1 23

Current Microbiology ISSN 0343-8651Volume 62Number 4 Curr Microbiol (2011)62:1260-1266DOI 10.1007/s00284-010-9851-7

Isolation of a Gene from Leuconostoccitreum B/110-1-2 Encoding a NovelDextransucrase Enzyme

1 23

Your article is protected by copyright and

all rights are held exclusively by Springer

Science+Business Media, LLC. This e-offprint

is for personal use only and shall not be self-

archived in electronic repositories. If you

wish to self-archive your work, please use the

accepted author’s version for posting to your

own website or your institution’s repository.

You may further deposit the accepted author’s

version on a funder’s repository at a funder’s

request, provided it is not made publicly

available until 12 months after publication.

Isolation of a Gene from Leuconostoc citreum B/110-1-2 Encodinga Novel Dextransucrase Enzyme

Reinaldo Fraga Vidal • Claire Moulis •

Pierre Escalier • Magali Remaud-Simeon •

Pierre Monsan

Received: 5 November 2010 / Accepted: 1 December 2010 / Published online: 13 January 2011

� Springer Science+Business Media, LLC 2011

Abstract The amplicon encoding dextransucrase DSR-F

from Leuconostoc citreum B/110-1-2, a novel sucrose

glucosyltransferase (GTF)-specific for a-1,6 and a-1,3

glucosidic bond synthesis, with a-1,4 branching was

cloned, sequenced, and expressed into Escherichia coli

JM109. Recombinant enzyme catalyzed oligosaccharides

synthesis from sucrose as donor and maltose acceptor. The

dsrF gene encodes for a protein (DSR-F) of 1,528 amino

acids, with a theoretical molecular mass of 170447.72 Da

(*170 kDa). From amino acid sequence comparison, it

appears that DSR-F possesses the same domains as those

described for GTFs. However, the variable region is longer

than in other GTFs (by 100 amino acids) and two APY

repeats (a 79 residue long motif with a high number of

conserved glycine and aromatic residues, characterized by

the presence of the three consecutive residues Ala, Pro, and

Tyr) were identified in the glucan binding domain. The

DSR-F catalytic domain possesses the catalytic triad

involved in the glucosyl enzyme formation. The amino

acid sequence of this domain shares a 56% identity with

catalytic domain of the alternansucrase ASR from L. citr-

eum NRRL B-1355 and with the catalytic domain of a

putative alternansucrase sequence found in the genome of

L. citreum KM20. A truncated active variant DSR-F-DSP-

DGBD of 1,251 amino acids, with a molecular mass of 145

544 Da (*145 kDa), was obtained.

Introduction

Glucansucrases from family 70 of glycoside-hydrolases

(GH) are transglucosidases that produce a-glucans from

sucrose, a very cheap and widely available substrate,

without the use of nucleotide activated sugars. Among

glucansucrases, dextransucrases (EC 2.4.1.5) are cell-

associated or soluble extracellular enzymes produced by

bacteria belonging to the genus Leuconostoc [12, 25]. Their

natural polymerase activity can be shifted toward oligo-

saccharide production or gluco-conjugate synthesis by

introducing acceptors in the reaction medium [8, 16, 30].

Both acceptor glycosylation yield and acceptor reaction

product structures were also shown to be highly dependent

on the enzyme specificity. Consequently, using glucan-

sucrases of distinctive specificities and varying the accep-

tors give access to a large variety of applications [12].

However, only a few applications have progressed to the

industrial scale to date. The linear dextran produced by

L. mesenteroides NRRL B-512F (ATCC 10830A) has been

used as a blood plasma substitute [1] and is now exploited

for use in a chromatographic support and as an iron carrier

R. Fraga Vidal

Cuban Research Institute on Sugarcane By-Products (ICIDCA),

P.O. Box 4026, CH-10, CP:11000 Havana City, Cuba

e-mail: reynaldo.fraga@icidca.edu.cu;

reynaldofraga@yahoo.com

C. Moulis � P. Escalier � M. Remaud-Simeon � P. Monsan

Universite de Toulouse; INSA, UPS, INP, LISBP,

135 Avenue de Rangueil, F-31077 Toulouse, France

C. Moulis � P. Escalier � M. Remaud-Simeon � P. Monsan

CNRS, UMR5504, F-31400 Toulouse, France

C. Moulis � P. Escalier � M. Remaud-Simeon � P. Monsan

INRA, UMR792 Ingenierie des Systemes Biologiques et des

Procedes, 31400 Toulouse, France

P. Monsan (&)

Laboratoire d’Ingenierie des Systemes Biologiques et des

Procedes, INSA DGBA, UMR CNRS 5504, UMR INRA 792,

135, avenue de Rangueil, F-31077 Toulouse Cedex 04, France

e-mail: Pierre.Monsan@insa-toulouse.fr

123

Curr Microbiol (2011) 62:1260–1266

DOI 10.1007/s00284-010-9851-7

Author's personal copy

[34]. This dextran has also been approved as an additive in

panification [36]. Other examples of manufactured dex-

transucrase products are the mixture of a-1,2 and a-1,6

glucooligosaccharides marketed for functional foods and

dermocosmetical applications synthesized by L. mesen-

teroides NRRL-B1299 dextransucrase [11]. The Leuco-

nostoc citreum strain B/110-1-2 has been used for dextran

production from sugarcane molasses at the industrial level

[3]. It has also been applied in the production of iron-

dextran at pilot plant scale [21]. The dextran obtained from

the strain B/110-1-2 has been used for the development of

controlled release solid dosage forms (soluble drugs) [6, 7].

This application is a promising avenue for diversification

of the sugarcane agro-industry in its search for high value-

added products. The dextran produced by the strain B/110-

1-2 as revealed by 13C NMR spectra [7], is consistent with

the structure proposed by Seymour et al. [32] for dextrans

produced by Streptobacterium dextranicum NRRL B-1254

and by L. citreum NRRL-B-742 (ATCC 13146) [33].

Whereas many genes encoding dextransucrases are avail-

able, no genes encoding a dextransucrase producing a

dextran formed by a (1–6) (93%), a (1–3) (6%) links, and a(1–4) (1%) branches have been previously reported. In

this communication the authors describe the cloning,

sequencing, and expression of a dextransucrase gene from

L. citreum B/110-1-2, and its primary structure is analyzed.

Materials and Methods

Bacterial Strains, Vectors and Culture Conditions

Chromosomal DNA of Leuconostoc citreum B/110-1-2

was used as a template for the amplification of the DNA

fragments. Escherichia coli JM109 and pGEM3Zf (?)

vector (Promega, USA) were used for the cloning steps.

Escherichia coli JM109 and pSE380 vector (Invitrogen,

USA) were used for protein expression. The screening

of E. coli colonies expressing functional dextransucrase

enzymes was done basically as described by [14]. LBT

medium was used instead of Luria-Bertani (LB) medium

[24]. The method relies on the addition of the pH indicator

Bromothymol blue to LBT media, supplemented with 5%

sucrose and 1% glycerol as extra carbon sources. E. coli

was grown and maintained on LB medium supplemented

when needed with ampicillin (100 lg ml-1). All strains

were stored at -80�C in 15% glycerol.

Leuconostoc citreum B/110-1-2 (Cuban Research Insti-

tute on Sugarcane by-Products Culture Collection) was

grown in a rotary shaker at 30�C at 200 cycles min-1 in

standard medium [24]. Cultures were grown until the pH

reached 4.8–4.5.

DNA Extraction and Purification

E. coli plasmid isolation and Leuconostoc citreum B/110-

1-2 chromosomal DNA purification were done with the

QiaPrep Spin Plasmid kit and the Blood and Cell Culture

DNA Maxi kit (Qiagen), respectively. PCR purification

and gel extraction were performed using QIAquick kit

(Qiagen). DNA manipulation used standard methods [31].

Restriction and modification enzymes were purchased from

New England Biolabs and used according to the manu-

facturer’s recommendations.

PCR Amplification of a Dextransucrase Encoding Gene

and its Truncated Variant

Primers were designed from N- and C-terminal regions of

amino acid sequences of the alternansucrase asr deposited

at GenBankTM

under the accession number AJ250173.

Amplicons were generated by LA PCR (Long and

Accurate PCR) using the Expand High Fidelity PCR

System (Roche Applied Science) with a UNO-Thermo-

block Vers. 3.30 thermocycler and 50 ng of genomic

DNA, 10 lM of forward and reverse primers (Table 1),

200 lM of each dNTP, 5 ll of expand high fidelity

buffer, 109 concentration with 15 mM MgCl2 in a total

reaction volume of 50 ll. The thermal cycling was 1

cycle 94�C for 2 min, 10 cycles of 94�C for 15 s, 50�C

for 30 s, 68�C for 10 min, 20 cycles of 94�C for 15 s,

50�C for 30 s, 68�C for 10 min plus 5 s for each cycle

and 1 cycle 68�C for 15 min. The amplicons were cloned

in the pGEM3Zf (?) vector and subcloned in the

expression vector pSE380.

ATG in italic type represent the start codon. Nucleotides

in bold type and underlined represent mismatches with the

sequence bearing asr in order to transform the start codon

in a NcoI cleavage site. Restriction cleavage sites intro-

duced in the dsrF sequence to facilitate the cloning and

subcloning steps are shown.

DNA Sequencing and Sequence Analysis

Amplicons were sequenced in both directions by Genome

Express, France. Nucleotide sequence analyses were per-

formed by using the software Vector NTI 10.0 (Invitrogen

and InforMax, USA). The sequence of the coding region of

dsrF gene has been submitted to the GenBankTM

database

under accession number FJ844434.

ClustalW2 and WebLogo internet programs were used

to perform the sequence alignments at http://www.ebi.

ac.uk/Tools/clustalw2/index.html [19] and http://weblogo.

berkeley.edu/logo.cgi [9].

R. Fraga Vidal et al.: Isolation of a Gene from Leuconostoc citreum B/110-1-2 1261

123

Author's personal copy

Enzyme Production and Extraction Methods

For the expression of DSR-F and DSR-F-DSP-DGBD

dextransucrases, a single colony of each clone was inoc-

ulated into 10 ml of LBT medium supplemented with

100 lg ml-1 of ampicillin and grown at 30�C overnight.

The cultures were centrifuged at 6,0009g, 10 min, 4�C.

The cells were resuspended in 10 ml of fresh 29YT

medium [31] with 100 mM Tris/HCl, pH 6.4,

200 lg ml-1 ampicillin. The cultures were then diluted to

1:100 with 29YT medium supplemented with 100 mM

Tris/HCl, pH 6.4, 200 lg ml-1 ampicillin, and grown at

30�C until OD600 reached 0.5. Then 2.4 mM isopropyl-1-

thio-b-D-galactopyranoside (IPTG) was added. The cul-

tures temperature was shifted to 20�C and agitation kept

at 200 cycles per minutes for 12–14 h. Finally the cells

were disrupted by sonication. The cell homogenate was

centrifuged at 10,0009g, 30 min, 4�C to separate cell

debris. Soluble protein extract preparations were kept at

4�C for further analysis.

Enzyme Activity Assays

Glucosyltransferase activity (GTF) was assayed using the

dinitrosalicylic acid method [35]. For dextransucrase

variants, one unit is defined as the amount of enzyme that

catalyzes the formation of 1 l mol of fructose/min at

30�C in 20 mM sodium acetate buffer pH 5.4, 0.05 g/l

CaCl2 and 100 g/l sucrose. For the acceptor reaction,

maltose (100 g/l) and 0.5 U ml-1 of DSR-F were added.

The oligosaccharides synthesized were analyzed by high-

performance anion-exchange chromatography with pulsed

amperometric detection (HPAEC-PAD), according to

described [26].

Results and Discussion

PCR Amplification and Cloning of the Dextransucrase

Encoding Gene dsrF and its Truncated Form dsrF-DSP-

DGBD

Figure 1 describes the dsrF gene cloning and the truncated

variant dsrF-DSP-DGBD construction steps. Using the LA

PCR technique with the primers shown in Table 1, it was

possible to amplify and clone into pGEM3Zf (?) a DNA

fragment of 5839 bp. It contained an open reading frame

(ORF) of 4656 bp (DSR-F). E. coli JM109 clones

expressing GTF activity (DSR-F) were selected using a

simple phenotypic screening procedure. Positive clones

turned the medium color from the initial green (pH

6.5–7.0) to yellow (pH\6.0) revealing acidification by the

consumption, via glucolysis, of the glucose and fructose

released from sucrose [14]. In addition, positive clones

showed the typical dextran polymer formation phenotype

and negative clones appeared as flat colonies without

dextran.

To investigate the functions of the CW(Cell Wall)-like

and APY (Ala-Pro-Tyr) repeats present in the C-terminal

Glucan binding domain (GBD), in respect to DSR-F

activity and specificity, a truncated form was constructed

(Fig. 3). A 3765-bp DNA fragment, containing the gene

dsrF deleted from the sequence encoding signal peptide

and a portion of the C-terminal domain (DSR-F-DSP-

DGBD), was obtained by LA PCR amplification and suc-

cessive digestion with the restriction enzymes NcoI-EcoRI

of the respective amplicon. After purification, the digestion

product was ligated into the NcoI-EcoRI digested expres-

sion vector pSE380. E. coli JM109 clones expressing GTF

activity were selected as previously described above

(see also Fig 1). No activity was detected in the culture

Table 1 Oligoprimers used for

the LA PCR amplification

nt nucleotidesa Primer sequences are

designed from the non-coding

strand (-dir-PS) and from the

complementary strand (-inv-PS)

Designation Description 5’-3’ Sequencea

dsrF PstI NcoI

dsrF-dir-PS asr nt 199–220 CTGCAT CCATGG AACAACAAGAAACAGTTACCCG

dsrF-inv-PS asr nt 6378–6404 CCCGGG GCTGATAATGTTACCCTCCTTTGTCGA

Cfr9I

dsrF-ΔSP-ΔGBD SacI NcoI

dsrF-dir dsr ATGG ATACACACAAAACGCCGGTTGGTAC

dsrF-inv dsr

F nt 127–152 GAGCTCC

F nt 3851–3875 GAATTC AAGTGATATGCATTACCGC

EcoRI

1262 R. Fraga Vidal et al.: Isolation of a Gene from Leuconostoc citreum B/110-1-2

123

Author's personal copy

supernatant of E. coli JM109 transformed by the recom-

binant plasmid (pSE380 ? DSR-F-DSP-DGBD). The acti-

vity in the soluble fraction of sonicated cell extracts

reached 129 IU ml-1 of crude extract. A comparison of the

acceptor reaction products formed by the native soluble

and cell-associated dextransucrases of L. citreum B/110-

1-2 with the ones produced by the recombinant dextran-

sucrase DSR-F-DSP-DGBD was performed. As shown in

Fig. 2, in the presence of maltose as an acceptor molecule,

the cell-associated dextransucrases of L. citreum B/110-1-2

and DSR-F-DSP-DGBD produce a series of isomaltodext-

rins analogs with retention times very similar to the ones

produced by the DSR-S from L. mesenteroides NRRL-

B-512F, except that two picks appeared more clearly,

immediately after the products with degrees of poly-

merization (DP) of 7 and 8, respectively. From these

observations, it can be concluded that dsrF encodes a cell-

associated dextransucrase enzyme of L. citreum B/110-1-2.

Structural Characteristics of the DSR-F

and DSR-F-DSP-DGBD

The dsrF gene encodes for a protein (DSR-F) of 1,529

amino acids, with a predicted molecular mass of

170447.72 Da (*170 kDa) and pI of 5.26. Primary

structure analyses revealed that DSR-F displays the same

organization as all the dextransucrases from family GH-70

(EC 2.4.1.5). From the N-terminal region of DSR-F, a

Gram-positive signal peptide sequence was identified. A

cleavage site following amino acid 39 was predicted with

the program SignalP 3.0 Server [4, 27] (Fig. 3). Then from

amino acids 40–380, DSR-F, like the alternansucrase ASR

of L. citreum NRRL B-1355, a highly variable region is

displayed which is much longer than the corresponding

region of the other GTFs (by 100 amino acids) [2, 23].

Within this region, six putative cell wall binding units (CW

units) can be localized at the N-terminal to the start of the

catalytic core (Fig. 3), showing homology to the CW units

of the C-terminal domain of the autolysin LytA from

Streptococcus pneumoniae [13].

The next 790 amino acids from the variable region

define the catalytic domain. Sequence comparison revealed

that the DSR-F catalytic domain shares a 56% identity

with the catalytic domain of the alternansucrase ASR of

L. citreum NRRL B-1355 and with the catalytic domain of

a putative alternansucrase sequence found in the genome of

L. citreum KM20.

In particular, the three blocks of sequences which

contain amino acids that play a role in catalysis can be

easily identified in DSR-F (Figs. 3, 4). Moreover, the

three amino acids likely to be involved in the catalytic

triad by analogy with a-amylases [10] are identified in

the DSR-F sequence: D557, E595, D667. Finally, the

C-terminus, also named glucan binding domain (GBD),

begins at position 1,171 and is 358 residues in size.

Once again four putative CW units can be localized at

the N-terminal region of this domain. This suggests, as

for DSR-E, ASR, and DSR-P [5, 12, 28, respectively]

Chromosomal DNA from Leuconostoc citreum B/110-1-2

LA PCR

DSR-F 3’ Cfr9I Pst I 5’

~ 5839 pb pGEM3Zf(+)

~ 3197 pb

pGEM3Zf(+)

+

DSR-F

~ 9035 pb

LA PCRpSE380

+

DSR-F-ΔSP-ΔGBD

~ 8165 pb

NcoI

EcoRI ~ 3765 pb

DSR-F-ΔSP-ΔGBD

Expression in E. coli JM109 Positive clones

Negative clones

Fig. 1 Cloning of the dsrF gene

and the truncated variant dsrF-

DSP-DGBD. Histochemical

detection of recombinant

dextransucrase enzymes activity

in E. coli

R. Fraga Vidal et al.: Isolation of a Gene from Leuconostoc citreum B/110-1-2 1263

123

Author's personal copy

that DSR-F GBD could be involved in enzyme anchoring

at the cell wall surface of L. citreum B/110-1-2. The

DSR-F C-terminal GBD also contains the unusual

repeats (named APY) repeated 2 times (Fig. 3). In family

GH-70, these repeats had only been found previously in

ASR [2, 12].

The dsrF-DSP-DGBD gene encodes for a truncated

variant of DSR-F where the signal peptide and a portion

including the two APY repeats and the fourth CW unit of

the C-terminal GBD have been deleted. The GBD of DSR-

F-DSP-DGBD contains only three putative CW units. This

truncated variant consisted of 1,251 amino acids, with a

predicted molecular mass of 145 544 Da (*145 kDa) and

a pI of 5.27. These APY repeats and the fourth CW unit in

DSR-F are not essential to maintain enzyme activity.

Similar results have been reported previously for ASR

C-del bis, which is the alternansucrase ASR truncated of all

the C-terminal APY repeats [12, 15].

The polymer formed by DSR-F-DSP-DGBD from

sucrose was analyzed and compared to the polymer syn-

thesized by the native cell associated dextransucrases from

L. citreum B/110-1-2. Size exclusion chromatography

analyses (HPSEC) revealed (data not shown) that for both

enzymes two populations of products are synthesized from

sucrose, polymers with an average molecular weight esti-

mated at 2 9 106 Da and oligosaccharides of DP \ 8

(degree of polymerization less than 8 units of glucose). The

presence of these oligosaccharides was also confirmed by

HPAEC-PAD, detecting many oligosaccharides displaying

overall an average degree of polymerization of 8. These

oligosaccharides are abundant in the DSR-F-DSP-DGBD

reaction medium (Fig. 2). Nevertheless, the deletion of

APY repeats and the fourth CW unit of the C-terminal

GBD did not suppress polymerase activity showing that

these motifs are not involved in polymer elongation. A

similar HPSEC pattern (although with polymers and

Fig. 2 HPAEC-PAD profile of

the products synthesized by the

recombinant dextransucrase

DSR-F-DSP-DGBD from

sucrose 435 mM in the presence

of 145 mM maltose as the

acceptor. Comparisons were

made with the products

synthesized by cellular and

supernatant fraction of

Leuconostoc citreum B/110-1-2

and by the dextransucrase

DSR-S from Leuconostocmesenteroides NRRL B-512F.

Arrows indicates two extra

picks immediately after the

products with degrees of

polymerization (DP) of 7 and 8.

Peak identification: G Glucose,

F Fructose, L Leucrose,

S Sucrose, M Maltose,

P Panose, I4-I12

isomaltooligosaccharides of

DP2–DP12

Fig. 3 Primary structure of the

dextransucrase DSR-F of

Leuconostoc citreum B/110-1-2

and its truncated variant DSR-

F-DSP-DGBD

1264 R. Fraga Vidal et al.: Isolation of a Gene from Leuconostoc citreum B/110-1-2

123

Author's personal copy

oligosaccharides with different linkages) has been described

for the alternansucrase ASR from the L. citreum NRRL-B-

1355 and its truncated variant ASR C-del bis [12, 15, 26].

According to these results, a cell-associated dextransucrase

of L. citreum B/110-1-2 and the recombinant DSR-F-DSP-

DGBD have some common structural and functional char-

acteristics with ASR, although their specificity is basically

like a dextransucrase enzyme. As revealed by 13C NMR

spectra (data not shown), the structural data of both dextran

polymers, the native and the recombinant (synthesized by

DSR-F-DSP-DGBD), are identical and consistent with the

structure formed by a (1–6) (93%), a (1–3) (6%) links, and

a (1–4) (1%) branches proposed by Castellanos et al. [7].

Thus, it can be concluded that the APY motifs of DSR-F are

not involved in the formation of a-1,6, a-1,3, and a-1,4

linkages. The deletion of these repeats resulted in an

increase of the solubility of the DSR-F-DSP-DGBD com-

pared to DSR-F. A very similar behavior was described for

ASR and ASR C-del [15], suggesting the APY motifs could

be involved in interactions with cell walls [12]. On the basis

of its sequence and specificity, DSR-F, is a novel dextran-

sucrase enzyme, which must be classified in family GH-70,

like all other GTFs from L. mesenteroides and L. citreum

(EC 2.4.1.5). The role of the very long variable region of

DSR-F will have to be further investigated and compared

with other GTFs. Further study combining site-directed

mutagenesis, random mutagenesis, and protein purification

is required to determine the role of several segments in

DSR-F specificity and other physical–chemical properties

of the enzyme.

Acknowledgments R. Fraga holds a contract as Research Associate

from INRA, Toulouse, France. The authors express the gratitude to

Elise Champion and Richard Guyton for their technical support and

advice for the HPAEC-PAD and HPSEC analysis, respectively. The

authors also wish to thank Dr. Joan Combie for the style correction of

the manuscript.

References

1. Alsop RM (1983) Industrial production of dextrans. In: Bushell

ME (ed) Progress in industrial microbiology, vol 1. Elsevier,

Amsterdam, pp 1–44

2. Arguello-Morales MA, Remaud-Simeon M, Pizzut S, Sarcabal P,

Willemot RM, Monsan P (2000) Sequence analysis of the gene

encoding alternansucrase, a sucrose glucosyltransferase from

Leuconostoc mesenteroides NRRL B-1355. FEMS Microbiol Lett

182:81–85

3. Bell A, Santiesteban CM (2000) Dextran. In: Galvez L, Resello S,

Cabello A, Villamil G, Garcıa A, Martın A, Costales R (eds)

Handbook of sugar cane derivatives, Chapt. 5.1, 3rd edn. Cuban

Research Institute on Sugarcane Derivatives (ICIDCA), Havana

City, Cuba, pp 323–326

4. Bendtsen JD, Nielsen H, von Heijne G, Brunak S (2004)

Improved prediction of signal peptides signalP 3.0. J Mol Biol

340:783–795

5. Bozonnet S, Dols-Laffargue M, Fabre E, Pizzut S, Remaud-Simeon

M, Monsan P, Willemot RM (2002) Molecular characterization of

DSR-E, an a-1,2 linkage-synthesizing dextransucrase with two

catalytic domains. J Bacteriol 184:5753–5761

6. Castellanos E, Iraizoz A, Bataille B, Pedraz JL, Heinamaki J

(2006) Development and optimization of a novel sustained-

release dextran tablet formulation for propranolol hydrochloride.

Int J Pharm 317:32–39

7. Castellanos E, Iraizoz A, Abdelsam E, Durand D, Delarbre JL,

Bataille B (2008) A sugar cane native dextran as an innovative

Fig. 4 Amino acid sequence alignment of highly conserved regions

(II, III, VII) in the catalytic domains of dextran-, mutan-, alternan-,

and reuteransucrase enzymes of lactic acid bacteria (including DSR-F

and also see [23]) and residues with functional roles identified by site-

directed mutagenesis. Key: DSR-S Ln. mesenteroides NRRL B-512F,

DSR-E CD1 and CD-2 Ln. mesenteroides NRRL B-1299, GTF-180

Lb. reuteri 180, GTF-Kg3 Lb. fermentum Kg3, GTF-B S. mutansGS5, GTF-I S. downei Mfe28, ASR Ln. mesenteroides NRRL

B-1355, GTF-L S. salivarius ATCC 5975, GTF-A Lb. reuteri 121,

DSR B 742 Ln. citreum NRRL B-742, DSR-F Ln. citreum strain

B/110-1-2.Symbols * identical residue, : highly conserved residue, .

conserved residue, � putative catalytic nucleophile, u putative acid/

base catalyst, ; putative residue stabilizing the transition state

intermediate [10, 20], h putative sugar-binding/glycosyl transfer sites

[10], V residues involved in linkage specificity and glucan solubility.

Amino acids involved in enzyme linkage specificity [12, 17, 18, 22,

26, 29] are in bold underlined type

R. Fraga Vidal et al.: Isolation of a Gene from Leuconostoc citreum B/110-1-2 1265

123

Author's personal copy

functional excipient for the development of pharmaceutical tab-

lets. Eur J Pharm Biopharm 68:319–329

8. Cote GL, Dunlap CA (2003) Alternansucrase acceptor reactions

with methyl hexopyranosides. Carbohyd Res 338:1961–1967

9. Crooks GE, Hon G, Chandonia JM, Brenner SE (2004) Web-

Logo: a sequence logo generator. Genome Res 14:1188–1190

10. Devulapalle KS, Goodman SD, Gao Q, Hemsley A, Mooser G

(1997) Knowledge-based model of a glucosyltransferase from the

oral bacterial group of mutans streptococci. Protein Sci 6:

2489–2493

11. Dols M, Remaud-Simeon M, Willemot RM, Vignon M, Monsan P

(1998) Characterization of the different glucosyltransferase activ-

ities excreted in glucose, fructose or sucrose medium by Leuco-

nostoc mesenteroides NRRL B-1299. Appl Environ Microbiol

64:1298–1302

12. Fabre E, Joucla G, Moulis C, Emond S, Richard G, Potocki-

Veronese G, Monsan P, Remaud-Simeon M (2006) Glucansucrases

of GH family 70: what are the determinants of their specificities?

Biocatal Biotransfor 24(1–2):137–145

13. Fernandez-Tornero C, Lopez R, Garcıa E, Gimenez-Gallego G,

Romero A (2001) A novel solenoid fold in the cell wall anchoring

domain of the pneumococcal virulence factor LytA. Nat Struct

Biol 8:1020–1024

14. Hernandez L, Menendez C, Soto M, Trujillo LE, Arrieta JG

(2002) A simple method for direct screening of Escherichia coliand Pichia pastoris expressing recombinant saccharolytic

enzymes. Biotecnologıa Habana 2002. Agro-Biotech in the New

Millennium. ISBN 959-235-021-3 Elfos Scientiae

15. Joucla G, Pizzut S, Monsan P, Remaud-Simeon M (2006) Con-

struction of a fully active truncated alternansucrase partially

deleted of its carboxy-terminal domain. FEBS Lett 580:763–768

16. Koepsell HJ, Tsuchiya HM, Hellman NN, Kazenko A, Hoffman

CA, Sharpe ES, Jackson RW (1953) Enzymatic synthesis of

dextran. Acceptor specificity and chain initiation. J Biol Chem

200:793–801

17. Kralj S, van Geel-Schutten GH, Faber EJ, van der Maarel MJ,

Dijkhuizen L (2005) Rational transformation of a dextransucrase

into a dextransucrase: analysis of mutant enzymes and their

glucan and oligosaccharides products. Biochemistry 44:9206–

9216

18. Kralj S, van Geel-Schutten GH, van der Maarel MJ, Dijkhuizen L

(2004) Biochemical and molecular characterization of Lactoba-cillus reuteri 121 reuteransucrase. Microbiology 150:2099–2112

19. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan

PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R,

Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W and

Clustal X version 2.0. Bioinformatics 23:2947–2948

20. Macgregor EA, Jespersen HM, Svensson B (1996) A circularly

permuted alpha-amylase-type alpha/beta-barrel structure in glu-

can-synthesizing glucosyltransferases. FEBS Lett 378:263–266

21. Michelena G, Santiesteban CM (2000) Injectable Iron Dextran.

In: Galvez L, Resello S, Cabello A, Villamil G, Garcıa A, Martın

A, Costales R (eds) Handbook of sugar cane derivatives, Chapt.

5.13, 3rd edn. pp 383–385

22. Monchois V, Vignon M, Escalier PC, Svensson B, Russel RB

(2000) Involvement of Gln 937 of Streptococcus downei GTF-I

glucansucrase in transition-state stabilisation. Eur J Biochem

2000:4127

23. Monchois V, Willemot RM, Monsan P (1999) Glucansucrases:

mechanism of action and structure-function relationships. FEMS

Microbiol Rev 23:131–151

24. Monchois V, Remaud-Simeon M, Russell RB, Monsan P,

Willemot RM (1997) Characterization of leuconostoc mesenter-oids NRRL B-512F dextransucrase (DSRS) and identification of

amino-acid residues playing a key role in enzyme activity. Appl

Microbiol Biot 48:465–472

25. Monsan P, Bozonnet S, Albenne C, Joucla G, Willemot RM,

Remaud-Simeon M (2001) Homopolysaccharides from lactic

acid bacteria. Int Dairy J 11:675–685

26. Moulis C, Joucla G, Harrison D, Fabre E, Potocki-Veronese G,

Monsan P, Remaud-Simeon M (2006) Understanding the poly-

merization mechanism of glycoside-hydrolase family 70 glu-

cansucrases. J Biol Chem 281:31254–31267

27. Nielsen H, Engelbrecht J, Brunak S, von Heijne G (1997) Iden-

tification of prokaryotic and eukaryotic signal peptides and pre-

diction of their cleavage sites. Protein Eng 10:1–6

28. Olvera C, Fernandez JL, Ledezma L, Lopez A (2007) Role of the

C-terminal region of dextransucrase from Leuconostoc mesen-teroides IBT-PQ in cell anchoring. Microbiology 153:3994–4002

29. Remaud-Simeon M, Willemot RM, Sarcabal P, Potocki de

Montalk G, Monsan P (2000) Glucansucrases: molecular engi-

neering and oligosaccharide synthesis. J Mol Catal B-Enzym

10:117–128

30. Richard G, Morel S, Willemot RM, Monsan P, Remaud-Simeon

M (2003) Glucosylation of alpha-butyl- and alpha-octyl-

D-glucopyranosides by dextransucrase and alternansucrase from

Leuconostoc mesenteroides. Carbohyd Res 338:855–864

31. Sambrook J, Russell DW (2001) Molecular cloning: a laboratory

manual. (3rd ed.). Cold Spring Harbor Laboratory, Cold Spring

Harbor, NY

32. Seymour FR, Knapp RD, Bishop SH (1976) Determination of

the structure of dextran by C-nuclear resonance spectrometry.

Carbohyd Res 51:179–194

33. Slodki ME, England RE, Plattner RD, Dick WE (1986) Meth-

ylation analyses of NRRL dextrans by capillary gas-liquid

chromatography. Carbohyd Res 156:199–206

34. Soetaert W, Schwengers D, Buchholz K and Vandamme EJ

(1995) A wide range of carbohydrate modifications by single

micro-organism: Leuconostoc mesenteroides. In: Petersen SB,

Svensson B, Pedersen S. (Eds) Carbohydrate Bioengineering, vol.

10, Elsevier Science BV, Amsterdam, pp 351–358

35. Sumner J, Howell S (1935) A method for determination of

invertase activity. J Biol Chem 108:51

36. Vandamme EJ, Renard CEFG, Arnaut FRJ, Vekemans NMF,

Tossut PPA (2002) Process for obtaining improved structure

build-up of baked products. US Patent 6,399,119, 4 June 2002

1266 R. Fraga Vidal et al.: Isolation of a Gene from Leuconostoc citreum B/110-1-2

123

Author's personal copy