doi:10.1152/ajpgi.00253.2010 301:G119-G127, 2011. First published 17 March 2011;Am J Physiol Gastrointest Liver Physiol

Francesco Bellanti, José Viña, María Monsalve and Juan SastreAlessandro Arduini, Gaetano Serviddio, Javier Escobar, Ana M. Tormos,depletion and deletionscirrhosis in rats leading to mitochondrial DNA Mitochondrial biogenesis fails in secondary biliary

You might find this additional info useful...

for this article can be found at:Supplemental material

http://ajpgi.physiology.org/content/suppl/2011/03/17/ajpgi.00253.2010.DC1.html http://ajpgi.physiology.org/content/suppl/2011/04/29/ajpgi.00253.2010.DC2.html

47 articles, 17 of which can be accessed free at:This article cites http://ajpgi.physiology.org/content/301/1/G119.full.html#ref-list-1

including high resolution figures, can be found at:Updated information and services http://ajpgi.physiology.org/content/301/1/G119.full.html

can be found at:AJP - Gastrointestinal and Liver Physiologyabout Additional material and information http://www.the-aps.org/publications/ajpgi

This infomation is current as of January 13, 2012. 

Society. ISSN: 0193-1857, ESSN: 1522-1547. Visit our website at http://www.the-aps.org/.American Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2011 by the American Physiologicalabnormal function of the gastrointestinal tract, hepatobiliary system, and pancreas. It is published 12 times a year (monthly) by the

publishes original articles pertaining to all aspects of research involving normal orAJP - Gastrointestinal and Liver Physiology

on January 13, 2012ajpgi.physiology.org

Dow

nloaded from

Mitochondrial biogenesis fails in secondary biliary cirrhosis in rats leadingto mitochondrial DNA depletion and deletions

Alessandro Arduini,1 Gaetano Serviddio,2 Javier Escobar,1 Ana M. Tormos,1 Francesco Bellanti,2

José Viña,1 María Monsalve,3 and Juan Sastre1

1Department of Physiology, University of Valencia, Valencia, Spain; 2Department of Medical and Occupational Sciences,University of Foggia, Foggia, Italy; and 3CNIC, CSIC, Madrid, Spain

Submitted 28 May 2010; accepted in final form 8 March 2011

Arduini A, Serviddio G, Escobar J, Tormos AM, Bellanti F,Viña J, Monsalve M, Sastre J. Mitochondrial biogenesis fails insecondary biliary cirrhosis in rats leading to mitochondrial DNAdepletion and deletions. Am J Physiol Gastrointest Liver Physiol301: G119 –G127, 2011. First published March 17, 2011;doi:10.1152/ajpgi.00253.2010.—Chronic cholestasis is character-ized by mitochondrial dysfunction, associated with loss of mitochon-drial membrane potential, decreased activities of respiratory chaincomplexes, and ATP production. Our aim was to determine themolecular mechanisms that link long-term cholestasis to mitochon-drial dysfunction. We studied a model of chronic cholestasis inducedby bile duct ligation in rats. Key sensors and regulators of theenergetic state and mitochondrial biogenesis, mitochondrial DNA(mtDNA)-to-nuclear DNA (nDNA) ratio (mtDNA/nDNA) relativecopy number, mtDNA deletions, and indexes of apoptosis (BAX,BCL-2, and cleaved caspase 3) and cell proliferation (PCNA) wereevaluated. Our results show that long-term cholestasis is associatedwith absence of activation of key sensors of the energetic state,evidenced by decreased SIRT1 and pyruvate dehydrogenase kinaselevels and lack of AMPK activation. Key mitochondrial biogenesisregulators (PGC-1� and GABP-�) decreased and NRF-1 was nottranscriptionally active. Mitochondrial transcription factor A (TFAM)protein levels increased transiently in liver mitochondria at 2 wk afterbile duct ligation, but they dramatically decreased at 4 wk. ReducedTFAM levels at this stage were mirrored by a marked decrease (65%)in mtDNA/nDNA relative copy number. The blockade of mitochon-drial biogenesis should not be ascribed to activation of apoptosis orinhibition of cell proliferation. Impaired mitochondrial turnover andloss of the DNA stabilizing effect of TFAM are likely the causativeevent involved in the genetic instability evidenced by accumulation ofmtDNA deletions. In conclusion, the lack of stimulation of mitochon-drial biogenesis leads to mtDNA severe depletion and deletions inlong-term cholestasis. Hence, long-term cholestasis should be consid-ered a secondary mitochondrial hepatopathy.

chronic cholestasis; PGC-1�; TFAM; mitochondrial DNA

CHOLESTASIS IS COMMON IN NUMEROUS chronic liver diseases andit is a prominent feature of primary biliary cirrhosis, primarysclerosing cholangitis, biliary atresia, and iatrogenic obstruc-tion of bile ducts (25). Chronic cholestasis results in intrahe-patic accumulation of toxic hydrophobic bile acids leading tohepatocyte death by apoptosis and necrosis, and eventually toliver fibrosis and cirrhosis (27, 38). A central feature of chroniccholestasis and biliary cirrhosis in the liver is mitochondrialdysfunction (19, 27), evidenced by a loss of mitochondrialmembrane potential (38) and decreased activities of respiratorychain complexes and ATP production (10, 19). Mitochondrial

dysfunction leads to decreased fatty acid oxidation and ketonebody formation (20, 22, 23). Mitochondrial impairment islikely to be central in the progression of liver damage duringchronic cholestasis because mitochondria play central roles inenergy homeostasis, signaling, and apoptosis (13).

During chronic cholestasis the mitochondrial protein contentincreases despite the reduced activities of mitochondrial com-plexes (19). It has been reported that mitochondrial content pergram of liver increases up to 14 days of chronic cholestasis anddecreases thereafter (9), suggesting that during chronic choles-tasis mitochondrial biogenesis tries to maintain mitochondrialmetabolism of the liver, but it seems not to be effective in thelong term.

Mitochondrial biogenesis requires a complex interplay be-tween nuclear and mitochondrial genomes (35). Peroxisomeproliferator-activated receptor � coactivator-1� (PGC-1�) is akey transcriptional regulator of cellular energy metabolism thatstimulates mitochondrial biogenesis through activation of nu-clear respiratory factor-1 (45). PGC-1� together with nuclearrespiratory factor 1 (NRF-1) as well as GA-binding protein-�(GABP-�, or nuclear respiratory factor-2) are the main tran-scriptional factors that regulate the coordinated expression ofnuclear-encoded mitochondrial proteins (28, 35, 45), such asthe mitochondrial transcription factor A (TFAM). TFAM isresponsible for the maintenance of mtDNA copy number (17).TFAM is able to bind and wrap mtDNA, activating andregulating mitochondrial DNA (mtDNA) transcription andreplication (24). Tiao et al. (42) recently studied mitochondrialbiogenesis in the short term of experimental cholestasis andfound that Pgc1-� gene expression, TFAM protein, andmtDNA copy number decreased in the liver within the first 72h of cholestasis. Nevertheless, the regulation of mitochondrialbiogenesis in the long-term cholestasis remains to be estab-lished.

Given the fine tuning in mitochondrial biogenesis to copewith changing metabolic conditions (13), we aimed to identifythe status of the major mitochondrial regulatory pathways inlong-term cholestasis to understand the molecular basis of theassociated mitochondrial dysfunctions. Our results show afailure of mitochondrial biogenesis and genomic instabilityrelated to a marked decrease in TFAM.

MATERIALS AND METHODS

Animal experimentation. Adult male Wistar rats weighing 220–260g were held in individual cages. Animals were distributed into twogroups: a group that underwent bile duct ligation (BDL), and asham-operated group pair-fed to BDL animals (sham). The totalnumber of rats used was 30: 18 BDL rats and 12 control rats. Animalswere euthanized under anesthesia at 14 and 28 days postsurgery. All

Address for reprint requests and other correspondence: J. Sastre, Dept. ofPhysiology, School of Pharmacy, Univ. of Valencia, Avda. Vicente AndrésEstellés, s/n, 46100 Burjassot (Valencia), Spain (e-mail: juan.sastre@uv.es).

Am J Physiol Gastrointest Liver Physiol 301: G119–G127, 2011.First published March 17, 2011; doi:10.1152/ajpgi.00253.2010.

0193-1857/11 Copyright © 2011 the American Physiological Societyhttp://www.ajpgi.org G119

on January 13, 2012ajpgi.physiology.org

Dow

nloaded from

rats received humane care according to the criteria outlined in theGuide for the Care and Use of Laboratory Animals (NIH publication86-23 revised 1985). The study was approved by the ResearchCommittee of the School of Medicine at the University of Valencia(Valencia, Spain).

Common bile duct ligation. BDL was performed as previouslydescribed (38). The correct induction of chronic cholestasis wasassessed by the increase in total bilirubin concentration in plasma[6.3 � 3.3 mg/dl in BDL vs. 0.5 � 0.3 mg/dl in Sham]. Livercirrhosis was confirmed by histological analysis at 4 wk after BDL(see supplementary material; the online version of this articlecontains supplemental data).

Isolation of mitochondria. Mitochondria were isolated by discon-tinuous Percoll gradient (as described in Ref. 31). With use of thismethod, citrate synthase activity increased 4.1 � 0.2-fold (n � 4) incontrol livers and 3.8 � 0.3-fold (n � 3) in cirrhotic livers uponmitochondrial isolation. The corresponding enrichment of mitochon-dria was also confirmed by Western blotting using antibodies specificfor mitochondrial proteins. The recovery of mitochondria in terms ofmilligrams of mitochondrial pellet per milligrams of liver tissue was1.34% in control rats and 0.65% in BDL rats. The appropriate qualityof our isolated mitochondria relies on the respiratory ratio usingsuccinate as substrate (see Table 1). Mitochondrial fraction wassuspended in mitochondrial buffer before storage at �80°C.

Measurement of mitochondrial oxygen consumption and membranepotential. Freshly isolated mitochondria were assayed at 37°C foroxygen consumption via a Clark-type oxygen electrode (HansatechInstruments, King’s Lynn, UK) equipped with Oxygraph Plus Version1.01 and for membrane potential (��) via a tetraphenylphosphonium(TPP�) electrode (WPI Europe, Berlin, Germany). Membrane poten-tial calculations were made by using a modified Nernst equation aspreviously reported (37).

Determination of metabolites. Lactate levels were measured in theliver by the method described by Gutmann and Wahlefeld (11). Thehepatic ATP concentration was assessed by using a commercialbioluminescent assay kit (Enliten ATP assay kit, Promega, Madison,WI), according to the method of Yang et al. (47). ADP was measuredafter conversion to ATP with pyruvate kinase (PK) and phosphoenol-

pyruvate (PEP) and was determined by the luciferin-luciferase assayas the difference between the measurements with and without PK andPEP.

Nuclear protein extraction. Nuclear protein extracts were preparedfrom liver tissue by the method of Deryckere and Gannon (6). Proteinmeasurement was performed by the Bradford assay.

Table 1.

Gene Name Forward Primer (5=-3=) Reverse Primer (5=-3=)

Primer for gene expression

Atp5i CGCCAAGCGCTACAGTTAC TTCCTCCGCTGCTATTCTTCAtp5b CAGCATTTAGGGGAGAGCAC CATGATTCTGCCCAAGGTCTPolg CACTTATCACCATGGCAACG GAGGCAGCTTGAAAAACCAGTfam ACCAAAAAGACCTCGGTCAG CTTCAATTTCCCCTGAGCTGNrf1 GCACCTTTGGAGAATGTGGT GCAGACTCCAGGTCTTCCAGPpargc1a AAGGTCCCCAGGCAGTAGAT CGGTGTCTGTAGTGGCTTGAGabpa TGACCAGCCTGTGCAAATTA GTAGTCGGCGTAGCAGAAGGPprc1 GATCTTGACTCCAATCGGGA AGGTTCTTCTGGGCCTGTTTTfb2m AACGCAATGCCCCAATAATA CGTGTCTCCAGGTCTTTTCCCycs CAGGCTGCTGGATTCTCTTAC TCCCCAGGTGATACCTTTGTIl1b TGACCCATGTGAGCTGAAAG GGGATTTTGTCGTTGCTTGTTnfa TGCCTCAGCCTCTTCTCATT CCCATTTGGGAACTTCTCCTRplp0/Arbp CAGCAGGTGTTTGACAATGG CCCTCTAGGAAGCGAGTGTG

Primers for nDNA and mtDNA quantification

Tbca* TGTCCCACCTGTTTGTTCTCT GGTCCTTGGACACCTAGACG12 s rRNA CTCAAGACGCCTTGCCTAGC TCGTATGACCGCGGTGGCT

Primers for mtDNA deletions

Cox1 GCAGGGATACCTCGTCGTTACyb GTTGGGAATGGAGCGTAGAA

nDNA, nuclear DNA; mtDNA, mitochondrial DNA. *5= upstream intronicsequence of Tbca gene. At least 1 primer of each set was designed to span anintron, thus eliminating the possibility of amplifying genomic DNA.

Table 2. ATP/ADP and mitochondrial function in liver fromrats with long-term cholestasis

State 4 State 3

Sham BDL Sham BDL

Glutamate/malate

O2 consumption 9.1 � 3.6 9.4 � 1.8 63 � 18 27 � 10†RR with glutamate-malate 6.4 � 1.2 2.8 � 1.5*

Succinate

O2 consumption 34 � 9 28 � 3 116 � 24 131 � 28RR with succinate 4.1 � 0.4 4.2 � 0.4Membrane potential 193 � 14 156 � 18*ATP/ADP 1.3 � 0.2 1.0 � 0.35

BDL, bile duct ligation; RR, respiratory ratio (state 3/state 4 oxygenconsumption). The number of experiments was 3–6. Statistical significance isexpressed as follows: *P 0.05; †P 0.01 vs. Sham.

Fig. 1. Sensors and regulators of the energetic state in chronic cholestasis.A: hepatic lactate levels in liver from Sham (n � 4) and bile duct ligation (BDL;n � 7) rats. Values are expressed as means � SD; **P 0.01. B: Western blottingof pyruvate dehydrogenase kinase (PDK), phospho (p)-AMPK (Tyr172), AMPK1,and sirtuin-1 (SIRT1) (representative images) in liver from Sham and BDL rats(n � 3–4). �-Tubulin was used as loading reference.

G120 MITOCHONDRIAL BIOGENESIS IN BILIARY CIRRHOSIS

AJP-Gastrointest Liver Physiol • VOL 301 • JULY 2011 • www.ajpgi.org

on January 13, 2012ajpgi.physiology.org

Dow

nloaded from

Real-time RT-PCR. Liver tissue was homogenized in TRIzol re-agent, and total RNA was isolated by the chloroform:phenol method(Invitrogen). RT was performed using the High Capacity cDNAReverse Transcription Kit with RNase Inhibitor (Applied Biosys-tems).

Quantitative PCR experiments were performed on a thermal cycler(7900HT, Applied Biosystems) by using PowerSYBR Green PCRMaster Mix (Applied Biosystems). Results were normalized by use ofRplp0 as reference. The threshold cycle (Ct) was determined, andrelative gene expression levels were subsequently calculated by the2(���Ct) formula. Primers used for PCR experiments are shown inTable 1.

Determination of the mtDNA/nDNA relative copy number. TotalDNA was extracted by a standard protocol (34). Equal amounts ofDNA were amplified by using specific primers (Table 1). Results wereanalyzed comparatively (mitochondrial-to-nuclear DNA ratio,mtDNA/nDNA).

Determination of mtDNA deletions. Total DNA (400 ng) wasamplified with Taq polymerase (Promega) by use of specific primers(Table 1). Products were resolved by agarose gel electrophoresisstained with ethidium bromide.

Western blotting. Immunoblotting was performed using the ECLsystem (Bio-Rad) and chemiluminescence was detected with acharge-coupled device camera (LAS-3000, Fujifilm) or film autora-diography (Kodak Biomax). Relative protein abundance was referredto total protein as determined by either �-tubulin or Ponceau Sstaining. Antibodies used in Western blotting were as follows: pyru-vate dehydrogenase kinase (PDK; Santa Cruz, sc-28783), phospho-AMPK (Thr172) (Cell Signaling, no. 2531), AMPK1 (GenScript, no.A00664), sirtuin-1 (SIRT1; Upstate, 07-131), PGC-1� (Santa Cruz,sc-13067), NRF-1 (Santa Cruz, sc-23624), GABP-� (Santa Cruz,sc-28311), lamin A/C (Santa Cruz, sc-7293), phospho-AKT (S473)(Cell Signaling, no. 4058), AKT (GenScript, no. 5117), �-tubulin(Santa Cruz, sc-8035), heat shock protein 60 (HSP60; Stressgen,SPA-805), TFAM (Biovision, no. 3885), translocase of the outermitochondrial membrane 20 kDa (TOM20; Santa Cruz, sc-11415),translocase of the outer mitochondrial membrane 70 kDa (TOM70;Santa Cruz, sc-26495), cytochrome c (Santa Cruz, sc-13156),

GAPDH (Cell Signaling, no. 2128), PCNA (Santa Cruz, sc-56),phospho-p65 (S536) (Cell Signaling, no. 3033), p65 (Santa Cruz,sc-109), Bax (Biolegend, no. 62510), Bcl-2 (Cell Signaling, no. 2870),and caspase-3 (Cell Signaling, no. 9665).

Statistical analysis. All results are given as means � SD. Signifi-cant differences were assessed by the one-way ANOVA statisticfollowed by a Tukey’s post hoc test.

RESULTS

Mitochondrial function in long-term cholestasis. Table 2shows that oxygen consumption in liver mitochondria usingglutamate/malate as complex I-linked substrates did not change

Fig. 2. Gene expression of mitochondrial biogenesis regulators in chroniccholestasis. Relative mRNA levels of Ppargc-1a, Pprc1, Nrf-1, and Gabp-ain liver from Sham (n � 4) and BDL rats (n � 4 –7) studied by real-timeRT-PCR. Rplp0 was used as a reference gene. Values are expressed asmeans � SD. **P 0.01.

Fig. 3. Protein levels of mitochondrial biogenesis regulators in chronic choles-tasis. A: Western blotting experiments to assess peroxisome proliferator-activated receptor � coactivator-1� (PGC-1�), nuclear respiratory factor 1(NRF-1), and GA-binding protein-� (GABP-�) levels in liver from Sham andBDL rats. �-Tubulin was used as reference. B: Western blotting of NRF-1 andlamin A/C in nuclear fractions from livers of Sham and BDL rats. C: Westernblotting of phospho-AKT at serine 473 [p-AKT(Ser473)] and AKT in Shamand BDL liver. The number of experiments was 3–5.

G121MITOCHONDRIAL BIOGENESIS IN BILIARY CIRRHOSIS

AJP-Gastrointest Liver Physiol • VOL 301 • JULY 2011 • www.ajpgi.org

on January 13, 2012ajpgi.physiology.org

Dow

nloaded from

in state 4 in long-term cholestasis, but in state 3 it was less thanhalf in BDL rats than in control animals, leading to a 56%reduction in the respiratory ratio. In contrast, when succinatewas used as complex II-linked substrate, oxygen consumptiondid not change significantly in liver mitochondria from BDLrats compared with those from control rats in both states 4 and3. In agreement with our previous work (38), in the presentstudy long-term cholestasis also caused a decrease in mito-chondrial membrane potential (see Table 2). This impairmentin mitochondrial function is associated with an increase in theflux through glycolysis, evidenced by the fourfold increase inhepatic lactate levels in BDL rats (see Fig. 1A). HepaticATP-to-ADP ratio tended to decrease, although not signifi-cantly, in BDL rats compared with Sham rats (see Table 2).The adaptive stimulation of glycolysis upon long-term choles-tasis may account for maintenance of this ratio without signif-icant changes.

Sensors and regulators of the energetic state in long-termcholestasis. PDK, phospho-AMPK (p-AMPK), and SIRT1were measured as major sensors and regulators of the energeticstatus. PDK and SIRT1 protein levels were markedly de-creased in BDL liver vs. controls (P 0.01), whereas p-AMPK was not significantly different between BDL and pair-fed livers (P 0.05) (Fig. 1B).

Regulation of mitochondrial biogenesis at the nuclear levelin long-term cholestasis. Ppargc-1� mRNA expression wasmarkedly decreased in BDL vs. controls (P 0.01); con-versely, Pprc-1 and Nrf-1 gene expression was upregulated inBDL vs. controls (P 0.01) (Fig. 2). Gabp-�/Nrf-2 mRNAwas not significantly different between BDL and controls.

In accordance with the mRNA expression, PGC-1� andGABP-� protein levels were decreased in BDL livers relativeto controls (P 0.01) (Fig. 3A), whereas NRF-1 levels werehigher in BDL liver than in controls (P 0.05). It is notewor-thy that NRF-1 suffered a molecular weight shift that could bedue to a posttranslational modification. However, this modifi-cation does not seem to be glycosylation, nor phosphorylationsince it could not reversed by alkaline phosphatase (results notshown). NRF-1 is a shuttling nuclear/cytoplasmic protein, andhence its nuclear localization in BDL liver was investigated.

Similarly to the Sham liver, NRF-1 was also present in thenuclear extracts from BDL liver (Fig. 3B). NRF-1 phosphory-lation and trans-activation of its target genes is promoted byphosphorylation of AKT at serine 473 [p-AKT(Ser473)] (41).Hence, we also studied p-AKT(Ser473), which was decreasedsignificantly in BDL liver vs. controls despite upregulation ofAKT levels (P 0.01) (Fig. 3C).

Gene expression of nuclear-encoded mitochondrial proteinsin long-term cholestasis. The transcription factors that con-trol mitochondrial biogenesis regulate the gene expressionof critical nuclear encoded mitochondrial proteins, such aspolymerase � (Polg), Tfam, and cytochrome c (Cycs). Thegene expression of these target genes was decreased in BDLrats with respect to controls (Fig. 4). The mRNA expressionof Atp5b and Atp5i, two subunits of the oxidative phosphor-ylation complexes, was also downregulated in liver fromBDL rats, whereas gene expression of the transcriptionfactor Tfb2m was not affected upon long-term cholestasis(Fig. 4).

TFAM and other mitochondrial proteins during chroniccholestasis. Protein levels of TFAM, a major regulator ofmtDNA replication and transcription, increased at 2 wk afterBDL, but they diminished markedly at 4 wk (Fig. 5A). Markedchanges were also found at 4 wk in two transmembranereceptor proteins, TOM70 and TOM20, components of thetranslocase of the outer mitochondrial membrane (TOM).TOM70 levels were remarkably lower at 4 wk, whereasTOM20 increased at this stage (Fig. 5A). No significantchanges were found for HSP60 and cytochrome c.

mtDNA/nDNA relative copy number and cell proliferation inlong-term cholestasis. The mtDNA/nDNA relative copy num-ber did not change significantly at 2 wk, but it decreaseddramatically, by 65% (612 vs. 1689), in BDL livers vs. controls(P 0.01) at 4 wk (Fig. 5B). PCNA levels, an index of cellproliferation, were upregulated both at 2 and 4 wk after BDL(see Fig. 5C). Therefore, the upregulation of TFAM at 2 wkseems to maintain mtDNA/nDNA ratio in presence of in-creased cell proliferation. However, the marked decrease inTFAM levels in the long term, i.e., at 4 wk, leads to a dramatic

Fig. 4. Gene expression of nuclear-encodedmitochondrial proteins in chronic cholestasis.Relative mRNA levels of Polg, Tfam, andTfb2m (top) and Cycs, Atp5b, Atp5i (bottom)in liver from Sham (n � 4) and BDL (n � 7)rats studied by real-time PCR. Rplp0 wasused as a reference gene. mtDNA, mito-chondrial DNA; OXPHOS, oxidative phos-phorylation. Values are expressed as means �SD. *P 0.05 and **P 0.01.

G122 MITOCHONDRIAL BIOGENESIS IN BILIARY CIRRHOSIS

AJP-Gastrointest Liver Physiol • VOL 301 • JULY 2011 • www.ajpgi.org

on January 13, 2012ajpgi.physiology.org

Dow

nloaded from

decrease in mtDNA vs. nDNA even with enhanced cell pro-liferation.

Inflammatory status and evolution of apoptosis duringchronic cholestasis. Figure 6 shows that chronic cholestasisleads to a chronic proinflammatory state, evidenced by upregu-lation of IL-1� and TNF-� mRNAs and phosphorylation ofp65, the latter as an index of NF-�B activation, at both 2 and4 wk. This chronic inflammation and the maintained upregu-lation of TNF-� were associated with a transient activation ofapoptosis. Indeed, although apoptosis was significantly trig-gered at 2 wk of BDL, as evidenced by increased levels ofcleaved caspase 3 and BAX, these indexes of apoptosis re-turned almost to normal levels at 4 wk (Fig. 7). Upregulationof BCL-2 without a parallel increase in BAX levels at 4 wk(Fig. 7) would explain, at least in part, the reduction ofapoptosis in long-term cholestasis.

mtDNA deletions occur in long-term cholestasis. Sincechronic TFAM deficiency might result in higher mtDNA in-stability, we investigated the appearance of large mtDNAmutations by PCR analysis. The results revealed that differentmtDNA deletions may occur in the development of long-termcholestasis. Indeed, five of eight BDL livers exhibited extrabands in the PCR amplification, indicating the presence of

deletions in the mitochondrial genome (Fig. 8) that were absentin the livers of control animals.

DISCUSSION

The adaptive response to energy demand fails in the liver inlong-term cholestasis. Chronic cholestasis leads to severe mito-chondrial dysfunction in rodents and humans, evidenced by lossof membrane potential as well as decreased activity of the respi-ratory chain complexes, fatty acid oxidation, and ketone bodyformation (10, 18–20, 22, 23, 38). In the present study long-termcholestasis caused a decrease in mitochondrial oxygen consump-tion likely to be ascribed to a loss in complex-I activity togetherwith an adaptive stimulation of glycolysis. In addition, we founda striking lack of induction of metabolic sensors, PDK, AMPK,and SIRT1, in face of a metabolic stress. PDK inactivates viaphosphorylation the pyruvate dehydrogenase complex that cata-lyzes the irreversible decarboxylation of pyruvate to acetyl coen-zyme A. Hence, PDK controls the entry of pyruvate into the citricacid cycle and contributes to switch the energy source fromglucose oxidation to fatty acid oxidation (44). PDK was down-regulated in long-term cholestasis, releasing the brake for glucoseoxidation and lipogenesis.

Fig. 5. Levels of mitochondrial transcription factor A (TFAM) and other mitochondrial proteins, mitochondrial-to-nuclear DNA ratio (mtDNA/nDNA) relativecopy number, and PCNA levels in chronic cholestasis. A: TFAM, Tom70, Tom20, cytochrome c (Cyt-c), and HSP60 protein levels in hepatic mitochondria fromSham and BDL rats. Ponceau staining was used as loading reference. The number of experiments was 3–4. B: mtDNA/nDNA relative copy number determinedby real-time PCR in liver from Sham (n � 4) and BDL (n � 7) rats. **P 0.01 vs. Sham. C: PCNA protein levels in liver from Sham and BDL rats. The numberof experiments was 3–4. GAPDH was used as loading reference.

G123MITOCHONDRIAL BIOGENESIS IN BILIARY CIRRHOSIS

AJP-Gastrointest Liver Physiol • VOL 301 • JULY 2011 • www.ajpgi.org

on January 13, 2012ajpgi.physiology.org

Dow

nloaded from

AMPK is activated by energetic stress (low ATP and highAMP) and acts to maintain cellular energy stores by switchingoff energy-consuming biosynthetic pathways and switching onATP-generating pathways, such as fatty acid oxidation andmitochondrial biogenesis (3). Despite the metabolic stressassociated with mitochondrial impairment, we did not findAMPK activation in liver of BDL rats.

The NAD�-dependent type III deacetylase SIRT1 is anothermetabolic sensor that plays a key role in hepatic glucose andlipid homeostasis by inducing gluconeogenesis, fatty acid ox-idation, and cholesterol degradation (32). Long-term cholesta-sis led to SIRT1 downregulation, suggesting lower capacity forfatty acid oxidation and cholesterol degradation.

Consequently, the downregulation of PDK4, AMPK, andSIRT1 shows that mitochondrial impairment and the corre-sponding energetic stress do not trigger an adaptive response inthe liver in long-term cholestasis.

Decreased mitochondrial biogenesis occurs in the liver inlong-term chronic cholestasis. The energetic deficiency shouldactivate mitochondrial biogenesis through PGC-1�, NRF-1,and GABP-�/NRF2 (2, 18, 28, 30). PGC-1� is a key regulatorof cellular energy metabolism with crucial roles in thecontrol of mitochondrial biogenesis and antioxidants (30).Expression of Ppargc-1a gene is highly inducible accordingto the tissue energy demands, and accordingly it is rapidlyupregulated in the liver upon starvation (30, 45). However,Ppargc-1a gene expression and PGC-1� protein levels weredownregulated upon long-term chronic cholestasis, contrib-uting not only to a reduced mitochondrial biogenesis but alsoto the mitochondrial oxidative stress that occurs in BDL rats(38). Further research is needed to elucidate the upstreammechanisms responsible for the downregulation of PGC1-�.CREB is a major regulator of PGC1� mRNA expression (12),

and changes in its expression and phosphorylation level mightcontribute to PGC1-� downregulation in long-term cholestasis.

PDK-4, the major PDK isoform in the liver, is under thecontrol of PGC1-�, which downregulates glucose oxidation byinducing PDK4 gene expression (44). Consequently, the de-crease in PGC1-� may explain the absence of PDK-4 upregu-lation.

Both energetic stress and oxidative stress activate NRF-1through phosphorylation (2, 41), in the latter case via AKT/protein kinase B. Although NRF-1 was upregulated in the liverof BDL rats, it exhibited a posttranslational modification notrelated to phosphorylation, and its specific target gene Cycswas downregulated. Its coactivator PGC1-� was decreased andAKT was not phosphorylated in BDL liver. Hence, the NRF-1pathway seems to be inactive or reduced upon long-termchronic cholestasis despite the energetic stress and oxidativestress that occur in this condition (10, 38). Nrf-1 upregulationmight be mediated, at least in part, by the parallel increase inPprc1. The upregulation of Pprc1 mRNA could be associatedwith the proliferative state present in long-term cholestasis, asdescribed in other proliferative models (1).

GABP-� also senses cellular energy demands and regulatesthe transcriptional activity of COX nuclear subunits and TFAM(28). GABP-�/NRF-2 was largely decreased in the liver uponlong-term cholestasis. Consequently, in biliary cirrhosis thereis a general failure in the regulation of mitochondrial biogen-esis to meet energetic and signaling demands.

The activity of Tfam rat promoter is mainly regulated by thecoactivator PGC-1� together with the trans-acting elementsNRF-1 and GABP-�/NRF-2 (45). GABP-� and PGC-1� werelargely decreased in BDL rats, and NRF-1 was not transcrip-tionally active. Accordingly, Tfam transcript level was de-creased in BDL liver. In addition, expression of nuclear tran-

Fig. 6. Activation of NF-�B and expression ofproinflammatory cytokines during chronic choles-tasis. A: representative Western blot of total pro-tein levels of p65 and its phosphorylated form(p65-S356) in liver from Sham and BDL rats at 2and 4 wk after BDL. GAPDH was used as aloading control. B: mRNA expression levels ofIL-1� and TNF-� measured by real-time RT-PCRin liver of Sham and BDL rats. Rplp0 was used asa reference gene. The number of experiments was3–5. *P 0.05; **P 0.01 vs. Sham.

G124 MITOCHONDRIAL BIOGENESIS IN BILIARY CIRRHOSIS

AJP-Gastrointest Liver Physiol • VOL 301 • JULY 2011 • www.ajpgi.org

on January 13, 2012ajpgi.physiology.org

Dow

nloaded from

scripts Cycs, Polg, Atp5i, and Atp5b that encode for mitochon-drial proteins was downregulated in the liver upon long-termcholestasis. Similar findings were obtained with mitochondrial-encoded genes CoxI and Cyb (results not shown). The upregu-lation of the Pprc1, a related coactivator of PGC-1�, does not

seem enough to maintain the expression of mitochondrialencoded genes.

Our experiments show a transient increase in mitochondrialTFAM levels at 2 wk after BDL, but a marked decrease ofTFAM at 4 wk. Downregulation of Tfam expression in thislatter stage would contribute to the low TFAM levels, whichmay be responsible, at least in part, for the mitochondrialdysfunction in long-term cholestasis. Indeed, TFAM geneknockdown led to reduced mitochondrial respiratory activityand ATP production (14).

The loss of mitochondrial TFAM in long-term cholestasismight also be ascribed to a failure in the import of matrix-targeted proteins. Indeed, mitochondrial membrane potential(��m), a driving force for the import of most matrix-directedmitochondrial proteins (29), is decreased in chronic cholesta-sis, as we reported previously (38) and confirm here. In BDLlivers we also found a dramatic decrease in TOM70 levels, atransmembrane receptor protein that belongs to the TOMcomplex (5). In contrast, levels of TOM20, another transmem-brane receptor, were increased in BDL mitochondria, probablyas an adaptive compensatory response. Therefore, changes inthe composition of the TOM complex might affect the importof matrix-targeted proteins.

Recently, Suliman et al. (39) have reported that S-nitros(yl)-ation of mitochondrial HSP60 regulates TFAM accumulation

Fig. 7. Apoptosis in the liver during chronic cholestasis. A: representative Western blots of protein levels of pro-caspase 3 (Casp-3) and cleaved caspase 3 inliver from Sham and BDL rats at 2 and 4 wk after BDL. GAPDH was used as a loading control. B: densitometric quantification of cleaved caspase 3 vs. GAPDH.**P 0.01 vs. Sham. C: representative Western blotting of Bax and Bcl-2 protein levels in isolated mitochondria from Sham and BDL rats. Ponceau stainingwas used to confirm equal loading. The number of experiments was 3–4.

Fig. 8. Mitochondrial DNA deletions in long-term cholestasis. PCR amplifi-cation of the “hot spot” of mitochondrial DNA reveals multiple deletions. The8.3-kb fragment spanning from mitochondrial cytochrome c oxidase, subunit I(mtCOXI) to mitochondrial cytochrome b (mtCYB) was amplified by PCR(see MATERIALS AND METHODS). The picture shows a representative image ofagarose gel electrophoresis for PCR fragments of mtDNA from Sham andBDL livers at 4 wk after BDL. Arrows mark mtDNA deletions. The asteriskmarks a nonspecific product.

G125MITOCHONDRIAL BIOGENESIS IN BILIARY CIRRHOSIS

AJP-Gastrointest Liver Physiol • VOL 301 • JULY 2011 • www.ajpgi.org

on January 13, 2012ajpgi.physiology.org

Dow

nloaded from

in mitochondria in peritonitis. Although no significant changesin HSP60 levels were found in our experimental model oflong-term cholestasis, the contribution of S-nitros(yl)atedHSP60 to the decreased mitochondrial TFAM levels and itschaperone function remains to be investigated in this liverdisease.

Since TFAM is a major regulator of mtDNA transcriptionand replication (17, 24), its remarkable fall together withdownregulation of Polg expression may be directly responsiblefor the mtDNA depletion, 65% decrease in mtDNA/nDNArelative copy number, found in long-term cholestasis. Accord-ing to our results, this blockade of mitochondrial biogenesisshould not be ascribed to activation of apoptosis or inhibitionof cell proliferation.

mtDNA deletions occur in the liver in long-term cholestasis.Deletions or rearrangement of mtDNA have been identified inmitochondrial hepatopathies, which may be associated with asevere reduction in the mtDNA copy number (26). In addition,TFAM is considered a histone-like protein that protectsmtDNA and its fall might lead to mtDNA instability. Our studyshows that long-term cholestasis leads to mtDNA deletions thatare likely to be consequence of loss TFAM. As an alternativeexplanation, oxidative stress, which has been previously ob-served in BDL liver (38), could be responsible for oxidativedamage to mtDNA and occurrence of mtDNA deletions (40).Somatic mtDNA mutations have been associated with hepato-carcinogenesis (48). Consequently, and taking into accountthese mtDNA mutations together with the severe mtDNAdepletion, long-term cholestasis and biliary cirrhosis should beconsidered a secondary mitochondrial hepatopathy.

In conclusion, in long-term cholestasis we identified a lackof adaptive response to energetic stress that normally inducesmitochondrial biogenesis. In addition, impaired mitochondrialturnover, severe mtDNA depletion, and increased mtDNAinstability are likely to account for the reduction in mitochon-drial ATP production and increased mitochondrial reactiveoxygen species production that are characteristic of chroniccholestasis. Therefore, long-term cholestasis and biliary cirrho-sis should be considered a secondary mitochondrial hepatopa-thy in which both the mitochondrial impairment and lack ofstimulation of mitochondrial biogenesis may sustain and per-petuate liver damage.

GRANTS

This work was supported by Grants CSD-2007-00020, SAF2006-06963,and SAF2009-09500 from Ministerio de Ciencia e Innovación together withFEDER funds to J. Sastre and Grant Prometeo/2010/074 to J. Viña.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).

REFERENCES

1. Andersson U, Scarpulla RC. Pgc-1-related coactivator, a novel, serum-inducible coactivator of nuclear respiratory factor 1-dependent transcrip-tion in mammalian cells. Mol Cell Biol 21: 3738–3749, 2001.

2. Bergeron R, Ren JM, Cadman KS, Moore IK, Perret P, Pypaert M,Young LH, Semenkovich CF, Shulman GI. Chronic activation of AMPkinase results in NRF-1 activation and mitochondrial biogenesis. Am JPhysiol Endocrinol Metab 281: E1340–E1346, 2001.

3. Cantó C, Gerhart-Hines Z, Feige JN, Lagouge M, Noriega L, MilneJC, Elliott PJ, Puigserver P, Auwerx J. AMPK regulates energy expen-diture by modulating NAD� metabolism and SIRT1 activity. Nature 458:1056–1060, 2009.

4. Chen CH, Nagayama K, Enomoto N, Miyasaka Y, Kurosaki M,Sakamoto N, Maekawa S, Kakinuma S, Ikeda T, Izumi N, Sato C,Watanabe M. Enhancement of mitochondrial gene expression in the liverof primary biliary cirrhosis. Hepatol Res 31: 24–30, 2005.

5. Dekker PJ, Ryan MT, Brix J, Müller H, Hönlinger A, Pfanner N.Preprotein translocase of the outer mitochondrial membrane: moleculardissection and assembly of the general import pore complex. Mol Cell Biol18: 6515–6524, 1998.

6. Deryckere F, Gannon F. A one-hour minipreparation technique forextraction of DNA-binding proteins from animal tissues. Biotechniques16: 405, 1994.

7. Diekert K, de Kroon AI, Ahting U, Niggemeyer B, Neupert W, deKruijff B, Lill R. Apocytochrome c requires the TOM complex fortranslocation across the mitochondrial outer membrane. EMBO J 20:5626–5635, 2001.

8. Ducluzeau PH, Lachaux A, Bouvier R, Streichenberger N, Stepien G,Mousson B. Depletion of mitochondrial DNA associated with infantilecholestasis and progressive liver fibrosis. J Hepatol 30: 149–55, 1999.

9. Forestier M, Solioz M, Isbeki F, Talos C, Reichen J, Krähenbühl S.Hepatic mitochondrial proliferation in rats with secondary biliary cirrho-sis: time course and mechanisms. Hepatology 26: 386–391, 1997.

10. Goncalves I, Hermans D, Chretien D, Rustin P, Munnich A,Saudubray JM, Van Hoof F, Reding R, de Ville de Goyet J, Otte JB,Buts JP, Sokal EM. Mitochondrial respiratory chain defect: a newetiology for neonatal cholestasis and early liver insufficiency. J Hepatol23: 290–294, 1995.

11. Gutmann I, Wahlefeld AW. L-(�)Lactate: determination with lactatedehydrogenase and NAD. In: Methods of Enzymatic Analysis (2nd ed.),edited by Bergmeyer HU. New York: Academic, 1974, vol. 3, p. 1464–1468.

12. Herzig S, Long F, Jhala US, Hedrick S, Quinn R, Bauer A, RudolphD, Schutz G, Yoon C, Puigserver P, Spiegelman B, Montminy M.CREB regulates hepatic gluconeogenesis through the coactivator PGC-1.Nature 413: 179–183, 2001.

13. Hock MB, Kralli A. Transcriptional control of mitochondrial biogenesisand function. Annu Rev Physiol 71: 177–203, 2009.

14. Jeng JY, Yeh TS, Lee JW, Lin SH, Fong TH, Hsieh RH. Maintenanceof mitochondrial DNA copy number and expression are essential forpreservation of mitochondrial function and cell growth. J Cell Biochem103: 347–357, 2008.

15. Joseph AM, Rungi AA, Robinson BH, Hood DA. Compensatory re-sponses of protein import and transcription factor expression in mitochon-drial DNA defects. Am J Physiol Cell Physiol 286: C867–C875, 2004.

16. Kang PJ, Ostermann J, Shilling J, Neupert W, Craig EA, Pfanner N.Requirement for HSP70 in the mitochondrial matrix for translocation andfolding of precursor proteins. Nature 348: 137–143, 1990.

17. Kanki T, Ohgaki K, Gaspari M, Gustafsson CM, Fukuoh A, Sasaki N,Hamasaki N, Kang D. Architectural role of mitochondrial transcriptionfactor A in maintenance of human mitochondrial DNA. Mol Cell Biol 24:9823–9834, 2004.

18. Komura M, Chijiiwa K, Naito T, Kameoka N, Yamashita H, Yama-guchi K, Kuroki S, Tanaka M. Sequential changes of energy charge,lipoperoxide level, and DNA synthesis rate of the liver following biliaryobstruction in rats. J Surg Res 61: 503–508, 1996.

19. Krähenbühl L, Schäfer M, Krähenbühl S. Reversibility of hepaticmitochondrial damage in rats with long-term cholestasis. J Hepatol 28:1000–1007, 1998.

20. Krähenbühl S, Talos C, Reichen J. Mechanisms of impaired hepaticfatty acid metabolism in rats with long-term bile duct ligation. Hepatology19: 1272–1281, 1994.

21. Krimmer T, Rapaport D, Ryan MT, Meisinger C, Kassenbrock CK,Blachly-Dyson E, Forte M, Douglas MG, Neupert W, Nargang FE,Pfanner N. Biogenesis of porin of the outer mitochondrial membraneinvolves an import pathway via receptors and the general import pore ofthe TOM complex. J Cell Biol 152: 289–300, 2001.

22. Lang C, Berardi S, Schäfer M, Serra D, Hegardt FG, Krähenbühl L,Krähenbühl S. Impaired ketogenesis is a major mechanism for disturbedhepatic fatty acid metabolism in rats with long-term cholestasis and afterrelief of biliary obstruction. J Hepatol 37: 564–571, 2002.

23. Lang C, Schäfer M, Serra D, Hegardt F, Krähenbühl L, KrähenbühlS. Impaired hepatic fatty acid oxidation in rats with short-term cholestasis:characterization and mechanism. J Lipid Res 42: 22–30, 2001.

24. Larsson NG, Wang J, Wilhelmsson H, Oldfors A, Rustin P, Lewan-doski M, Barsh GS, Clayton DA. Mitochondrial transcription factor A is

G126 MITOCHONDRIAL BIOGENESIS IN BILIARY CIRRHOSIS

AJP-Gastrointest Liver Physiol • VOL 301 • JULY 2011 • www.ajpgi.org

on January 13, 2012ajpgi.physiology.org

Dow

nloaded from

necessary for mtDNA maintenance and embryogenesis in mice. Nat Genet18: 231–236, 1998.

25. Lazaridis KN, Talwalkar JA. Clinical epidemiology of primary biliarycirrhosis: incidence, prevalence, and impact of therapy. J Clin Gastroen-terol 41: 494–500, 2007.

26. Lee WS, Sokol RJ. Mitochondrial hepatopathies: advances in geneticsand pathogenesis. Hepatology 45: 1555–1565, 2007.

27. Miyoshi H, Rust C, Roberts PJ, Burgart LJ, Gores GJ. Hepatocyteapoptosis after bile duct ligation in the mouse involves Fas. Gastroenter-ology 117: 669–677, 1999.

28. Ongwijitwat S, Liang HL, Graboyes EM, Wong-Riley MT. Nuclearrespiratory factor 2 senses changing cellular energy demands and itssilencing down-regulates cytochrome oxidase and other target genemRNAs. Gene 374: 39 –49, 2006.

29. Pfanner N, Wiedemann N. Mitochondrial protein import: two mem-branes, three translocases. Curr Opin Cell Biol 14: 400–411, 2002.

30. Puigserver P, Spiegelman BM. Peroxisome proliferator-activated recep-tor-gamma coactivator 1 alpha (PGC-1 alpha): transcriptional coactivatorand metabolic regulator. Endocr Rev 24: 78–90, 2003.

31. Rajapakse N, Shimizu K, Payne M, Busija D. Isolation and character-ization of intact mitochondria from neonatal rat brain. Brain Res Brain ResProtoc 8: 176–183, 2001.

32. Rodgers JT, Puigserver P. Fasting-dependent glucose and lipid meta-bolic response through hepatic sirtuin 1. Proc Natl Acad Sci USA 104:12861–12866, 2007.

33. Rolo AP, Oliveira PJ, Moreno AJ, Palmeira CM. Bile acids affect livermitochondrial bioenergetics: possible relevance for cholestasis therapy.Toxicol Sci 57: 177–185, 2000.

34. Sambrook J, Fritschi EF, Maniatis T. Molecular Cloning: A LaboratoryManual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press,1989.

35. Scarpulla RC. Transcriptional paradigms in mammalian mitochondrialbiogenesis and function. Physiol Rev 88: 611–638, 2008.

36. Seidel-Rogol BL, Shadel GS. Modulation of mitochondrial transcriptionin response to mtDNA depletion and repletion in HeLa cells. NucleicAcids Res 30: 1929–1934, 2002.

37. Serviddio G, Bellanti F, Romano AD, Tamborra R, Rollo T, AltomareE, Vendemiale G. Bioenergetics in aging: mitochondrial proton leak inaging rat liver, kidney and heart. Redox Rep 12: 91–95, 2007.

38. Serviddio G, Pereda J, Pallardó FV, Carretero J, Borras C, Cutrin J,Vendemiale G, Poli G, Viña J, Sastre J. Ursodeoxycholic acid protects

against secondary biliary cirrhosis in rats by preventing mitochondrialoxidative stress. Hepatology 39: 711–720, 2004.

39. Suliman HB, Babiker A, Withers CM, Sweeney TE, Carraway MS,Tatro LG, Bartz RR, Welty-Wolf KE, Piantadosi CA. Nitric oxidesynthase-2 regulates mitochondrial HSP60 chaperone function duringbacterial peritonitis in mice. Free Radic Biol Med 48: 736–746, 2010.

40. Suliman HB, Carraway MS, Piantadosi CA. Postlipopolysaccharideoxidative damage of mitochondrial DNA. Am J Respir Crit Care Med 167:570–579, 2003.

41. Suliman HB, Carraway MS, Welty-Wolf KE, Whorton AR, Pianta-dosi CA. Lipopolysaccharide stimulates mitochondrial biogenesis viaactivation of nuclear respiratory factor-1. J Biol Chem 278: 41510–41518,2003.

42. Tiao MM, Lin TK, Liou CW, Wang PW, Chen JB, Kuo FY, HuangCC, Chou YM, Chuang JH. Early transcriptional deregulation of hepaticmitochondrial biogenesis and its consequent effects on murine cholestaticliver injury. Apoptosis 14: 890–899, 2009.

43. Valle I, Alvarez-Barrientos A, Arza E, Lamas S, Monsalve M. PGC-1alpha regulates the mitochondrial antioxidant defense system in vascularendothelial cells. Cardiovasc Res 66: 562–573, 2005.

44. Wende AR, Huss JM, Schaeffer PJ, Giguère V, Kelly DP. PGC-1alphacoactivates PDK4 gene expression via the orphan nuclear receptor ER-Ralpha: a mechanism for transcriptional control of muscle glucose me-tabolism. Mol Cell Biol 25: 10684–10694, 2005.

45. Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha V,Troy A, Cinti S, Lowell B, Scarpulla RC, Spiegelman BM. Mechanismscontrolling mitochondrial biogenesis and respiration through the thermo-genic coactivator PGC-1. Cell 98: 115–124, 1999.

46. Yamamoto H, Fukui K, Takahashi H, Kitamura S, Shiota T, Terao K,Uchida M, Esaki M, Nishikawa S, Yoshihisa T, Yamano K, Endo T.Roles of Tom70 in import of presequence-containing mitochondrial pro-teins. J Biol Chem 284: 31635–31646, 2009.

47. Yang NC, Ho WM, Chen YH, Hu ML. A convenient one-step extractionof cellular ATP using boiling water for the luciferin-luciferase assay ofATP. Anal Biochem 306: 323–327, 2002.

48. Yin PH, Lee HC, Chau GY, Wu YT, Li SH, Lui WY, Wei YH, Liu TY,Chi CW. Alteration of the copy number and deletion of mitochondrialDNA in human hepatocellular carcinoma. Br J Cancer 90: 2390–2396,2004.

G127MITOCHONDRIAL BIOGENESIS IN BILIARY CIRRHOSIS

AJP-Gastrointest Liver Physiol • VOL 301 • JULY 2011 • www.ajpgi.org

on January 13, 2012ajpgi.physiology.org

Dow

nloaded from