schistosoma mansoni antigen homologous to human Ro/SS-A

autoantigen. Mol Biochem Parasitol. 1993;57(2):193-202. doi: 10.1016/0166-

6851(93)90195-4. PubMed PMID: 8433712.

193. Miquel J, Swiderski Z, Sripa B, Ribas A. Ultrastructural characters of the

spermatozoon of the liver fluke Opisthorchis viverrini (Poirier, 1886)

(Opisthorchiidae). Parasitol Res. 2017;116(9):2499-506. doi: 10.1007/s00436-017-

5559-y. PubMed PMID: 28725936.

194. Apinhasmit W, Sobhon P, Saitongdee P, Menayotin S, Upatham ES.

Opisthorchis viverrini: ultrastructure of the tegument of the first-week juveniles and

adult flukes. Int J Parasitol. 1994;24(5):613-21. doi: 10.1016/0020-7519(94)90113-9.


195. Kaewpitoon N, Laha T, Kaewkes S, Yongvanit P, Brindley PJ, Loukas A, et

al. Characterization of cysteine proteases from the carcinogenic liver fluke,

Opisthorchis viverrini. Parasitol Res. 2008;102(4):757-64. doi: 10.1007/s00436-007-

0831-1. PubMed PMID: 18092178.

196. Suttiprapa S, Mulvenna J, Huong NT, Pearson MS, Brindley PJ, Laha T, et al.

Ov-APR-1, an aspartic protease from the carcinogenic liver fluke, Opisthorchis

viverrini: functional expression, immunolocalization and subsite specificity. Int J

Biochem Cell Biol. 2009;41(5):1148-56. doi: 10.1016/j.biocel.2008.10.013. PubMed

PMID: 18996218.

Ref. code: 25605412330010EAN

161

197. Pinlaor P, Kaewpitoon N, Laha T, Sripa B, Kaewkes S, Morales ME, et al.

Cathepsin F cysteine protease of the human liver fluke, Opisthorchis viverrini. PLoS

Negl Trop Dis. 2009;3(3):e398. doi: 10.1371/journal.pntd.0000398. PubMed PMID:

19308250.

198. Nithikathkul C, Tesana S, Sithithaworn P, Balakanich S. Early stage biliary

and intrahepatic migration of Opisthorchis viverrini in the golden hamster. J

Helminthol. 2007;81(1):39-41. doi: 10.1017/S0022149X07212106. PubMed PMID:

17381865.

199. Chaiyadet S, Krueajampa W, Hipkaeo W, Plosan Y, Piratae S, Sotillo J, et al.

Suppression of mRNAs encoding CD63 family tetraspanins from the carcinogenic

liver fluke Opisthorchis viverrini results in distinct tegument phenotypes. Sci Rep.

2017;7(1):14342. doi: 10.1038/s41598-017-13527-5. PubMed PMID: 29084967.

200. Sripa B, Kaewkes S. Localisation of parasite antigens and inflammatory

responses in experimental opisthorchiasis. Int J Parasitol. 2000;30(6):735-40. doi:

10.1016/S0020-7519(00)00054-0. PubMed PMID: 10856508.

201. Chaiyadet S, Sotillo J, Smout M, Cantacessi C, Jones MK, Johnson MS, et al.

Carcinogenic liver fluke secretes extracellular vesicles that promote cholangiocytes to

adopt a tumorigenic phenotype. J Infect Dis. 2015;212(10):1636-45. doi:

10.1093/infdis/jiv291. PubMed PMID: 25985904.

202. Sripa B, Kaewkes S. Relationship between parasite-specific antibody

responses and intensity of Opisthorchis viverrini infection in hamsters. Parasite

Immunol. 2000;22(3):139-45. doi: 10.1046/j.1365-3024.2000.00286.x PubMed

PMID: 10672195.

203. Park BJ, Lee DG, Yu JR, Jung SK, Choi K, Lee J, et al. Calreticulin, a

calcium-binding molecular chaperone, is required for stress response and fertility in

Caenorhabditis elegans. Mol Biol Cell. 2001;12(9):2835-45. doi:

10.1091/mbc.12.9.2835. PubMed PMID: 11553721.

204. Leach MR, Cohen-Doyle MF, Thomas DY, Williams DB. Localization of the

lectin, ERp57 binding, and polypeptide binding sites of calnexin and calreticulin. J

Biol Chem. 2002;277(33):29686-97. doi: 10.1074/jbc.M202405200. PubMed PMID:

12052826.

Ref. code: 25605412330010EAN

162

205. Wijeyesakere SJ, Gafni AA, Raghavan M. Calreticulin is a thermostable

protein with distinct structural responses to different divalent cation environments. J

Biol Chem. 2011;286(11):8771-85. doi: 10.1074/jbc.M110.169193. PubMed PMID:

21177861.

206. Raj HG, Kumari R, Seema, Gupta G, Kumar R, Saluja D, et al. Novel function

of calreticulin: characterization of calreticulin as a transacetylase-mediating protein

acetylator independent of acetyl CoA using polyphenolic acetates. Pure Appl Chem.

2006;78(5):985-92. doi: 10.1351/pac200678050985.

207. Singh P, Ponnan P, Priya N, Tyagi TK, Gaspari M, Krishnan S, et al. Protein

acyltransferase function of purified calreticulin: the exclusive role of P-domain in

mediating protein acylation utilizing acyloxycoumarins and acetyl CoA as the acyl

group donors. Protein Pept Lett. 2011;18(5):507-17. doi:

10.2174/092986611794927938. PubMed PMID: 21235489.

208. Kumari R, Bansal S, Gupta G, Arora S, Kumar A, Goel S, et al. Calreticulin

transacylase: genesis, mechanism of action and biological applications. Biochimie.

2010;92(9):1173-9. doi: 10.1016/j.biochi.2010.01.016. PubMed PMID: 20109516.

209. Raj HG, Parmar VS, Jain SC, Kohli E, Ahmad N, Goel S, et al. Mechanism of

biochemical action of substituted 4-methylbenzopyran-2-ones. Part 7: Assay and

characterization of 7,8-diacetoxy-4-methylcoumarin:protein transacetylase from rat

liver microsomes based on the irreversible inhibition of cytosolic glutathione S-

transferase. Bioorg Med Chem. 2000;8(7):1707-12. doi: 10.1016/S0968-

0896(00)00104-8. PubMed PMID: 10976517.

210. Raj HG, Kohli E, Goswami R, Goel S, Rastogi RC, Jain SC, et al. Mechanism

of biochemical action of substituted benzopyran-2-ones. Part 8: Acetoxycoumarin:

protein transacetylase specificity for aromatic nuclear acetoxy groups in proximity to

the oxygen heteroatom. Bioorg Med Chem. 2001;9(5):1085-9. doi: 10.1016/S0968-

0896(00)00328-X. PubMed PMID: 11377166.

211. Arora S, Vohra P, Kumar A, Tyagi YK, Raj HG, Dawarkanath BS, et al.

Calreticulin transacetylase catalyzed activation of rat tracheal smooth muscle cell

nitric oxide synthase by acetoxycoumarins. Biol Pharm Bull. 2008;31(4):709-13. doi:

10.1248/bpb.31.709 PubMed PMID: 18379067.

Ref. code: 25605412330010EAN

163

212. Singh U, Kumar A, Sinha R, Manral S, Arora S, Ram S, et al. Calreticulin

transacetylase catalyzed modification of the TNF-alpha mediated pathway in the

human peripheral blood mononuclear cells by polyphenolic acetates. Chem Biol

Interact. 2010;185(3):263-70. doi: 10.1016/j.cbi.2010.02.025. PubMed PMID:

20188080.

213. Kishore U, Sontheimer RD, Sastry KN, Zaner KS, Zappi EG, Hughes GR, et

al. Release of calreticulin from neutrophils may alter C1q-mediated immune

functions. Biochem J. 1997;322 ( Pt 2):543-50. PubMed PMID: 9065775.

214. Naresha S, Suryawanshi A, Agarwal M, Singh BP, Joshi P. Mapping the

complement C1q binding site in Haemonchus contortus calreticulin. Mol Biochem

Parasitol. 2009;166(1):42-6. doi: 10.1016/j.molbiopara.2009.02.007. PubMed PMID:

19428671.

215. Sirisinha S, Rattanasiriwilai W, Puengtomwatanakul S, Sobhon P, Saitongdee

P, Koonchornboon T. Complement-mediated killing of Opisthorchis viverrini via

activation of the alternative pathway. Int J Parasitol. 1986;16(4):341-6. doi:

10.1016/0020-7519(86)90112-8. PubMed PMID: 3744673.

216. Marikovsky M, Levi-Schaffer F, Arnon R, Fishelson Z. Schistosoma mansoni:

killing of transformed schistosomula by the alternative pathway of human

complement. Exp Parasitol. 1986;61(1):86-94. doi: 10.1016/0014-4894(86)90138-4.


217. Goto H, Sanchez MCA. Does the complement system work for or against the

host during parasite infections. Int Trends Immun. 2013;1(2):11-23. PubMed PMID:

218. Zhao L, Shao S, Chen Y, Sun X, Sun R, Huang J, et al. Trichinella spiralis

Calreticulin Binds Human Complement C1q As an Immune Evasion Strategy. Front

Immunol. 2017;8:636. doi: 10.3389/fimmu.2017.00636. PubMed PMID: 28620388.

219. Paidassi H, Tacnet-Delorme P, Verneret M, Gaboriaud C, Houen G, Duus K,

et al. Investigations on the C1q-calreticulin-phosphatidylserine interactions yield new

insights into apoptotic cell recognition. J Mol Biol. 2011;408(2):277-90. doi:

10.1016/j.jmb.2011.02.029. PubMed PMID: 21352829.

220. Bobak DA, Gaither TA, Frank MM, Tenner AJ. Modulation of FcR function

by complement: subcomponent C1q enhances the phagocytosis of IgG-opsonized

Ref. code: 25605412330010EAN

164

targets by human monocytes and culture-derived macrophages. J Immunol.

1987;138(4):1150-6. PubMed PMID: 3492544.

221. Ogden CA, deCathelineau A, Hoffmann PR, Bratton D, Ghebrehiwet B,

Fadok VA, et al. C1q and mannose binding lectin engagement of cell surface

calreticulin and CD91 initiates macropinocytosis and uptake of apoptotic cells. J Exp

Med. 2001;194(6):781-95. doi: 10.1084/jem.194.6.781. PubMed PMID: 11560994.

222. Navratil JS, Watkins SC, Wisnieski JJ, Ahearn JM. The globular heads of C1q

specifically recognize surface blebs of apoptotic vascular endothelial cells. J

Immunol. 2001;166(5):3231-9. doi: 10.4049/jimmunol.166.5.3231 PubMed PMID:

11207277.

223. Thielens NM, Tedesco F, Bohlson SS, Gaboriaud C, Tenner AJ. C1q: A fresh

look upon an old molecule. Mol Immunol. 2017;89:73-83. doi:

10.1016/j.molimm.2017.05.025. PubMed PMID: 28601358.

224. Wu Z, Boonmars T, Boonjaraspinyo S, Nagano I, Pinlaor S, Puapairoj A, et al.

Candidate genes involving in tumorigenesis of cholangiocarcinoma induced by

Opisthorchis viverrini infection. Parasitol Res. 2011;109(3):657-73. doi:

10.1007/s00436-011-2298-3. PubMed PMID: 21380578.

225. Mesaeli N, Nakamura K, Zvaritch E, Dickie P, Dziak E, Krause KH, et al.

Calreticulin is essential for cardiac development. J Cell Biol. 1999;144(5):857-68.

doi: 10.1083/jcb.144.5.857 PubMed PMID: 10085286.

226. Lee W, Kim KR, Singaravelu G, Park BJ, Kim DH, Ahnn J, et al. Alternative

chaperone machinery may compensate for calreticulin/calnexin deficiency in

Caenorhabditis elegans. Proteomics. 2006;6(4):1329-39. doi:

10.1002/pmic.200500320. PubMed PMID: 16404716.

Ref. code: 25605412330010EAN

165

APPENDICES

Ref. code: 25605412330010EAN

166

APPENDIX A

SPECIFICATIONS OF DNA VECTORS

1. pGEM®‐T Easy

Ref. code: 25605412330010EAN

167

2. pQE‐30 expression vector

Ref. code: 25605412330010EAN

168

3. pET21b(+) expression vector

Ref. code: 25605412330010EAN

169

Ref. code: 25605412330010EAN

170

APPENDIX B

REAGENT PREPARATIONS

1. Antibiotics stock solution

1.1 Ampicillin stock solution (100 mg/ml)

Dissolve 1 g of ampicillin in 10 ml distilled water, sterilize by

filtration through a 0.22 μm filter, aliquot into 1.5 ml microcentrifuge tubes, and store

at −20°C.

1.2 Chloramphenicol (34 mg/ml)

Dissolve 340 mg of chloramphenicol in 10 ml absolute ethanol,

aliquot into 1.5 ml microcentrifuge tubes, and store at −20°C.

1.3 Kanamycin stock solution (25 mg/ml)

Dissolve 250 mg of kanamycin in 10 ml distilled water, sterilize by

filtration through a 0.22 μm filter, aliquot into 1.5 ml microcentrifuge tubes, and store

at −20°C.

1.4 Tetracycline stock solution (12.5 mg/ml)

Dissolve 125 mg of tetracycline hydrochloride in 10 ml distilled

water, sterilize by filtration through a 0.22 μm filter, aliquot into 1.5 ml

microcentrifuge tubes, and store at −20°C.

2. Media for E. coli bacterial culture

2.1 Luria Bertani (LB) Broth (1,000 ml)

Bacto peptone 10 g

Bacto yeast extract 5 g

NaCl 5 g

Dissolve all components in 1,000 ml distilled water, sterilize the

broth by autoclaving, and store at room temperature.

Ref. code: 25605412330010EAN

171

2.2 LB agar plates

Bacto peptone 10 g

Bacto yeast extract 5 g

NaCl 5 g

Agar 15 g

Dissolve all components in 1,000 ml DW, sterilize the agar by

autoclaving, allow the media to cool down to about 60°C, pour into petri dishes, allow

to harden for several hours at room temperature, and store the plates at 4°C.

3. General buffers/stock solutions

3.1 1 M CaCl2

Dissolve 11 g CaCl2 in ultrapure water to a final volume of 100 ml,

sterilize by autoclaving, and store at room temperature.

3.2 DEPC-treated water

Add 1 ml of DEPC solution to 1000 ml ultrapure water, shake well,

remove CO2 by placing the uncapped bottle in a fume hood for overnight, sterilize the

solution by autoclaving, and store at room temperature.

3.3 0.5 M EDTA

Dissolve 18.6 g EDTA·Na2·2H2O in ultrapure water, adjust the pH

to 8.0 with NaOH, add ultrapure water to complete the volume, sterilize the solution

by autoclaving, and store at room temperature.

3.4 Ethidium bromide

Dissolve 1 g ethidium bromide in 100 ml sterile ultrapure water,

mix vigorously and carefully, and store at room temperature in a dark container.

3.5 2 M Glucose

Dissolve 18 g glucose in 100 ml ultrapure water, sterilize by

filtration through a 0.22 μm membrane filter, aliquot and store at −20°C.

3.6 60% (v/v) Glycerol

Mix 60 ml of glycerol with 40 ml ultrapure water, sterilize the


Ref. code: 25605412330010EAN

172

3.7 1 M IPTG

Dissolve 2.38 g IPTG in 10 ml ultrapure water, sterilize by filtration

through a 0.22 μm membrane filter, aliquot and store at −20°C.

3.8 1 M MgCl2

Dissolve 9.5 g MgCl2 in ultrapure water to a final volume of 100 ml,

sterilize by filtration through a 0.22 μm membrane filter, and store at room

temperature.

3.9 0.85% (w/v) NaCl

Dissolve 8.5 g NaCl in 1,000 ml distilled water, sterilize the


3.10 5 M NaCl

Dissolve 29.2 g NaCl in 100 ml ultrapure water, sterilize the


3.11 5 N NaOH

Dissolve 20 g NaOH pellets in 100 ml sterile ultrapure water, and

store at room temperature.

3.12 10 mM Phosphate buffered saline (PBS) (10X)

Per liter:

Na2HPO4 14.4 g

KH2PO4 2.4 g

NaCl 80 g

KCl 2 g

Dissolve all components in 800 ml ultrapure water, adjust the pH to

7.2–7.4 by adding HCl, adjust the volume to 1,000 ml with ultrapure water, sterilize

the solution by autoclaving, and store at room temperature.

3.13 20% (w/v) SDS

Dissolve 20 g SDS in 100 ml sterile ultrapure water, and store at

room temperature.

3.14 Tris-buffered saline (10X TBS)

0.2 M Tris-base

1.5 M NaCl

Ref. code: 25605412330010EAN

173

Dissolve all components in ultrapure water, adjust the pH to 7.5

with HCl, sterilize the solution by autoclaving, and store at room temperature.

3.15 1 M Tris-HCl

Dissolve 12.114 g Tris-base in 80 ml ultrapure water, adjust the pH

as required with HCl, adjust volume to 100 ml, sterilize the solution by autoclaving,

and store at room temperature.

4. Reagents for agarose gel electrophoresis

4.1 DNA/RNA agarose gel loading buffer (10X)

50% (v/v) Glycerol

0.25% (w/v) Bromophenol blue

0.25% (w/v) Xylene cyanol FF

Mix all components in sterilized ultrapure water, aliquot into 1.5 ml

microcentrifuge tubes, and store at 4°C. In case of RNA, prepare by using DEPC‐

treated water.

4.2 Tris‐Boric EDTA (TBE) buffer stock (5X)

Per liter:

Tris-base 52 g

Boric acid 27.5 g

Disodium EDTA·2H2O 4.56 g

Dissolve all components in 800 ml distilled water, adjust the pH to

8.0 by adding HCl, adjust the volume to 1,000 ml, and store at room temperature.

4.3 Tris-Boric EDTA (TBE) running buffer (0.5X)

Dilute 100 ml of 5X TBE buffer with 900 ml distilled water, add 50

μl ethidium bromide stock solution, mix well, and store at room temperature.

Ref. code: 25605412330010EAN

174

5. Reagents for ELISA

5.1 Antibody diluents

5.1.1 0.25% (w/v) BSA in 10 mM PBS, pH 7.2

Dissolve 25 mg BSA in 10 ml of 10 mM PBS,pH 7.2, and

store at 4°C.

5.1.2 0.5 % (w/v) skim milk in 10 mM PBS, pH 7.2

Dissolve 50 mg BSA in 10 ml of 10 mM PBS,pH 7.2, and

store at 4°C.

5.2 Blocking solutions

5.2.1 0.25% (w/v) BSA in carbonate coating buffer, pH 9.6

Dissolve 50 mg BSA in 20 ml of carbonate coating buffer,

and keep at 4°C until use.

5.2.2 0.5 % (w/v) skim milk in 10 mM PBS, pH 7.2

Dissolve 100 mg skim milk in 20 ml of 10 mM PBS, pH 7.2,

stir until homogenous, and keep at 4°C until use.

Ref. code: 25605412330010EAN

175

5.3 Carbonate coating buffer

30 mM Na2CO3

75 mM NaHCO3

Dissolve all components in ultrapure water, adjust the pH to 9.6,

sterilize the solution by autoclaving, and store at 4°C.

5.4 Washing buffer (prepare fresh)

10 mM PBS, pH 7.2 999.5 ml

Tween® 20 0.5 ml

6. Reagents for GST‐tagged protein purification

6.1 Extraction/loading buffer pH 7.5

10 mM NaH2PO4

1.8 mM KH2PO4

140 mM NaCl


sterilize the solution by autoclaving, and store at room temperature.

6.2 Elution buffer pH 8.0 (prepare fresh)

33 mM reduced glutathione

50 mM Tris‐HCl

Dissolve 100 mg of reduced glutathione in 10 ml of 50 mM Tris-

Base, pH 10.23, adjust the pH to 8.0, and store at 4°C or on ice.

7. Reagents for immunohistochemistry

7.1 Antibody diluent (1% BSA in PBS)

Dissolve 100 mg BSA in 10 ml of 10 mM PBS, pH 7.2, and store at

4°C.

7.2 Blocking solution (4% BSA in PBS)

Dissolve 400 mg BSA in 10 ml of 10 mM PBS, pH 7.2, and store at

4°C.

Ref. code: 25605412330010EAN

176

7.3 Epitope retrieval buffers

7.3.1 Sodium citrate buffer

10 mM sodium citrate

0.05% (v/v) Tween® 20

Dissolve sodium citrate in sterile ultrapure water, adjust the

pH to 6.0, add Tween® 20, and mix well.

7.3.2 Tris‐EDTA buffer

10mM Tris‐Base

1mM EDTA

0.05% (v/v) Tween® 20

Dissolve Tris‐Base in sterile ultrapure water, add EDTA

(from 0.5 M EDTA, pH 8.0 stock solution), adjust the pH to 9.0, add Tween® 20, and

mix well.

7.4 Fixing solution (4% paraformaldehyde)

Dissolve 4 g of paraformaldehyde in 10 ml 0.1 M PBS, pH 7.2 and

70 ml ultrapure water by adding 1 drop of 2 N NaOH and heating at 65°C, adjust

volume to 100 ml by adding ultrapure water, and store at 4°C.

7.5 Gelatin solution (glass‐slide coating solution)

0.3% (w/v) Gelatin

0.05% (w/v) Chromium potassium sulfate

Add all components to sterile ultrapure water, stir and heat the

solution at 60°C until all components are dissolved, and cool down to room

temperature before use.

7.6 Glycine blocking solution (0.1% glycine in PBS)

Dissolve 100 mg glycine in 100 ml of 10 mM PBS, pH 7.2, and


7.7 Mounting medium (10% glycerol in PBS)

Glycerol 10 ml

10X PBS, pH 7.2 10 ml

Distilled water 80 ml

Mix all above solutions, sterile the solution by autoclaving, and


Ref. code: 25605412330010EAN

177


10 mM PBS, pH 7.2 999 ml

Tween® 20 1 ml

8. Reagents for Native‐PAGE

8.1 Native electrophoresis buffer

25 mM Tris‐base

202 mM glycine

Dissolve all components in sterile distilled water, and store at room

temperature.

8.2 Native sample electrophoresis buffer (2X)

120 mM Tris‐HCl, pH 6.8

0.05% (w/v) Bromophenol Blue

01% (w/v) DTT

20% (v/v) glycerol

Dissolve all components in sterile ultrapure water, add glycerol as

the last component, aliquot into 1.5 ml microcentrifuge tubes, and store at −20°C.

9. Reagents for crude worm extraction

9.1 Soluble crude worm extraction buffer

10 mM PBS, pH 7.2

150 mM NaCl

1 mM EDTA

1 mM PMSF

0.5% (v/v) Triton X-100

Mix the first three components as stock solutions in sterile ultrapure

water, mix well, and add PMSF solution and Triton X-100 before use.

Ref. code: 25605412330010EAN

178

9.2 Insoluble crude worm extraction buffer

50 mM Tris‐HCl, pH 8.0

3% (w/v) SDS

Dissolve Tris‐Base in sterile ultrapure water, adjust the pH to 8.0,

add SDS solution (from 20% [w/v] SDS stock solution) to a final concentration of

3%, and mix well.

10. Reagents for plasmid DNA isolation (quick preparation)

10.1 Solution I

25 mM Tris-base

50 mM glucose

10 mM EDTA


sterilize the solution by autoclaving, and store at room temperature.

10.2 Solution II (prepare fresh before use)

0.1 N NaOH

1% (w/v) SDS

Dilute NaOH from stock solution (5 N NaOH) to a final

concentration of 0.1 N with sterile ultrapure water, and then add SDS from stock

solution (20% [w/v] SDS) stock solution to a final concentration of 1%.

10.3 Solution III

2.7 M potassium acetate, pH 4.8

Dissolve potassium acetate in ultrapure water, adjust the pH to 4.8

by glacial acetic acid, sterilize the solution by autoclaving, and store at room

temperature.

11. Reagents for protein purification under denaturing conditions

11.1 Denaturing lysis buffer

100 mM NaH2PO4

10 mM Tris-base

Ref. code: 25605412330010EAN

179

8 M Urea



11.2 Lysis buffer

100 mM NaH2PO4

10 mM Tris-base

8 M Urea

Dissolve all components in sterile ultrapure water, adjust the pH to

8.0 by using NaOH, and store at room temperature.

11.3 Washing buffer

100 mM NaH2PO4

10 mM Tris-base

8 M Urea



11.4 Elution buffer I

100 mM NaH2PO4

10 mM Tris-base

8 M Urea



11.5 Elution buffer II

100 mM NaH2PO4

10 mM Tris-base

8 M Urea


4.5 by using HCl, and store at room temperature.

12. Reagent for protein purification under native conditions

12.1 Native lysis buffer

50 mM NaH2PO4

Ref. code: 25605412330010EAN

180

300 mM NaCl

10 mM Imidazole


8.0, and store at room temperature.

12.2 Washing buffer

50 mM NaH2PO4

300 mM NaCl

20 mM Imidazole



12.3 Elution buffer

50 mM NaH2PO4

300 mM NaCl

250 mM Imidazole



13. Reagents for SDS-PAGE

13.1 10%(w/v) Ammonium persulfate

Dissolve 10 g ammonium persulfate in a total volume of 100 ml

sterile ultrapure water, aliquot into 1.5 ml microcentrifuge tubes, and store at −20°C.

13.2 Coomassie blue staining solution

0.025% (w/v) Coomassie Blue R-250

40% (v/v) Methanol

7% (v/v) Acetic acid

Dissolve Coomassie Blue R-250 dye in distilled water and

methanol, finally add acetic acid, store at room temperature.

13.3 Electrophoresis buffer

25 mM Tris‐base

202 mM glycine

0.1% (w/v) SDS

Ref. code: 25605412330010EAN

181

Dissolve all components in sterile distilled water, and store at room

temperature.

13.4 High‐methanol destaining solution

40% (v/v) Methanol


Dilute absolute methanol in distilled water, finally add acetic acid,


13.5 Low‐methanol destaining solution

5% (v/v) Methanol


Dilute absolute methanol in distilled water, finally add acetic acid,


13.6 Sample electrophoresis buffer (2X)

0.125 M Tris-HCl, pH 6.8

4% (w/v) SDS

0.2 M DTT

0.02% (w/v) Bromophenol blue

20% (v/v) Glycerol

Dissolve all components in sterile ultrapure water, add glycerol as

the last component, aliquot into 1.5 ml microcentrifuge tubes, and store at −20°C.

14. Reagent for transacetylase activity

14.1 0.25 M Potassium phosphate buffer, pH 6.5

KH2PO4 6.315 g

K2HPO4 2.795 g

Dissolve all the components in 500 ml ultrapure water, adjust the

pH to 6.5, sterilize the solution by autoclaving, and store at room temperature.

Ref. code: 25605412330010EAN

182

15. Reagents for Western blot analysis

15.1 Antibody diluent (1% skim milk in TBS)

Dissolve 100 mg skim milk in 10 ml TBS, pH 7.5, stir the solution

until homogenous, and keep at 4°C until use.

15.2 Blocking solution (5% skim milk in TBS)

Dissolve 500 mg skim milk in 10 ml TBS, pH 7.5, stir the solution

until homogenous, and keep at 4°C until use.

15.3 Detection buffer, pH 9.5

0.1 M Tris‐HCl

0.1 M NaCl

50 mM MgCl2

Mix all above stock solutions in sterilized ultrapure water, adjust

the pH to 9.5 with NaOH, store at room temperature.

15.4 Ponceau S dye solution

0.1% (w/v) Ponceau S dye


Dissolve Ponceau S dye in sterile distilled water, add acetic acid to

complete the volume, and store at room temperature.

15.5 Semi-dry transfer buffer

50 mM Tris-base

40 mM Glycine

0.04% (w/v) SDS

20% (v/v) Methanol

Dissolve all powder components in sterile ultrapure water, add

methanol to complete the volume, and store at 4°C in a tight container.


10 mM PBS, pH 7.2 999.5 ml

Tween® 20 0.5 ml

Ref. code: 25605412330010EAN

183

APPENDIX C

ANIMAL ETHICAL PERMISSION

Ref. code: 25605412330010EAN

184

APPENDIX D

HUMAN ETHICAL PERMISSION

Ref. code: 25605412330010EAN

185

BIOGRAPHY

Name Miss Wanlapa Chaibangyang

Date of birth October 28, 1984

Educational attainment

2003–2006 Bachelor of Science (B.Sc.) in Medical Technology

with Second class honors, Faculty of Allied Health

Sciences, Thammasat University

2011–2017 Doctor of Philosophy (Ph.D.) in Biomedical Sciences,

Graduate Program in Biomedical Sciences,

Faculty of Allied Health Sciences,


Scholarship The Royal Golden Jubilee Ph.D. Scholarship (13th

)

under the supervision of Assoc. Prof. Dr. Hans Rudi

Grams from the Thailand Research Fund and


Publication

1. Chaibangyang W, Geadkaew-Krenc A, Vichasri-Grams S, Tesana S, Grams R.

Molecular and Biochemical Characterization of Opisthorchis viverrini Calreticulin.


PMID: 29320819.

Work Experience 2007–2011: Medical Technologist, Mahachai

Hospital, Samutsakhon, Thailand

License and Training attended

1. Undergraduate research trainee at the Protein‐Ligand Engineering and Molecular

Biology Research Laboratory, National Center for Genetic Engineering and

Ref. code: 25605412330010EAN

186

Biotechnology (BIOTEC), National Science and Technology Development Agency

(NSTDA), Pathumthani, Thailand (2006)

2. Student trainee (Medical Technology) in diagnostic laboratory at Thammasat

Hospital, Pathumthani, Thailand (2006)

3. Student trainee (Medical Technology) in diagnostic laboratory at Vajira Hospital,

Bangkok, Thailand (2007)

4. License on Medical Technologist from The Medical Technology Council of

Thailand (2007–present)

5. Human Ethics Training, March 21st, 2014, Faculty of Allied Health Sciences,

Thammasat University, Pathumthani, Thailand

6. Animal Ethics Training, June 9th

, 2014, Faculty of Allied Health Sciences,

Thammasat University, Pathumthani, Thailand

7. Training in Ethical Principles and Guidelines for the Use of Animals for

Scientific Purposes, January 20th

, 2015, Thammasat University, Pathumthani,

Thailand

8. Biosafety training, July 15th

, 2015, Thammasat University, Pathumthani,

Thailand

9. Genomic Epidemiology Workshop in Asian Institute in Statistical Genetics and

Genomics (1st Asian Workshop), December 18

th, 2017, Faculty of Allied Health

Sciences, Thammasat University, Pathumthani, Thailand

10. Informatics for RNA‐seq analysis Workshop in Asian Institute in Statistical

Genetics and Genomics (1st Asian Workshop), December 19

th, 2017, Faculty of Allied

Health Sciences, Thammasat University, Pathumthani, Thailand

Seminar and Conferences attended

1. The 3rd

ASEAN Federation of Hematology Congress (AFH 2014), October 23rd

–

25th

, 2014, the Centara Grand and Bangkok Convention Centre at Centralworld,

Bangkok, Thailand

2. The 1st International Allied Health Sciences Conference, November 4

th–6

th, 2014,

Rama Gardens Hotel, Bangkok, Thailand

Ref. code: 25605412330010EAN

187

3. The 2nd

Joint Symposium of BK21‐PLUS of CUK and Thammasat University,

January 21st–23

rd, 2015, Thammasat University, Pathumthani, Thailand

4. The Joint Symposium of Universiti Kebangsaan Malaysia and Thammasat

University 2015, May 27th

–28th

, 2015, Universiti Kebangsaan Malaysia, Kuala

Lumpur, Malaysia

5. RMIT Animal Ethics Seminar, October 28th

, 2016, RMIT University (Bundoora

Campus), Victoria, Australia

6. The Royal Golden Jubilee‐Ph.D. Congress 18, June 8th

–10th

, 2017, Richmond

Stylish Convention Hotel, Nonthaburi, Thailand

Poster Presentation

1. Chaibangyang W., Geadkaew A.,Grams R., Molecular Cloning of Calreticulin

from the Human Liver Fluke Opisthorchis viverrini, November 4th

–6th

, 2014, The 1st

International Allied Health Sciences Conference, Rama Gardens Hotel, Bangkok,

Thailand

Oral Presentations

1. Chaibangyang W., Geadkaew A., Grams R., Characterization of calreticulin from

the human liver fluke Opisthorchis viverrini, The Joint Symposium of Universiti

Kebangsaan Malaysia and Thammasat University 2015, May 27th

–28th

, 2015,UKM

,Kuala Lumpur, Malaysia

2. Chaibangyang W., Geadkaew A., Grams R., Molecular and biochemical

characterization of calreticulin from the human liver fluke, Opisthorchis viverrini,

The Royal Golden Jubilee‐Ph.D. Congress 18, June 8th

–10th

, 2017, Richmond Stylish

Convention Hotel, Nonthaburi, Thailand

Ref. code: 25605412330010EAN

Molecular cloning and functional characterization ... - doi@nrct

Documents

Transcript of Molecular cloning and functional characterization ... - doi@nrct