Tree Genetics & Genomes (2006) 2: 76–85DOI 10.1007/s11295-005-0029-6

ORIGINAL PAPER

K. D. Jermstad . L. A. Sheppard . B. B. Kinloch .A. Delfino-Mix . E. S. Ersoz . K. V. Krutovsky .D. B. Neale

Isolation of a full-length CC–NBS–LRR resistance gene analogcandidate from sugar pine showing low nucleotide diversity

Received: 14 June 2005 / Revised: 7 November 2005 / Accepted: 23 November 2005 / Published online: 17 February 2006# Springer-Verlag 2006

Abstract The nucleotide-binding-site and leucine-rich-repeat (NBS–LRR) class of R proteins is abundant andwidely distributed in plants. By using degenerate primersdesigned on the NBS domain in lettuce, we amplifiedsequences in sugar pine that shared sequence identity withmany of the NBS–LRR class resistance genes catalogued inGenBank. The polymerase chain reaction products wereused to probe a cDNA library constructed from needle tissueof sugar pine seedlings. A full-length cDNA was obtainedthat demonstrated high predicted amino acid sequencesimilarity to the coiled coil (CC)–NBS–LRR subclass ofNBS–LRR resistance proteins in GenBank. Sequenceanalyses of this gene in megagametophytes from two sugarpine trees segregating for the hypersensitive response towhite pine blister rust revealed zero nucleotide variation.Moreover, there was no variation found in 24 unrelated sugarpine trees except for three single-nucleotide polymorphismslocated in the 3′ untranslated region. Compared to othergenes sequenced in Pinaceae, such a low level of sequencevariation in unrelated individuals is unusual. Although,numerous studies have reported that plant R genes are underdiversifying selection for specificity to evolving pathogens,

the resistance gene analog discussed here appears to be underintense purifying selection.

Keywords Resistance gene analog . SNP . Haplotype .Nucleotide diversity

Introduction

Sugar pine (Pinus lambertiana) is a conifer indigenous to thePacific Northwest, easily recognized by its long pendentcones and arching branches. It belongs to thePinus subgenusStrobus and, like all members of this subgenus, is threatenedby an exotic fungal pathogen, Cronartium ribicola, whichwas introduced into North America in the early 1900s.Extensive research using controlled crosses of sugar pineshowed that a major gene of resistance (MGR) whichmediates a hypersensitive response (HR) segregates as adominant allele (Cr1) at a low frequency in natural stands[40, 42]. Exploration of disease-related genes in sugar pinewas conducted in an effort to provide genomic tools forunderstanding and managing important pathosystems in thisconiferous species.

CloningMGRs to plant pathogens by homology became apopular strategy [48, 59, 68] after monogenic resistancegenes (R genes) from several species were successfullycloned and characterized [13, 46, 74] (reviewed in [12]). Themajority of R genes isolated were of the NBS–LRR class,which is characterized by the presence of a nucleotide-binding-site (NBS) domain and a C-terminal leucine-rich-repeat (LRR) region. In many angiosperms, R genes arefound in clusters interspersed throughout the genome [10,33, 61, 63]. However, in gymnosperms, the frequency, classtype, and distribution of R genes are relatively unexplored.Partial cDNA sequences similar to NBS–LRR R genes havebeen reported in loblolly pine (Pinus taeda L., [59]), mar-itime pine (Pinus pinaster, [21]; unpublished, BX683030),sugi (Cryptomeria japonica, [72]) and western white pine(Pinus monticola Doug., [50]), but the majority of these arefragments representing theNBS region only. In this study,wereport a full-length coiled-coil (CC)–NBS–LRR resistance

K. D. Jermstad . L. A. Sheppard . B. B. Kinloch .A. Delfino-Mix . K. V. Krutovsky . D. B. Neale (*)USDA-Forest Service, Pacific Southwest Research Station,Institute of Forest Genetics,2480 Carson Road,Placerville, CA 95667, USAe-mail: dbneale@ucdavis.edu

E. S. Ersoz . D. B. NealeDepartment of Plant Sciences, University of California,1 Shields Avenue,Davis, CA 95616, USA

Present address:L. A. SheppardIngenuity Systems,1565 Charleston Road,Mountain View, CA 94043, USA

gene-like cDNA (Pl_RGC-CC_1, GenBank accession num-ber DQ017061) that is highly conserved in sugar pine and inwestern white pine.

Materials and methods

Plant material

Seed was collected from open-pollinated cones from each oftwo sugar pine trees (5701 and 6000) and three westernwhite pine trees (714, 717, and 721; [43]) that wereheterozygous (Rr) for resistance to white pine blister rust(WPBR). Seedlings were grown in the greenhouse, andmegagametophytes (haploid seed tissue) were rescued upongermination and stored at −80°C for DNA isolation [27].Six-week-old seedlings were artificially challenged with theappropriate strain of C. ribicola [41] using standardprotocols described by Kinloch [40]. The disease phenotype(susceptible or resistant) was scored and recorded forsegregation analyses [27]. For construction of a cDNAlibrary, needle tissue from seedlings of family 5701 wascollected prior to inoculation and individually flash-frozen inliquid nitrogen, labeled and stored at −80°C. After diseasephenotypes for individual seedlings were scored, the flash-frozen tissue from resistant seedlings was pooled and used toobtain RNA.

For polymerase chain reaction (PCR) amplification andsequencing in sugar pine, DNA from several megagame-tophtyes from trees 5701 and 6000 and a single megagame-tophyte from 24 unrelated trees originating from Californiaseed zones 301, 302, 311, 312, 331, 372, 516, 521, 522, 523,524, 525, 526, 531, 742, 994 [19] was extracted usingFastPrep method (Qbiogene, Irvine, CA) and used astemplate. For comparison of sequences in outgroups, severalmegagametpophtyes from western white pine trees 714, 717and 721, a single megagametophyte from each of 24unrelated loblolly pine trees [32], and a single megagame-tophyte from each of 30 unrelated Douglas-fir [Pseudotsugamenziesii (Mirb.) Franco] were used to obtain DNA [44].

Cloning NBS sequences from genomic DNA

Degenerate primers corresponding to the NBS domain P-loop (VGKTT) and GLPLAL conserved motifs of NBS–LRR resistance sequences in lettuce [68] were used toamplify sequences from sugar pine genomic DNA (Table 1).PCR conditions were 1 μM for each primer, 200 μM eachdNTP, 1.5 mM MgCl2, 25 ng template DNA, and 1.0 U ofTaq polymerase (QIAGEN, Inc., Valencia, CA). The cyclingparameters were 94°C for 2 min, followed by 35 cycles of94°C for 30 s, 50°C for 1 min, 72°C for 2 min, and a finalextension of 72°C for 5 min. PCR products were gel purifiedand ligated into pGemT-Easy vector (Promega, Madison,WI). Transformed Escherichia coli was cultured overnightfor plasmid amplification and isolation. Inserts were se-quenced (Davis Sequencing Center, Davis, CA), andsequences were submitted to BLASTX searches [2] to

determine sequence similarity to known NBS–LRR class Rproteins in GenBank.

cDNA library construction and colony screening

A unidirectional cDNA library was constructed from needletissue of uninfected resistant sugar pine seedlings from tree5701 using ZAP-cDNA Synthesis Kit (Stratagene, La Jolla,CA). Total RNA was extracted by methods described byChang et al. [22], and polyA+ purified using mRNASeparator Kit (Clonetech, Mountain View, CA). A total of1.2 μg of mRNA was used in construction of the cDNAlibrary producing 1.2×1011 pfu. Colony lifts were preparedwith Immobilon N+ membrane (Millipore, Billerica, MA)and crosslinked with UV light. The NBS clones 7b3, 16B,B2, and C6 that were produced using degenerate PCRprimers (Table 1) were biotinylated and used to probecolonies following instructions in the NEBlot PhototopeChemiluminescent Kit (NewEngland Biolabs, Inc., Beverly,MA). Blots constructed with known amounts of target insertDNA were used in hybridization as a control for limits ofdetection. Hybridization was detectable as low as 0.1 pg oftarget DNA. Selected cDNAs were sequenced by the UCDavis Sequencing Center using T7 and T3 primers andaligned using Sequencher (Gene Codes Corporation, AnnHarbor, MI, USA) to identify transcript redundancy. ABLASTX [2] search was performed with the single cDNAsequence obtained, and ORFinder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) was used to define and characterize thesequence. The unique cDNA sequence was named Pl_RGC-CC_1 and submitted to the GenBank database (accessionnumber DQ017061).

A rooted phylogenetic tree was generated with theneighbor-joining algorithm [67] using a subset of proteinsequences identified by BLASTX [2] and aligned byClustalW [71]. Sequences that were redundantly representedor highly divergent were not included in the tree. Thephylogenetic tree was constructed with 1,025 bootstrap rep-lications using the software MEGA3 [45]. The loblollyprotein, AAM28916 [60], was used as an outgroup.

Primer design and resequencing

Sense and antisense primers were designed from Pl_RGC-CC_1 using Generunner v. 3.05 (Hastings Software, Inc.)and Primer3 (http://www.genome.wi.mit.edu/cgi-bin/prim-er/primer3.cgi; Table 2. Several primer-pair combinationswere used for amplifying and sequencing Pl_RGC-CC_1(referred to as RGC-CC_1 in all genomic resequencing) inmegagametophytes from 26 sugar pine trees, three westernwhite pine trees, and 24 unrelated loblolly pine trees. PCRconditions were 0.3 μM for each primer, 200 μM eachdNTP, 1.5 mM MgCl2, 20 ng template DNA, and 1.0 U ofHotStart Taq polymerase (QIAGEN) in a 25-μl reaction.The cycling parameters consisted of a 15-min hot start at94°C, followed by 12 cycles of 94°C for 45 s, 62°C for 30 sminus 0.5°C/cycle, 72°C for 45 s; 30 cycles of 94°C for

77

45 s, 58°C for 30 s, 72°C for 45 s plus 0.03 s/cycle; and afinal extension of 72°C for 10 min. All sequencing wasperformed as described by Gill et al. [31].

Sequence alignments and nucleotidediversity analyses

The software Sequencher (Gene Codes) and the MultipleAlignment Consed Extensions (MACE) program (BillGilliland and Charles Langley, University of California,Davis) were used for DNA multiple sequence alignments.Amplicon sequences were aligned with the cDNA Pl_RGC-CC_1, then grouped and aligned within trees, between trees,and finally, between species. DnaSP v. 4.0 [66] was used todetermine nucleotide diversity estimates π and θ.

To determine if the single-nucleotide polymorphism(SNP) frequency detected in RGC-CC_1 was typical ofthe sugar pine genome, two genes that have been sequence-analyzed in other conifers were PCR-amplified and se-quenced in megagametophyte DNAs of 24 unrelated sugarpine trees. Primers and sequence data for aquaporin–MIPwere available from loblolly pine [32, 70], and primers andsequence data for 4-coumarate:CoA ligase (4CL) wereavailable from both loblolly pine ([18]; Ersoz, personalcommunication) and Douglas-fir [44]. PCR amplification ofeach of these genes in sugar pine megagametophyte DNAproduced a single product and a clean sequence read, in-dicating that only one locus per sample was isolated.Interspecific alignments resulted in 378 bp of 4CL and685 bp of aquaporin–MIP.

Results and discussion

Isolation of a CC–NBS–LRR resistancegene analog in sugar pine

A total of 43 PCR fragments were amplified by NBSdegenerate primers, excised from an agarose gel, ligated intovector, and sequence-analyzed. Three genomic sequences(7B3, 16B, and C6) were similar to R genes yet unique fromeach other. Genomic clone B2 shared a high sequenceidentity with clone C6. The remainder of the successfullyligated PCR products resulted in alignment with genesunrelated to disease resistance. All four genomic clones werelabeled and used in cDNA colony hybridization.

Ten cDNA plaques were detected by hybridization withthree of the four NBS genomic clones (7B3, B2, and C6;Table 1). Of the ten cDNA plaques isolated, four containedinserts that had high similarity to NBS–LRR gene sequencesin GenBank. These four cDNAs were identical in sequence.The resistance gene analog (RGA) sequence was given thedesignation Pl_RGC-CC_1 (DQ017061) and characterizedas 2,926 bp in length that translates into a protein of 777amino acids (Fig. 1). It contains a start codon at 55 bp and astop codon at 2,388 bp. The P-loop and GLPLALmotifs thatdelineate the NBS domain were located at 522 and 1,000 bp,respectively. A query with BLASTX [2] resulted in highidentity scores with a large number of plant NBS–LRR Rproteins (data not shown). The longest alignments were withCC–NBS–LRR subclass R proteins from Arabidopsisthaliana, many of which pathosystem function has notbeen assigned. The P. taeda protein (AAM28916, [60]),predicted from an expressed sequence tag (EST) derived

Table 2 Primers designed from Pl_RGC-CC_1 for resequencing pine megagametophytes

Primer name Sequence (sense strand) Position (bp) Paired with

KDJ_F2 GCGTGGAATTGCTGAAAAAGTG 62 BIF2 (as)BIF1 AGCGAGCTCTACTCCAGAG 464 DGF2 (as)BIF2 CCAGAATGTGGAGGAAGC 683 DGR2DGF2 TGGACGAGGAAGCACGAGAG 1,158 DGR6DGF4 TGGGAGCTGTTCAAGGATCAAG 1,494 DGR8DGF7 TGTTGTGATTTGGAGGAGTGCC 1,926 BIR2DGR2 CACACAGGGACAATGGAAGAGG 1,542 KDJ_F2DGR6 CTGCCTAAATCAGTGGAGGGC 2,223 DGF2DGR8 CGCACTTCAGCTTGGATTGGC 2,359 DGF4BIR2 GTGTATCTAGAGTCCTCATCG 2,558 DGF7KDJ_R1 TAAATGGGACTCCGGTTCTTGC 2,866 DGR8 (as)

Table 1 Degenerate primers from lettuce [68] used to amplify the NBS sequences from sugar pine genomic DNA

RGA clone P-loop domain (sense) GLPLAL domain (antisense)

7b3 AA (GGN GTN GGN AAA ACA AC) GLPLAL-6 (ANN GCC AAN GGC AAT CC)16b AG (GGN GTN GGN AAA ACG AC) GLPLAL-6 (ANN GCC AAN GGC AAT CC)B2 AA (GGN GTN GGN AAA ACA AC) GLPLAL-2 (AGN GCN AGN GGN AGA CC)C6 GA (GGN GTN GGN AAG ACA AC) GLPLAL-3 (AGN GCN AGN GGN AGT CC)

The NBS polymerase chain reaction (PCR) products were then used to probe a cDNA libraryNBS Nucleotide-binding site, RGA resistance gene analog

78

from xylem tissue (AW225937), had the closest relationship(Fig. 2), but the sequence consisted of the C-terminal of theNBS region (GLPLAL) and the LRR region only. Threealignments demonstrated consensus with Toll/interleukin-1receptor (TIR)–NBS–LRR subclass R proteins with thehighest similarity predominantly in the conserved NBS andLRR regions.

CC motifs were detected in the N-terminal region ofPl_RGC-CC_1 with the CC prediction software COILS[53]. These protein structures are thought to facilitateinteractions with other proteins within the cytoplasm, possi-bly initializing downstream signaling in the defense response[47]. Several Arabidopsis CC–NBS–LRR subclass R geneshave been shown to interact with proteins such as NPR1,NDR1, RAR1, SGT1, and RIN4 [1, 6, 9, 11, 52, 54].Pl_RGC-CC_1 has a high amino acid similarity (60%) toADR1 (Table 3; Figs. 1 and 2) which confers resistance toPeronospora parasitica (Noco2) and Erysiphe cichoracearuUED1, is salicylic-acid-dependent, and partially NPR1-dependent [34]. Salicylic acid is putatively associated withboth the establishment of systemic acquired resistance [30]and R protein-mediated resistance [25]. ADR1 was alsoexpressed upon wounding and in unchallenged systemictissue, again suggesting that it may function in theestablishment of systemic immunity [34]. Two ArabidopsisCC–NBS–LRR R proteins that have been studied exten-sively are RPS2 (NM_118742) and RPM1 (AAF27008.1)[7, 8, 11, 17, 54]. Pairwise alignments showed that eachRPS2 and RPM1 resulted in 45% amino acid similarity(Table 3). RPS2 and RPM1 are membrane-associated Rproteins that confer resistance to P. syringeae; RPS2responds specifically to pathogen effector avrRpt2, whileRPM1 mediates resistance to effectors avrRpm1, avrB, andavrRpt2 (reviewed in [54]). Recent studies have shown thatRPS2 interacts indirectly with the RIN4 protein, and thatRPM1 is regulated by direct physical interaction with the

RIN4 protein [11, 54]. Pairwise alignments of the coiled-coilregion (exclusively) showed that RPM1 andADR1had aminoacid similarity of 46% (data not shown) while ADR1 andPl_RGC-CC_1 had amino acid similarity of 43% (Table 3).The similarity between protein domains in Pl_RGG-CC_1and the domains in these CC subclass resistance genes inArabidopsis allows for speculation about the role of this RGAin sugar pine. Under this model, Pl_RGC-CC_1 may act as adownstream regulator of systemic acquired response inconifers to one or more pests (including browsers) and/ormay interact with or guard other host proteins.

Recently, a number of pine ESTs representing NBS–LRRR genes have been submitted to Genbank and have highnucleotide identity (e values=0, bit scores>900) withPl_RGC-CC_1. The ESTsequenceswith the highest identitywere from loblolly pine (DR093011, CO201882,DR069858, and CX715236). The EST CX715236 alignedwith the entire CC region and a short portion of the NBSregion (position 8–649) with 96.6% identity, while the othersaligned predominantly with the LRR region. A second EST(AL751000; P. pinaster) also aligned with the CC region(position 279–762) with 96.3% identity. R gene-like ESTsfrom Picea sitchensis (DR485806) and Picea glauca(CO243634 and CO227910) aligned with the NBS–LRRregion.

Sequence variation in RGC-CC_1 in sugar pine

A single PCR product was amplified from megagameto-phyte DNA from each of the primer pairs for Pl_RGC-CC_1, confirming that the primers were specific to thePl_RGC-CC_1 locus. Nucleotide sequences of overlappingamplicons (Table 2) revealed no variation in Pl_RGC-CC_1(genomic locus referred to as RGC-CC_1) among mega-gametophytes from two sugar pine trees, 5701 (n=24) and

Fig. 1 Sequence alignment of predicted protein of Pl_RGC-CC_1 and the ADR1 disease resistance protein from Arabidopsis

79

6000 (n=12). The only variation detected was a 211-bpdeletion in the 3′ noncoding region (position 2,428) in tree5701 relative to tree 6000 (Fig. 3). The cDNA, which wasderived from tree 5701, also contained this deletion.

The total absence of SNPs in RGC-CC_1 for trees 5701and 6000 was an unexpected result that prompted us toinvestigate nucleotide diversity in a larger sample ofunrelated sugar pine trees. The coding region in the sampleof 24 trees was completely monomorphic; however, threeSNPs were detected in the 3′ noncoding region (Table 4;Fig. 3). Among the 24 trees, only four haplotypes wereobserved, including a common haplotype that was identicalto the sequence found in trees 5701 and 6000. No intronswere detected, and none of the sequences from the 24 treeshad the 211-bp deletion characteristic of tree 5701. In fact,the 211-bp indel was monomorphic in all sugar pine treesexcept for a shared SNP detected in two trees from seedzones 522 and 531. The absence of introns is reportedly acharacteristic of the majority of CC–NBS–LRR proteins inArabidopsis [61].

Typically, nucleotide polymorphisms are found in theleucine-rich repeat (LRR) region of R genes and have been

shown to be responsible for pathogen specificity (reviewedin [28]); therefore, it was surprising that no variation wasfound in this region of RGC-CC_1 in any of the samplestested. It may be possible that the variation responsible forresistance (vs susceptibility) resides, not in the RGC-CC_1gene itself, but in other host proteins that interact withRGC-CC_1. The growing body of evidence that R proteinsact synergistically with other host proteins has spawned anexpanding collection of pathosystem models that allow formore complexity than that afforded by the classic gene-for-gene model [16, 29, 55, 58, 69]. A contemporary model isthe ‘guard hypothesis’ in which an R protein is proposed toguard host virulence molecules that are targeted by one ormore pathogens [24, 37, 38, 54, 73]. RPM1 and RPS2 havebeen shown to monitor the activity of host protein RIN4and become activated when this protein becomes phos-phorylated by pathogen effectors [11, 55]. RPM1 is knownto mediate resistance to multiple type III effectors fromP. syringae [11]. In tomato, a serine–threonine kinase,Pto, is targeted by multiple type III secretion effectorsfrom P. syringae (AvrPto and AvrPtoB). The interactionbetween Pto and either one of the pathogen effectors

AAM28916 P.taeda

Pl RGC-CC 1

Q9FW44 ADR1 At

NP 195056 CC At

NP 176572 TIR At

AAG09951 LM6 G.max

A54810 N Nicotiana

NP 176171 CC At

T52429 PRM1 At

AAP80287 Sorb5 At

BAD05330 MLA O.sativa

BAC55682 RPR1 O.sativa

AC016827 RPM1 At

NP 172692 CC At

NP 176314 CC At

NM 118742 RSP2 At

NP 194452 At

NP 201492 CC At

AAN62760 MsR1 M.sativa

100

100

100

59

99

90

57

80

100

100

100

97

99

100

55

78

0.1

Fig. 2 Neighbor-joining phylo-genetic tree showing relation-ship between NBS–LRRproteins from conifer and an-giosperm plant species. Integersat the branch nodes representbootstrap values (%) based on1,025 replications

Table 3 Percent similarity ascertained from pairwise global alignment using ClustalW

Pl_RGC-CC_1 ADR1 RPS2 RPM1

Pl_RGC-CC_1 - 60 (43) 45 (39) 45 (37)

Percent similarity of coiled-coil (CC) region only is shown in parentheses

80

activates the NBS–LRR subclass R guard protein, Prf,thereby inducing an HR [64]. Prf is also required for theactivity of fen, a Pto-like gene that mediates a hyper-sensitive-like response to the insecticide fenthion [15].

Thus, host proteins not only can (RIN4) have multiple Rprotein guards (RPS2 and RPM1), host target proteins(Pto, RIN4) can also interact with multiple pathogeneffectors. The strongest support for the guard model

Fig. 3 Characterization of theprotein predicted by Pl_RGC-CC_1. A start codon is locatedat position 55 and a stop codonat position 2,388. Gray-shadedareas represent the noncodingregions. Blue-shaded arearepresents the region of RGC-CC_1 that was sequenced ana-lyzed in each of the sample sets,and red vertical lines representSNPs that were detected. Onlysugar pine tree 5701 contained a211-bp deletion at position2,428. See Table 4 for numberof megagametophytes sampled

Table 4 Sample source, number of megagametophytes sampled, region of RGC-CC_1 sequenced, and nucleotide diversity estimates

Sample HRphenotype

No. ofmegagametophytes

Region sequence-analyzed(nt position)

No. ofSNPs

No. ofhaplotypes

SNPfrequencya

πb θwb

Sugar pineTree 5701 Rr 24 42–2,796 0 2 – – –Tree 6000 Rr 12 42–2,796c 0 2 – – –24 Unrelatedtrees

N/Ad 1 42–2,796c 3b 4 – – –

All trees(mean)

– – – – 8 1/923 0.00047 0.00129

Western white pineTree 714 Rr 12 42–2,796c 5b 2 – – –Tree 717 Rr 12 2,409–2,796c 30 2 – – –Tree 721 Rr 12 2,409–2,796c 29 2 – – –All trees(mean)

– – – – 6 1/92 0.02747 0.02406

HR Hypersensitive response, SNP single-nucleotide polymorphismaBased on entire gene sequencebSNPs were located in the 3′ noncoding region (2,409–2,796)cPlus 211 nucleotides in insertiondNot available

81

comes from studies for single-copy R genes that evolveconservatively and that have multiple specificity, allow-ing interaction with more than one host virulence target[57].

The expression of RGC-CC_1 may be regulated bytranscription factors [26, 65] or cis-regulatory elements [3,51]. Indels in the upstream promoter of a monomorphic Rgene were responsible for differential allele expressionleading to the susceptibility or resistance to bacterial blightin rice [35]. Since Pl-RGC-CC_1 was isolated from acDNA library made from seedlings resistant to C. ribicola,evaluation of Pl_RGC-CC_1 transcripts in susceptibleseedlings is warranted to test the hypothesis of differentialregulatory control.

Nucleotide diversity of RGC-CC_1 in sugar pine

In conifers from the family Pinaceae, the number of SNPsdetected in genome-wide analyses averages one per every53 bp (1/53), and the nucleotide diversity estimates, π andθw, averaged across several studies [18, 32, 44], are 0.00529and 0.00537, respectively The mean nucleotide diversityestimates, π and θw, for RGC-CC_1 for all sugar pine trees(26) were 0.00009 and 0.00026, respectively. These valuessuggest that RGC-CC_1 is up to 58 times less variable thanwhat has been reported, on average, in conifers. Brown et al.[18] reported a highly conserved phenylpropanoid pathwaygene, coumarate 3-hydroxylase (c3h; 2,268 nt), withcomparable π and θw estimates (0.00027 and 0.00068,respectively), and González-Martinez et al. [32] reportedsimilar nucleotide diversity estimates for 635 nt of a stress-related protein phosphatase gene (pp2c). NonsynonymousSNPs were detected in c3h, whereas only silent SNPs weredetected in pp2c. The absence of synonymous SNPs in thecoding region of RGC-CC_1 in our sample of 26 sugar pinetrees is noteworthy and may be the result of regionalselective constraints, such as a selective sweep [14, 23, 49]or a recombination ‘cold spot’ [4].

R genes are commonly reported to be under balancingselection, where several to many alleles are maintained ina population in response to pathogen selection pressure[20, 73] and where the diversity and dynamics of host andpathogen populations make it unlikely that a single R genewould be driven to fixation [62]. Considering this as-sertion, it is unlikely that RGC-CC_1 is involved in directpathogen recognition. Single-copy R genes that evolveconservatively are likely candidates for guarding Rproteins that generally maintain a low number of allelesin the population [5, 56, 57]. Based on this hypothesis,RGC-CC_1 fits the model of a guarding R gene that hasbeen driven to fixation. Its high similarity to ADR1, whichconfers resistance to multiple pathogens, suggests that itmay guard multiple host proteins. Additionally, or alter-natively, RGC-CC_1 may be involved in a salicylic-acid-dependent basal defense response [34]. These conjecturesabout RGC-CC_1 may be useful for directing futureresearch for determining the role of this full-length RGA ina conifer genome for which little is known.

Nucleotide diversity of RGC-CC_1 in westernwhite pine

Loblolly pine belongs to the subgenus Pinus and was initiallyselected for comparing outgroup sequences of the RGC-CC_1 ortholog because a large body of sequence data from arange-wide sample of unrelated trees was available. Howev-er, most of the primer pairs failed to amplify a single PCRproduct for sequencing. Only a fragment from the 3′noncoding region was successfully amplified and sequenced;however, alignments were spurious due to a large number ofindels and mismatches. This result caused us to abandon thisoutgroup sequence comparison because an orthologousrelationship between the two sequences could not beestablished. Subsequently, three trees of western white pine,which belongs to the same subgenus as sugar pine, were usedfor outgroup sequence comparisons of RGC-CC_1. Eachprimer-pair combination that was used in sugar pine (Table 2)successfully amplified the single PCR product conducive tosequence analyses. The entire length of RGC-CC_1 wassequenced in megagametophytes of tree 714; five SNPs weredetected in the 3′ noncoding region (Table 4; Fig. 3). As insugar pine, the short segment of 5′ noncoding sequence (42–55 bp) and the coding region (55–2,388 bp) was devoid ofpolymorphism (π and θ=0). A fragment (2,409–2,796 bp) ofthe 3′ noncoding region of trees 717 and 721 was alsosequenced, in which 30 and 29 SNPs were detected,respectively, many of which were located within the 211-bpindel (Table 4; Fig. 3). Trees 717 and 721 shared numerousSNPs (25) with each other but none with tree 714 or withsugar pine. Each tree contained two haplotypes with noevidence of recombination or introns. There was no apparentassociation between the genotype of the megagametophyteand the disease phenotype of the corresponding seedling.

Since all variation was located in the 3′ region of the gene,nucleotide diversity estimates for this region were calculatedand compared among sugar pine and western white pine(Table 4). Nucleotide diversity estimates were much greaterfor western white pine than for sugar pine, with π being 50times greater for western white pine (Table 4).

Nucleotide diversity in the sugar pine genome

Conifers in North America have undergone extensivemigration and occupied continental southern refugia duringglaciation. The possibility of a genetic bottleneck has beenexplored in a number of species. Range-wide populationstudies with allozymes and molecular markers have shownthat, in general, conifers are highly heterozygous [36].Although no such study has been reported in sugar pine, arecent study in western white pine confirms that geneticdiversity has been maintained despite mortality fromWPBRand extensive artificial selection through tree-breedingprograms [39]. To our knowledge, no genetic diversitystudies in sugar pine have been reported. To investigate if theobserved low nucleotide diversity in RGC-CC_1 in sugarpine is extraordinary, we sequence-analyzed two functionalgenes in sugar pine for which sequence data were available

82

from other conifer species. Aquaporin–MIP sequences fromloblolly pine and 4-coumarate-ligase (4CL) sequences fromeach loblolly pine andDouglas-fir were compared with thoseof sugar pine. The frequency of SNPs in the aquaporin–MIPsequences (685 bp) derived from sugar pine was identical tothat found in loblolly pine (1/171 nt), and the SNP frequencyfor 4CL (378 bp) in sugar pine was half (1/189) that foundfor loblolly pine (1/95 nt) and Douglas-fir (1/76 nt). The θwestimates for sugar pine and loblolly pine for aquaporin–MIPwere 0.00170 and 0.00166, respectively. The θw estimatesfor sugar pine, loblolly pine, and Douglas-fir for 4CL were0.00156, 0.00414, and 0.00325, respectively. Thus, thenucleotide diversity found in sugar pine at these two loci iscomparable to that found for the same loci in other conifers.In summary, these preliminary nucleotide sequence dataimply that the low genetic diversity observed in RGC-CC_1is not genome-wide but unique to this locus.

Conclusion

In conclusion, we have isolated a 2.9-kb CC–NBS–LRRsubclass RGA in sugar pine that has high nucleotidesequence identity with R gene-like EST sequences fromloblolly pine, maritime pine, and two Picea species, and forwhich function is unknown. Its strong similarity to thepeptide sequence ADR1 from Arabidopsis and its highlyconserved nucleotide sequence suggests that it may functionas a guarding R protein that monitors and interacts with otherhost proteins having affinity for invasive pathogen effectors.A second possibility is that Pl_RGC-CC_1 is a late path-ogen-related gene responsible for systemic acquired resis-tance and induced upon salicylic acid accumulation. Thecoding region of RGC-CC_1 is completely conserved inoutgroup sequence comparisons of western white pine;however, nucleotide diversity in the 3′ noncoding region wasfound to be much higher than that found in sugar pine. Acurrent or recent selective sweep provides a plausibleexplanation for the absence of synonymous SNPs in thecoding region, but further testing on larger samples of bothspecies at various ages is needed to ascertain the extent ofnucleotide and haplotype diversity at this locus.

Acknowledgements Many thanks to Blake Meyers, DelawareBiotechnology Institute, and John Davis, University of Florida, forreview of this manuscript.

References

1. Aarts J, Metz M, Holub E, Staskawicz BJ, Daniels MJ (1998)Different requirements for EDS1 and NDR1 by disease resistancegenes define at least two R gene-mediated signaling pathways inArabidopsis. Proc Natl Acad Sci U S A 95:10306–10311

2. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990)Basic local alignment search tool. J Mol Biol 215:403–410

3. Ancillo G, Hoegen E, Kombrink E (2003) The promoter of thepotato chitinase C gene directs expression to epidermal cells.Planta 217:566–576

4. Arguade M, Miyashita N, Langley CH (1989) Reducedvariation in the yellow-achaet-scute region in natural popula-tions of Drosphila melanogaster. Genetics 122:607–615

5. Ashfield T, Ong LE, Nobuta K, Schneider M, Innes RW (2004)Convergent evolution of disease resistance gene specificity intwo flowering plant families. Plant Cell 16:309–318

6. Austin MJ, Muskett P, Kahn K, Feys BJ, Jones JDG, Parker JE(2002) Regulatory role of SGT1 in early R gene-mediated plantdefenses. Science 295:2077–2080

7. Axtell MJ, Staskawicz BJ (2003) Initiation of RPS2-specifieddisease resistance in Arabidopsis is coupled to the avrRpt2-directed elimination of RIN4. Cell 112:369–377

8. Axtell MJ, McNellis TW, Mudgett MB, Hsu CS (2001)Mutational analysis of the Arabidopsis RPS2 disease resistancegene and the corresponding Pseudomonas syringae avrRpt2avirulence gene. Mol Plant Microbe Interact 14:181–188

9. Azevedo C, Sadanandom A, Kitagawa K, Freialdenhoven A,Shirasu K, Schulze-Lefert P (2002) The RAR1 interactorSGT1, an essential component of R gene-triggered diseaseresistance. Science 295:2073–2076

10. Baumgarten A, Cannon S, Spangler R, May G (2003) Genome-level evolution of resistance genes in Arabidopsis thaliana.Genetics 165:309–319

11. Belkhadir Y, Nimchuk Z, Hubert DA, Mackey D, Dangl JL(2004) Arabidopsis RIN4 negatively regulates disease resis-tance mediated by RPS2 and RPM1 downstream or indepen-dent of the NDR1 signal modulator and is not required for thevirulence functions bacterial type III effectors AvrRpt2 orAvrRpm1. Plant Cell 16:2822–2835

12. Bent AF (1996) Plant resistant genes: function meets structure.Plant Cell 8:1757–1771

13. Bent AF, Kundel BN, Dahlbeck D, Brown KL, Schmidt R,Giraudat J, Leung J, Staskawicz BJ (1994) RPS2 ofArabidopsis thaliana: a leucine-rich repeat class of plantdisease resistance genes. Science 265:1856–1859

14. Bergelson J, Kreitman M, Stahl EA, Tian D (2001) Evolu-tionary dynamics of plant R-genes. Science 292:2281–2285

15. Bogdanove A (2002) Pto update: recent progress on ancientplant defence response signaling pathway. Mol Plant Pathol3:282–288

16. Bonas U, Lahaye T (2002) Plant disease resistance triggered bypathogen-derived molecules: refined models of specific recog-nition. Curr Opin Microbiol 5:44–50

17. Boyes DC, Nam J, Dangl JL (1998) The Arabidopsis thalianaRPM1 disease resistance gene product is a peripheral plasmamembrane protein that is degraded coincident with thehypersensitive response. Proc Natl Acad Sci U S A95:15849–15854

18. Brown GR, Gill GP, Kuntz RJ, Langley CH, Neale DB (2004)Nucleotide diversity and linkage disequilibrium in loblollypine. Proc Natl Acad Sci U S A 101:15255–15260

19. Buck JM, Adams RS, Cone J, Conkle MT, Libby WJ, Eden CJ,Knight MJ (1970) California tree seed zones. USDA ForestService, San Francisco

20. Caicedo AL, Schaal BA (2004) Heterogeneous evolutionaryprocesses affect R gene diversity in natural populations ofSolanum pimpinellifolium. Proc Natl Acad Sci U S A101:17444–17449

21. Canton FR, Le Provost G, Garcia V, Barre A, Frigerio J-M,Paiva J, Fevereiro P, Avila C, Mouret J-F, Brach J, de DaruvarA, Canovas FM, Plomion C (2004) Transcriptome analysis ofwood formation in maritime pine. In: Sustainable forestry,wood products and biotechnology. BIOFOR proceeding.pp 333–347

22. Chang S, Puryear J, Cairney J (1993) A simple and efficientmethod for isolating RNA from pine trees. Plant Mol BiolReport 11:113–116

23. Charlesworth B (1994) The effect of background selectionagainst deleterious mutation on weakly selected, linkedvariants. Genet Res 63:213–227

83

24. Dangl JL, Jones JDG (2001) Plant pathogens and integrateddefence responses to infection. Nature 411:826–833

25. Delaney TP, Freidrich L, Ryals JA (1995) Arabidopsis signaltransduction mutant defective in chemically and biologicallyinduced disease resistance. Proc Natl Acad Sci U S A 92:6602–6606

26. Desveaux D, Subramaniam R, Després C, Mess J-N, LévesqueC, Fobert PR, Dangl JL, Brisson N (2004) A “Whirly”transcription factor is required for salicylic acid-dependentdisease resistance in Arabidopsis. Dev Cell 6:229–240

27. Devey ME, Delfino-Mix A, Kinloch BB Jr, Neale DB (1995)Random amplified polymorphic DNA markers tightly linked toa gene for resistance to white pine blister rust in sugar pine.Proc Natl Acad Sci U S A 92:2066–2070

28. Ellis J, Dodds P, Pryor T (2000) The generation of plant diseaseresistance gene specificities. Trends Plant Sci 5:373–379

29. Flor HH (1971) Current status of the gene-for-gene concept.Annu Rev Phytopathol 9:275–296

30. Gaffney T, Friedrich L, Vernooij B, Negrotto D, Nye G, UknesS, Ward E, Kessmann H, Ryals J (1993) Requirement ofsalicylic acid for the induction of systemic acquired resistance.Science 261:754–756

31. Gill GP, Brown GR, Neale DB (2003) A sequence mutation inthe cinnamyl alcohol dehydrogenase gene associated with alteredlignification in loblolly pine. Plant Biotechnol J 1:253–258

32. González-Martinez SC, Ersoz ES, Brown GR, Wheeler NC,Neale DB (2005) Candidate genes for drought-stress responsein Pinus taeda L.: DNA sequence variation and naturalselection. Genetics DOI 10.1534/genetics.105.047126

33. Graham MA, Marek LF, Shoemaker RC (2002) Organization,expression and evolution of a disease resistance cluster insoybean. Genetics 162:1961–1977

34. Grant JJ, Chini A, Basu D, Loake GJ (2003) Targetedactivation tagging of the Arabidopsis NBS–LRR gene,ADR1, conveys resistance to virulent pathogens. Mol PlantMicrobe Interact 16:669–680

35. Gu K, Yang B, Tian D, Wu L, Wang D, Sreekala C, Yang F,Chu Z, Wang G-L, White FF, Yin Z (2005) R gene expressioninduced by a type-III effector triggers disease resistance in rice.Nature 435:1122–1125

36. Hamrick JL, Godt MJW, Sherman-Broyles SL (1992) Factorsinfluencing levels of genetic diversity in woody plant species.New For 6:95–124

37. Holt BF III, Hubert DA, Dangl JL (2003) Resistance genesignaling in plants—complex similarities to animal innateimmunity. Curr Opin Immunol 15:20–25

38. Innes RW (2004) Guarding the goods. New insights into thecentral alarm system of plants. Plant Physiol 135:695–701

39. Kim M-S, Brunsfield SJ, McDonald GI, Klopfenstein NB (2003)Effect of white pine blister rust (Cronartium ribicola) and rust-resistance breeding on genetic variation in western white pine(Pinus monticola). Theor Appl Genet 106:1004–1010

40. Kinloch BB Jr (1992) Distribution and frequency of a gene forresistance to white pine blister rust in natural populations ofsugar pine. Can J Bot 70:1319–1323

41. Kinloch BB Jr, Dupper GE (2002) Genetic specificity in thewhite pine-blister rust pathosystem. Phytopathology 92:278–280

42. Kinloch BB Jr, Littlefield L (1977) White pine blister rust:hypersensitive resistance in sugar pine. Can J Bot 55:1148–1155

43. Kinloch BB Jr, Sniezko RA, Barnes GD, Greathouse TE (1999)A major gene for resistance to white pine blister rust in westernwhite pine from the Western cascade range. Phytopathology89:861–867

44. Krutovsky KV, Neale DB (2005) Nucleotide diversity andlinkage disequilibrium in cold hardiness and wood qualityrelated candidate gene in Douglas-fir. Genetics 171:2029–2041

45. Kumar S, Tamura K, Nei M (2004) MEGA3: integratedsoftware for molecular evolutionary genetics analysis andsequence alignment. Brief Bioinform 5:150–163

46. Lawrence GJ, Finnegan EJ, Ayliffe MA, Ellis JG (1995) The L6gene for flax rust resistance is related to the Arabidopsisbacterial resistance gene RPS2 and the tobacco viral resistancegene N. Plant Cell 7:1195–1206

47. Lehmann P (2002) Structure and evolution of plant diseaseresistance genes. J Appl Genet 43:403–414

48. Leister D, Ballvora A, Salamini F, Gebhardt C (1996) A PCR-based approach for isolating pathogen resistance genes frompotato with potential for wide application in plants. Nat Genet14:421–429

49. Lercher MJ, Hurst LD (2002) Human SNP variability andmutation rate are higher in regions of high recombination.Trends Genet 18:337–340

50. Liu J-J, Ekramoddoullah AKM (2003a) Isolation, geneticvariation and expression of TIR–NBS–LRR resistance geneanalogs from western white pine (Pinus monticola Dougl. Ex.D. Don.). Mol Genet Genomics 270:432–441

51. Liu J-J, Ekramoddoullah AKM (2003b) Root-specific expres-sion of a western white pine PR10 gene is mediated by differentpromoter regions in transgenic tobacco. Plant Mol Biol 52:103–120

52. Lorrain S, Vailleau F, Balagúe C, Roby D (2003) Lesion mimicmutants: keys for deciphering cell death and defense pathwaysin plants? Trends Plant Sci 6:263–271

53. Lupas A, Van Dyke M, Stock J (1991) Predicting coiled coilsfrom protein sequences. Science 252:1162–1164

54. Mackey D, Belkhadir Y, Alonso JM, Ecker JR, Dangle JL(2003) Arabidopsis RIN4 is a target of the type III virulenceeffector avrRpt2 and modulates RPS2-mediated resistance. Cell112:379–389

55. Marathe R, Dinesh-Kumar SP (2005) Plant defense: on post,multiple guards?! Mol Cell 11:282–286

56. Maurico R, Stahl EA, Korves T, Tian D, Kreitman M,Bergelson J (2003) Natural selection for polymorphism in thedisease resistance gene Rps2 of Arabidopsis thaliana. Genetics163:735–746

57. McDowell JM (2004) Convergent evolution of disease resis-tance genes. Trends Plant Sci 9:315–317

58. McDowell JM, Woffenden BJ (2003) Plant disease genes:recent insights and potential applications. Trends Biotechnol21:178–183

59. Meyers BC, Dickerman AW, Michelmore RW, SivaramakrishnanS, Sobral BW, Young ND (1999) Plant disease resistance genesencode members of an ancient and diverse protein family withinthe nucleotide-binding superfamily. Plant J 20:317–332

60. Meyers BC, Morgante M, Michelmore RW (2002) TIR-X andTIR–NBS proteins: two new families related to diseaseresistance TIR–NBS–LRR proteins encoded in Arabidopsisand other plant genomes. Plant J 32:77–92

61. Meyers BC, Kozik A, Griego A, Kuang H, Michelmore RW(2003) Genome-wide analysis of NBS–LRR-encoding genes inArabidopsis. Plant Cell 15:809–834

62. Meyers BC, Kaushik S, Nandety RS (2005) Evolving diseaseresistance genes. Curr Opin Plant Biol 8:129–134

63. Nobuta K, Ashfield T, Kim S, Innes RW (2005) Diversificationof non-TIR class NB–LRR genes in relation to whole-genomeduplication events in Arabidopsis. Mol Plant Microbe Interact18:103–109

64. Pedley KF, Martin GB (2003) Molecular basis of PTO-mediated resistance to bacterial speck disease in tomato.Annu Rev Phytopathol 41:215–143

65. Pontier D, Balagué C, Bezombes-Marion I, Tronchet M,Deslandes L, Roby D (2001) Identification of a novelpathogen-responsive element in the promoter of the tobaccogene HSR203J, a molecular marker of the hypersensitiveresponse. Plant J 26:495–507

66. Rozas J, Sánchez-DelBarrio JC, Messeguer X, Rozas R (2003)DnaSP, DNA polymorphism analyses by the coalescent andother methods. Bioinformatics 19:2496–2497

84

67. Saitou N, Nei M (1987) The neighbor-joining method: a newmethod for reconstructing phylogenetic trees. Mol Biol Evol4:406–425

68. Shen KA, Meyers BC, Islam-Faridi MN, Chin DB, Stelly DM,Michelmore RW (1998) Resistance gene candidates identifiedby PCR with degenerate oligonucleotide primers map toclusters of resistance genes in lettuce. Mol Plant MicrobInteract 11:815–823

69. Shirasu K, Schulze-Lefert P (2003) Complex formation,promiscuity and multi-functionality: protein interaction indisease-resistance pathways. Trends Plant Sci 8:252–258

70. Temesgen G, Brown GR, Harry DE, Kinlaw CS, Sewell MM,Neale DB (2001) Genetic mapping of expressed sequence tagpolymorphism (ESTP) markers in loblolly pine (Pinus taedaL.). Theor Appl Genet 102:644–675

71. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW:improving the sensitivity of progressive multiple sequencealignment through sequence weighting, positions-specific gappenalties and weight matrix choice. Nucleic Acids Res22:4673–4680

72. Ujino-Ihara T, Yoshimura K, Ugawa Y, Yoshimaru H,Nagasaka K, Tsumura Y (2000) Expression analysis of ESTsderived from the inner bark of Cryptomeria japonica. PlantMol Biol 43:451–457

73. Van der Hoorn R, De Wit P, Joosten M (2002) Balancing selectionfavors guarding resistance protein. Trends Plant Sci 7:67–71

74. Whitham S, Dinesh-Kumar SP, Choi D, Hehl R, Corr D, BakerB (1994) The product of the tobacco mosaic virus resistancegene N: similarity to Toll and the interleukin-1 receptor. Cell78:1101–1115

85