Mapping of quantitative trait loci for basmati quality traitsin rice (Oryza sativa L.)

Yellari Amarawathi Æ Rakesh Singh Æ Ashok K. Singh Æ Vijai P. Singh ÆTrilochan Mohapatra Æ Tilak R. Sharma Æ Nagendra K. Singh

Received: 3 May 2006 / Accepted: 2 May 2007 / Published online: 9 June 2007

� Springer Science+Business Media B.V. 2007

Abstract Traditional basmati rice varieties are very

low yielding due to their poor harvest index, tendency

to lodging and increasing susceptibility to foliar

diseases; hence there is a need to develop new

varieties combining the grain quality attributes of

basmati with high yield potential to fill the demand

gap. Genetic control of basmati grain and cooking

quality traits is quite complex, but breeding work can

be greatly facilitated by use of molecular markers

tightly linked to these traits. A set of 209 recombinant

inbred lines (RILs) developed from a cross between

basmati quality variety Pusa 1121 and a contrasting

quality breeding line Pusa 1342, were used to map the

quantitative trait loci (QTLs) for seven important

quality traits namely grain length (GL), grain breadth

(GB), grain length to breadth ratio (LBR), cooked

kernel elongation ratio (ELR), amylose content (AC),

alkali spreading value (ASV) and aroma. A frame-

work molecular linkage map was constructed using

110 polymorphic simple sequence repeat (SSR)

markers distributed over the 12 rice chromosomes.

A number of QTLs, including three for GL, two for

GB, two for LBR, three for aroma and one each for

ELR, AC and ASV were mapped on seven different

chromosomes. While location of majority of these

QTLs was consistent with the previous reports, one

QTL for GL on chromosomes 1, and one QTL each

for ELR and aroma on chromosomes 11 and 3,

respectively, are being reported here for the first time.

Contrary to the earlier reports of monogenic recessive

inheritance, the aroma in Pusa 1121 is controlled by

at least three genes located on chromosomes 3, 4 and

8, and similar to the reported association of badh2

gene with aroma QTL on chromosome 8, we

identified location of badh1 gene in the aroma QTL

interval on chromosome 4. A discontinuous 5 + 3 bp

deletion in the seventh exon of badh2 gene, though

present in all the RILs with high aroma, was not

sufficient to impart this trait to the rice grains as many

of the RILs possessing this deletion showed only mild

or no aroma expression.

Keywords Basmati � Rice � Grain and cooking

quality � QTL � SSR markers

Electronic supplementary material The online version ofthis article (doi:10.1007/s11032-007-9108-8) containssupplementary material, which is available to authorized users.

Y. Amarawathi � R. Singh � T. Mohapatra �T. R. Sharma � N. K. Singh (&)

Rice Genome Laboratory, National Research Centre on

Plant Biotechnology, Indian Agricultural Research

Institute, Lal Bahadur Shastri Building, Pusa Campus,

New Delhi, Delhi 110012, India

e-mail: nksingh@nrcpb.org

A. K. Singh � V. P. Singh

Division of Genetics, Indian Agricultural Research

Institute, New Delhi 110012, India

Present Address:R. Singh

National Bureau of Plant Genetic Resources, New Delhi

110012, India

123

Mol Breeding (2008) 21:49–65

DOI 10.1007/s11032-007-9108-8

Abbreviations

AC Amylose content

ASV Alkali spreading value

ELR Cooked kernel elongation ratio

GL Grain length

GB Grain breadth

LBR Grain length to breadth ratio

SSR Simple sequence repeat

QTL Quantitative trait locus

Introduction

Rice is one of the most important cereal crops and is

staple food for more than half of the world popula-

tion. The inherent quality of rice grain assumes

special significance because most of the rice produce

is cooked and consumed as a whole kernel, the

percentage of rice converted into flour or flakes being

very small (Huang et al. 1998). The grain quality

attributes of rice that determine its acceptability by

the end user can be grouped into two main categories,

(i) grain appearance and (ii) cooking and eating

qualities (Juliano and Villareal 1993). The appear-

ance quality is determined by grain length, breadth,

length-breadth ratio, and translucency of the endo-

sperm. The cooking and eating quality traits include

volume expansion, fluffiness, cooked kernel elonga-

tion, firmness/stickiness (related to amylose content),

gelatinization temperature (also measured as alkali

spreading value), mouth feel and a pleasant aroma.

Each of these traits is determined by the physico-

chemical properties of the rice grain which in turn are

genetically controlled with some modulation of

expression by the growth environment. Long slender

grain aromatic basmati rice varieties are traditionally

grown in the foothills of the Himalayas and on the

Indo-Gangetic plains and command premium price in

the international market (Redona and Mackill 1998).

Breeding for high yielding superior quality basmati

rice varieties will require precise knowledge of the

genes controlling these traits. Most of these grain

quality attributes are controlled by quantitative trait

loci (QTLs) as inferred from continuous phenotypic

variation in the segregating progeny of intervarietal

crosses. It is difficult for the breeders to select for

quality using conventional methods due to lack of

discrete phenotypic classes in the progeny and

tedious methodologies for quality testing. Assessment

of rice grain quality is further complicated by the

triploid nature of the endosperm and the effect of

environment on the expression of these traits (He

et al. 1999). Earlier studies have focused on physico-

chemical and sensory evaluation of the rice grain

quality with emphasis on amylose content, alkali

spreading value, gel consistency and chalkiness of the

endosperm (McKenzie and Rutger 1983; Tan et al.

1999; Lanceras et al. 2000). Genetics of rice quality

has also been studied in various genetic backgrounds

using molecular markers (Ahn et al. 1992, 1993;

Lorieux et al. 1996; Radona and Mackill 1998; He

et al. 1999; Aluko et al. 2004; Bradbury et al. 2005a,

b; Wanchana et al. 2005, Wan et al. 2006; Chen et al.

2006). The badh2 gene located on the long arm of

rice chromosome 8 has been implicated in the control

of rice aroma and a perfect marker system has been

developed employing single tube allele specific assay

to screen for aroma in segregating rice progeny

(Bradbury et al. 2005b).

Despite these mapping efforts, only limited infor-

mation is available on the molecular mapping of

genes/QTLs for grain appearance and cooking quality

traits in basmati rice. Furthermore, availability of

small amount of grains and transient heterozygous

nature of the F2/F3 progeny, do not allow accurate

and repeated destructive analysis of the rice grain

quality parameters. Therefore, an immortal mapping

population of recombinant inbred lines (RILs) was

developed from a cross between basmati quality Pusa

1121 and non-basmati quality Pusa 1342 and used to

identify QTLs for grain length, breadth, length/

breadth ratio, cooked kernel elongation ratio, amy-

lose content, alkali spreading value and aroma in the

present study.

Materials and methods

Plant material

A mapping population of RILs was developed from a

cross between Pusa 1121 and Pusa 1342 using single

seed descend method. Pusa 1121, is a basmati quality

aromatic extra long slender grain variety with high

alkali spreading value (low gelatinization tempera-

ture), intermediate amylose content and exceptionally

high cooked kernel length, developed at the Indian

Agricultural Research Institute, New Delhi (Singh

50 Mol Breeding (2008) 21:49–65

123

et al. 2002). It was crossed as female to Pusa 1342, a

non-aromatic new plant type breeding line with

medium grain length, high amylose content, low

alkali spreading value and medium kernel elongation

upon cooking. The RIL population consisted of 194

F6 lines derived from independent F2 seeds of a single

F1 plant. In addition, 15 sister lines from 13 of these

RILs, 11 RILs with A and B types and two RILs with

A, B and C types, were also included in the analysis

making a total of 209 RILs. The sib lines were

identified at the F4 stage taking advantage of late

segregation in some of the RILs for one or two

morphological traits. The 209 RILs were planted in

normal rice growing season of 2004 at the Indian

Agricultural Research Institute in an augmented field

design with parental lines and a check variety Pusa

Basmati 1 repeated after every 20 lines.

Phenotyping for grain quality traits

Mature F7 grains of the RILs and parental lines were

dried at 378C for 15 days, dehulled in a laboratory Mill

(model no. NF 271) and polished with a mini polisher

(Kett Electronics, Japan). A set of ten representative

unbroken polished grains were spread on a graph paper

and photographed using CCD camera (Alpha Innotech

FluorChemTM 5500) for the measurement of grain

dimensions. The CCD camera was first calibrated

against Vernier calipers and photo enlarger manual

readings. Image Pro Plus software version 4.1 (Media

Cybernetics) was used to automatically estimate the

mean, range and standard deviation of length (GL) and

breadth (GB) of ten grains before and after cooking

(Fig. S1.D). The measurements were repeated with

another set of ten grains, thus total 20 grains were

analyzed for each line. The length to breadth ratio

(LBR) was calculated by dividing mean GL with mean

GB of the ten grains in each replication. Similarly,

cooked kernel elongation ratio (ELR) was estimated by

dividing mean GL after cooking with mean GL before

cooking (Table S1).

Amylose content (AC) was estimated using the

procedure of Juliano (1971) with minor modifica-

tions. A set of 30 polished grains were ground to a

fine powder with mortar and pestle and sieved

through a 0.40 mm screen. Rice flour weighing

50 mg was extracted overnight in a solution of 0.5 ml

absolute ethanol and 5 ml 1 N NaOH. After making

up the volume of the extract to 50 ml with distilled

water, 2.5 ml was taken into fresh culture tube and

20 ml of distilled water plus three drops of 0.1% (w/

v) phenolphthalein indicator (0.1 g phenolphthalein

in 100 ml distilled ethanol) was added and mixed

well to get pink color in the alkaline medium. The

content was neutralized by adding 0.1 N HCl drop by

drop until the pink color just disappeared. After the

end point, 1 ml of iodine reagent (0.1 g iodine and 1 g

potassium iodide in 50 ml water) was added and

volume made up to 50 ml with water. The absorbance

was recorded at 590 nm in a spectrophotometer

(Molecular devices) in 96-well plate format. The AC

was estimated using a standard curve developed from

known quantities of purified potato amylose from

Sigma, USA (Fig. S1.L).

The alkali spreading value (ASV) was determined

by the method of Little et al. (1958) with minor

modifications. A set of five polished rice grains from

each line was immersed in a freshly prepared 1.7%

KOH solution and incubated at 308C for 23 h and

spreading of the rice grains was recorded by visual

observation in seven categories from 1 (unaffected) to

7 (completely dissolved, Fig. S1.N).

The aroma of polished rice grains was determined

by a sensory evaluation panel according to the

method of Sood and Siddiq (1978) with minor

modifications. Ten milled rice grains were placed in

a 50 mm Petri plate containing 10 ml of 1.7% KOH

and incubated at room temperature for 10 min with

lids on. The lids were then opened one by one and

samples were smelled and rated for aroma by a panel

of three experts in a scale of 0–3, where 0 was non-

aromatic and 3 was highly aromatic. Two blind

checks, Pusa Basmati 1 (moderately aromatic) and

Pusa 44 (non aromatic) were included with each

batch of seven samples (P1, P2 and five RILs)

analysed by the sensory panel to increase the

reliability of aroma rating.

Genotyping of the RILs and construction of

molecular linkage map

A total of 408 simple sequence repeat (SSR) markers

were used for the parental polymorphism survey

(Supplementary Table S2). The PCR products were

separated by electrophoresis in either 3% metaphor

agarose or 10% polyacrylamide gel (PAGE) with

0.8% cross-linker (ratio of bis-acrylamide to acryl-

amide) in 0.5· tris-borate EDTA (TBE) buffer. The

Mol Breeding (2008) 21:49–65 51

123

resolved PCR bands were detected by staining with

gel star for agarose gels and ethidium bromide for

polyacrylamide gels. Data generated after genotyping

of 209 RILs by polymorphic SSR markers were

tested using the v2 goodness of fit test against 1:1

segregation ratio. Linkage maps were constructed

using MAPMAKER version 3.0 (Lander et al. 1987).

The marker order within a linkage group was

determined using the ‘‘compare’’, ‘‘try’’ and ‘‘rip-

ple’’ commands of MAPMAKER. Map distances

were based on Kosambi function (Kosambi 1944). In

case of no linkage between clusters of SSR markers

belonging to the same chromosome, the clusters were

placed in a single linkage group based on the physical

position of the SSR markers in the IRGSP pseudo-

molecules (IRGSP 2005).

QTL mapping

A whole genome scan was done to identify and map

QTLs using two different softwares viz., QTL

cartographer version 2.0 (Basten et al. 2002) and

MultiQTL version 2.4 (Korol et al. 1999). Use of two

different software helped mutual confirmation of the

QTLs as it can be difficult to identify consistent

QTLs. In QTL cartographer composite interval

mapping (CIM) and multiple interval mapping

(MIM) functions were employed, which combines

interval mapping with multiple regressions (Zeng

1994), whereas MultiQTL software integrates a broad

spectrum of data mining, statistical analysis and

modeling tools that allow permutation, significance

test and bootstrap analysis (Korol et al. 1999).

Analysis of RILs for segregating badh2 alleles

Initially four primers viz. ESP, INSP, IFAP and EAP

developed by Bradbury et al. (2005b) for the

amplification of badh2 alleles were used either in a

single tube assay or in allele-specific pairs but we

could not get consistent results. Hence, this region of

the badh2 gene was amplified from the genomic

DNA templates of 96 samples, including two parents

(eight sample each) and 80 RILs using the external

sense primer (ESP) and external anti-sense primer

(EAP) of Bradbury (2005b) to amplify a *580 bp

fragment which was then sequenced from both ends

using GE-Healthcare’s ET dye terminator chemistry

and MegaBACE 4000 DNA sequencer. The sequenc-

ing reactions were repeated once to generate total 370

successful sequence reads representing two alleles,

which were then assembled separately using Phred/

Praph/Consed software to obtain high quality con-

sensuses sequence of the badh2 alleles of Pusa 1121

and Pusa 1342. Based on our sequence data a new

pair of primers (nksbad2F and nksbad2R) was

designed from sequences flanking the reported 8 bp

deletion (Bradbury et al. 2005a), which gave consis-

tent results that matched with the sequence data. The

new primers were then used to screen all the 209

RILs for the segregating badh2 alleles.

Results and discussion

Phenotypic segregation of the basmati quality

traits in the RILs

Frequency distribution in the RILs for segregating

phenotypic classes of seven grain quality traits

important for the basmati grade of rice viz. grain

length, grain breadth, grain length to breadth ratio,

cooked kernel elongation ratio, amylose content,

alkali spreading value and aroma are shown in

Fig. 1A–G. All these traits except ASV and aroma

were measured on a quantitative scale and showed

continuous variation with normal distribution. The

ASV and aroma were scored as ordinal traits with

arbitrary categories of 1–7 and 0–3, respectively. The

RILs showed transgressive segregation for all the

traits except aroma, suggesting that all fragrance

genes were contributed by one parent Pusa 1121.

Although we did not have a precise quantitative

measurement of aroma to rule out the possibility of

transgressive segregation.

Long slender grain is a defining characteristic of

basmati rice varieties. Based on the official notifica-

tion of standards issued by the Ministry of Com-

merce, Government of India (notification no 67, 23

Jan, 2003) the minimum GL for A grade basmati rice

is 7.0 mm, while its minimum LBR is 3.5. Pusa 1121

was characterized by extra long grains of

9.15 ± 0.13 mm, while Pusa 1342, the non-basmati

parent of the RILs, had comparatively shorter grains

of 6.65 ± 0.36 mm. The GL in the RILs ranged from

5.51 to 9.23 mm with a population mean of 7.31 mm

(Fig. 1A, Table S1). The two parental lines Pusa 1121

and Pusa 1342 were quite similar in their grain

52 Mol Breeding (2008) 21:49–65

123

breadth, measuring 2.06 ± 0.06 and 2.18 ± 0.02 mm,

respectively. However, GB in the RILs ranged from

1.63 to 2.62 mm with a population mean of 2.01.

More than 80% of the RILs had GB above or below

the parental values showing high degree of trans-

gressive segregation (Fig. 1B). The mean LBR for

P1 P2 RILsA

05

1015202530

5.51-

5.70

5.91-

6.10

6.31-6

.50

6.71-

6.90

7.11-

7.30

7.51-

7.70

7.91-

8.10

8.31-

8.50

8.71-

8.90

9.11-

9.30

Grain length (mm)

P2 P1

BP1 P2 RILs

0

5

10

15

20

25

30

1.60

-1.6

5

1.71

-1.7

5

1.81

-1.8

5

1 .90-

1 .95

2.01-

2 .05

2.11

-2.1

5

2 .21-

2 .25

2.31

-2.3

5

2.41

-2.4

5

2.51

-2.5

5

2 .61-

2 .65

Grain breadth (mm)

P1 P2

Fre

quen

cyF

requ

ency

Fre

quen

cy

C

0

5

10

15

20

25

30

35

2.2-2

.4

2 .5-2

.7

2.8-3

.0

3.1-3

.3

3.4-3

.6

3.7-3

.9

4.0-4

.2

4.3-4

.5

4.6-4

.8

4.9-

5.1

Grain length/ breadth ratio

Fre

quen

cyF

requ

ency

Fre

quen

cyF

requ

ency

P1P2

0

5

10

15

20

25

30

35

1.41-1

.45

1 .51-1

.55

1 .61-1

.65

1 .71-1

.75

1 .81-1

.85

1.91-1

.95

2 .01-2

.05

2 .11-2

.15

2 .21-2

.25

2 .31-2

.35

2 .41-2

.45

Cooked kernel elongation ratio

P2

P1

D

0

5

10

15

20

25

30

35

.7-5

.90 0.21-5.01

0.51-5.31.61

-51

.80

.91

-52

.10

-5.22

20.4

-5.52

20.7

.825

3-.00

.135

3-.30

-5.43

30.6 3-5.73

.90

Amylose content (%)

P2

P1E

0

50

100

150

Alkali spreading value

P2

F P1

0

20

40

60

80

Aroma intensity

P2

P1

G

321

1 2 3 4 5 6 7

0

Fig. 1 (A–G). Frequency distribution of phenotypic variation

for seven grain quality traits among 209 recombinant inbred

lines derived from a cross between basmati quality rice variety

Pusa 1121 (P1) and a contrasting quality breeding line Pusa

1342 (P2). Inset pictures in part (A) and (B) show segregating

RILs with different grain length and breadth

Mol Breeding (2008) 21:49–65 53

123

Pusa 1121 was 4.50 ± 0.20 and that for Pusa 1342 it

was 3.06 ± 0.19. The LBR in the RILs ranged from

2.30 to 4.98 with a population mean of 3.67, thereby

showing transgressive segregation. The LBR in the

RILs was contributed by segregation in both GL and

GB. The cooked kernel elongation ratio (ELR) of

Pusa 1121 was 2.06 ± 0.01, which is typical of

basmati rice that elongates length wise with minimal

breadth wise swelling on cooking. In contrast, Pusa

1342 showed a significantly lower ELR of

1.83 ± 0.06. The ELR in the RILs ranged from 1.44

to 2.42 with a population mean of 1.84 (Fig. 1D), thus

some of the RILs had still higher ELR than the highly

elongating Pusa 1121.

Amylose content of the rice grain determines

whether it will be firm and fluffy on cooking, or it

will turn sticky and glutinous. The japonica rice

varieties have very low AC and hence turn sticky

upon cooking, which the consumer prefers in China

and Japan for eating with chopsticks. In contrast,

basmati varieties have intermediate AC of 20–25%

and their grains remain firm and separated after

cooking, at the same time they give a soft mouth feel

while eating. Pusa 1121 showed a medium AC of

17.1 + 1.83%, whereas Pusa 1342 showed nearly

double the amount of AC at. 31.9 ± 1.26%. Our AC

values seem to be underestimated as elsewhere Pusa

1121 is reported to have 26% AC (Singh et al. 2002).

This could be due to differences in the experimental

procedure and reagents used or environmental fac-

tors, but it will have little bearing on the QTL

mapping results, which are based on the relative

values in the segregating lines. There was high

transgressive segregation for AC in the RILs, ranging

nearly five fold from 7.6 to 39.6% (Fig. 1E,

Table S1), suggesting involvement of either multiple

genes or high influence of environment on this trait.

However, a somewhat bimodal distribution of AC in

the RILs is indicative of one major gene with two

contrasting alleles (Fig. 1E).

The two parental lines differed markedly in their

alkali spreading value which is inversely related to

the gelatinization temperature. Pusa 1121 with a high

ASV of 7 will require less time or temperature for

cooking while Pusa 1342 with an ASV of 4 will

require longer time or higher temperature for cook-

ing. The ASV of RILs ranged from 2 to 7, but its

frequency distribution was skewed towards higher

side with more than two-thirds of the RILs having an

ASV of 7 (Fig. 1F, Table S1). Both, AC and ASV are

known to be governed by the enzymes of starch

biosynthesis pathway, including granule bound starch

synthase (GBSS1), soluble starch synthase, and

starch branching and de-branching enzymes (Umem-

oto et al. 2002). While AC is almost entirely

attributed to the GBSS1 gene located on the short

arm of chromosome 6, ASV depends on the nature of

the amylopectin molecules and is reported to be

dependent on soluble starch synthase gene on the

same chromosome arm but it could be modulated by

other poorly characterized genes of the pathway. The

very small proportion (4.1%) of RILs showing ASV

scores of 4 or less suggests involvement of three or

more genes in determining this trait (Fig. 1F).

One of the most important quality attributes

characterizing basmati varieties is their typical

pleasant aroma. The two parents differed in grain

aroma; Pusa 1121 was highly aromatic with an

arbitrary sensory score of 3, while Pusa 1342 was

non-aromatic with a sensory score of 0. The RILs

were scored as having two additional categories of

sensory scores 1 (mildly aromatic) and 2 (moderately

aromatic). Only a small proportion of the RILs

(6.7%) were able to reconstitute the original aroma of

Pusa 1121, suggesting involvement of three or more

genes as their expected proportion in the RILS will be

1/2n with n number of genes. Many published reports

indicate involvement of only one gene for aroma

located on chromosome 8 with recessive phenotype

(Ahn et al. 1992; Bradbury et al. 2005a; Wanchana

et al. 2005). On the other hand studies by Pinson

(1994) and Loriex et al. (1996) have clearly indicated

involvement of multiple genes for rice aroma.

The normal frequency distribution of GL, GB,

LBR, ELR and AC in the RILs indicates quantitative

inheritance of these traits with multiple genes and

environment influencing the phenotype. In addition to

nearly normal frequency distribution, transgressive

segregation was noted for all the traits except aroma,

suggesting that all the alleles for aroma were

contributed by one parent Pusa 1121. Transgressive

segregations observed for the other traits were in both

the directions indicating that neither of the two

parents carried all the positive or negative alleles and

hence there is room for further improvement in these

traits by recombination breeding. We analyzed cor-

relation among the seven co-segregating quality traits

in the 209 RILs to see if there was any interdependence

54 Mol Breeding (2008) 21:49–65

123

among these traits (Table 1). In general the correla-

tion coefficients between different pair of traits were

quite low, except for an obvious dependence of the

LBR upon GL and GB with highly significant

positive and negative correlations of 0.77 and

�0.79, respectively. Other correlation coefficients

were smaller than 0.23 and mostly statistically

insignificant, suggesting that these quality attributes

were controlled by independent set of genes. Small

but statistically significant correlations (P < 0.01)

included a negative correlations of �0.23 between

GL and GB and �0.19 between GL and ELR, and a

positive correlation of 0.18 between grain aroma and

ASV (Table 1). The significance and molecular basis

of these correlations need further investigation to

ascertain as to whether these reflect a cause and effect

relationship, or pedigree related associations.

Genotyping of the RILs and construction of

molecular genetic map

A total of 408 SSR markers were screened for

polymorphism between Pusa 1121 and Pusa 1342,

and 118 (28.9%) of these were polymorphic. Of these

37 markers displayed clear size difference in 3%

Metaphor agarose gels, but other 81 could only be

separated well in 10% PAGE due to relatively poor

resolution of agarose gels. All the 209 RILs were

genotyped for these 118 SSR marker loci and our

analysis showed that there was still some residual

heterozygosity in the RILs, probably due to insuffi-

cient number of self-pollination cycles at the F6

generation. For example, segregation of the two

parental alleles at SSR locus RM153 is depicted in

Fig. 2, where three out of 24 RILs are heterozygous

(lanes 7, 10 and 15). A similar analysis of 209 RILs

with 110 SSR markers with normal segregation

showed that on an average the RILs had achieved

homozygosity for more than 97% of these SSR loci,

24 RILs were homozygous for all 110 markers and

there was no RIL with 10% or higher heterozygosity

(Table S5). This indicated that the genome of the

RILs has reached high level of homozygosity at the

F6 generation. Deviation of observed frequencies of

the two segregating alleles of individual markers

from the expected 1:1 Mendelian ratio has been

defined as segregation distortion which can seriously

affect the QTL mapping results (Xu et al. 1997).

Segregation distortion was analyzed for all the 118

SSR loci using v2 test, and 16 of these deviated

significantly from the expected 1:1 ratio at 5%

probability level. The 16 markers showing distorted

segregation were distributed over eight different

chromosomes viz. 2, 3, 4, 6, 7, 8, 9 and 10, and

hence the distortion was random and not restricted to

any specific part of the genome. Nevertheless, eight

out of the 16 SSR markers viz. RM279, RM186,

RM3337, RM190, RM6359, RM248, RM524 and

RM244, showing extreme segregation distortion

(v2 > 10.5, P < .001) were eliminated from the

analysis and the only 110 markers showing normal

Table 1 Correlation coefficients among seven basmati quality

traits in recombinant inbred lines derived from Pusa 1121 ·Pusa 1342 cross

Trait GL GB LBR ELR AC ASV

GB �0.23**

LBR 0.77** �0.79**

ELR �0.19** �0.06 �0.10

AC �0.15* 0.12 �0.17* �0.11

ASV 0.17* 0.11 0.03 0.03 �0.09

Aroma 0.11 �0.001 0.06 0.07 �0.13 0.18**

GL = grain length, GB = grain breadth, LBR = grain length

to breadth ratio, ELR = cooked kernel elongation ratio,

AC = amylose content, ASV = alkali spreading value

*P < 0.05; **P < 0.01

M P1 P2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

150

200

250

(bp)

Fig. 2 Genotyping of Pusa 1121 · Pusa 1342 recombinant

inbred lines (1–24) with SSR marker RM153 in 10% native

PAGE showing residual heterozygosity for the two alleles at

this locus (lanes 7, 10 and 15). M 50 bp DNA ladder, P1 Pusa

1121, P2 Pusa 1342

Mol Breeding (2008) 21:49–65 55

123

segregation were used for the construction of molec-

ular linkage map using MAPMAKER (Lander et al.

1987). These 110 SSR markers were distributed over

all the 12 rice chromosomes (Fig. 3). A total of eight

of the 110 markers remained singleton as they did not

cluster with any linkage group in the MAPMAKER

output but these were placed in the map of rice

chromosomes 1, 4, 5, 7, 9, 10 and 11 based on their

physical location in the rice genome pseudomole-

cules (IRGSP 2005), as revealed by BLASTN search.

The average genetic distance between markers for 98

intervals on the 12 chromosomes was 20.4 cM, but

there were five large genetic gaps of 134–190 cM on

chromosomes 5, 9, 10 and 11, where map distance

could not be estimated accurately and these are

shown by discontinuous chromosome bars in Fig. 3.

Excluding these unlinked loci the average distance of

remaining 93 intervals was only 11.99 cM providing

a fairly dense molecular map for QTL interval

mapping. There were two more large gaps of 54.3

and 66.4 cM on chromosomes 1 and 2, respectively.

On the other hand genetically close markers could be

located physically far apart due to variation in

recombination frequency along the length of a

chromosome (King et al. 2002). We actually

observed these situations while comparing the genetic

and physical location of these markers in the map of

rice genome developed in the present study (Fig. 3,

Table S2). The examples of small genetic interval

(cM) with large physical distance (Mb) include,

(i) RM233A-RM5699 (7.4 cM, 6.9 Mbp) on the short

arm of chromosome 2, and (ii) RM16-RM5813

(5 cM, 7.8 Mbp) on the long arm of chromosome 3.

These intervals may represent chromosomal seg-

ments with low recombination or poor fitness value of

the recombinant gametes. In contrast, there were

genetically unlinked loci separated by small physical

distance e.g. (i) RM21-RM 206 (134.3 cM, 2.8 Mbp)

on the long arm of chromosome 11, showing

presence of recombination hot spots. These anoma-

lies in the genetic and physical distances have

implications in devising effective population size

for recombining desired traits from diverse parents.

Mapping of the QTLs for basmati quality traits

The main aim of the present study was to identify and

map QTLs for grain appearance, eating and cooking

qualities using the RIL population. A total of 13

QTLs affecting seven quality traits were identified by

Fig. 3 Molecular genetic maps of the 12 rice chromosomes

based on 110 SSR marker loci segregating in Pusa 1122 · Pusa

1342 RILs. Genetic distances between markers (in cM) are

shown on the left side of the chromosome bars. Significant

QTLs for basmati quality traits are shown on the left side using

different symbols. Five very large genetic distances indicating

freely recombining markers are shown as discontinuous bars

56 Mol Breeding (2008) 21:49–65

123

QTL cartographer software using its composite

interval mapping (CIM) function at 2.5 cut off LOD

score (Table 2). It was important to compare the

location of these QTLs in relation to the previous

reports on QTLs for rice quality traits, both for

validation of the earlier results and to identify new

QTLs specific to present mapping population, if any.

QTLs for grain length

The QTL cartographer software detected three sig-

nificant QTLs for grain length, one on chromosome 1

and two on chromosome 7, designated as grl1-1,

grl7-1 and grl7-2, respectively. The grl1-1 was

located in the marker interval RM431–RM104 on

the long arm of chromosome 1 with a LOD score of

5.75 and explained 10.1% of the phenotypic variation

for GL. This QTL was tightly linked to the marker

RM431 with a map distance of 0.1 cM, which can be

used in marker assisted selection (MAS) for grain

length after validation. The grl7-1 and grl7-2 were

located on chromosome 7 in the marker intervals

RM11-RM505 and RM505-RM336 with LOD scores

of 4.05 and 3.02, explaining 7.4 and 5.7% of the

phenotypic variation, respectively (Table 2, Figs. 3,

4). The grl7-1 and grl7-2 were also tightly linked to

their nearest flanking markers RM11 and RM 336

with genetic distance of 0.01 and 0.49 cM respec-

tively, and may be suitable for MAS after validation.

The three QTLs together explained 23.2% of the

phenotypic variation for GL and all three were

contributed by alleles from Pusa 1121. Thus, a major

part of the variation in grain length was still

unexplained. Though some of this could be due to

environmental factors, other QTLs for GL may have

small individual effects below the threshold LOD

score of 2.5 or may be located in the region of

genome with poor marker density in the present map.

Earlier, Lin et al. (1995) have reported QTLs for

grain length on chromosome 7. Redona and Mackill

(1998) also found transgressive segregation for grain

length in a mapping population developed from cross

between Black Gora and Labelle. The QTL grl7-1

detected in the present study was in the same region

of rice chromosome 7 as one of the QTLs reported by

Redona and Mackill (1998). However, they detected

two additional QTLs for grain length on chromosome

3, explaining 10.4% and 20.9% of the phenotypic

variation, respectively. Aluko et al. (2004) also

mapped a QTL for grain length on chromosome 3,

explaining 12.5% of the phenotypic variation.

Recently, Wan et al. (2006) have fine mapped a

QTL for grain length within a physical interval of

87.5 kb on chromosome 3. In the present study no

Table 2 Identification of QTLs for basmati rice quality traits using recombinant inbred lines derived from Pusa 1121 · Pusa1342

cross using composite interval mapping function of QTL cartographer software

S. No. Trait QTL name Chr. arm Marker interval NLM (cM) NRM (cM) LOD R2 Additive effect

1 Grain length grl1-1 1L RM431–RM104 0.01 7.43 5.75 0.101 1.92

2 grl7-1 7L RM11–RM505 0.01 9.67 4.05 0.074 1.64

3 grl7-2 7L RM505–RM336 9.88 1.29 3.02 0.057 1.47

4 Grain breadth grb7-1 7L RM11–RM505 0.01 9.67 6.15 0.101 �0.67

5 grb7-2 7L RM505–RM336 9.88 1.29 9.20 0.189 �0.79

6 Length/ breadth ratio lbr7-1 7L RM11–RM505 0.01 9.67 6.20 0.100 1.80

7 lbr7-2 7L RM505–RM336 9.88 1.29 10.80 0.219 2.28

8 Elongat-ion ratio elr11-1 11L RM1812–RM209 19.01 4.87 2.80 0.068 0.45

9 Amylose content amy6-1 6S RM3–RM217 20.50 2.01 21.8 0.396 �2.76

10 ASV asv6-1 6S RM3–RM217 18.82 4.00 2.63 0.069 2.54

11 Aroma aro3-1 3S RM5474–RM282 15.50 16.50 3.20 0.103 3.05

12 aro4-1 4L RM5633–RM273 2.01 8.12 3.30 0.061 2.34

13 aro8-1 8L RM223–RM80 0.01 22.70 11.54 0.189 4.21

ASV = alkali spreading value; L = Long arm; S = Short arm; LOD: log10 (probability of linkage/probability of no linkage); R2 =

proportion of variation explained by the QTL; NLM = nearest left marker; NRM = nearest right marker; Additive = additive effect

expressed in terms of estimated change in the phenotype expected from introgression of Pusa 1121 alleles

Mol Breeding (2008) 21:49–65 57

123

QTL was detected on chromosome 3. There was no

large genetic gap in this region of chromosome 3 in

our map; hence any linked QTLs should have been

identified unless there is very high rate of recombi-

nation between the QTL and the markers. A total of

seven markers on chromosome 3 were polymorphic

between the two parents, which helped prepare the

genetic map but none of these showed linkage with

the grain length trait. The list of all polymorphic and

non-polymorphic markers along with their physical

location in the rice chromosome pseudomolecules is

provided in Supplementary Table S2. The grain

length QTLs grl1-1 identified in this study is novel

one, and may be unique to Pusa 1121 which has an

exceptionally high grain length (Singh et al. 2002).

QTLs for grain breadth

Two QTLs were identified for GB on the long arm of

chromosome 7 and were designated grb7-1 and grb7-

2. The QTL grb7-1 was located in the interval RM11-

RM505 with a LOD score of 6.15 and explained

10.1% of the phenotypic variation, whereas QTL

grb7-2 was located in the interval RM505-RM336

with a high LOD score of 9.20 and explained 18.9%

of the phenotypic variation. The two QTLs for GB

explained 29% of the phenotypic variation and both

were contributed by Pusa 1342 (Table 2). Earlier, Lin

et al. (1995) identified minor QTLs affecting GB on

chromosome 7 using two different F2 mapping

populations. However, physical position of the QTLs

identified here are different from the RG4 marker

linked QTL for GB identified by Lin et al. (1995).

Redona and Mackill, (1998) mapped a major locus

for GB on chromosome 7 between RG711 and RG

650, explaining 22% of the phenotypic variance. This

QTL also seems to be different from the loci

identified in the present study which are located at

around 67.9 cM. Even though the QTLs for GL and

GB mapped in the same marker intervals on

chromosome 7 at identical positions (Table 2), their

contribution was not from the same parent, suggest-

ing that these two traits are likely controlled by

different genes, a conclusion supported by the

previous studies by Chauhan and Chauhan (1994)

and Sarkar et al. (1994). However, we cannot rule out

the possibility of GL and GB being controlled by

different alleles of the same genes.

QTLs for grain length/breadth ratio

The QTL cartographer software identified two chro-

mosomal regions significantly associated with the

grain LBR on chromosome 7 in the same marker

intervals and map positions as the individual QTLs

for GL and GB described above. However, these

were designated lbr7-1 and lbr7-2 for the purpose of

description here (Table 2). The QTL lbr7-1 was

mapped in the interval RM11-RM505 with LOD

score 6.20) and explained 10.0% of the phenotypic

variation, whereas lbr7-2 was located in the interval

RM505-RM336 with a LOD score of 10.80 and

explained 21.9 % of the variation for LBR. Both the

QTLs for high LBR were contributed by the long

grain parent Pusa 1121, and together explained 32.7%

of the phenotypic variation. The LBR QTLs coin-

cided with the QTLs for grain length and grain

breadth, suggesting that there may not be separate

genes controlling this trait and it is totally dependent

on the genes controlling GL and GB. This is

consistent with the earlier reports of Redona and

Mackill (1998), suggesting that the grain shape was

actually associated with the loci for its component

traits. Recently, Rabiei et al. (2004) have identified

two major QTLs for grain shape on chromosomes 3

and 8, which coincided with the major QTLs for grain

length and grain breadth. In the present study the

regions of chromosomes 3 and 8 did differ between

the two parents with respect to random SSR markers,

but there were no linked QTLs controlling the GL,

GB or LBR.

QTLs for cooked kernel elongation ratio

Linear kernel elongation upon cooking is an essential

quality attribute of the basmati rice varieties that can

be measured in terms of ratio of the grain length after

and before cooking, and it is described as cooked

kernel elongation ratio (ELR). Parental lines used in

the present study did not differ highly in their ELR,

but the progeny showed a much larger range due to

transgressive segregation (Fig. 1D). A major QTL for

kernel elongation has been reported by Ahn et al.

(1993) on the long arm of chromosome 8, but this

was not detected in the present study despite having a

good molecular genetic map of chromosome 8 with

evenly spaced SSR markers. A QTL on chromosome

11 was significant at 2.5 cutoff LOD score but has

58 Mol Breeding (2008) 21:49–65

123

very small LOD score of 2.8, explaining 6.8% of the

variation, Table 2). This can be attributed to the fact

that even though Pusa 1121 exhibits extremely high

cooked kernel length (Singh et al. 2002), its elonga-

tion ratio 2.06 was not much higher than 1.83 for

Pusa 1342. Another mapping population developed

from cross between parental lines showing extreme

values for kernel elongation ratio will be more

suitable to identify the QTLs controlling this trait

(Ahn et al. 1993).

QTL for amylose content

QTL cartographer detected a single major QTL

amy6-1 for grain amylose content (AC) located in

the interval RM3-RM217 on the short arm of

chromosome 6 with a high LOD score of 21.80. This

QTL explained 39.6% of the phenotypic variation for

AC (Table 2). AC is a key factor in determining the

rice cooking quality and thereby its market value due

to varying consumer preferences. It has been reported

that the AC in non-waxy rice varieties is controlled

by a single dominant gene with major effect and a

number of modifier genes with minor effects

(McKenzie and Rutger 1983; He et al. 1999). The

occurrence of transgressive segregation was postu-

lated to be due to presence of modifying genes

(Kumar and Khush 1988). The amy6-1 QTL was

located in the waxy gene (GBSS1) region of

chromosome 6. There is wide variation for AC in

the non-waxy indica rice varieties suggesting that a

series of alleles may be present for the waxy locus.

But in the present study large variation in AC among

the RILs must be due to non-allelic modifier genes or

due to environmental factors as we have only two

alleles segregating at the amy6-1 locus.

QTL for alkali spreading value

A significant QTL for ASV, designated asv6-1, was

detected in the SSR marker interval RM3-RM217 on

chromosome 6 with a LOD score of 2.63, explaining

6.9% of the phenotypic variation (Table 2, Fig. 3).

The allele from Pusa 1121 contributed high ASV.

The QTL asv6-1 was genetically linked to amy6-1 for

AC in the same marker interval, but its position was

slightly closer to the SSR marker RM217. The

linkage between loci controlling AC and ASV has

also been reported earlier by McKenzie and Rutger

(1983) and He et al. (1999). Even though the QTLs

for the two traits are genetically linked, there was no

significant correlation between AC and ASV at the

phenotypic level (Table 1). Hence, these two traits

can be improved simultaneously using tightly linked

molecular markers as early generation selection for

these traits in large breeding populations is tedious.

The major part of variation for ASV was not

explained by asv6-1, hence there may be other genes

controlling ASV located in the large genetic gaps in

the framework molecular genetic map of the rice

genome prepared here, or the trait may have a large

environmental component.

QTLs for grain aroma

A total of three QTLs were identified for grain aroma

by QTL cartographer, one each on chromosome 3, 4

and 8 (Table 2, Figs. 3, 4). The most effective QTL,

aro8-1 with a LOD score of 11.54 was located on the

long arm of chromosome 8 between SSR markers

RM223 and RM80, and explained 18.9% of the

phenotypic variation for aroma. There were two more

significant QTLs for aroma located on chromosomes

3 and 4, designated aro3-1 and aro4-1, respectively.

The aro3-1 locus mapped on chromosome 3 in the

interval RM5474-RM282 with a LOD score 3.20 and

explained 10.3% of the phenotypic variation, whereas

aro4-1 was located in the marker interval RM5633-

RM273 on chromosomes 4 with a LOD score of 3.30

and explained 6.1% of the phenotypic variation. As

expected, the positive alleles for all three aroma

QTLs were contributed by Pusa 1121.

Aroma is one of the most important quality traits

for basmati rice consumers. Petrov et al. (1996)

reported more than 100 volatile compounds in the

rice grain, of which 15 were involved in the

discrimination of scented and non-scented varieties

and 2-acetyl-1-pyrroline was the most predominant

component of these. Among the three QTLs for grain

aroma identified in the present study, aro8-1 mapped

in the same region of chromosome 8 as that reported

earlier by Ahn et al. (1992) and Lorieux et al. (1996).

Recent studies by Bradbury et al. (2005a), Wanchana

et al. (2005) and Chen et al. (2006) making use of rice

genome sequence information (IRGSP 2005) have

identified badh2 as a candidate gene for aroma on

chromosome 8, which codes for enzyme betaine

aldehyde dehydrogenase (BADH, EC 1.2.1.8). The

Mol Breeding (2008) 21:49–65 59

123

aro4-1 locus was in the same region of chromosome

4 as one of the QTLs reported by Lorieux et al.

(1996). We searched the rice genome database for

annotated function of genes in the aro4-1 QTL

interval of chromosome 4 and found that a gene for

betaine aldehyde dehydrogenase 1 (badh1) is located

in the same interval between base pairs 22795011-

22799839 of the IRGSP chromosome 4 pseudomol-

ecule build 4 (AP008210.1). The badh1 could be a

likely candidate gene for aroma QTL aro4-1 due to

similar molecular function as the badh2 gene of

chromosome 8. However, the exact role of the BADH

enzyme in aroma development is yet to be established

by proper validation and complementation studies.

The aroma QTL aro3-1 identified in the present study

is in a new region of the rice genome which may be

specific to the basmati rice varieties.

In order to further test the significance of 13 QTLs

identified by the composite interval mapping (CIM)

function of QTL cartographer at a fixed cutoff LOD

score of 2.5, and to identify any epistatic interaction

between the QTLs, we used multiple interval

mapping (MIM) function of QTL cartographer with

1,000 permutations. Ten out of the 13 QTLs identi-

fied by the CIM function were also significant in the

MIM analysis (Fig. S2.H–N, Table S3). Three QTLs,

namely asv6-1, aro3-1 and aro4-1, became non-

significant after 1,000 permutations due to increase in

LOD score cutoff for ASV and aroma to 2.6 and 8.7,

respectively, but this could be partly due to semi-

quantitative nature and arbitrary sensory phenotyping

for these traits. The MIM function of QTL cartog-

rapher also allowed analysis of epistatic interactions

between multiple QTLs for a trait (Table S3).

However, main effects of the QTLs explained most

of the variation for seven quality traits, except for GB

where interaction between grb7-1 and grb7-2

explained 8.9% of the variation, LBR where interac-

tion between lbr7-1 and lbr7-2 explained 9.1% of the

variation and aroma where interaction between aro8-

1 and aro4-1 explained 3.25% of the variation

(Table S3).

We also analysed our data using another QTL

mapping software viz. MultiQTL version 2.4 (Korol

Fig. 4 QTL Cartographer LOD plots for seven basmati quality traits with a default cutoff LOD score of 2.5. The traces for individual

traits are color coded

60 Mol Breeding (2008) 21:49–65

123

et al. 1999). This software uses different algorithms

integrating a broad spectrum of data mining, statis-

tical analysis and modeling tools that allow permu-

tation, significance test and bootstrap analysis of the

QTLs. The MultiQTL software detected ten of the 13

QTLs identified by QTL cartographer. Three QTLs

not detected by MultiQTL were grl7-2, elr11-1 and

aro3-1 all of which have low LOD scores. All the

other QTLs for GL, GB, LBR, AC and aroma were

commonly identified by both the software.

Validation of badh2 gene specific markers for rice

aroma

Recently, Bradbury et al. (2005b) developed a badh2

gene based perfect marker system for screening of

grain aroma in basmati and jasmine rice varieties.

They designed four PCR primers namely, ESP

(external sense primer), EAP (external anti-sense

primer), INSP (internal non-fragrant sense primer)

and IFAP (internal fragrant anti-sense primer). When

all the four primers are used in a single tube assay,

the ESP/EAP pair amplifies a 577/585 bp fragment in

all the rice varieties that serves as positive control for

the PCR reaction. In addition, non-aromatic varieties

amplify a 355 bp fragment resulting from primer pair

INSP/EAP, whereas aromatic varieties amplify a

257 bp fragment resulting from primer pair ESP/

IFAP and heterozygote lines amplify all the above

three fragments. We used Bradbury’s primers to

check their validity in our RIL population and

parental lines. The parental lines Pusa 1121 and Pusa

1342 showed the expected size PCR products of 257

and 355 bp, respectively and RILs segregated for the

two allelic fragments (Fig. 5A). However, there was

inconsistency with these primers as sometimes the

same RIL gave different results in repeat PCR

reactions. We also tried separate amplification of

the 355 bp non-fragrant allele using IFSP/EAP primer

pair and the 257 bp fragrant allele using ESP/IFAP

primer pair (Figs. 5B, C), but surprisingly both the

parents and all the RILs showed amplification of the

target sequence and no discrimination could be

achieved between lines when these primers were

used separately. This also gave explanation to the

inconsistency of the single tube assay which is most

likely due to competitive nature of the binding of two

internal primers to the genomic DNA templates of

respective alleles. Slight difference in the relative

concentration of these primers may lead to non-

specific amplification as both the primers are capable

of binding either allele although with different

efficiency.

Hence, we sequenced the *580 bp PCR product

amplified by ESP/EAP primer pair from the two

parents and RILs for more precise genotyping of the

badh2 alleles in our mapping population. The PCR

product was sequenced from both 50 and 30 ends and

sequencing reactions were repeated once to obtain

1 2 3 4 5 6 P2 P1

253 bp

253 bp

355 bp

580 bp

90 bp

82 bp

355 bp

A

B

C

D

Fig. 5 (A–D) PCR amplification patterns of a part of badh2gene from parents and a set of six RILs from Pusa 1121 · Pusa

1342 cross using different primers. (A) Bradbury’s four

primers (ESP + INSP + IFAP + EAP) in single tube assay

showing three bands; (B) Primers INSP + EAP showing a

single band of 355 bp; (C) Primers ESP + IFAP showing a

single band of 253 bp; (D) Newly designed primers nks-

bad2F + nksbad2R showing amplification of a 82 bp (aromatic)

or 90 bp (non-aromatic) fragments. (A–C) agarose gel; (D)

PAGE

Mol Breeding (2008) 21:49–65 61

123

high quality data. Total 369 sequence reads were

obtained representing eight samples each of Pusa

1121 and Pusa 1342 and 80 different RIL samples.

Out of these 313 reads, were of high quality and were

used for sequence assembly by Phred/Phrap/Consed

software. As expected we obtained two types of

sequences for the segregating badh2 alleles (Fig. 6,

Supplemental Fig. S3); (i) Pusa 1121 allele repre-

sented by 241 sequence reads with 8 bp deletion in

the seventh exon, and (ii) Pusa 1342 allele repre-

sented by 72 reads without this deletion. The two

types of sequences were then assembled separately to

get high quality consensus sequences for the individ-

ual alleles (Fig. 6, Fig. S3). The segment of badh2

gene between ESP/EAP primers consisted of three

exons and three introns (no. 6–8). Pair wise alignment

of the two allelic sequences revealed minor differ-

ences with the sequence information reported earlier

by Bradbury et al. (2005a, b). First, the reported 8 bp

deletion in the seventh exon of the badh2 gene is not

continuous in the Pusa 1121 allele; but is interrupted

by a 3 bp conserved sequence between the two

alleles. This must be providing stability for the non-

specific annealing of the INSP and IFAP primers

leading to non-specific amplification of target se-

quence from both the alleles (Fig. 5B, C). Secondly,

in addition to this discontinuous 8 bp deletion

(highlighted red, Fig. 6), there is a 7 bp insertion in

the eighth exon of badh2 allele from Pusa 1121

(highlighted green, Fig. 6). Thirdly, there are only

two SNPs (highlighted magenta, Fig. 6) between Pusa

1121 and Pusa 1342 alleles in this region; (i) an A/T

SNP just before the 5 bp deletion which is part of the

INSP/IFAP primers and (ii) a G/A SNP in the eighth

intron of the badh2 gene which is part of the EAP

primer.

We designed a new pair of primers nksbad2F/

nksbad2R from the conserved sequences flanking the

5 + 3 bp deletion in the seventh exon and used it for

amplification of badh-2 alleles from the two parents

and RILs (Fig. 5D). This primer pair gave consis-

tently an 82 bp product for Pusa 1121 allele and a

TTGT ESP 5TGCGTTGGAGCTTGCTGATGTGTGTAAAGAGGTTGGTCTTCCTTCAGGTGTGCTAA

ACATAGTGACTGGATTAGGTTCTGAAGCCGGTGCTCCTTTGTCATCACACCCTGGTG

TAGACAAGGTacagctattcctcctgtaatcatgtataccccatcaatggaaatgatnksbad2F

attcctctcaatacatggtttatgttttctgttTTAGGTTGCATTTACTGGGAGTTA

T INSPTGAAACTGGTAAAAAGATTATGGCTTCAGCTGCTCCTATGGTTAAGgtttgtttcca CCATAT ATA AAGTCGACGAGGATAC caaacaaaggt

IFAP nksbad2R aatttctgtggatattttttgttctctttctactaactctctattatcaattctcaattaaagacacct

tgttgtccttttcttttaactcctttactttttagaattgtgatcaagacactttga

gcatcattctagtagccagttctatcctgtttcttacctttttatggttcgtcttttGATGTTC

cttgacAGCCTGTTTCACTGGAACTTGGTGGAAAAAGTCCTATAGTGGTGTTTGATG

ATGTTGAAAAAGgtacatgccacttgctatgattaactaattctgaagtgcgggact cgccctga a ttgtaaggcact3 EAPaacatttcgtga

Fig. 6 Consensus sequence (based on 72 sequence reads) of

badh2 allele from non-aromatic rice variety Pusa 1342 between

ESP and EAP primers of Bradbury et al. (2005b). Sequence in

capital letters represents exons whereas that in lower case

represents introns. Location of Bradbury’s primers (ESP, EAP,

INSP and IFAP) are highlighted in cyan whereas two new

primers designed in the present study (nksbad2F and nks-

bad2R) are highlighted in yellow. Consensus sequence of

badh2 allele of aromatic variety Pusa 1121 (based on 241

sequence reads) has a 5 + 3 bp deletion (highlighted red), a

7 bp insertion (highlighted green) and two SNPs (highlighted

magenta) as compared to Pusa 1342 allele

62 Mol Breeding (2008) 21:49–65

123

90 bp product for Pusa 1342 allele with perfect

correspondence between the PCR results and DNA

sequence data of the 96 samples. Hence, we used the

new primer pair for genotyping of badh2 alleles in all

the 209 RILs (Supplementary Table S4). Since badh2

gene has been implicated in the expression of rice

aroma, we closely examined the correspondence

between sensory aroma score of the RILs and their

allelic composition at the badh2 gene and nearest

linked markers to the aroma QTLs aro3-1, aro4-1

and aro8-1 (Table 3, Table S4). The segregation

pattern of badh2 alleles in the RILs was heavily

distorted in favor of Pusa 1121 allele with a v2 value

of 54.340 (P < 0.001), indicating that there was

strong selection against the Pusa 1342 allele. There-

fore, we did not use the badh2 locus information for

QTL mapping. A comparison of the aroma score of

RILs with their genotyping patterns showed that all

the highly aromatic RILs (aroma score 3) possessed

badh2 allele from Pusa 1121 carrying 5 + 3 bp

deletion that introduces a premature stop codon in the

reading frame of exon seven (Bradbury et al. 2005a).

More than 82% of the RILs with moderate or mild

aroma possessed the Pusa 1121 allele. However,

68.5% of the RILs with no aroma also possessed the

Pusa 1121 allele indicating that badh2 gene alone is

not sufficient to explain the aroma of rice. Other

possibility is that badh2 gene is only a marker for the

aroma gene and actually not a causal factor directly

responsible for the fragrance in rice as concluded in

the earlier studies.

It was clear from the analysis of allelic distribution

of markers linked to the three aroma QTLs that

aromatic RILs have significantly higher proportion of

the A allele (coming from Pusa 1121) than the non-

aromatic RILs (Table 3, Table S4). Thus, more than

77% of the RILs with high or moderate aroma have

the A allele of RM223 which is linked nearest

(0.01 cM) to aro8-1 as compared to only 20–25% of

the non-aromatic RILs having this allele. Similarly,

76.9 and 65.3% of the RILs with high and moderate

aroma, respectively, have the A allele of RM5633

which is linked nearest (2.01 cM) to the aroma QTL

aro4-1 as compared to only 32.8% of the non-

aromatic RILs. The percentage of RILs having A

allele of RM5474 which is linked nearest (15.50 cM)

to the QTL aro3-1 on chromosome 3 was also higher

in aromatic RILs than non-aromatic RILs, although

the difference was not as high in this case due to a

larger genetic distance between marker and QTL

(Table 3). This analysis clearly shows that all the

three QTLs identified in the present study contribute

to the overall aroma profile of the RILs and badh2

gene alone is not sufficient to impart high fragrance

to the rice grain.

Grain and cooking quality traits are economically

important for the traders and consumers of basmati

rice and therefore new high-yielding disease resistant

varieties of basmati rice need to be developed to cater

for the growing domestic and global demand for this

premium grade of rice. DNA markers tightly linked

to the major QTLs controlling these traits can be

employed for marker assisted breeding of new

basmati varieties to maintain its unique quality

attributes while improving the yield potential and

resistance to various biotic and abiotic stresses. In

addition, these markers would also help in screening

of parental lines for introgression of specific genes for

Table 3 Association of sensory aroma score with Pusa 1121 alleles of nearest SSR markers flanking aroma QTLs on chromosomes

3, 4 and 8 and a distorted segregation of badh2 alleles in Pusa1121 · Pusa1342 recombinant inbred lines

Aroma sensory score No. of RILs Frequency of A alleles (from Pusa 1121) of the nearest flanking marker of aroma QTLs and

badh2 gene

aro3-1 RM 5474 aro4-1 RM 5633 aro8-2 RM 223 Badh2

3 14 9/13 (69.2%) 10/13 (76.9%) 11/14 (78.6%) 14/14 (100%)

2 74 38/70 (54.3%) 47/72 (65.3%) 57/74 (77.0%) 56/68 (84.8%)

1 60 30/59 (50.8%) 25/55 (45.5%) 12/60 (20.0%) 43/57 (82.7%)

0 61 26/58 (44.8%) 19/58 (32.8%) 15/60 (25.0%) 37/52 (68.5%)

Total 209 103/200a 101/198a 95/208a 150/191a

v2 (1:1 ratio) 0.180 P = 0.6713 0.081 P = 0.7759 1.558 P = 0.2119 54.348 P < 0.001

a Excluding RILs with heterozygote and missing genotype data

Mol Breeding (2008) 21:49–65 63

123

quality from different donor varieties. The major

QTLs affecting basmati grain quality identified in this

study can be used effectively by breeders in crop

improvement programs and for further fine mapping

and validation of specific genes to develop gene-

based perfect markers for use in rice breeding

(Bradbury et al. 2005b) and for mining of better

alleles of these genes in basmati rice collections.

Acknowledgements This work was done under National

Bioscience Award to NKS by the DBT, Government of India.

We are thankful to the financial support of ICAR through

NPTC project, IARI and CSIR, New Delhi for fellowship

supports to AY, and Dr. KV Prabhu for off-season

multiplication of RILs in the National Phytotron Facility.

References

Ahn SN, Bollich CN, Tanksley SD (1992) RFLP tagging of a

gene for aroma in rice. Theor Appl Genet 84:825–828

Ahn SN, Bollich CN, McClung AM, Tanksley SD (1993)

RFLP analysis of genomic regions associated with

cooked-kernel elongation in rice. Theor Appl Genet

87:27–32

Aluko G, Martinez C, Tohme J, Castano C, Bergman CJ, Oard

JH (2004) QTL mapping of grain quality traits from the

interspecific cross Oryza sativa · O. glaberrima. Theor

Appl Genet 109:630–639

Basten CJ, Weir BS, Zeng ZB (2002) QTL cartographer Ver-

sion 1.16. Department of Statistics, North Carolina State

Univerity, Raleigh, NC

Bradbury LM, Fitzgerald TL, Henry RJ, Jin Q, Waters DL

(2005a) The gene for fragrance in rice. Plant Biotech J

3:363–370

Bradbury LM, Henry RJ, Jin Q, Reinke RF, Waters DL

(2005b) A perfect marker for fragrance genotyping in rice.

Mol Breed 16:279–283

Chauhan JS, Chauhan VS (1994) Genetic analysis of grain

dimensions and weight and their association with grain

yield in rain fed rice (Oryza sativa L.). Indian J Agric Sci

64:613–618

Chen S, Wu J, Yang Y, Shi W, Xu M (2006) The fgr gene

responsible for rice fragrance was restricted within 69 kb.

Plant Sci 171:505–514

He P, Li SG, Qian Q, Ma YQ, Li JZ, Wang WM, Chen Y, Zhu

LH (1999) Genetic analysis of rice grain quality. Theor

Appl Genet 98:502–508

Huang FS, Sun ZX, Hu PS, Tang SQ (1998) Present situations

and prospects for the research on rice grain quality

farming. Chinese J Rice Sci 12:172–176

IRGSP (2005) The map based sequence of the rice genome

(2005). Nature 436:793–800

Juliano BO (1971) A simplified assay for milled rice amylose.

Cereal Sci Today 16:334–338

Juliano BO, Villareal CP (1993) Grain quality evaluation of

world rices. International Rice Research Institute, Manila,

Philippines

King J, Armstead IP, Donnison IS, Thomas HM, Jones RN,

Kearsey MJ, Roberts LA, Thomas A, Morgan WG, King

IP (2002) Physical and genetic mapping in the grasses

Lolium perenne and Festuca pratensis. Genetics 161:315–

324

Korol A, Ronin Y, Minkov D, Britvin E, Mester D, Korosty-

shevsky M, Greenspan G, Muganshtein N, Brailovsky A

(1999) MultiQTL-an integrated solutions for genome

mapping, Institute of evolution, Haifa university, Haifa,

Israel http://esti.haifa.ac.il/*poptheor

Kosambi DD (1944) The estimation of map distances from

recombination values. Ann Eugen 12:172–175

Kumar I, Khush GS (1988) Inheritance of amylose content in

rice (Oryza sativa L.). Euphytica 38:261–269

Lanceras JC, Huang ZL, Naivikul O, Vanavichit A, Ruanjai-

chon V, Tragoonrung S (2000) Mapping of genes for

cooking and eating qualities in Thai Jasmine rice

(KDML105). DNA Res 7:93–101

Lander ES, Green P, Abrahamson J, Barlow A, Daley M

(1987) MAPMAKER: an interactive computer package

for constructing primary genetic linkage maps of experi-

mental and natural populations. Genomics 1:174–181

Lin HX, Min-Shao K, Xiong ZM, Qian HR, Zhuang JY, Lu J,

Huang N, Zheng K, Lin HX, Min SK, Xiong ZM, Qian

HR, Zhuang JY, Lu J, Huang N, Zheng KL (1995) RFLP

mapping of QTLs for grain shape traits in indica rice

(Oryza sativa L. subsp. indica). Scientia Agricultura Si-

nica 28:1–7

Little RR, Hilder GB, Dawson EH (1958) Differential effect of

dilute alkali on 25 varieties of milled white rice. Cereal

Chem 35:111–126

Lorieux M, Petrov M, Huang N, Guiderdoni E, Ghesquiere A

(1996) Aroma in rice: genetic analysis of quantitative

trait. Theor Appl Genet 93:1145–1151

McKenzie KS, Rutger JN (1983) Genetic analysis of amylose

content, alkali spreading score, and grain dimensions in

rice. Crop Sci 23:306–311

Petrov M, Danzart M, Giampaoli P, Faure J, Richard H (1996)

Rice aroma analysis: discrimination between a scented

and a non-scented rice. Sciences des Aliments 16:347–

360

Pinson SRM (1994) Inheritance of aroma in six rice cultivars.

Crop Sci 34:1151–1157

Rabiei B, Valizadeh M, Ghareyazie B, Moghaddam M, Ali AJ

(2004) Identification of QTLs for rice grain size and shape

of Iranian cultivars using SSR markers. Euphytica

137:325–332

Redona ED, Mackill DJ (1998) Quantitative trait locus analysis

for rice panicle and grain characteristics. Theor Appl

Genet 96:957–963

Sarkar RK, Nanda BB, Dash AB, Lodh SB (1994) Grain

characteristics and cooking quality of aromatic and non-

aromatic, long and slender varieties of rice (Oryza sativaL.). Indian J Agric Sci 64:305–309

Singh VP, Singh AK, Atwal SS, Joseph M, Mohapatra T

(2002) Pusa 1121:A rice line with exceptionally high

cooked kernel elongation and basmati quality. Intl Rice

Res Notes 27:25–26

Sood BC, Siddiq EA (1978) A rapid technique for scent

determination in rice. Indian J Genet Plant Breed 38:268–

271

64 Mol Breeding (2008) 21:49–65

123

Tan YF, Li JX, Yu SB, Xing YZ, Xu CG, Zhang Q (1999) The

three important traits for cooking and eating quality of

rice grains are controlled by a single locus in an elite rice

hybrid, Shanyou 63. Theor Appl Genet 99:642–648

Umemoto T, Yano M, Satoh H, Shomura A, Nakamura Y,

(2002) Mapping of gene responsible for the difference in

amylopectin structure between japonica-type and indica-

type rice varieties. Theor Appl Genet 104:1–8

Wan XY, Wan JM, Jiang L, Wang JK, Zhai HQ, Weng JF,

Wang HL, Lei CL, Wang JL, Zhang X, Cheng ZJ, Guo

XP (2006) QTL analysis for rice grain length and fine

mapping of an identified QTL with stable and major ef-

fects. Theor Appl Genet 112:1258–1270

Wanchana S, Kamolsukyunyong W, Ruengphayak S, Toojinda

T, Tragoonrung S, Vanavichit A (2005) A rapid con-

struction of a physical contig across a 4.5 cM region for

rice grain aroma facilitates marker enrichment for posi-

tional cloning. Sci Asia 31:299–306

Xu Y, Zhu L, Xiao J, Huang N, McCouch S (1997). Chro-

mosomal regions associated with segregation distortion of

molecular markers in F2, backcross, doubled haploid, and

recombinant inbred populations in rice (Oryza sativa L.).

Mol Gen Genet 253:535–545

Zeng Z (1994) Precision mapping of quantitative trait loci.

Genetics 136:1457–1468

Mol Breeding (2008) 21:49–65 65

123