Journal of Biotechnology 121 (2006) 318–329

ITS primers for the identification of marketable boletes

Antonietta Melloa,∗,1, Stefano Ghignonea,1, Alfredo Vizzinib,Clizia Sechic, Pino Ruiuc, Paola Bonfantea,b

a Istituto per la Protezione delle Piante del CNR, Sezione di Torino, Viale Mattioli, 25, 10125 Torino, Italyb Dipartimento di Biologia Vegetale dell’Universita di Torino, Viale Mattioli, 25, 10125 Torino, Italy

c Stazione Sperimentale del Sughero della Regione Autonoma Della Sardegna, Via Limbara, 9, 07029 Tempio Pausania, Sassari, Italy

Received 31 May 2005; received in revised form 25 July 2005; accepted 24 August 2005

Abstract

Boletus species belonging to the sectionBoletus are the most frequently eaten fungi among those harvested in natural conditionsin Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them havebeen shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact.

Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus,B. aestivalis, all classified asB. edulis s.l.) remain open, together with the absence of tools which distinguish the species, wesequenced the ITS region of 28Boletus samples and then we designed specific primers. These allowed the effective separation ofthe taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed thatB. violaceofuscus, a spectacularC rso©

K

1

stl

f

tri-t oftri-ideeni-thercit aost.pro-ht

0

hinese fungus considered belonging to the sectionBoletus and often sold intermixed withB. edulis s.l. specimens, clusteutside the sectionBoletus.2005 Published by Elsevier B.V.

eywords: Boletus edulis s.l.; ITS primers; Phylogenetic analysis

. Introduction

The Kingdom Fungi is increasingly attracting thecientific community because it includes organismshat play important functions, both in terms of eco-ogical and economic roles. By breaking down dead

∗ Corresponding author. Tel.: +39 0116502927;ax: +39 0116705962.

E-mail address: a.mello@ipp.cnr.it (A. Mello).1 These authors contributed equally to this work.

organic material, fungi continue the cycle of nuents through ecosystems; by the establishmenmycorrhizae, symbiotic fungi supply essential nuents to most vascular plants. Other fungi provimportant drugs for the human health, such as pcillin, cephalosphorines and statins. On the ohand, fungi produce allergens, molecules that elihypersensitivity reaction in a previously exposed hGenerally, fungal allergens are proteins or glycoteins, while fungal toxins are low-molecular-weigmetabolites.

168-1656/$ – see front matter © 2005 Published by Elsevier B.V.doi:10.1016/j.jbiotec.2005.08.022

A. Mello et al. / Journal of Biotechnology 121 (2006) 318–329 319

Although many fungi produce allergens, somesaprotrophic genera, e.g.,Alternaria, Cladosporium,Aspergillus, are considered as the most responsible,probably, due to their abundance in the environmentmore than to their intrinsic allergenic properties. How-ever, reports of food allergy reactions show that alsomushrooms are responsible (Torricelli et al., 1997;Roncarolo et al., 1998).

Mushrooms belonging to theBoletus edulis sensulato group, a complex of at least four species of ecto-mycorrhizal fungi in the genusBoletus sectionBoletus(Singer, 1986) (Edules Fr. 1838) are an interestingexample of contrasting fungal features. These fruit-bodies are, in fact, in high demand as mushroomswith a pleasant flavour and texture, but at the sametime, they have been shown to induce allergic IgE-mediated symptoms either through inhalation, inges-tion or contact (Helbling et al., 2002). When investi-gating whetherB. edulis induce distinct allergens, theseauthors showed that the fungus causes food allergyin two ways: first causing systemic symptoms prob-ably due to cross-reactivity to inhaled, atmosphericallergens and second due to a digestion-stable 75 kDaprotein (Helbling et al., 2002).

Boletus sectionBoletus Singer has long been consid-ered a complex of hardly distinguishable species. In all10 taxa, including species, varieties, forms, have beenascribed to this complex (Lannoy and Estades, 2001).All the species included are characterized by white-textured unchanging flesh, never tending towardst allyw heng

aa -s ndr hoseh ver,q ny oft enceo erd( rigi-n .g.,H -e thes d

in Europe from China and frequently sold among driedmushrooms ofB. edulis s.l. (Floriani et al., 2000).

B. edulis s.l. is used in huge quantities for the pro-duction of dried mushroom-soups, but its fruitbodiesare collected from the wild and – although claimshave been made for successful cultivation (Hall et al.,1998) – a protocol for their commercial productionhas not evolved yet. Attempts to infect host plants inorder to cultivateB. edulis s.l. gave several problemswith different techniques (sporal inocula, mother planttechnique); fruiting bodies being produced from trans-planted plants infected withB. edulis s.l. have neverbeen reported (Hall et al., 1998; Yun and Hall, 2004). Invitro mycelia have been produced in order to inoculateseedlings in controlled conditions and to obtain bet-ter results (Montemartini Corte and Vianello, 1996). Insome mountainous and hilly areas of Europe, this groupof fungi is not only a natural product but also a source ofseasonal income for the population.Salerni and Perini(2004)have investigated the effect of tree canopy andpresence/absence of litter on fruitbody production ofB.edulis s.l. in order to provide indications for the forestmanagement aimed at conserving the ideal habitat ofthis natural product.

Molecular markers have been mainly developedto detect and identify phytopathogenic fungal agents(Ghignone and Migheli, 2005), but DNA-based meth-ods have also been used to identify commercially rel-evant fungal species, such as white and black truf-fles (Amicucci et al., 1998, 2002; Mello et al., 1999;R thep ngt -p

, wed tec-ta la-te

2

or-p t oft onef

he blue, more or less reticulated stipe and initihite pores, which later become yellowish and treenish.

Among them,B. edulis Bull.: Fr. sensu stricto, B.ereus Bull.: Fr, B. pinophilus Pilat et Dermek andB.estivalis Fr. (all classified asB. edulis s.l.) are conidered valid taxa by the mycological community aepresent the most frequently eaten fungi among tarvested in natural conditions in Europe. Howeuestions related to the presence of allergens in a

he four species remain open together with the absf tools, which allow us to distinguish them. A furthifficulty is that fragments ofB. violaceofuscus, Chiu1948), a spectacular violaceous tincted bolete oally described from China, found also in Japan (eongo, 1960; Imazeki and Hongo, 1989) and considred, on a morphological basis, as belonging toectionBoletus (Singer, 1986), are currently importe

ubini et al., 1998) and to detect frauds, such asresence ofTuber indicum Cooke and Massee amo

he high-value marketT. melanosporum Vittad. samles (Paolocci et al., 1997).

In order to guarantee safe naturally derived foodeveloped specific primers for the unambiguous de

ion of B. edulis sensu stricto,B. aereus, B. pinophilusndB. aestivalis. In addition, we examined the re

ionships ofB. violaceofuscus with the members ofB.dulis s.l.

. Materials and methods

Thirty-five fruitbodies were investigated by mhological and molecular analyses. Twenty-eigh

hem originated from Italy, three from Sweden,rom Croatia and three from China (Table 1). Each

320 A. Mello et al. / Journal of Biotechnology 121 (2006) 318–329

Table 1Samples’ name, geographic origin, accession numbers of the ITS sequences and sets of specific primers used in PCR amplification

Samples Geographic origin Material Accssion No. PCR amplification

Baer set Baes set Bedu set Bpin set Bvio set

Boletus aereusBS1 Sardinia, Italy F + − − − −BS2 Sardinia, Italy F + − − − −SU07 Sardinia, Italy F DQ131619 + − − − −SU08 Sardinia, Italy F DQ131620 + − − − −SU09 Sardinia, Italy M + − − − −SU10 Sardinia, Italy M + − − − −SU11 Sardinia, Italy M + − − − −SU12 Sardinia, Italy M + − − − −SU13 Sardinia, Italy M + − − − −SU14 Sardinia, Italy M + − − − −SU15 Sardinia, Italy M + − − − −SU16 Sardinia, Italy M DQ131612 + − − − −SU17 Sardinia, Italy M + − − − −SU18 Sardinia, Italy M + − − − −SU19 Sardinia, Italy M DQ131617 + − − − −SU20 Sardinia, Italy M + − − − −SU22 Sardinia, Italy M DQ131614 + − − − −SU23 Sardinia, Italy M + − − − −SU24 Sardinia, Italy M DQ131613 + − − − −SU63 Sardinia, Italy F DQ131618 + − − − −SU68 Sardinia, Italy F DQ131615 + − − − −SU69 Sardinia, Italy F DQ131616 + − − − −SU85 Sardinia, Italy F + − − − −

Boletus aestivalisSU05 Veneto, Italy F DQ131607 − + − − −SU06 Piedmont, Italy F DQ131608 − + − − −SU21 Sardinia, Italy M − + − − −SU76 Piedmont, Italy F DQ131609 − + − − −SU79 Sweden F DQ131610 − + − − −SU90 China F DQ131611 − + − − −

Boletus edulisSU35 Motovun, Croatia F DQ131624 − − + − −SU48 Piedmont, Italy F DQ131622 − − + − −SU74 Valle d’Aosta, Italy F DQ131621 − − + − −SU75 Valle d’Aosta, Italy F DQ131625 − − + − −SU77 Sweden F DQ131623 − − + − −

Boletus erythropusSU46.1 Piedmont, Italy F DQ131633 − − − − −SU47.5 Piedmont, Italy F DQ131634 − − − − −

Boletus luridusSU72 Piedmont, Italy F − − − − −

Boletus pinophilusSU71 Tuscany, Italy M DQ131627 − − − + −SU73 Valle d’Aosta, Italy F DQ131626 − − − + −SU78 Sweden F DQ131628 − − − + −

Boletus violaceofuscusSU91 China F DQ131629 − − − − +SU92 China F DQ131630 − − − − +

A. Mello et al. / Journal of Biotechnology 121 (2006) 318–329 321

Table 1 (Continued )

Samples Geographic origin Material Accssion No. PCR amplification

Baer set Baes set Bedu set Bpin set Bvio set

Gyroporus castaneusSU86 Sardinia, Italy F − − − − −SU87 Sardinia, Italy F − − − − −SU88 Sardinia, Italy F − − − − −

Leccinum lepidumSU70 Sardinia, Italy F DQ131631 − − − − −

Suillus luteusSU80 Valle d’Aosta, Italy F − − − − −

Xerocomus armeniacusSU83 Sardinia, Italy F − − − − −

Xerocomus impolitusSU62 Sardinia, Italy F − − − − −SU64 Sardinia, Italy F − − − − −

Xerocomus subtomentosusSU81 Sardinia, Italy F DQ131632 − − − − −SU82 Sardinia, Italy F − − − − −

(F) indicates fruitbody, (M) the mycelium, and (±) indicates presence/absence of the PCR products.

fresh fruitbody was cleaned and a portion was driedand kept in the Herbarium Orti Botanici Taurinensisc/o Dipartimento di Biologia Vegetale, Universita diTorino, as part of the collection of Dr. Alfredo Vizzini.The inner part of the remaining portion was cut in smallpieces and stored at−80◦C for molecular analysis. Inaddition, 17Boletus mycelia were investigated; theywere isolated at the Stazione Sperimentale del Sug-hero from fruitbodies sampled in Sardinia, grown onMMN medium and after 1 month, sent to our labora-tory. Here, the mycelia were grown for 1 more monthbefore being used for molecular analysis.

2.1. Morphological analysis

All the fruitbodies were macro- and micro-morphologically characterized according toWatling(1970), Alessio (1978, 1985), Engel et al. (1983), Galli(1998)andLannoy and Estades (2001). Sections weremounted in 5% KOH and cotton blue-lactophenol andobserved under a light microscope at 400× magnitude.

2.2. Molecular analysis

DNA was extracted from each fruitbody andmycelia grown for 2 months, using the Dneasy plant

mini kit (Qiagen) according to the manufacturer’sinstructions.

Portions of the nuclear rDNA region (ITS), com-prised between the 18S and 28S rDNA genes wereamplified from 50 samples using primers ITS1F(CTTGGTCATTTAGAGGAAGTAA) and ITS4(TCCTCCGCTTATTGATATGC) according toGardesand Bruns (1993). The PCR products from 28 sampleswere sequenced by GeneLab with both primers. Thesequences obtained were verified visually on thechromatograms using Sequencher 3.1.1 (GeneCodes).Accession numbers are shown inTable 1. A multiplesequence alignment was carried out with ClustalXVersion 1.8 (Thompson et al., 1997), using defaultparameters and adjusted manually with GENEDOCVersion 2.6 (Nicholas et al., 1997).

Five pairs of primers (Baer2F/Baer1R, Bedu1F/Bedu2R, Baes1F/Baes2R, Bpin1F/Bpin1R, Bvio1F/Bvio1R) were specifically designed to, respectively,amplify B. aereus, B. edulis, B. aestivalis, B.pinophilus, B. violaceofuscus (Table 1). ForB. aereus,the forward primer Baer2F (GAA GCC GTT TCCTCG GAC TCC) was designed with an artificial substi-tution, in the original sequence (GAA GGG GTT TCCTCG GAC TCC), of the two Guanines, in position 5–6from the 5′ terminus, with two Cytosines. This substitu-

322 A. Mello et al. / Journal of Biotechnology 121 (2006) 318–329

tion increases the 5′ stability of the primer, avoiding thehigh-end self-complementarity and does not compro-mise primer specificity (Table 1). The primer sequencesand the size of PCR products are listed inTable 3.The optimumTa (◦C) was chosen for each primer setevaluating the intended specificity and the PCR prod-uct yield obtained at, at least three, differentTa (◦C).PCR amplification conditions are as follows: denatu-rations at 95◦C for 5 min, 35 cycles at 94◦C for 45 s,annealing (depending on the primer set,Table 3) for45 s, extension at 72◦C for 1 min and a final extensionstep at 72◦C for 7 min. Each 50�l reaction contained1–30 ng of genomic DNA, 10 mM Tris–HCl (pH 8.3),50 mM KCl, 1.1 mM MgCl2, 0.01% gelatin, 2.5 mMdNTP, 40 pmol of primer and 1.5 units of Red Taq DNAPolymerase.

Ten sequences belonging toB. aereus (AY680954),B. edulis (AY680993), B. aestivalis (AY680963), B.pinophilus (AY680972), B. fragrans (AJ419186),B.calopus (AJ296293),B. erythropus (AJ419188),B.rhodoxanthus (AJ419189) andB. luridus (AJ419191,AY278766) were taken from NCBI and used in ourphylogenetic analysis.

Neighbour-joining analysis (NJ), with the Kimuratwo-parameter (K2P) method for superimposed muta-tions, was performed using PAUP* 4.0b10 (Swofford,2003) and TreeviewX (Page, 1996) was used todesign the tree. Maximum parsimony analyses wasalso performed with PAUP* 4.0b10, with start-ing tree(s) obtained via stepwise addition, addi-t ction( s oft anal-y

3

3

a ableb res,s siono asBa ,2

3.2. Molecular analysis

ITS was amplified from all fruitbodies and mycelia.Amplification with the primers ITS1F and ITS4 of theITS region produced a band of about 700 bp forB.pinophilus, 750 bp forB. edulis, 790 bp forB. aestivalisand 827 bp forB. aereus. In order to design specificprimers for theB. edulis s.l. species and to investigatetheir relation with theB. violaceofuscus from China,sequences were obtained from 28 samples (Table 1).

These sequences were first used to generate a NJphylogenetic tree to verify whether all the samples mor-phologically classified as belonging to a given speciesof theB. edulis s.l. grouped together (Table 1, Fig. 1).The NJ phylogeny was congruent to maximum parsi-mony analysis (data not shown). Four sequences fromB. aereus, B. pinophilus, B. edulis, B. aestivalis, pub-lished byLeonardi et al. (2005)were also considered. Inaddition to them, one sample ofB. fragrans, B. calopusandB. erythropus, two samples ofB. luridus and one ofB. rhodoxanthus were taken from NCBI database andadded to our phylogenetic analysis.Leccinum lepidumandXerocomus subtomentosus were used as outgroups.In all, 39 sequences were used in our alignment (970 bplength). WithinB. edulis s.l., four clusters (clades) wereclearly distinguished, according to our morphologicalclassification and toLeonardi et al. (2005)(Fig. 1).Furthermore, interspecific connections are seen, sinceB. edulis cluster is very close toB. pinophilus andB.aereus cluster toB. aestivalis. Our molecular resultsm ies.IB onf ruit-imT nBc rt

tert ,rpr

eda

ion sequence ‘as-is’ and tree-bisection–reconneTBR) as branchswapping algorithm. Robustneshe internal branches was assayed by bootstrapsis (1000 runs).

. Results

.1. Morphological analysis

B. edulis, B. aestivalis, B. pinophilus andB. aereusre very close species, often hardly distinguishecause of the extreme variability of some featuuch as pileus pigmentation and reticulum extenn stipe. One sample from China was identified. aestivalis and the other two, asB. violaceofuscus,ccording toSimonini et al., 2001andFloriani et al.000.

irror the morphological features of the four specn particular, each pair,B. edulis–B. pinophilus and. aereus–B. aestivalis, is characterized by comm

eatures (cap surface, context, stipe reticulum, fng, distribution) as summarized inTable 2. The three

ycelial sequences clustered in theB. aereus group.he ChineseB. aestivalis clusters within the Europea. aestivalis clade, while the twoB. violaceofuscusluster apart from the four species ofB. edulis s.l., neahe outgroups.

The twoB. erythropus sequences obtained clusogether with the publishedB. erythropus sequenceesulting to be very close toB. fragrans andB. calo-us sequences. By contrast,B. luridus is close toB.hodoxanthus (Fig. 1).

Once the four taxa of theB. edulis s.l. resulted to bistinguishable and separate fromB. violaceofuscus, asfurther step specific primers were designed.

A. Mello et al. / Journal of Biotechnology 121 (2006) 318–329 323

Fig. 1. Neighbour-joining tree obtained from ITS sequences alignment of fruitbodies and *mycelia. Percentage bootstrap support (out of 1000trials) is shown. The kimura two-parameter model was used for pairwise distance measurement. Bar, kimura distance.

Table 2Distinguishing characters betweenBoletus edulis–Boletus pinophilus andBoletus aereus–Boletus aestivalis

Boletus edulis–Boletus pinophilus Boletus aereus–Boletus aestivalis

Cap surface greasy-shiny, smooth Cap surface dry, matt, finely tomentose, granulateContext under pileus cuticle vinaceous-red Context under pileus cuticle whitishStipe reticulum at first white then slightly coloured Stipe reticulum dark buff to brick-colourFruiting in Hygrophilous and fresh areas Fruiting in warm conditions, in xerotermophilic areasIn continental Europe, spring–late autumn, early winter,

March–DecemberIn continental Europe, late spring–late summer, May–September

324A

.Mello

etal./JournalofBiotechnology

121(2006)

318–329

Fig. 2. Localization and specificity of the forward primers (A) and the reverse primers (B) on the 1–130 bp ITS1 alignment stretch and 638–866 bp ITS2 alignment stretch, respectively.Dots indicate sequences identity. Baes1F/Baes1R are specific forB. aestivalis (AS), Baer2F/Baer1R forB. aereus (AR), Bedu1F/Bedu2R forB. edulis (ED), Bpin1F/Bpin1R forB.pinophilus (PN) and Bvio1F/Bvio1R forB. violaceofuscus (VF). The accession numbers in bold are newly obtained sequences.

A. Mello et al. / Journal of Biotechnology 121 (2006) 318–329 325

Fig

.2.

(Con

tinu

ed).

326 A. Mello et al. / Journal of Biotechnology 121 (2006) 318–329

Table 3Name, sequence and annealing temperature of the primers

Set name Primer name Sequence (from 5′ to >3′) Ta (◦C) Amplicon size (bp)

Bedu Bedu1F ATG GAG GAG TCA AGG CTG TC 60 515Bedu2R TAG ATT AGA AGC GAT TCA CT

Bpin Bpin1F GGG AAA ATG GAC AAG GAC CC 62 538Bpin1R AGT CAG TCT CAC GAC CGA CTT T

Baer Baer2F GAA GCC GTT TCC TCG GAC TCC 60 532–533Baer1R TGA GGC TTA GGG TTC GAG TC

Baes Baes1F AAG GGG TTT CCT CGG ACT CT 65 481–485Baes2R AAT TGG AAG CGA TTC ACC GCW

Bvio Bvio1F CAC ACT TTG TCG CAT GTC CAT 61 558Bvio1R CCA CCA TCG TGT GCT TGT GT

Amplicon size resulting from each pair used in PCR reactions.

To reach this goal, a crucial point is to cover thepotential intraspecific variability. To satisfy this param-eter for theB. edulis s.l., samples coming from differentgeographic areas were considered, with the exceptionof B. aereus, whose samples are homogeneous for ori-gin.

Alignment of the sequences allowed the design ofa pair of primers for each species (Table 3). Fig. 2shows the differences observed in the oligonucleotideportion of Boletus species that should not be ampli-fied by a given primer. For the design of the primers,their position was taken into account in order to pro-vide a tool for the set up of a multiplex assay, wherethe length of the PCR products must be different. Forreasons which resulted to be dependant on the speciessequences, it was not possible to design four pairs ofprimers which gave products of reasonably differentlengths for each species. Furthermore, their optimumTa (◦C) was different for three species (Table 3). Theefficiency and specificity of the four pairs were testedon DNA from all the available fruitbodies and mycelia.These amplifications gave a band of the expected sizefor each species (B. aereus, B. pinophilus, B. edulisandB. aestivalis, Fig. 3) and no band from all the othersamples listed inTable 1(data not shown). A generalview of the presence/absence of amplification productsis given inTable 1. In order to simulate the detectionof these species from a commercial mixture of driedfungi labelled “B. edulis s.l.”, the efficiency of eachpair of primers was tested on a 25/25/25/25 DNA arti-fia ed(

The pair of primers Baer2F/Baer1R gave theexpected band in 15 mycelia that were, therefore,assigned to the speciesB. aereus.

A pair of primers specific forB. violaceofuscus wasalso designed (Tables 1 and 3), on the basis of twosequences. These primers, tested in PCR experiments,gave the expected band of 558 bp forB. violaceofuscus

F ntsw andBB

cial mixture fromB. aereus, B. pinophilus, B. edulisndB. aestivalis. The expected bands were obtaindata not shown).

ig. 3. Amplification products from four PCR experimeith Baer2F/Baer1R, Bpin1F/Bpin1R, Bedu1F/Bedu2Raes1F/Baes1R, respectively. Lanes 1–4:B. aereus, B. pinophilus,. edulis, B. aestivalis. M: pUC18 digested withHae III.

A. Mello et al. / Journal of Biotechnology 121 (2006) 318–329 327

and no bands for the other fungi used in our analysis(data not shown).

4. Discussion

ITS analysis allowed us to design primers specificfor B. edulis s.l. taxa and to define their relationshipswith B. violaceofuscus.

Each pair of primers revealed to be very effi-cient, taxon-specific and workable. Furthermore, it wastested on fresh and dried fruitbodies coming fromEurope and Asia, as well as on mycelia isolated fromB. aereus.

However, even if these primers are not suitablefor multiplex PCR, it is still possible to simultane-ously detect each of the four taxa by performingfour PCR experiments in a Tgradient thermocycler(from Biometra). In this way, many PCRs with vari-ous primers differing for annealing temperatures canbe performed in a single run, allowing us to distin-guish the taxa of theB. edulis s.l. from other fungicommonly present, by mistake or due to fraudulentadulteration, in dried mushrooms and in processedfood.

4.1. From molecular taxonomy to specific markersfor food market and health

The alignment of 39 sequences gave rise to a phylo-g le int o-l2 ualm

alm req-u onsf tedab s-i eena oi-s hasb ith-o .( tinek .

This enzymatic increase is an index of rhabdomyoly-sis in humans. Therefore, even if this response requiresa certain amount of ingested mushroom, the authorsrecommend a screening program of wild mushrooms.Furthermore, as the paper byHelbling et al. (2002)does not give any taxonomic indication aboutB. edulis(sensu stricto or sensu lato), there is a need to investi-gate this group of fungi more deeply.

Since the discrimination of the four taxa, bytheir morphological features only, is not easy andas they are sold in Europe without distinction, theavailability of specific DNA probes is a crucial point.Laws regulating the mushroom market depend on thecountries. In Italy, France and Spain, the four taxa maybe sold irrespective of their identity. Apart from thehigh economic value involved, there is a need for laws,which require certification of the specific taxa. Thisshould better guarantee individuals who show allergicreactions or present susceptibility toB. edulis s.s. Sincethe individual responses could be common effects ofB. edulis s.s.,B. aereus, B. aestivalis, B. pinophilus,further immunological experiments should beperformed.

The second fallout of the specific primers avail-ability is the use of certified mycelia as inocula inlong-term reforestation programs focused on increas-ing boletes productions. Although morphological char-acters allow us to distinguish many fungi of differentgenera in pure culture, it is difficult to differentiatebetweenB. edulis, B. aestivalis, B. luridus species, ont rac-t ler t off ge-m ee uit-aC -lM e( -PT ugh-o alsob ewZ l.,2 ioni

enetic tree, where four clusters are distinguishabheB. edulis s.l. The four clusters mirror the morphogical criteria used in this work and inLeonardi et al.005). All the samples with both typical and unusorphological features fit in the same cluster.The possibility of identifying the four taxa in fung

ixtures usually sold on the market could be a preisite for medical studies on toxic and allergic reacti

ollowing ingestion of these mushrooms. Food-relallergic reactions due to the mushroomB. edulis haveeen reported (Helbling et al., 2002). Compounds cau

ng poisoning effects or milder symptoms have bnalysed mainly in fungi traditionally considered ponous and inedible. Recently, increasing attentioneen given to mushrooms consumed for centuries wut reports of any toxicity. The paper byNieminen et al2005)reports on the increase of the plasma creainase activities in mice fed withB. edulis powder

he basis of the colony morphology and hyphal chaers (Iotti et al., 2005). It is known that a large-scaeforestation with suitable plants and the harvesruitbodies are an important goal in forest manaent and cultivation (Hall et al., 1998). Boletes arctomycorrhizal fungi with a huge number of sble hosts, among them: Fagales-Fagaceae (Castanea,astanopsis, Fagus, Lithocarpus, Quercus) and Betu

aceae (Carpinus, Corylus, Betula, Ostrya, Populus);alvales-Malvaceae (Tilia); Malpighiales-Salicacea

Salix); Ericales-Ericaceae (Arctostaphylos); Pinalesinaceae (Abies, Keteleeria, Picea, Pinus, Tsuga).hese hosts occur in a wide variety of habitats throut the Northern Hemisphere and they haveeen accidentally introduced into South Africa, Nealand and Kenya (Hall et al., 1998; Stringer et a002). The potentiality to improve boletes product

s, therefore, particularly widespread.

328 A. Mello et al. / Journal of Biotechnology 121 (2006) 318–329

4.2. Molecular diagnosis: a tool against foodfrauds

The phylogenetic tree (Fig. 1) defines well the rela-tionships betweenB. edulis s.l. andB. violaceofuscus.Interestingly,B. violaceofuscus samples cluster withthe outgroups, apart fromB. edulis s.l. and from theotherBoletus species used in our analysis, demonstrat-ing its wrong attribution to the sectionBoletus andopening the question whether it belongs to the genusBoletus. Already,Simonini et al. (2001)in an attemptto study the close relationship betweenB. violaceo-fuscus and B. separans, an Eastern North Americabolete, by pigment chemistry and 28S phylogeneticanalyses, suggested that these species are outside thesectionBoletus and the genusBoletus. Because of thisfinding, the sale ofB. violaceofuscus as dried fruit-bodies of the sectionBoletus has to be debated; a newsales regulation is desirable. To detect the fungus, apair of primers specific forB. violaceofuscus has beendesigned and tested in PCR experiments. Although wecould not check the intraspecific variability of this Chi-nese fungus since it is present in Europe exclusivelyas fragments mixed among dried mushrooms ofB.edulis s.l., the successful and exclusive detection ofthis spectacular fungus, together with the probes aimedat discriminating the four species of theBoletus s.l.opens the possibility of safely monitoring the marketof these high prices fungi. Up to now, only primers spe-cific for the genusBoletus and primers able to detectaH mingfs

A

ttof inS d-i nd S.B ry.

en-t rchi n( o.1

References

Alessio, C.L., 1978. Il Porcino—Saggio Sulle Specie di BoletiIncluse in Questa Denominazione. Edagricole, Bologna, pp.1–70.

Alessio, C.L., 1985.Boletus Dill. ex L. Fungi Europaei. EdizioniBiella Giovanna, Saronno.

Amicucci, A., Zambonelli, A., Giomaro, G., Potenza, L., Stocchi, V.,1998. Identification of ectomycorrhizal fungi of the genusTuberby species-specific ITS primers. Mol. Ecol. 7 (3), 273–277.

Amicucci, A., Guidi, C., Zambonelli, A., Potenza, L., Stocchi, V.,2002. Molecular approaches for the detection of truffle species inprocessed food products. J. Sci. Food Agric. 82 (12), 1391–1397.

Chiu, 1948. The boletes of Yunnan. Mycologia 40, 199–231.Engel, H., Krieglsteiner, J., Dermek, A., Watling, R., 1983.

Dickrohrlinge—Die Gattung Boletus in Europe. Weidhausen.Floriani, M., Simonini, G., Sitta, N., 2000.Boletus violaceofus-

cus, una specie orientale commercializzata in Italia. Bollettinodel Gruppo Micologico G. Bresadola—Nuova Serie 43 (3),4–15.

Galli, R., 1998. I Boleti. Atlante pratico-monografico per la deter-minazione dei Boleti. Edinatura, 1–287.

Gardes, M., Bruns, T.D., 1993. ITS primers with enhanced specificityfor basidiomycetes—application to the identification of mycor-rhizae and rusts. Mol. Ecol. 2 (2), 113–118.

Ghignone, S., Migheli, Q., 2005. SPPADBASE.COM: the databaseof PCR primers for phytopathogenic fungi. Eur. J. Plant Pathol.,submitted for publication.

Hall, I.R., Lyon, A.J.E., Wang, Y., Sinclair, L., 1998. Ectomycor-rhizal fungi with edible fruiting bodies-2.Boletus edulis. Econ.Bot. 52 (1), 44–56.

Helbling, A., Bonadies, N., Brander, K.A., Pichler, W.J., 2002.Bole-tus edulis: a digestion-resistant allergen may be relevant for foodallergy. Clin. Exp. Allergy 32 (5), 771–775.

Hongo, T., 1960. The agaricales of Japan: 1–2. Acta Phytotax.

I oms

I gi-hizal

L l. 6:

L G.,theS

M rs aszal

M ice-ie

M rase

r.

ChineseB. edulis are available (Moor et al., 2002).owever, from our analyses the short sequence co

rom this ChineseB. edulis clusters withB. aestivalisequences.

cknowledgements

We wish to thank G.M. Mureddu and F. Meoor kindly providing all the fruitbodies collectedardinia, A. Taylor and N. Sitta for kindly provi

ng Swedish and Chinese samples, respectively, auonuomo for mycelia propagation in our laboratoThe research was funded by Istituto Sperim

ale del Sughero, the National Council of Resean Italy (Commessa Biodiversita), CRT FoundatioCuneo, Italy) and CEBIOVEM (DM 17/10/2003, N93/2003).

Geobot. 18 (4), 97–112.mazeki, R., Hongo, T., 1989. Coloured Illustrations of Mushro

of Japan II. Osaka.otti, M., Barbieri, E., Stocchi, V., Zambonelli, A., 2005. Morpholo

cal and molecular characterisation of mycelia of ectomycorrfungi in pure culture. Fung. Divers. 19, 51–68.

annoy, G., Estades, A., 2001. Flore Mycologique d’Europe. voLes Bolets. Doc. Myc. Mem. Hors Serie No. 6, 163 pp.

eonardi, M., Paolocci, F., Rubini, A., Simonini, G., Pacioni,2005. Assessment of inter- and intra-specific variability inmain species ofBoletus edulis complex by ITS analysis. FEMMicrobiol. Lett. 243 (2), 411–416.

ello, A., Garnero, L., Bonfante, P., 1999. Specific PCR-primea reliable tool for the detection of white truffles in mycorrhiroots. New Phytol. 141 (3), 511–516.

ontemartini Corte, A., Vianello, A., 1996. Diversi aspetti del mlio di Boletus edulis eB. aereus e micorrizazione di alcune specarboree. Mic. Ital. 3, 75–79.

oor, D., Brodmann, P., Nicholas, G., Eugster, A., 2002. Polymechain reaction (PCR) for the detection of king bolete (Boletusedulis) and slippery jack (Suillus luteus) in food samples. EuFood Res. Technol. 214 (4), 340–345.

A. Mello et al. / Journal of Biotechnology 121 (2006) 318–329 329

Nicholas, K.B., Nicholas, H.B., Jr., Deerfield, D.W., II, 1997. Gene-Doc: Analysis and Visualization of Genetic Variation, EMB-NEW. NEWS 4:14.

Nieminen, P., Mustonen, A.-M., Kirsi, M., 2005. Increased plasmacreatine kinase activities triggered by edible wild mushrooms.Food Chem. Toxicol. 43 (1), 133–138.

Page, R.D.M., 1996. TREEVIEW: an application to display phylo-genetic trees on personal computers. Comput. Appl. Biosci. 12(4), 357–358.

Paolocci, F., Rubini, A., Granetti, B., Arcioni, S., 1997. Typ-ing Tuber melanosporum and Chinese black truffle speciesby molecular markers. FEMS Microbiol. Lett. 153 (2), 255–260.

Roncarolo, D., Minale, P., Mistrello, G., Voltolini, S., Falagiani, P.,1998. Food allergy toBoletus edulis. J. Allergy Clin. Immunol.101 (6), 850–851.

Rubini, A., Paolocci, F., Granetti, B., Arcioni, S., 1998. Sin-gle step molecular characterization of morphologically sim-ilar black truffle species. FEMS Microbiol. Lett. 164 (1),7–12.

Salerni, E., Perini, C., 2004. Experimental study for increasing pro-ductivity of Boletus edulis s.l. in Italy. For. Ecol. Manage. 201(2–3), 161–170.

Simonini, G., Floriani, M., Binder, M., Besl, H., 2001. Two closeextraeuropean Boletes:Boletus violaceofuscus andBoletus sep-arans. Micol. Veg. Mediterranea XVI (2), 148–170.

Singer, R., 1986. The Agaricales in Modern Taxonomy, fourth ed.Koenigstein.

Stringer, A., Wang, Y., Bulman, S., Hall, I.R., Orlovich, D.,2002. Boletus edulis sensu lato down under. In: Hall, I.R.,Wang, Y., Zambonelli, A., Danell, E. (Eds.), Edible MycorrhizalMushrooms and Their Cultivation. Proceedings of the SecondInternational Conference on Edible Mycorrhizal Mushrooms.New Zealand Institute for Crop and Food Research Limited,Christchurch.

Swofford, D.L., 2003. PAUP*. Phylogenetic Analysis Using Par-simony (*and Other Methods), Version 4. Sinauer Associates,Sunderland, MA.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Hig-gins, D.G., 1997. The CLUSTALX windows interface: flex-ible strategies for multiple sequence alignment aided byquality analysis tools. Nucleic Acids Res. 25 (24), 4876–4882.

Torricelli, R., Johansson, S.G.O., Wuthrich, B., 1997. Ingestive andinhalative allergy to the mushroomBoletus edulis. Allergy 52(7), 747–751.

Watling, R., 1970. British fungus flora, Agarics and Boleti. In: 1-Boletaceae: Gomphidiaceae: Paxillaceae. Royal Botanic Garden,Edinburgh, pp. 1–125.

Yun, W., Hall, I.R., 2004. Edible ectomycorrhizal mushrooms: chal-lenges and achievements. Can. J. Bot. Rev. Can. Bot. 82 (8),1063–1073.