Modulation of Inducible Nitric Oxide Synthase Activation by Immuno-suppressive Drugs

INFECTION AND IMMUNITY, Nov. 2002, p. 6424–6435 Vol. 70, No. 110019-9567/02/$04.00�0 DOI: 10.1128/IAI.70.11.6424–6435.2002Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Modulation of Inducible Nitric Oxide Synthase Expression by theAttaching and Effacing Bacterial Pathogen Citrobacter

rodentium in Infected MiceBruce A. Vallance,1 Wanyin Deng,1 Myriam De Grado,1 Crystal Chan,1

Kevan Jacobson,2 and B. Brett Finlay1*Biotechnology Laboratory, University of British Columbia,1 and Department of Pediatrics, Division of

Gastroenterology, British Columbia Children’s Hospital,2 Vancouver, British Columbia,Canada V6T 1Z3

Received 14 May 2002/Returned for modification 20 June 2002/Accepted 8 August 2002

Citrobacter rodentium belongs to the attaching and effacing family of enteric bacterial pathogens that includesboth enteropathogenic and enterohemorrhagic Escherichia coli. These bacteria infect their hosts by colonizingthe intestinal mucosal surface and intimately attaching to underlying epithelial cells. The abilities of thesepathogens to exploit the cytoskeleton and signaling pathways of host cells are well documented, but theirinteractions with the host’s antimicrobial defenses, such as inducible nitric oxide synthase (iNOS), are poorlyunderstood. To address this issue, we infected mice with C. rodentium and found that iNOS mRNA expressionin the colon significantly increased during infection. Immunostaining identified epithelial cells as the majorsource for immunoreactive iNOS. Finding that nitric oxide (NO) donors were bacteriostatic for C. rodentiumin vitro, we examined whether iNOS expression contributed to host defense by infecting iNOS-deficient mice.Loss of iNOS expression caused a small but significant delay in bacterial clearance without affecting tissuepathology. Finally, immunofluorescence staining was used to determine if iNOS expression was localized toinfected cells by staining for the C. rodentium virulence factor, translocated intimin receptor (Tir), as well asiNOS. Interestingly, while more than 85% of uninfected epithelial cells expressed iNOS, fewer than 15% ofinfected (Tir-positive) cells expressed detectable iNOS. These results demonstrate that both iNOS and intes-tinal epithelial cells play an active role in host defense during C. rodentium infection. However, the selectiveexpression of iNOS by uninfected but not infected cells suggests that this pathogen has developed mechanismsto locally limit its exposure to host-derived NO.

Enteropathogenic (EPEC) and enterohemorrhagic (EHEC)Escherichia coli are important causative agents of infectiousdiarrhea, belonging to a family of related pathogenic bacteriathat together infect a wide range of animal species, includinghumans (16, 29, 43, 62). Unlike the enteroinvasive bacterialpathogens Salmonella and Shigella, EPEC and EHEC are non-invasive and infect their hosts by attaching to the surface ofintestinal epithelial cells (4, 43). Following their initial ad-herence, these pathogens form attaching and effacing (A/E)lesions on infected epithelial cells, characterized by the efface-ment of microvilli and the production of pedestal-like struc-tures beneath the adherent bacteria. All A/E pathogens sharea homologous DNA region called the LEE (locus of enterocyteeffacement), a pathogenicity island required for A/E lesionformation (9, 20, 43, 67). The LEE encodes a type III secretionapparatus and several virulence factors, including the secretedproteins EspA, EspB, and EspD, as well as the outer mem-brane adhesin intimin and the translocated intimin receptor(Tir) (30). These proteins are critical for the intimate attach-ment of A/E pathogens to host cells, as well as for their abilityto cause disease (1, 45).

To successfully infect their hosts, A/E pathogens must notonly subvert the cytoskeleton of intestinal epithelial cells butalso encounter and survive the host’s innate and immune de-fenses. Although few studies have examined these interactions,intestinal biopsy samples taken from children suffering fromEPEC infection displayed significant intestinal inflammation,crypt hyperplasia, and tissue damage (12, 26, 28). Furthermore,testing of convalescent-phase sera as well as peripheral bloodlymphocytes from volunteer studies indicates that EHEC andEPEC infections induce strong humoral and cellular immuneresponses (37, 59). Other studies indicate that the infectedepithelial cells themselves may play an active role in the hostinflammatory response, as EPEC attachment to cultured epi-thelial cells triggers NF-�B activation and the release of inter-leukin-8 (IL-8) (23, 50–52). In related studies, EPEC infectionhas been shown to activate mitogen-activated protein kinasepathways in host cells (7, 8, 53). In contrast, EPEC has beenfound to undermine the actions of professional immune cells,at least in vitro. A toxin secreted by EPEC can inhibit cytokineproduction by T lymphocytes (31, 32), while EPEC infectionimpairs the phagocytic ability of macrophages through a phos-phatidylinositol 3-kinase-dependent mechanism (5, 21).

Despite these observations, it remains to be determined ifepithelial cells actually play an active role during infection invivo and to what degree innate and immune responses con-tribute to host defense or instead become subverted by A/Epathogens. Furthering our understanding in this area has been

* Corresponding author. Mailing address: Biotechnology Labora-tory, Room 237, Wesbrook Building, 6174 University Blvd., Universityof British Columbia, Vancouver, British Columbia, Canada V6T 1Z3.Phone: 604-822-2210. Fax: 604-822-9830. E-mail: [email protected].

6424

on February 12, 2016 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

limited by the inability of EPEC and EHEC to infect and causeA/E lesions in laboratory animal species. Fortunately, there areseveral veterinary A/E pathogens that infect their hosts in amanner similar to EPEC and EHEC (3, 43, 48). Our laboratory(8, 9, 61) and others (3, 24, 40) have used Citrobacter roden-tium, the causative agent of transmissible murine colonic hy-perplasia, to model these infections. So far, studies have iden-tified the elevated expression of several Th1 cytokines,including gamma interferon (IFN-�), that contribute to bothhost defense and tissue damage in the inflamed colons ofinfected mice (24, 25, 57). Another element of host defense,nitric oxide (NO), is a central component of innate immunityand an effective antimicrobial agent. Unlike the constitutiveNO synthases, the inducible form of nitric oxide synthase(iNOS) can produce large quantities of reactive nitrogen in-termediates (RNI) such as nitrite and S-nitrosoglutathione(GSNO) (39, 44), as well as NO at concentrations that canexert antimicrobial effects. Increased expression of iNOS isfrequently observed during colonic inflammation (35, 38, 46)and is induced in response to both IFN-� (34, 49) and bacteriallipopolysaccharide (15, 33). Therefore, iNOS expression andthe subsequent release of NO could contribute not only to hostdefense but also to the tissue damage seen during A/E patho-gen infections.

To assess the potential role of iNOS in A/E pathogen infec-tions, we infected wild-type mice with C. rodentium and exam-ined iNOS expression. Finding that epithelial cells stronglyexpressed iNOS during infection, we also studied the effects ofchemical sources of NO on C. rodentium growth in vitro andmonitored the course of C. rodentium infections in mice lack-ing iNOS. Our findings demonstrate that iNOS expressioncontributes to C. rodentium clearance but, more importantly,that epithelial cells play an active role in host defense duringinfection by an A/E lesion-causing bacterial pathogen. None-theless, when we examined the proximity of iNOS staining tobacterial attachment, iNOS was selectively expressed by unin-fected but not infected epithelial cells. These results suggestthat, although the host response to C. rodentium infection leadsto upregulation of iNOS expression, this pathogen has devel-oped mechanisms to locally limit its exposure to host-derivedNO.

MATERIALS AND METHODS

Mice. Three- to four-week-old iNOS-deficient mice (65) (on a C57BL/6 back-ground) and wild-type C57BL/6 mice were obtained from Jackson Laboratories(Bar Harbor, Maine). Mice were kept in sterilized cages with filter tops, handledin tissue culture hoods, and fed autoclaved food and water under specific-pathogen-free conditions at our animal facilities. Sentinel animals were routinelytested for common pathogens. The protocols employed were in direct accor-dance with guidelines drafted by the University of British Columbia’s AnimalCare Committee and the Canadian Council on the Use of Laboratory Animals.

Bacterial strains and infection of mice. Mice were orally inoculated with eitherthe wild-type C. rodentium (formerly Citrobacter freundii biotype 4280) strainDBS100 (55) or the type III secretion mutant (�escD). For inoculations, bacteriawere grown overnight with shaking in Luria broth (LB) at 37°C. Mice wereinfected by oral gavage with 0.1 ml of LB containing approximately 2.5 � 108

CFU of C. rodentium. To minimize any differences between infections, bothwild-type and iNOS-deficient mice were infected with the same bacterial prep-aration. Mice were sacrificed at various time points postinfection (p.i.), andtissues were prepared for histological analysis, viable bacterial counts, or RNAisolation as described below.

C. rodentium �escD possesses a phenotype similar to that of the correspondingEPEC mutant in that it does not secrete effector proteins and is unable to cause

pedestals on host cells in tissue culture. �escD was generated as follows. A PCRfragment (3.75 kb) containing the escD gene as well as flanking regions from 2.2kb upstream and 0.4 kb downstream of the escD gene was cloned into pCR2.1-TOPO to create pTOPO-ISDL. The primers used for the PCR were Seq-1 andSeq-6. The template pTOPO-ISDL was used for inverse PCR (Elongase) withdeletion primers �escD� and �escD� to create an internal deletion and trun-cation in the escD gene. About 471 bp of the escD gene (from codons 26 to 149)was deleted. A BamHI site and a stop codon were introduced into the site ofdeletion. The inverse PCR product was treated with Klenow enzyme and T4polynucleotide kinase and then gel purified before self-ligation and transforma-tion into DH10B. The escD gene with the internal deletion was subcloned as anXbaI-SacI fragment into the suicide vector pRE118 (XbaI-SacI) along with itsflanking regions and used for allelic exchange in wild-type C. rodentium.

Survival and body weight measurement. The systemic effects of C. rodentiuminfection on the host, the survival of infected mice, as well as changes in theirbody weight were measured over the course of infection. Mice were weighed justprior to infection, as well as at 4-day intervals until day 24 p.i. Survival data arepresented as the percentages of the initial 12 mice still surviving at the end of theexperiment.

Tissue collection. Over the course of the infection, mice were euthanized and,following careful dissection, the first 4 cm of the colon beginning at the analverge was collected. Fecal pellets were removed before the tissue was weighed.Tissues were then placed in 10% neutral-buffered formalin (Sigma) for histo-logical analysis, or the colon plus fecal pellets were collected in phosphate-buffered saline, pH 7.4, and kept on ice before being processed for viablebacterial counts.

Histology. Full-thickness colonic tissues were fixed in 10% neutral-bufferedformalin. Sections (3 �m) were cut and stained with hematoxylin and eosin stain.Photomicrographs were taken using a Nikon Eclipse E400 microscope. Cryptheights were measured by micrometry by an observer blinded to the experimen-tal condition, with 10 measurements being taken in the distal colon of eachmouse. Only well-oriented crypts were measured.

Bacterial counts. Colonic tissues plus any fecal pellets were homogenized at alow speed with a Kinematica tissue homogenizer (Brinkmann). Homogenateswere serially diluted and plated onto MacConkey agar plates (selective forgram-negative organisms). Bacterial colonies were enumerated the followingday. C. rodentium colonies were easily distinguished from colonies derived fromcommensal flora by their size and appearance (pink center with white rim), aspreviously described (54, 55). The validity of this approach was verified by PCRanalysis for LEE genes.

C. rodentium response to GSNO and SNP. To test the in vitro effects of NO onthe growth of C. rodentium, wild-type cultures were grown in LB overnight at37°C in a shaking incubator. The cultures were divided in half, with those culturesreceiving the NO donor sodium nitroprusside (SNP; Sigma) diluted to 106

CFU/ml in LB at pH 7.0, while those receiving the NO releaser GSNO (AlexisBiochemicals) were diluted in LB at pH 5.0 (the optimal pH for GSNO) (58).Different doses of the compounds were then added to the cultures, which wereincubated with shaking at 37°C for 4 h. Cultures were then serially diluted andplated onto LB plates. Bacterial colonies were enumerated the following day.

Modified Griess reaction for levels of NO. NO has an extremely short half-lifeand rapidly degrades to nitrate and nitrite. Thus, NO levels were determinedindirectly by measuring the total levels of these stable NO end products inplasma. In brief, blood samples were centrifuged and plasma was collected.Nitrate was reduced to nitrite by incubating the samples at room temperaturewith 0.05 U of nitrate reductase (Oxford Biomedical Research)/ml following themanufacturer’s instructions. Samples were then mixed in 96-well microtiterplates with Griess reagent (1% sulfanilamide, 0.1% naphthylethylenediaminedihydrochloride, 25% H3PO4) to measure nitrite levels. After 10 min, the opticaldensity was measured at 560 nm.

Immunostaining. Immunoperoxidase staining was performed using standardtechniques. In brief, tissues were rinsed with ice-cold phosphate-buffered saline,embedded in OCT (optimal cutting template) compound (Sakura Finetech),frozen with isopentane (Sigma) and liquid N2, and stored at �70°C. Serialsections were cut at a thickness of 6 �m and fixed in ice-cold acetone for 10 min.Endogenous peroxidase activity was blocked by treatment with 1% H2O2 inTris-buffered saline, pH 7.4, for 30 min. Tissues were then blocked with 1%bovine serum albumin. For iNOS detection, a rabbit polyclonal immunoglobulinG (IgG) antibody targeted against the carboxyl terminus of mouse iNOS (SC650; Santa Cruz Biotechnology, Santa Cruz, Calif.) was used. Detection wasperformed with goat anti-rabbit polyclonal IgG conjugated to horseradish per-oxidase by using 3-amino-9-ethyl carbazole as the chromogen source. Specificitywas confirmed by performing the staining with the omission of the primaryantibody. Photomicrographs were taken using Nikon Eclipse E400 microscope.

VOL. 70, 2002 ROLE OF iNOS DURING CITROBACTER RODENTIUM INFECTION 6425


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Immunofluorescence staining was performed in a fashion similar to that usedfor immunoperoxidase staining. Following acetone fixation, tissue sections weredirectly blocked with 1% bovine serum albumin, followed by the addition of therabbit anti-iNOS polyclonal antibody or rabbit anti-E. coli serum no. 8 (BiotechLabs, Ipswich, England) as well as rat anti-C. rodentium His-Tir serum generatedin the lab. Following extensive washing with Tris-buffered saline, Alexa488-conjugated goat anti-rabbit as well as biotinylated goat anti-rat polyclonal IgGantibodies were added. Following incubation, the tissues were again washed,followed by the addition of streptavidin labeled with Alexa568. Finally, 1 �g of4�,6�-diamidino-2-phenylindole (DAPI; Sigma)/ml was used to stain the host cellDNA. Coverslips were mounted in Mowiol mounting medium (Aldrich) andviewed at 350, 488, and 594 nm on a Zeiss Axiophot epifluorescence microscope.

For studies examining whether iNOS and Tir expression colocalized to thesame cells, we examined at least 10 randomly chosen high-power fields in thedistal colon of each mouse, with four mice tested per group. Using DAPI stainingto estimate epithelial cell numbers, we counted the number of epithelial cells thatstained positively for one or both markers. Infected cells were characterized asmildly or heavily infected based on the number of focal sites of Tir expression,presumably equivalent to the number of attaching bacteria. Ten or fewer Tir focidesignated a cell as mildly infected; more than 10 designated it as heavilyinfected.

RNA extraction and semiquantitative PCR. Immediately following dissection,colonic tissues were transferred to 1 ml of TRIzol reagent (Gibco Life Technol-ogies), frozen in liquid N2, and stored at �70°C. RNA was purified according tothe manufacturer’s instructions. Total cellular RNA was isolated by homogeni-zation of the tissue in 2 ml of TRIzol reagent (Gibco Life Technologies). Fol-lowing incubation at room temperature for 5 min, RNA was extracted withchloroform (Sigma) and then centrifuged for 15 min at 12,000 � g and 4°C. Theaqueous phase was precipitated with an equal volume of isopropanol (Sigma)and subsequently centrifuged for 15 min at 12,000 � g and 4°C. The pellet waswashed with 70% ethanol and resuspended in 50 �l of water. Total RNA wasdetermined by spectrometric analysis. RNA was treated with DNase I (Clontech,Palo Alto, Calif.) to remove contaminant genomic DNA for 1.5 h in the presenceof the RNase inhibitor (Ambion, Austin, Tex.). A 10� termination mixture (0.1M EDTA [pH 8.0], 1 mg of glycogen/ml) was added to stop the reaction. Theenzyme was removed with phenol-chloroform extraction, and RNA was precip-itated with 2 volumes of ethanol and 1/10 volume of 3 M sodium acetate, pH 5.2.RNA was resuspended in 15 �l of diethyl pyrocarbonate-treated H2O containingthe RNase inhibitor and stored at �70°C. RNA was tested for the presence ofremaining DNA contamination by 35 cycles of PCR amplification with theglyceraldehyde-3-phosphate dehydrogenase (GAPDH)-specific primers CR127(AGAACATCATCCCTGCATCC) and CR128 (CTGGGATGGAAATTGTGAGG).

Reverse transcription (RT) was performed with Superscript (Gibco) accordingto the manufacturer’s instructions by using 3 �g of total RNA in each reactionmixture. cDNA was synthesized in 20-�l reaction mixtures with oligo(dT). PCRamplification was performed by using 0.5 �l of cDNA as template with thespecific primers for mouse iNOS CR104 (CAGAGGACCCAGAGACAAGA)and CR105 (ACCTGATGTTGCCATTGTTG). The following PCR conditionswere used: a 10-min denaturing step at 94°C and 35 cycles of 40 s at 94°C, 40 sat 61°C, and 50 s at 72°C. PCR products were analyzed by 1.5% ethidiumbromide-agarose gel electrophoresis.

Data presentation and statistical analysis. All the results were expressed asthe mean 1 standard error of the mean (SEM) from three independentexperiments; n refers to the number of mice tested. Statistical significance wascalculated by using the nonparametric Mann-Whitney U test. Multiple compar-isons were performed by using the Neuman-Keuls multiple-comparison test. A Pof 0.05 was considered significant.

RESULTS

C. rodentium infection induces iNOS mRNA expression inthe colon. C57BL/6 mice were infected with either wild-type C.rodentium or the type III secretion mutant �escD. This muta-tion eliminates the ability of C. rodentium as well as EPEC toform pedestals on tissue culture cells. Following oral inocula-tion into mice, �escD only transiently colonized the colon anddid not cause any appreciable tissue damage or disease (datanot shown). RT-PCR for iNOS was performed on tissues takenfrom uninfected mice as well as from mice infected 6 or 10 days

previously with the two isogenic C. rodentium strains. As shownin Fig. 1, iNOS mRNA levels were significantly increased byday 6 p.i. in mice infected with wild-type C. rodentium andexpression was further increased by day 10 p.i. In contrast, noincrease in iNOS mRNA expression was observed in tissuesfrom mice that received the �escD mutant, indicating that theinduction of iNOS mRNA required both the stable infection ofthe colon and C. rodentium possessing a functional type IIIsecretion system.

Immunoreactive iNOS expression is localized to colonic ep-ithelial cells. Based on the increased iNOS expression seen byRT-PCR, immunostaining was used to identify the cells ex-pressing iNOS in the colons of mice infected with wild-type C.rodentium. Few if any cells in uninfected colonic tissues wereimmunoreactive for iNOS (Fig. 2A). In contrast, by day 6 p.i.,more than 50% of the superficial epithelial cells in the infecteddistal colon expressed iNOS (data not shown). At this time,there was little inflammatory infiltrate and only a few iNOS-positive mononuclear cells could be detected within the laminapropria and submucosa. Compared to the number of epithelialcells that expressed iNOS, this cell population was negligible.By day 10 p.i., the inflammatory and pathological response toinfection had increased, with edema and epithelial hyperplasiathickening the colonic mucosa. At this time, the number ofiNOS-expressing cells had increased, as had the intensity of thestaining throughout the infected colon. Again, 50 to 60% of thesuperficial epithelial cells were immunoreactive for iNOS. Inaddition, many of the less mature epithelial cells found midwayalong the length of the colonic crypts as well as at their base(Fig. 2B) expressed iNOS. Higher magnification revealed thatiNOS expression by epithelial cells was focused along theirapical membrane (Fig. 2C). While the number of inflammatorycells in the infected colon was greater on day 10 p.i., there werestill only a small number that stained positively for iNOS. Asimilar pattern of iNOS expression was also seen at days 14 and18 p.i., but between days 21 and 24 p.i., iNOS expression, whilestill observed on epithelial cells, had begun to subside (data notshown).

Plasma nitrate and nitrite levels increase during infection.Since elevated iNOS expression was seen in the colon duringinfection, the levels of NO found in the plasma were alsoassessed. As NO rapidly degrades to nitrate and nitrite, we

FIG. 1. Infection by wild-type (wt) C. rodentium but not the type IIIsecretion mutant �escD leads to increased iNOS mRNA expression incolonic tissues. RT-PCR for iNOS demonstrated that infection ofimmunocompetent C57BL/6 mice with wild-type C. rodentium leads toa progressive and significant elevation in iNOS expression, as seen ondays 6 and 10 p.i., compared to that in uninfected (�) mice. In con-trast, infection with the �escD mutant did not induce iNOS mRNAexpression over the same time course. The housekeeping geneGAPDH was used to normalize RNA abundance.

6426 VALLANCE ET AL. INFECT. IMMUN.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

measured total levels of these end products in plasma by con-verting nitrate to nitrite and then measuring nitrite by using theGriess reaction. Uninfected mice had plasma nitrate levels of86.8 12.6 �M. At the peak of the infection (day 10 p.i.),levels had significantly increased to 147.6 11.2 �M (P 0.05) (n � 4 in three independent infections).

SNP and GSNO are bacteriostatic for C. rodentium in vitro.The bacteriostatic and bactericidal effects of RNI have beencharacterized for a number of bacterial species but not for A/Elesion-causing pathogens. The induction of iNOS expressionand the elevation of circulating NO levels during C. rodentiuminfection indicated that this pathogen would encounter ele-vated NO levels as it infected its host. Therefore, the effects ofthe NO donor SNP and the NO releaser GSNO on C. roden-tium growth were tested in vitro. As shown in Fig. 3A and B,both SNP and GSNO exhibited a dose-dependent inhibition ofbacterial growth. SNP proved more effective than GSNO atinhibiting bacterial growth, although this may partially reflectthe reduced basal bacterial growth seen at the low pH (pH 5.0)required for GSNO efficacy (58). At their most effective doses,SNP inhibited bacterial growth from an almost 1,000-fold in-crease down to less than 40-fold whereas GSNO inhibitedgrowth from 450-fold down to approximately 60-fold. It shouldbe noted that SNP in particular had a significant inhibitoryeffect on C. rodentium growth even at lower concentrations(100 �M).

iNOS deficiency does not affect morbidity in mice duringinfection. Based on the increased iNOS expression and NOlevels during infection and the finding that chemical sources ofNO had strong bacteriostatic effects on C. rodentium in vitro,we next assessed the role of iNOS during infection in vivo. Thecourse of C. rodentium infection in iNOS-deficient mice was

compared to that seen in wild-type C57BL/6 mice. Infectionled to reduced activity, ruffled fur, loose stool, and perianalfecal staining in both wild-type and iNOS-deficient mice. Asimilar degree and timing of weight loss was seen in bothmouse strains during infection (data not shown), with bodyweight dropping by as much as 15% from days 10 to 14 p.i.compared to that of age-matched uninfected mice. Infectionalso resulted in the deaths of a small number of mice betweendays 10 and 14 p.i. In a total of three infections, mortality ofwild-type mice averaged 24 12% whereas mortality wasreduced in iNOS-deficient mice to an average of 8 6%.Despite the trend towards reduced mortality in the iNOS-deficient mice, it did not reach statistical significance.

We also examined the circulating plasma NO levels underbasal and infected conditions in the two mouse strains byassaying both the nitrate and nitrite levels. In contrast to thesignificant increase in plasma NO levels found in infected wild-type mice (see above), levels in uninfected (74.0 9.4 �M)and infected (89.8 7.0 �M) iNOS-deficient mice were notsignificantly different (n � 4 in three independent infections).As well, staining of colonic tissues from infected and unin-fected iNOS-deficient mice for immunoreactive iNOS (datanot shown) confirmed their lack of iNOS protein expression.

iNOS expression accelerates bacterial clearance. We nextcompared the course of bacterial colonization and clearance inwild-type and iNOS-deficient mice by homogenizing whole co-lons and plating the homogenate in serial dilutions on selectivemedia. Both mouse strains were heavily colonized by C. roden-tium by day 6 p.i., with bacterial numbers increasing on days 10and 14 p.i. (Fig. 4). While there was a trend towards greaternumbers in the iNOS-deficient mice at the earlier time points(days 6 to 14 p.i.), the differences did not reach statistical

FIG. 2. C. rodentium infection leads to iNOS expression by colonic epithelial cells. Immunohistochemistry for immunoreactive iNOS wasperformed on colonic tissues taken from uninfected mice (A), as well as mice at day 10 p.i. (B and C). Little if any immunoreactive iNOS wasdetectable in the colons of C57BL/6 mice prior to infection (panel A) (original magnification, �100). By day 10 p.i., iNOS expression was seenalong much of the mucosal surface (arrows) of infected C57BL/6 mice, including deep in the crypts (arrowheads) and by some scattered cells inthe lamina propria (panel B) (original magnification, �100). Under higher magnification, iNOS expression could be seen focused at the apicalsurface of many epithelial cells (arrows). A few lamina propria mononuclear cells were also found to express iNOS (arrowheads) (panel C) (originalmagnification, �400).



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

significance. By day 18 p.i., however, the numbers of C. roden-tium bacteria within the colon began to drop and this clearanceoccurred more rapidly in the wild-type mice than in the iNOS-deficient mice. Bacterial counts were significantly greater (by10- to 100-fold) in the iNOS-deficient mice than those in thewild-type mice at days 18, 21, and 24 p.i. (P 0.05).

C. rodentium cells are found deeper in the crypts of iNOS-deficient mice. As recently described for the infection of IL-12-and IFN-�-deficient mice (57), the absence of these cytokinesleads to deeper penetration of C. rodentium into the coloniccrypts of infected mice. Since the location and intensity ofiNOS expression in the colonic crypts changed over the courseof infection, we examined whether iNOS expression influencedbacterial localization within individual crypts. Bacterial coloni-zation of both wild-type and iNOS-deficient mice occurred byday 6 p.i. (Fig. 4), but at this time, the infection was superficial,

with bacteria rarely penetrating deeply into crypts. At day10 p.i., most C. rodentium cells remained in superficial loca-tions in the colons of wild-type mice (Fig. 5.) An occasionalcrypt was found where the infection had progressed deeper, toa depth halfway down the crypt (3.3 1.2 crypts/cross section)or, rarely, to the base of the crypt (0.5 0.4 crypts/crosssection). At the same time, the depth of infection was muchgreater in the iNOS-deficient mice (Fig. 5), with many cryptspartially (24.6 12.9 crypts/cross section) or totally (13.0 9.4crypts/cross section) filled with bacteria all the way to theirbase. This effect was transient, since by day 14 p.i., bacteria inboth mouse strains were again found to be in superficial loca-tions, and this localization remained apparent at later timepoints.

Colonic pathology is similar in wild-type and iNOS-deficientmice. The colons of wild-type and iNOS-deficient mice wereexamined for changes in colonic weight as an indirect measureof epithelial hyperplasia, mucosal inflammation, and hyper-emia (common features of C. rodentium infection). There waslittle increase in colon weight over the first 6 days of infectionin either mouse strain, but between days 6 and 10 p.i., thetissue weight at least doubled that found in uninfected mice(Table 1). In the days following, the colon weights remained atthis plateau and started to decrease only at day 21 p.i. Simi-larly, when we directly measured colonic crypt heights, we sawa similar dramatic increase in crypt heights in both wild-typeand iNOS-deficient mice (Fig. 6). In both colon weight andcrypt height measurements, while there was a trend towardsgreater pathology during the later stages of infection in theiNOS-deficient mice, the differences did not reach statisticalsignificance.

Immunostaining for the virulence factor Tir to identify C.rodentium-infected cells. Despite the observation that a num-ber of colonic epithelial cells expressed iNOS during C. roden-tium infection, it remained to be determined if the expression

FIG. 3. The NO donor SNP and the NO releaser GSNO are bac-teriostatic for C. rodentium in vitro. The addition of SNP (A) or GSNO(B) to bacterial cultures led to a dose-dependent suppression of bac-terial growth over a period of 4 h. The cultures were grown in LB at pH7.0 for SNP and pH 5.0 for GSNO. The asterisks denote a significantreduction in bacterial growth compared to that in untreated cultures(�, P 0.05).

FIG. 4. Following oral infection, both wild-type and iNOS-deficientmice were heavily colonized by C. rodentium by day 6 p.i. The numbersof bacteria recovered from the colons of individual infected wild-typeC57BL/6 mice (filled circles) and iNOS-deficient mice (open circles)on days 6, 10, 14, 18, 21, and 24 p.i. are presented. Each groupcontained four or five mice. The asterisks denote the recovery ofsignificantly more bacteria (mean value) recovered from iNOS-defi-cient mice compared to that recovered from wild-type mice at days 18,21, and 24 p.i. (�, P 0.05.).



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

by these cells was directly induced by C. rodentium attachmentor, alternatively, if it reflected an activation of the epithelialcells by the host immune response. This necessitated the de-velopment of an approach to identify infected cells. While

staining for C. rodentium lipopolysaccharides (LPS) can beused to identify these pathogens in colonic tissue sections (61),such staining identifies all C. rodentium cells within the colon,many of which are not actually attached to host cells. Consid-

FIG. 5. C. rodentium bacteria at day 10 p.i. penetrate deeper into the colonic crypts of iNOS-deficient mice than in wild-type mice. (A) Duringthe course of C. rodentium infection in wild-type C57BL/6 mice, the majority of the bacteria were found attached to superficial epithelial cells(arrowheads) and within the lumen. There is little evidence of bacteria penetrating deeply into colonic crypts. (C) Under higher magnification, onecan see individual bacteria (arrowheads) on the surface of these superficial epithelial cells while the base of the crypts are uninfected. (B) Incontrast, bacteria infecting iNOS-deficient mice at day 10 p.i. were found to penetrate deeper into crypts, sometimes reaching even the base of theglands. The asterisks identify crypts that are heavily infected with C. rodentium reaching to the base of the crypt. (D) At higher magnification, onecan see several crypts filled down to their base with C. rodentium (arrowheads). This effect was transient with the infection in iNOS-deficient mice,again becoming superficial at later time points in the infection. Original magnification for all, �400.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

ering that C. rodentium can cover most of the colonic mucosalsurface during the peak of its infection, a more specific markerfor identifying infected cells was required. We therefore choseto stain for Tir, as this virulence factor is translocated insidehost cells during the process of intimate attachment. By omit-ting detergents in our staining procedure, we found that weselectively stained Tir, as demonstrated in Fig. 7A. By doublestaining for C. rodentium with sera against LPS (serotypeO152) as well as Tir, Tir staining was found beneath, but notinside, adherent bacteria, indicating that this is a suitablemarker for identifying cells in colonic tissue sections that havebeen infected by C. rodentium.

iNOS is predominantly expressed by uninfected but notinfected epithelial cells. Using antibodies against both Tir andiNOS, we next examined colonic tissue sections to determinewhether Tir-positive, C. rodentium-infected epithelial cells alsoexpressed iNOS. Similar to our immunoperoxidase staining inFig. 2, immunofluorescence staining of infected tissues identi-fied many epithelial cells in the infected colon and particularlycells at the base of the colonic crypts as being iNOS positive.However, since C. rodentium predominantly infected superfi-cial epithelial cells in immunocompetent C57BL/6 mice (Fig.5), we focused only on those epithelial cells in the uppermostthird of the crypts for the iNOS and Tir colocalization studies.Surprisingly, there was very little colocalization between thetwo markers on these superficial epithelial cells (Fig. 7B).

While 87% of uninfected (Tir-negative) cells were stronglyiNOS positive at day 10 p.i., epithelial cells that were mildlyinfected (fewer than 10 Tir foci/cell) seldom expressed iNOS(23%) and those that were more heavily infected were evenless likely to express iNOS (Table 2). While Tir-positive, iNOS-negative epithelial cells were often found in stretches alongseveral adjacent crypts, this staining pattern was also seen inindividual cells. As shown in the Fig. 7B insert, there were longstretches of iNOS-expressing epithelial cells that were occa-sionally interspersed by Tir-positive, iNOS-negative epithelialcells. This pattern was seen on days 6, 10, and 14 p.i. At latertime points, the number of bacteria in the colon had decreasedto levels that made it difficult to identify more than a fewscattered infected cells per tissue cross section.

DISCUSSION

Following their ingestion, enteric bacterial pathogens mustnot only survive the harsh environment of the gastrointestinaltract but also overcome or avoid an array of mucosal defensesin order to replicate and successfully colonize their hosts.Strategies used by Shigella, Salmonella, and other bacterialpathogens to accomplish these goals include the invasion of theintestinal epithelium (47) and, in some cases, using the mucosaas a portal of entry to spread to distal sites by subsequentlyinfecting professional phagocytes (14). As a result, most stud-ies examining host defenses against these intestinal pathogenshave focused on the responses of epithelial cells to bacterialinvasion (10, 47) as well as on the antimicrobial mechanismsactivated within phagocytes (6, 63). In contrast, there are manyimportant diarrheagenic pathogens such as EPEC and EHECthat do not invade the intestinal epithelium but instead remainat and colonize the mucosal surface by attaching to the surfaceof epithelial cells (56). By remaining in this position through-out the duration of their infection, these microbes interactalmost exclusively with underlying epithelial cells and havelittle contact with professional inflammatory or immune cells(62). Little is known about the host defense mechanisms andactions that are exerted against A/E pathogens.

This study demonstrates that one host defense mechanismencountered by the A/E pathogen C. rodentium during itsinfection of the mouse colon is the upregulation of iNOSexpression by uninfected rather than infected colonic epithelialcells. iNOS-derived NO is a central effector molecule in theinnate immune response to many pathogens. While NO andother RNI have a number of immunoregulatory functions,including inhibiting lymphocyte proliferation, altering cytokineand prostaglandin production, and inducing or inhibiting apo-ptosis (11), their primary function in host defense appears to

FIG. 6. Both wild-type C57BL/6 mice (solid bars) and iNOS-defi-cient mice (open bars) undergo significant increases in colonic cryptheights during C. rodentium infection. No significant differences in themean crypt heights (in micrometers) were found between these twomouse strains over the first 24 days of infection. The data represent themeans from three independent experiments in which each group con-tained five mice, and error bars represent standard errors.

TABLE 1. Colon weights of the mice in this study

StrainMean colon wt (mg)a at day:

0 6 10b 14b 18b 21b 24b

Wild type 102 6 123 11 188 20 193 16 190 17 173 19 168 11iNOS (�/�) 100 4 120 14 206 26 208 24 243 28 203 16 174 9

a C. rodentium infection results in increased colon weights in both wild-type and iNOS-deficient mice. Values represent the mean colon weight 1 SEM from threeindependent experiments, each with groups of four to five mice.

b Significantly increased colon weight in both the wild-type and iNOS-deficient strains compared to that of uninfected mice of the same strain (P 0.05).



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

FIG. 7. Immunofluorescence staining shows that infected cells in colonic tissue sections can be identified by their immunoreactivity for Tir butthat Tir generally does not colocalize to cells expressing iNOS. (A) Colonic tissue section from a C. rodentium-infected mouse (day 10 p.i.) showingthe lumenal surface of the colonic mucosa. Most host cells in this field of view (using DAPI to stain their nuclei blue) are superficial epithelial cells,while C. rodentium LPS is shown in green and Tir is shown in red. Large clusters of C. rodentium bacteria can be seen attached to these superficialepithelial cells during infection (original magnification, �1,000). In the inset, at a higher magnification, one can see that Tir staining is not foundinside the bacteria (arrow) but rather that it occurs outside of the bacteria (arrowhead), presumably translocated from the bacteria into theunderlying epithelial cell and focused at the tip of actin pedestals. (B) This field of view shows the superficial colonic mucosa in both the upperand lower parts of the field, with the lumen in the center. By using the staining of Tir as a marker for infected cells, double immunostaining forTir (red) and iNOS (green) shows that there is very little colocalization between cells expressing Tir and those expressing iNOS. The majority ofthe epithelial cells on the mucosal surface on the lower half of the picture are infected (Tir positive) but do not express iNOS, while the cells atthe top express iNOS but are not infected and do not express Tir (original magnification, �630). (Inset) At a higher magnification, one can seeindividual Tir foci in red (arrowhead) on the apical surface of one or two infected cells. These infected cells are the only iNOS-negative cells ina long stretch of uninfected epithelial cells expressing iNOS (green) at their apical surface.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

be to damage and destroy pathogens (44). A number of celltypes can produce RNI; however, macrophages generate thehighest output, considerably outpacing all other cell types,including polymorphonuclear cells. Studies examining the an-timicrobial actions of NO have therefore focused on the ac-tions of macrophages against intracellular pathogens. Withinmacrophages, iNOS expression results in the generation ofhigh concentrations of NO in close proximity to pathogens(44). At these concentrations, NO possesses potent antimicro-bial activity and plays an important host-protective role againstmany intracellular pathogens, including Mycobacterium tuber-culosis (44) and Leishmania major (65). While there is signif-icant evidence for iNOS contributing to host defense againstseveral intracellular pathogens, its role against extracellularmucosal pathogens is less clear (56). This is particularly truefor A/E pathogens that are extracellular, actually residing out-side the host itself. As a result of this protected location, theyare protected from many of the actions of the host’s inflam-matory cells. Furthermore, EPEC and probably other A/Epathogens are capable of impairing the phagocytic ability ofmacrophages (21) through a phosphatidylinositol 3-kinase-de-pendent mechanism (5). Even so, simply preventing their up-take by macrophages may not fully protect EPEC and otherpathogens, as RNI can be released by host cells into the ex-ternal environment, killing extracellular parasites and bacteriasuch as E. coli (44).

Considering the number of factors limiting the ability ofprofessional inflammatory cells to defend against A/E patho-gens, it was interesting to find that colonic epithelial cellsrather than phagocytes were the major cellular source of iNOSduring C. rodentium infection. Such a host response is notunique, as iNOS expression has been shown in the gastricmucosa during Helicobacter pylori infection (17) and in thebladder epithelium of uropathogenic E. coli-infected mice(42). Similar to the results found with these diverse mucosalpathogens, iNOS expression by epithelial cells in the colon wasfocused along their apical surface. Since C. rodentium inti-mately attaches to the colonic epithelium, it seemed plausiblethat iNOS expression was directly induced by bacterial attach-ment. There are several studies demonstrating that epithelialcells respond to A/E pathogen attachment by activating inflam-matory signaling pathways. EPEC and EHEC infections invitro trigger NF-�B activation and the release of IL-8 (50–52).Similarly, EPEC infection has been shown to activate mitogen-activated protein kinase pathways in host cells (7, 8, 53). While

there are no data demonstrating that A/E pathogens directlytrigger iNOS expression in epithelial cells, Salmonella andother invasive pathogens do trigger a massive increase in iNOSexpression in epithelial cells during the process of cellularinvasion (10, 66).

Intestinal epithelial cells have been shown to express iNOSnot only during infection but also in response to other chal-lenges such as intestinal inflammation. This has been seen inhumans (19, 34) and in experimental models (2, 35, 41) as wellas in tissue culture following cytokine and endotoxin stimula-tion (36). Studies in vitro have conclusively demonstrated notonly that epithelium-derived iNOS is functional but that theNO produced by epithelial cell monolayers is released predom-inantly from the apical surface (66). In the colon, this shouldresult in the release of NO predominantly into the coloniclumen. Accordingly, this is what was found in ulcerative colitispatients in whom extensive iNOS expression by colonic epithe-lial cells was associated with lumenal NO levels elevated morethan 20-fold over normal levels (19, 38, 46). The NO releasedby epithelial cells also can exert cytotoxic effects, as seen duringBordetella pertussis infection in the lung, where NO releasedfrom nonciliated epithelial cells causes the destruction of ad-jacent ciliated cells (13). Since A/E pathogens are in suchintimate contact with the epithelium, they should be exposedto damaging levels of NO released from epithelial cells.Whether this is sufficient to kill bacteria or would merely limittheir growth depends on the inherent susceptibility to RNI ofthe pathogen in question, as some bacteria possess mecha-nisms to limit the effects of NO (6). One way to test this is touse chemical sources of NO in culture. While the susceptibilityof EPEC and EHEC to NO has yet to be examined, in previousstudies, the NO donor SNP and the NO releaser GSNO haveboth been shown to have bacteriostatic effects on Salmonellaand other gram-negative bacterial pathogens (39, 44, 58).

Studies examining the susceptibility of C. rodentium to RNIin vitro found that both SNP and GSNO had significant bac-teriostatic effects on its growth in culture. At the highest dosestested, bacterial growth was reduced by more than 97% froman almost 1,000-fold increase in numbers over 4 h to less thana 40-fold increase. GSNO, which works best at the pH of thephagosome (pH 5.0), also suppressed C. rodentium growth,even though the baseline bacterial growth was reduced at thislow pH. More importantly, SNP in particular had significantbacteriostatic effects on C. rodentium at fairly low concentra-tions (100 �M). These results suggested that iNOS and NOcould be potent players in host defense in the C. rodentiummodel; therefore, iNOS-deficient mice were infected to deter-mine the effect the loss of this source of NO had on the courseof C. rodentium infection in vivo. Curiously, iNOS deficiencyonly transiently altered the infection, permitting C. rodentiumto penetrate deeper into the colonic crypts of iNOS-deficientmice, as well as causing a moderate delay in bacterial clear-ance. iNOS expression had even less of an effect on macro-scopic and histologic changes in the infected colon. Consider-ing the widespread and consistent expression of iNOS in thecolon of C. rodentium-infected wild-type mice, this was anunexpected result, particularly if adherent bacteria were indirect contact with the epithelial cells expressing iNOS. Todetermine if this was the case, it was necessary to examinewhether infected cells were actually expressing iNOS. In order

TABLE 2. iNOS expression by uninfected and infectedcolonic epithelial cells

Cell status% iNOS-expressing cellsa at day:

6 10 14

Uninfected 75 7 87 10 90 15Mildly infectedb 21 5 23 6 29 4Heavily infectedb 14 3 13 4 18 6

a Infected cells were separated into groups of mildly infected cells (10 foci ofTir/cell) and heavily infected cells (�10 foci of Tir/cell). Values represent themean percentage of epithelial cells that express detectable iNOS 1 SEM fromthree independent experiments, each with groups of four mice.

b Significantly lower percentages of iNOS-expressing cells at days 6, 10, and 14than those of uninfected cells at the same time points (P 0.05).



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

to test this, we needed to differentiate infected from uninfectedepithelial cells in colonic tissues. To achieve this goal, we useda novel approach, staining a translocated bacterial effectorprotein in infected tissues. Based on its location at the tip ofactin pedestals (22), we chose the bacterial effector Tir as amarker to identify C. rodentium-infected colonic epithelialcells. Through double-label immunostaining for both Tir andiNOS, we observed that iNOS expression was limited almostexclusively to uninfected epithelial cells. In contrast, those cellsdirectly infected by C. rodentium were predominantly iNOSnegative. This lack of colocalization between iNOS and Tir wasseen throughout the course of the infection.

These results suggest that the small protective role identifiedfor iNOS in vivo was probably mediated by uninfected ratherthan infected cells. More intriguing was the apparently selec-tive expression of immunoreactive iNOS by uninfected ratherthan infected epithelial cells. This result strongly indicates thatiNOS induction on epithelial cells was not caused by directcontact with C. rodentium but rather due to stimulation bybacterial LPS and/or the host inflammatory response. The lackof iNOS expression seen following infection with the type IIIsecretion mutant �escD was probably due to the limited abilityof this strain to colonize or induce an inflammatory response inthe host rather than a direct effect of type III secretion. Whilethere are several possible reasons behind the lack of iNOS andTir colocalization to the same epithelial cells, it seems unlikelythat it is simply due to C. rodentium preferentially infectingcells not expressing iNOS. Within a given section of colon, onecan assume that the epithelial cells lining infected cryptsshould receive at least as much exposure to LPS and cytokinesas those epithelial cells lining uninfected crypts. Despite this,iNOS expression was rarely seen in those crypts that wereinfected by C. rodentium. Furthermore, the observation that,amidst large stretches of iNOS-expressing epithelial cells, thefew isolated cells that were infected were iNOS negative sug-gests that this pathogen may be taking an active role in limitingits exposure to NO.

Based on the data in this study, we hypothesize that C.rodentium infection is capable of modulating iNOS expressionthrough the epithelial cells in its natural host, mice. In fact, anumber of bacterial pathogens have recently been shown tomanipulate or divert innate host defenses including iNOS andNO production (6). Best described are the mechanisms used bybacterial pathogens to subvert the microbicidal actions of mac-rophages. For example, Vazquez-Torres and Fang recentlydemonstrated the ability of Salmonella enterica serovar Typhi-murium to divert NADPH (phagocyte oxidase) from the Sal-monella-containing vacuole (63) whereas the bacterial patho-gen Burkholderia pseudomallei has been shown to interferewith iNOS expression in an infected macrophage cell line (60).While less is known about the interactions between bacterialpathogens and the antimicrobial mechanisms expressed by ep-ithelial cells, there is increasing evidence that pathogens dosubvert the host’s epithelial defenses. The H. pylori arginaserocF was recently found to inhibit NO production by eukary-otic cells (18), presumably as a strategy for survival in the faceof epithelium-based NO production in the infected gastricmucosa. In addition, studies examining biopsy samples fromShigella flexneri-infected patients found a striking reduction inthe expression of several antimicrobial peptides (defensins) in

the infected epithelium (27). In the cases of both macrophagesand epithelial cells, it appears that bacterial pathogens thatinteract for any length of time with these host cells commonlyact to subvert their antimicrobial defenses. EPEC has alreadybeen described as being able to block phagocytosis (5, 21) andinhibit cytokine release from lymphocytes (31, 32). These abil-ities, taken together with the fact that A/E pathogens areintimately bound to epithelial cells for several days and cancause lengthy infections (12, 22), suggest that these pathogenshave probably developed some means to avoid epithelial anti-microbial defenses, including NO-dependent killing. Futurestudies will be required to determine if the lack of iNOSexpression on C. rodentium-infected cells is mediated throughthe specific actions of translocated bacterial effectors. Alterna-tively, since iNOS is associated with the actin cytoskeleton(64), the extensive cytoskeletal rearrangements caused bythese infections may prevent the recruitment of iNOS from thecytoplasm to the apical surface of epithelial cells.

In conclusion, as we begin to understand the mucosal de-fenses involved in protecting the host during A/E pathogeninfections, it appears that colonic epithelial cells do play anactive role in host defense against these pathogens. Althoughthis study specifically examined iNOS expression, several otherantimicrobial effectors, including defensins, can be expressedby colonic epithelial cells. In fact, during the course of thesestudies, Simmons et al. (57) found that -defensin-3 and iNOS,as well as the cytokines IL-12 and IFN-�, were upregulatedduring C. rodentium infection. Unfortunately, the contributionof -defensin-3 to host defense was not examined; however,compared to the significant roles seen for IL-12 and IFN-�,iNOS was found to play little role during the course of infec-tion and was not examined further. Our more extensive eval-uation over the full time course of C. rodentium infection didreveal a modest contribution by iNOS to host defense but,more importantly, led us to the intriguing observation that theactivation of iNOS expression on epithelial cells was generallyabsent on infected cells. While determining the basis for thisspecific observation will require further studies using tissueculture models, it is important to note the novelty and appli-cability of this approach. This is the first study where a trans-located bacterial virulence factor has been stained in infectedtissue sections, allowing us to differentiate between the hostresponse in the whole infected tissue and the response at thesingle-infected-cell level. Future studies should assist in ourunderstanding of the intricate and complex interactions be-tween A/E pathogens and their hosts. Identifying what antimi-crobial mechanisms these pathogens actually encounter andhow they may subvert host cell functions should prove of ben-efit, not only in combating this important family of human andveterinary pathogens but in managing public health in general.

ACKNOWLEDGMENTS

We thank Valerie Templeman for technical assistance and CarrieRosenberger and Cathy Horne for critical reading of the manuscript.

This work was supported by operating grants from the CanadianInstitute for Health Research (CIHR) and the Howard Hughes Med-ical Institute. B.A.V. is supported by a Canadian Digestive DiseasesFoundation/Medical Research Council of Canada (MRC) postdoc-toral fellowship and is an honorary Isaak Walton Killam fellow. W.D.was supported by an MRC postdoctoral fellowship. B.B.F. is a Howard



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Hughes International Research Scholar and a CIHR DistinguishedInvestigator.

REFERENCES

1. Abe, A., U. Heczko, R. G. Hegele, and B. B. Finlay. 1998. Two enteropatho-genic Escherichia coli type III secreted proteins, EspA and EspB, are viru-lence factors. J. Exp. Med. 188:1–10.

2. Asfaha, S., C. J. Bell, J. L. Wallace, and W. K. MacNaughton. 1999. Pro-longed colonic epithelial hyporesponsiveness after colitis: role of induciblenitric oxide synthase. Am. J. Physiol. 276:G703–G710.

3. Barthold, S. W., G. L. Coleman, R. O. Jacoby, E. M. Livestone, and A. M.Jonas. 1978. Transmissible murine colonic hyperplasia. Vet. Pathol. 15:223–236.

4. Celli, J., W. Deng, and B. B. Finlay. 2000. Enteropathogenic Escherichia coli(EPEC) attachment to epithelial cells: exploiting the host cell cytoskeletonfrom the outside. Cell. Microbiol. 2:1–9.

5. Celli, J., M. Olivier, and B. B. Finlay. 2001. Enteropathogenic Escherichiacoli mediates antiphagocytosis through the inhibition of PI 3-kinase-depen-dent pathways. EMBO J. 20:1245–1258.

6. Chakravortty, D., I. Hansen-Wester, and M. Hensel. 2002. Salmonellapathogenicity island 2 mediates protection of intracellular salmonella fromreactive nitrogen intermediates. J. Exp. Med. 195:1155–1166.

7. Czerucka, D., S. Dahan, B. Mograbi, B. Rossi, and P. Rampal. 2001. Impli-cation of mitogen-activated protein kinases in T84 cell responses to enter-opathogenic Escherichia coli infection. Infect. Immun. 69:1298–1305.

8. de Grado, M., C. M. Rosenberger, A. Gauthier, B. A. Vallance, and B. B.Finlay. 2001. Enteropathogenic Escherichia coli infection induces expressionof the early growth response factor by activating mitogen-activated proteinkinase cascades in epithelial cells. Infect. Immun. 69:6217–6224.

9. Deng, W., Y. Li, B. A. Vallance, and B. B. Finlay. 2001. Locus of enterocyteeffacement from Citrobacter rodentium: sequence analysis and evidence forhorizontal transfer among attaching and effacing pathogens. Infect. Immun.69:6323–6335.

10. Eckmann, L., J. R. Smith, M. P. Housley, M. B. Dwinell, and M. F. Kagnoff.2000. Analysis by high density cDNA arrays of altered gene expression inhuman intestinal epithelial cells in response to infection with the invasiveenteric bacteria Salmonella. J. Biol. Chem. 275:14084–14094.

11. Eisenstein, T. K. 2001. Implications of Salmonella-induced nitric oxide (NO)for host defense and vaccines: NO, an antimicrobial, antitumor, immuno-suppressive and immunoregulatory molecule. Microbes Infect. 3:1223–1231.

12. Fagundes Neto, U., V. D. Ferreira, F. R. Patricio, V. L. Mostaco, and L. R.Trabulsi. 1989. Protracted diarrhea: the importance of the enteropathogenicE. coli (EPEC) strains and Salmonella in its genesis. J. Pediatr. Gastroen-terol. Nutr. 8:207–211.

13. Flak, T. A., and W. E. Goldman. 1999. Signalling and cellular specificity ofairway nitric oxide production in pertussis. Cell. Microbiol. 1:51–60.

14. Fleckenstein, J. M., and D. J. Kopecko. 2001. Breaching the mucosal barrierby stealth: an emerging pathogenic mechanism for enteroadherent bacterialpathogens. J. Clin. Investig. 107:27–30.

15. Forsythe, R. M., D. Z. Xu, Q. Lu, and E. A. Deitch. 2002. Lipopolysaccha-ride-induced enterocyte-derived nitric oxide induces intestinal monolayerpermeability in an autocrine fashion. Shock 17:180–184.

16. Frankel, G., A. D. Phillips, I. Rosenshine, G. Dougan, J. B. Kaper, and S.Knutton. 1998. Enteropathogenic and enterohaemorrhagic Escherichia coli:more subversive elements. Mol. Microbiol. 30:911–921.

17. Fu, S., K. S. Ramanujam, A. Wong, G. T. Fantry, C. B. Drachenberg, S. P.James, S. J. Meltzer, and K. T. Wilson. 1999. Increased expression andcellular localization of inducible nitric oxide synthase and cyclooxygenase 2in Helicobacter pylori gastritis. Gastroenterology 116:1319–1329.

18. Gobert, A. P., D. J. McGee, M. Akhtar, G. L. Mendz, J. C. Newton, Y. Cheng,H. L. Mobley, and K. T. Wilson. 2001. Helicobacter pylori arginase inhibitsnitric oxide production by eukaryotic cells: a strategy for bacterial survival.Proc. Natl. Acad. Sci. USA 98:13844–13849.

19. Godkin, A. J., A. J. De Belder, L. Villa, A. Wong, J. E. Beesley, S. P. Kane,and J. F. Martin. 1996. Expression of nitric oxide synthase in ulcerativecolitis. Eur. J. Clin. Investig. 26:867–872.

20. Goffaux, F., B. China, L. Janssen, V. Pirson, and J. Mainil. 1999. The locusfor enterocyte effacement (LEE) of enteropathogenic Escherichia coli(EPEC) from dogs and cats. Adv. Exp. Med. Biol. 473:129–136.

21. Goosney, D. L., J. Celli, B. Kenny, and B. B. Finlay. 1999. EnteropathogenicEscherichia coli inhibits phagocytosis. Infect. Immun. 67:490–495.

22. Goosney, D. L., S. Gruenheid, and B. B. Finlay. 2000. Gut feelings: entero-pathogenic E. coli (EPEC) interactions with the host. Annu. Rev. Cell. Dev.Biol. 16:173–189.

23. Hecht, G. 2001. Microbes and microbial toxins: paradigms for microbial-mucosal interactions. VII. Enteropathogenic Escherichia coli: physiologicalalterations from an extracellular position. Am. J. Physiol. Gastrointest. LiverPhysiol. 281:G1-G7.

24. Higgins, L. M., G. Frankel, I. Connerton, N. S. Goncalves, G. Dougan, andT. T. MacDonald. 1999. Role of bacterial intimin in colonic hyperplasia andinflammation. Science 285:588–591.

25. Higgins, L. M., G. Frankel, G. Douce, G. Dougan, and T. T. MacDonald.

1999. Citrobacter rodentium infection in mice elicits a mucosal Th1 cytokineresponse and lesions similar to those in murine inflammatory bowel disease.Infect. Immun. 67:3031–3039.

26. Hill, S. M., A. D. Phillips, and J. A. Walker-Smith. 1991. EnteropathogenicEscherichia coli and life threatening chronic diarrhoea. Gut 32:154–158.

27. Islam, D., L. Bandholtz, J. Nilsson, H. Wigzell, B. Christensson, B. Ager-berth, and G. Gudmundsson. 2001. Downregulation of bactericidal peptidesin enteric infections: a novel immune escape mechanism with bacterial DNAas a potential regulator. Nat. Med. 7:180–185.

28. Kallas, M. R., F. R. Patricio, and U. Fagundes Neto. 1995. Morphometrics ofthe small intestine in children with diarrhea due to classical enteropatho-genic Escherichia coli and to environmental asymptomatic enteropathy. Rev.Assoc. Med. Bras. 41:162–166.

29. Kaper, J. B. 1998. Enterohemorrhagic Escherichia coli. Curr. Opin. Micro-biol. 1:103–108.

30. Kenny, B., R. DeVinney, M. Stein, D. Reinscheid, E. Frey, and B. Finlay.1997. Enteropathogenic E. coli (EPEC) transfers its receptor for intimateadherence into mammalian cells. Cell 91:511–520.

31. Klapproth, J. M., M. S. Donnenberg, J. M. Abraham, and S. P. James. 1996.Products of enteropathogenic E. coli inhibit lymphokine production by gas-trointestinal lymphocytes. Am. J. Physiol. 271:G841–G848.

32. Klapproth, J. M., I. C. Scaletsky, B. P. McNamara, L. C. Lai, C. Malstrom,S. P. James, and M. S. Donnenberg. 2000. A large toxin from pathogenicEscherichia coli strains that inhibits lymphocyte activation. Infect. Immun.68:2148–2155.

33. Kobayashi, O., H. Miwa, S. Watanabe, M. Tsujii, R. N. Dubois, and N. Sato.2001. Cyclooxygenase-2 downregulates inducible nitric oxide synthase in ratintestinal epithelial cells. Am. J. Physiol. Gastrointest. Liver Physiol. 281:G688–G696.

34. Kolios, G., N. Rooney, C. T. Murphy, D. A. Robertson, and J. Westwick.1998. Expression of inducible nitric oxide synthase activity in human colonepithelial cells: modulation by T lymphocyte derived cytokines. Gut 43:56–63.

35. Kubes, P. 2000. Inducible nitric oxide synthase: a little bit of good in all ofus. Gut 47:6–9.

36. Lahde, M., R. Korhonen, and E. Moilanen. 2000. Regulation of nitric oxideproduction in cultured human T84 intestinal epithelial cells by nuclear fac-tor-kappa B-dependent induction of inducible nitric oxide synthase afterexposure to bacterial endotoxin. Aliment. Pharmacol. Ther. 14:945–954.

37. Li, Y., E. Frey, A. M. Mackenzie, and B. B. Finlay. 2000. Human response toEscherichia coli O157:H7 infection: antibodies to secreted virulence factors.Infect. Immun. 68:5090–5095.

38. Ljung, T., M. Herulf, E. Beijer, H. Jacobsson, J. Lundberg, Y. Finkel, andP. M. Hellstrom. 2001. Rectal nitric oxide assessment in children with Crohndisease and ulcerative colitis. Indicator of ileocaecal and colorectal affection.Scand. J. Gastroenterol. 36:1073–1076.

39. Lu, S., P. B. Killoran, F. C. Fang, and L. W. Riley. 2002. The global regulatorArcA controls resistance to reactive nitrogen and oxygen intermediates inSalmonella enterica serovar Enteritidis. Infect. Immun. 70:451–461.

40. Luperchio, S. A., J. V. Newman, C. A. Dangler, M. D. Schrenzel, D. J.Brenner, A. G. Steigerwalt, and D. B. Schauer. 2000. Citrobacter rodentium,the causative agent of transmissible murine colonic hyperplasia, exhibitsclonality: synonymy of C. rodentium and mouse-pathogenic Escherichia coli.J. Clin. Microbiol. 38:4343–4350.

41. MacNaughton, W. K., S. S. Lowe, and K. Cushing. 1998. Role of nitric oxidein inflammation-induced suppression of secretion in a mouse model of acutecolitis. Am. J. Physiol. 275:G1353–G1360.

42. Mysorekar, I. U., M. A. Mulvey, S. J. Hultgren, and J. I. Gordon. 2002.Molecular regulation of urothelial renewal and host defenses during infec-tion with uropathogenic Escherichia coli. J. Biol. Chem. 277:7412–7419.

43. Nataro, J., and J. Kaper. 1998. Diarrheagenic Escherichia coli. Clin. Micro-biol. Rev. 11:142–201.

44. Nathan, C., and M. U. Shiloh. 2000. Reactive oxygen and nitrogen interme-diates in the relationship between mammalian hosts and microbial patho-gens. Proc. Natl. Acad. Sci. USA 97:8841–8848.

45. Newman, J. V., B. A. Zabel, S. S. Jha, and D. B. Schauer. 1999. Citrobacterrodentium espB is necessary for signal transduction and for infection oflaboratory mice. Infect. Immun. 67:6019–6025.

46. Perner, A., I. Nordgaard, P. Matzen, and J. Rask-Madsen. 2002. Colonicproduction of nitric oxide gas in ulcerative colitis, collagenous colitis anduninflamed bowel. Scand. J. Gastroenterol. 37:183–188.

47. Philpott, D. J., S. E. Girardin, and P. J. Sansonetti. 2001. Innate immuneresponses of epithelial cells following infection with bacterial pathogens.Curr. Opin. Immunol. 13:410–416.

48. Robins-Browne, R. M., A. M. Tokhi, L. M. Adams, V. Bennett-Wood, A. V.Moisidis, E. O. Krejany, and L. E. O’Gorman. 1994. Adherence character-istics of attaching and effacing strains of Escherichia coli from rabbits. Infect.Immun. 62:1584–1592.

49. Salzman, A. L., T. Eaves-Pyles, S. C. Linn, A. G. Denenberg, and C. Szabo.1998. Bacterial induction of inducible nitric oxide synthase in cultured hu-man intestinal epithelial cells. Gastroenterology 114:93–102.

50. Savkovic, S., A. Koutsouris, and G. Hecht. 1998. Activation of NF-�B in



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

intestinal epithelial cells by enteropathogenic Escherichia coli. Am. J.Physiol. 273:C1160–C1167.

51. Savkovic, S., A. Koutsouris, and G. Hecht. 1996. Attachment of a noninva-sive enteric pathogen, enteropathogenic Escherichia coli, to cultured humanintestinal epithelial monolayers induces transmigration of neutrophils. In-fect. Immun. 64:4480–4487.

52. Savkovic, S. D., A. Koutsouris, and G. Hecht. 1997. Activation of NF-kappaBin intestinal epithelial cells by enteropathogenic Escherichia coli. Am. J.Physiol. 273:C1160–C1167.

53. Savkovic, S. D., A. Ramaswamy, A. Koutsouris, and G. Hecht. 2001. EPEC-activated ERK1/2 participate in inflammatory response but not tight junctionbarrier disruption. Am. J. Physiol. Gastrointest. Liver Physiol. 281:G890–G898.

54. Schauer, D. B. 1994. Murine colonic hyperplasia, p. 197–208. In V. L. Miller,J. B. Kaper, D. A. Portnoy, and R. R. Isberg (ed.), Molecular genetics ofbacterial pathogenesis. American Society for Microbiology, Washington,D.C.

55. Schauer, D. B., and S. Falkow. 1993. The eae gene of Citrobacter freundiibiotype 4280 is necessary for colonization in transmissible murine colonichyperplasia. Infect. Immun. 61:4654–4661.

56. Simmons, C. P., S. Clare, and G. Dougan. 2001. Understanding mucosalresponsiveness: lessons from enteric bacterial pathogens. Semin. Immunol.13:201–209.

57. Simmons, C. P., N. S. Goncalves, M. Ghaem-Maghami, M. Bajaj-Elliott, S.Clare, B. Neves, G. Frankel, G. Dougan, and T. T. MacDonald. 2002. Im-paired resistance and enhanced pathology during infection with a noninva-sive, attaching-effacing enteric bacterial pathogen, Citrobacter rodentium, inmice lacking IL-12 or IFN-gamma. J. Immunol. 168:1804–1812.

58. St. John, G., N. Brot, J. Ruan, H. Erdjument-Bromage, P. Tempst, H.Weissbach, and C. Nathan. 2001. Peptide methionine sulfoxide reductasefrom Escherichia coli and Mycobacterium tuberculosis protects bacteria

against oxidative damage from reactive nitrogen intermediates. Proc. Natl.Acad. Sci. USA 98:9901–9906.

59. Tacket, C. O., M. B. Sztein, G. Losonsky, A. Abe, B. B. Finlay, B. P. Mc-Namara, G. T. Fantry, S. P. James, J. P. Nataro, M. M. Levine, and M. S.Donnenberg. 2000. Role of EspB in experimental human enteropathogenicEscherichia coli infection. Infect. Immun. 68:3689–3695.

60. Utaisincharoen, P., N. Tangthawornchaikul, W. Kespichayawattana, P.Chaisuriya, and S. Sirisinha. 2001. Burkholderia pseudomallei interfereswith inducible nitric oxide synthase (iNOS) production: a possible mecha-nism of evading macrophage killing. Microbiol. Immunol. 45:307–313.

61. Vallance, B. A., W. Deng, L. A. Knodler, and B. B. Finlay. 2002. Mice lackingT and B lymphocytes develop transient colitis and crypt hyperplasia yet sufferimpaired bacterial clearance during Citrobacter rodentium infection. Infect.Immun. 70:2070–2081.

62. Vallance, B. A., and B. B. Finlay. 2000. Exploitation of host cells by enter-opathogenic Escherichia coli. Proc. Natl. Acad. Sci. USA 97:8799–8806.

63. Vazquez-Torres, A., and F. C. Fang. 2001. Salmonella evasion of theNADPH phagocyte oxidase. Microbes Infect. 3:1313–1320.

64. Webb, J. L., M. W. Harvey, D. W. Holden, and T. J. Evans. 2001. Macro-phage nitric oxide synthase associates with cortical actin but is not recruitedto phagosomes. Infect. Immun. 69:6391–6400.

65. Wei, X. Q., I. G. Charles, A. Smith, J. Ure, G. J. Feng, F. P. Huang, D. Xu,W. Muller, S. Moncada, and F. Y. Liew. 1995. Altered immune responses inmice lacking inducible nitric oxide synthase. Nature 375:408–411.

66. Witthoft, T., L. Eckmann, J. M. Kim, and M. F. Kagnoff. 1998. Enteroinva-sive bacteria directly activate expression of iNOS and NO production inhuman colon epithelial cells. Am. J. Physiol. 275:G564–G571.

67. Zhu, C., T. S. Agin, S. J. Elliott, L. A. Johnson, T. E. Thate, J. B. Kaper, andE. C. Boedeker. 2001. Complete nucleotide sequence and analysis of thelocus of enterocyte effacement from rabbit diarrheagenic Escherichia coliRDEC-1. Infect. Immun. 69:2107–2115.

Editor: A. D. O’Brien



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Modulation of Inducible Nitric Oxide Synthase Activation by Immuno-suppressive Drugs

Documents

Transcript of Modulation of Inducible Nitric Oxide Synthase Activation by Immuno-suppressive Drugs