Investigating the Link Between Imipenem Resistance and Biofilm Formation by Pseudomonas aeruginosa

ENVIRONMENTAL MICROBIOLOGY

Investigating the Link Between Imipenem Resistanceand Biofilm Formation by Pseudomonas aeruginosa

Hadeel K. Musafer & Sherry L. Kuchma &

Amanda A. Naimie & Joseph D. Schwartzman &

Harith J. Fahad AL-Mathkhury & George A. O’Toole

Received: 7 June 2013 /Accepted: 23 December 2013# Springer Science+Business Media New York 2014

Abstract Pseudomonas aeruginosa, a ubiquitous environ-mental organism, is a difficult-to-treat opportunistic pathogendue to its broad-spectrum antibiotic resistance and its ability toform biofilms. In this study, we investigate the link betweenresistance to a clinically important antibiotic, imipenem, andbiofilm formation. First, we observed that the laboratory strainP. aeruginosa PAO1 carrying a mutation in the oprD gene,which confers resistance to imipenem, showed a modest reduc-tion in biofilm formation. We also observed an inverse relation-ship between imipenem resistance and biofilm formation forimipenem-resistant strains selected in vitro, as well as for clinicalisolates.We identified two clinical isolates ofP. aeruginosa fromthe sputum of cystic fibrosis patients that formed robustbiofilms, but were sensitive to imipenem (MIC≤2 μg/ml). Totest the hypothesis that there is a general link between imipenemresistance and biofilm formation, we performed transposonmutagenesis of these two clinical strains to identify mutantsdefective in biofilm formation, and then tested these mutantsfor imipenem resistance. Analysis of the transposon mutantsrevealed a role for previously described biofilm factors in theseclinical isolates of P. aeruginosa, including mutations in the

pilY1, pilX, pilW, algC, and pslI genes, but none of the biofilm-deficient mutants became imipenem resistant (MIC≥8 μg/ml),arguing against a general link between biofilm formation andresistance to imipenem. Thus, assessing biofilm formation ca-pabilities of environmental isolates is unlikely to serve as a goodpredictor of imipenem resistance. We also discuss our findingsin light of the limited literature addressing planktonic antibioticresistance factors that impact biofilm formation.

Introduction

Pseudomonas aeruginosa is an important opportunistic humanpathogen that can cause life-threatening infections, especially inpatients with cystic fibrosis (CF) and individuals with a compro-mised immune system. This environmental bacterium is able tosurvive both in free-swimming planktonic form and in surface-associated communities known as biofilms. P. aeruginosabiofilms can form on both biotic and abiotic surfaces in a widerange of environments, thus likely contributing to this microbe’sability to cause disease in clinical settings [1, 2].

Although there are several antimicrobial agents that continueto be effective against P. aeruginosa (i.e., carbapenems, cefe-pime, ceftazidime, tobramycin, and amikacin), in the last fewyears this bacterium’s increasing resistance to antibiotics hasbeen reported [3, 4]. For example, carbapenems, particularlyimipenem, are a suitable alternative for treating multidrug-resistant P. aeruginosa, yet the emergence and spread ofcarbapenem-resistant strains have compromised the effective-ness of therapeutic and control efforts using this antibiotic [5].

The OprD porin of P. aeruginosa facilitates the uptakeacross the outer membrane of basic amino acids, small pep-tides that contain these amino acids, and their structural ana-logue, the antibiotic imipenem. Indeed, prolonged treatmentof patients with P. aeruginosa infections with this antibioticleads to imipenem-resistant mutants that lack OprD due to an

H. K. Musafer :H. J. F. AL-MathkhuryDepartment of Biology, College of Science, University of Baghdad,Baghdad, Iraq

J. D. SchwartzmanDepartment of Pathology, Dartmouth-Hitchcock Medical Center,Lebanon, NH 03756, USA

H. K. Musafer : S. L. Kuchma :A. A. Naimie :G. A. O’TooleDepartment of Microbiology and Immunology, Geisel School ofMedicine at Dartmouth, Hanover, NH 03755, USA

G. A. O’Toole (*)Department of Microbiology and Immunology, Geisel School ofMedicine at Dartmouth, Rm 202 Remsen Building, Hanover,NH 03755, USAe-mail: [email protected]

Microb EcolDOI 10.1007/s00248-013-0361-6

oprD gene mutation [6], including disruption of the oprDstructural gene by insertion of large IS elements [7–10], mis-sense mutations or insertions [11], deletions creating frameshifts [12], or premature stop codons [12, 13]. Inactivatingmutations in the oprD gene have been documented to conferresistance to imipenem, and to a lesser extent to meropenemand doripenem [14, 15]. Alternatively, the pathway to OprD-mediated resistance can involve mechanisms that decrease thetranscriptional expression of the oprD gene. For example,reduced OprD levels can be caused by a mutation in the geneencoding mexT, which encodes a LysR-family transcriptionalregulator. Loss of MexT function results in reduced oprDexpression and upregulation of the operon encoding theMexEF-OprN multidrug efflux pump [16, 17], thus contrib-uting to imipenem resistance.

By analyzing laboratory strains and clinical isolates ofP. aeruginosa, we noticed a link between increased OprD-mediated imipenem resistance and reduced biofilm formation.Based on this observation, we hypothesized that loss of biofilmformation might be generally linked to increased imipenemresistance, and to test this idea, we identified and characterizedbiofilm-deficient variants of two different clinical isolates. Ourstudies, while identifying well-conserved biofilm-promoting fac-tors, do not support the hypothesis that loss of biofilm formationin general spurs increased resistance to imipenem. We discussour findings in light of the limited literature addressing plankton-ic antibiotic resistance factors that impact biofilm formation.

Materials and Methods

Strains and Media

The strains, plasmids, and primers used in this study are listedin Table 1. All strains were routinely cultured on lysogenybroth (LB) medium, which was solidified with 1.5 % agarwhen necessary, and supplemented with antibiotics as indicat-ed. Gentamicin (Gm) was used from 25 to 50 μg/ml forP. aeruginosa and at 10 μg/ml for Escherichia coli.Carbenicillin (Cb) was used at 50 μg/ml for P. aeruginosaand 10 μg/ml for E. coli. Nalidixic acid (NA) was used at20 μg/ml for E. coli. For all phenotypic assays, M63 minimalsalts medium was supplemented with MgSO4 (1 mM), glu-cose (0.2 %), and casamino acids (CAA; 0.5 %). Arabinosewas added to cultures at a final concentration of 0.05 % forstrains carrying expression plasmids harboring the pBADpromoter. Saccharomyces cerevisiae strain InvSc1(Invitrogen), used for plasmid construction via in vivo ho-mologous recombination, was grown with yeast extract-peptone-dextrose (1 % Bacto yeast extract, 2 % Bactopeptone, and 2 % dextrose) [18]. Selections with InvSc1were performed using synthetic defined agar-uracil (catalogno. 4813-065; Qbiogene).

Determination of Imipenem Minimal InhibitoryConcentration

The Etest method was used for minimal inhibitory concentra-tion (MIC) determination according to the manufactures in-structions. In brief, bacterial suspensions were prepared fromfresh colonies, the concentration adjusted to 0.5 McFarlandturbidity, each isolate was uniformly spread on the surface of aMueller Hinton agar (MHA) plate, and an imipenem Eteststrip (from 0.002 to 32μg/mL; bioMérieux, France) placed onthe surface of agar plate. After overnight incubation at 37 °C,MIC was determined and categorized as sensitive (≤2 μg/ml),intermediate (4 μg/ml) or resistant (≥8 μg/ml) according toClinical and Laboratory Standards Institute (CLSI) guidelines[19]. In select cases, we also determined the MIC by amicrodilution assay in microtiter plates to confirm the Etestfindings [20, 21]. Escherichia coli ATCC 25922 andP. aeruginosa ATCC 27853 were used as quality controlstrains for Etest and microdilution assay, respectively.

Mariner Transposon Mutagenesis of Clinical Strains

The strain E. coliS17-1λpir carrying the pBT20 plasmid servedas the donor and the P. aeruginosa clinical isolates (SMC576and SMC 214) as recipient strains for conjugations. Fromovernight LB-grown cultures (with the appropriate antibiotic),1 ml of donor and 1 ml of recipient was centrifuged to pellet thecells. Cell pellets were washed twice with LB and resuspendedin 100 μl of fresh LB. The cell suspensions of each strain werethen mixed, 60 μl of the mixture was plated to two LB platesand the conjugation was allowed to proceed for 1 h at 30 °C.Each conjugation mix was harvested, resuspended in 100 μl ofLB, and then plated on LB agar plates containing Gm to selectfor the transposon-carrying P. aeruginosa strains, as well as NAto select against growth of the E. coli donor. Libraries ofmutants were generated by inoculating individual coloniesinto 96-well plates containing 100 μl LB medium supple-mented with Gm, and the plates incubated overnight at37 °C to allow outgrowth of the candidate mutants.

Mutant strains were screened for biofilm formation defectsby inoculating fresh 96-well microtiter plates containing M63minimal medium supplemented with MgSO4, glucose, andcasamino acids, as reported [22]. The inoculum (2–3 μl) wastransferred from the library plate containing LB-grown candi-date mutants to the screening plates using a 48-pin multiprongdevice. The clinical isolates (SMC576 or SMC214) were usedas controls in each microtiter plate, respectively. After inocu-lation, the screening plates were incubated at 37 °C for 16 h,and biofilm formation assessed by the crystal violet assay, asreported [22]. We screened ∼1,500 Mariner transposon mu-tants for each clinical isolate background. The mutations weremapped by determining the DNA sequences flanking thetransposon insertions using an arbitrary-primed PCR, as

H. K. Musafer et al.

Table 1 Strains, plasmids, and primers used in this study

Strain name Relevant genotype, description or sequence Source

S. cerevisiae InvSc1 MATa/MATα leu2/leu2 trp1-289/trp1-289 ura3-52/ura3-52 his3-Δ1/his3-Δ1 Invitrogen

E. coli S17-1(λpir) thi pro hsdR-hsdM+ΔrecARP4-2::TcMu-Km::Tn7 [55]

E. coliDH5α lˉ f80dlacZDM15D(lacZYA-argF)U169 recA1 endA hsdR17(rKˉ mKˉ) supE44 thi-1 gyrA relA1 Life Technologies

P. aeruginosaPAO1 Wild type [54]

oprD::IsphoA/hah PAO1 with isphoA/hah insertion in opr::Tcʳ [54]

SMC214 Imipenem intermediate P. aeruginosa clinical isolate; robust biofilm former This study

SMC576 Imipenem-sensitive P. aeruginosa clinical isolate; robust biofilm former This study

SMC631 Imipenem-sensitive clinical isolate; robust biofilm former This study

SMC4972 P. aeruginosa clinical isolate This study




SMC5806 631-F/oprD; imipenem-resistant derivative of SMC631; premature stop mutation in oprD gene This study



SMC5812 SMC576 pilW::Mar19, Mariner insertion in pilW (769)a This study

SMC5813 SMC576 pilY1::Mar8, Mariner insertion in pilY1 (3214) This study



SMC5816 SMC576 pilY1::Mar20, Mariner insertion in pilY1(2156) This study

SMC5817 SMC576 pilY1::Mar25, Mariner insertion in pilY1(1228) This study

SMC5818 SMC576 pslI::Mar15, Mariner insertion in pslI This study

SMC5819 SMC576 algC::Mar10, Mariner insertion in algC This study

SMC5824 SMC214 pilX::Mar, Mariner insertion in pilX (84) This study

SMC5825 SMC214 pilW::Mar, Mariner insertion in pilW (627) This study

SMC5832 P. aeruginosaATCC 27853 This study

SMC5833 Escherichia coliATCC 25922 This study

Plasmid Plasmid description Reference

pMQ70 Shuttle vector for cloning in yeast and for arabinose-inducible gene expression; Apʳ [18]

pMQ72 Shuttle vector for cloning in yeast and for arabinose-inducible gene expression; Gmʳ [18]

pBT20 Vector carrying mariner transposon; Apʳ; Gmʳ [56]

poprD oprD gene cloned in pMQ72; Gmʳ This study

ppilY1 His-tagged pilY1 gene cloned in pMQ70; Apʳ This study

Primersb Primer sequence (5′–3′)

oprD comp 5′ ttctccatacccgtttttttggggaaggagatatacatATGAAAGTGATGAAGTGGAG

oprD comp 3′ taatctgtatcaggctgaaaatcttctctcatccgccTCACAGGATCGACAGCGGATAG

oprD seq a-f ATGAAAGTGATGAAGTGGAGC

oprD seq a-r AGGGAGGCGCTGAGGTT

oprD seq b-f AACCTCAGCGCCTCCCT

pilY1 comp 5′ tctccatacccgtttttttgggctagcgaattcgaaggagatatacatATGAAATCGGTACTCCACCAG

pilY1 comp 3′ tcttctctcatccgccaaaacagccaagcttgcatgcctTCAgtggtgatggtggtggtgGTTCTTTCCGATGGGGC

pilY1 seq Rev 2 TGAACGGACAGGTACAGATCC

pilY1 seq 3 GGATCTGTACCTGTCCGTTC

pilY1 seq 4 GGCGAGTTTCTCAAGAAGACC

pilY1 seq 5 CTTCCAGGACATCCTCAACCG

pilY1 seq 6 AGCCCAGCGGTAACTACTCC

pilY1 seq 7 CAAGGTCAACCAGGACGATC

P730 GCAACTCTCTACTGTTTCTCC

a The number in parentheses indicates the nucleotide after which the transposon has inserted in the open reading frameb For primer sequences, lowercase letters indicate sequence identity to the cloning vector, uppercase letters indicate a Pseudomonas gene-specificsequence, boldface and lower case letters indicates a His tag sequence

Imipenem Resistance and Biofilm Formation

described previously [23, 24], and the PCR products weresequenced at the Molecular Biology and Proteomics Core atDartmouth College. The resulting DNA sequences werealigned to the P. aeruginosa PAO1 genomic sequence usingthe NCBI BLAST program.

Construction of Mutant Strains and Plasmids

Table 1 lists all plasmids constructed in this study and primersused in plasmid construction. Plasmids for complementationand overexpression were generated via homologous recombi-nation in yeast [18]. The pMQ72 vector [18] was used as thebackbone for the oprD complementation construct, and plas-mid pMQ70 [18] served as the backbone for the pilY1 com-plementation construct. The poprD complementation con-structs and ppilY1 complementation constructs were generatedby PCR amplification of the respective genes using the high-fidelity Phusion polymerase (Finnzyme, Espoo, Finland).

Motility Assays

Twitch motility plates consisted of M63 medium supplement-ed with glucose,MgSO4, and CAA solidified with 1.5 % agar.Twitch assays were performed as previously reported [25, 26].Swarming motility plates were comprised of M8 mediumsupplemented with MgSO4, glucose, and CAA and solidifiedwith 0.5 % agar. For each strain tested, 2 μl of LB grownovernight cultures was inoculated onto the surface of theswarm plates and incubated for 16 h at 37 °C.

Biofilm Formation Assay

Biofilm formation in 96-well microtiter plates was assayedand quantified as previously described [26, 27]. All biofilmassays were performed using M63 minimal medium supple-mented with MgSO4, glucose, and CAA.

Quantification of Polysaccharide Production

We quantified Psl production via ELISAwith some modifica-tions from an existing protocol [28], using the anti-PSL anti-body WapR-001: Class II anti-Psl mAb. MedImmune LLCpreviously reported this identification and characterization ofthis antibody [29], and generously provided this reagent forour studies. Flat-bottom 96-well MaxiSorp plates (Nunc) werecoated, in triplicate, overnight at 4 °C with 100 μL/well of theindicated strains grown overnight in LB medium. The platewas washed thrice with PBS/0.1 % Tween-20 for 3 min eachand tapped to mix, then blocked with 300 μL/well PBS+1 %BSA for 60 min at 4 °C. Primary anti-PSL antibody (WapR-001: Class II anti-Psl mAb) diluted in PBS+0.1 % BSA to aconcentration of 1 μg/mL was added for 1–2 h at room temp,

then washed three times as above. Next, a 1:5,000 dilution ofHRP-conjugate secondary antibody diluted in PBS+0.1 %BSAwas added to each well and incubated for 1 h, the platewashed three times with PBS, and 100 μL/well TMBSureBlue development reagents added for color development.Finally, 100 μL/well 0.2 N H2SO4 was added to terminatecolor development and the wells measured at 450 nm.

Results

OprD Participates in Biofilm Formation

Given the critical role of OprD in imipenem resistance [30,31], the well-established role of biofilms in antimicrobialtolerance [32], and the limited literature linking planktonicresistance mechanisms to biofilm formation, we assessedwhether strains with a defect in the oprDgene might displayan altered biofilm phenotype. To test this hypothesis, weassessed the ability of an oprD transposon mutant to form abiofilm compared to the parental P. aeruginosa PAO1strain. The oprD mutant showed a significant, but modestreduction in biofilm formation using the 96-well microtiterassay compared to P. aeruginosa PAO1 (Fig. 1a). We ob-served no difference in the growth rate of the WT versus theoprD mutant (not shown), thus a growth defect could notexplain the reduction in biofilm formation. The biofilmformation defect of the oprD mutant was complementedby introducing a wild-type copy of the oprD gene on aplasmid but the vector control (pMQ72) was not able torescue this defect (Fig. 1a).

To confirm that the oprD mutant did indeed conferimipenem resistance, we performed an Etest assay on thestrains described in Fig. 1a. The oprD transposon mutantand the mutant carrying the vector control (pMQ72) showedsignificantly higher resistance to imipenem compared to theparental P. aeruginosa PAO1 and the oprD mutantcomplemented with a plasmid carrying the wild-type copyof this gene (Fig. 1b).

To assess whether these phenotypes might be observed in aclinical strain as well as the PAO1 laboratory strain, weassessed the biofilm formation and imipenem resistance phe-notypes of a clinical strain of P. aeruginosa isolated from thesputum of a cystic fibrosis patient. This non-mucoid strain,designated SMC631, could form a biofilm in the 96 wellmicrotiter dish and was sensitive to imipenem (Table 2). Weisolated several imipenem-resistant (ImR) variants of theSMC631 strain that grew as colonies in the zone of inhibitionat 32 μg/mL while performing an MIC assay with animipenem ETest strip. Upon retesting in a microdilution assay,these mutants were confirmed to be resistant to imipenem(MIC≥16 μg/L). Sequencing of the oprDgene in one of these


resistant isolates (631F-ImR) identified a single nucleotidechange resulting in mutation of a Trp residue at position 417to a premature stop codon.

As was shown for the laboratory strain P. aeruginosaPAO1, a mutation in the oprD gene of the clinical isolateSMC631 reduced biofilm formation, and this phenotype couldbe complemented by introducing a plasmid carrying the wild-type oprD gene of strain P. aeruginosa PAO1, but not thecorresponding vector control (Fig. 1c). Interestingly, theimipenem-resistant variant of SMC631 could not becomplemented for its antibiotic resistance phenotype by

introduction of a plasmid carrying the wild-type oprD gene(Fig. 1d), indicating either the possibility of a second mutationin this strain, that the mutation towards the C-terminal domainof the protein caused altered function, rather than loss offunction, of the protein, or alternatively, that providing theoprD gene in multicopy in this strain cannot rescue imipenemsensitivity in this clinical strain.

Taken together, these data indicate that loss of OprD func-tion in a lab isolate and a clinical isolate, which confersincreased imipenem resistance, also results in a reduction inbiofilm formation compared to the parental strain.

Bio

film

Fo

rmat

ion

(A

550)

0.00

0.05

0.10

0.15

0.20

Imip

enem

MIC

(g

/ml)

0

10

20

30

40

0.0

0.2

0.4

0.6

0.81.0

Bio

film

Fo

rmat

ion

(A

550)

Imip

enem

MIC

(g

/ml)

0

10

20

30

40

ns

** **

***

** **

ns*** ***

ns

*** ***

a b

c d

Fig. 1 OprD participates in biofilm formation as well as imipenemresistance. aQuantification of biofilm formation for the indicated strains,including P. aeruginosaPAO1 (PAO1), the oprD::IsphoA/hah transposonmutant [54], and the oprDmutant complemented with the vector control(pMQ72) or a plasmid carrying a wild-type copy of oprD (poprD+). Thebiofilm was detected by crystal violet (CV) staining. To quantify thebiofilm, CV was solubilized with 30 % glacial acetic acid and theabsorbance wasmeasured at 550 nm. Strains were grown inM63mediumwith MgSO4, glucose, and CAA for 24 h at 37 °C prior to crystal violetstaining. In this and all figures, each strain was tested in four wells perexperiment. Error bars represent standard deviations of means from threeseparate experiments. Statistical analysis was performed using ANOVAwith Tukey’s post-test comparison. ns not significantly different; **,P<0.01, compared to P. aeruginosa PAO1. b imipenem susceptibilitywas investigated by Etest strips for the same strains described in panel A.Strains were grown onMueller Hinton agar for 24 h at 37 °C as describedin the “Materials and Methods”. Error bars represent standard deviationsof averages from three independent experiments. Statistical analysis was

performed using ANOVA with Tukey’s post-test comparison. ns notsignificantly different; ***, P<0.001, compared to P. aeruginosa PAO1.c Quantification of biofilm formation for the indicated strains, as de-scribed in panel A. The strains tested are the P. aeruginosa imipenem-sensitive clinical isolate SMC631, its imipenem-resistant derivativeSMC631F-ImR (oprD), which carries a premature stop codon mutationin the oprD gene, SMC631F-ImR carrying the vector control (pMQ72)and SMC631F-ImR carrying a wild-type copy of oprD (poprD+). Errorbars represent standard deviations of the averages of three experimentswith four replicates per experiment. Data were analyzed by ANOVAwithTukey’s post-test comparison. ns not significantly different; **, P<0.01,compared to SMC631. d Imipenem susceptibility was investigated byEtest strips for the same strains described in panel C, as outlined for thestudies performed in panel B. Error bars represent standard deviations ofaverages from three independent experiments with four wells per exper-iment. Data were analyzed by ANOVAwith Tukey’s post-test compari-son. ***P<0.001, compared to SMC631


Assessing Biofilm Formation and Imipenem Resistancein Clinical Isolates

To further explore the relationship between biofilm formationand imipenem resistance, we assessed these phenotypes for theclinical strain SMC631, a number of imipenem-resistant vari-ants of SMC631, and several additional P. aeruginosa clinicalisolates. As shown in Table 2, SMC631, an imipenem-sensitive strain, makes a biofilm in the 96-well microtiter dish.We isolated five imipenem-resistant variants of this strain(SMC631C, F, H, J, K), and for all of these resistant strains,their ability to form a biofilm was compromised compared tothe parent SMC631. Similarly, the imipenem-resistant isolatesSMC4974, SMC5810, and SMC5811 showed relatively lowbiofilm formation compared to the imipenem-sensitive or in-termediate P. aeruginosa clinical isolates SMC576, SMC214,SMC4972, SMC4973, and SMC4979, which all formed rela-tively robust biofilms (Table 2). Sequence analysis showed thatall of the imipenem-resistant strains, with the exception ofSMC631K, carried a mutation in the oprD gene (not shown).These data suggested the possibility of an inverse relationshipbetween biofilm formation and OprD-mediated imipenemresistance, likely due to the participation of OprD in both ofthese processes in P. aeruginosa.

Biofilm Defective Mutants of Imipenem-Sensitive ClinicalIsolates SMC576 and SMC214 Remain Sensitiveto This Antibiotic

Given the observation that low levels of biofilm formation arecorrelated with imipenem resistance in P. aeruginosa PAO1

and various clinical isolates, and to better understand whetherthere might be a general link between biofilm formation andresistance phenotypes beyond the role described for OprDabove, we decided to identify factors required for biofilmformation in two clinical isolates then test these biofilm mu-tants for their imipenem resistance phenotype.

Clinical strains of P. aeruginosa (SMC576 and SMC214)were isolated from the sputum of CF patients, displayedrobust biofilm formation, are imipenem sensitive (MIC≤2 μg/ml) or intermediate (MIC=4 μg/ml), respectively, andcould be effectively mutagenized via Mariner transposon mu-tagenesis. A number of the other clinical isolates were alsotested, but they either did not form reproducible biofilms inthe 96-well dish assay in our large-scale screening conditions(four strains) or the strains showed high level gentamicinresistance, which is the selectable marker on the Marinertransposon (three strains). Thus, we focused our efforts onstrains SMC576 and SMC214.

We screened approximately 1,500 Mariner transposon mu-tants in the SMC576 strain for a reduction in biofilm forma-tion using the microtiter plate assay. We isolated severalbiofilm formation-defective strains and we mapped these mu-tations to seven different genes, with several of these genesmutated more than once in independent strains. A completelist of mutations isolated is as follows: pilY1, pilW, algC, pslI,cupA2, pilA, and pilO genes, all of which have documentedroles in biofilm formation [33–37], but we did not identify anymutations in the oprD gene. We further characterized thepilY1, pilW, algC, and pslI mutants in the studies below(Fig. 2a, b) to confirm that we had correctly mapped themutations to these genes.

As expected based on our previous studies [34, 37], thesingle pilW::Mar19 and five independent pilY1::Marmutantsisolated (Fig. 2a) showed a significant reduction in biofilmformation compared with the parental strain, SMC576(Fig. 2b,c), as well as increased swarming motility and lossof twitchingmotility (Fig. 2b,c). Additionally, we identified asbiofilm-defective a strain with a mutation in algC, whose geneproduct contributes to the biosynthesis of LPS, rhamnolipids[38, 39], and alginate, as well as a mutation in the pslI gene.Both the algC and pslI genes are required for the synthesis ofthe Psl polysaccharide [35, 40–44].

To confirm a role for the pilY1 gene in biofilm formationby strain SMC576, we performed complementation studies.Mutating the pilY1 gene in the SMC576 background result-ed in an increased swarming phenotype, which could becomplemented by the introduction of a plasmid carrying awild-type copy of the pilY1 gene, but not by the vectorcontrol (pMQ70, Fig. 2d). Similarly, the twitching(Fig. 2d) and biofilm formation (Fig. 2d, e) defect of thepilY1mutant could be complemented by the introduction ofa plasmid carrying a wild-type copy of the pilY1 gene, butnot by the vector control (pMQ70).

Table 2 Biofilm and Imipenem resistance phenotypes of clinical isolates

Imipenemresistancea

Strain ImipenemMIC

Biofilm(A550±SD))

Sensitive PA01 2 0.88±0.01

Sensitive SMC631 1.5 0.19±0.02

Resistant SMC631C 16 0.12±0.02

Resistant SMC631F 16 0.06±0.02

Resistant SMC631H 16 0.10±0.02

Resistant SMC631J 16 0.11±0.02

Resistant SMC631K 24 0.12±0.03

Resistant SMC4974 32 0.04±0.01



Sensitive SMC576 1 0.84±0.23

Intermediate SMC214 4 0.70±0.16

Sensitive SMC4972 1 0.77±0.03

Sensitive SMC4973 0.5 0.96±0.05

Intermediate SMC4979 4 0.53±0.06

a Sensitive (≤2 μg/ml), intermediate (4 μg/ml) or resistant (≥8 μg/ml)


The algC mutant shows loss of swarming and twitchingmotility, as well as loss of biofilm formation (Fig. 2b, c).Furthermore, as expected based on a recent report [35], thealgC mutant shows a reduced production of Psl polysaccha-ride as judged by ELISA using an antibody specific for the Pslpolysaccharide (Fig. 3). The strain carrying a mutation in pslIshows no obvious swarming or twitching defect (Fig. 2b, c),but it does show reduced Congo Red binding (not shown) andPsl production (Fig. 3). Finally, as expected, the strain carry-ing a mutation in the pilY1 gene showed no difference in Pslproduction compared to the parent strain SMC576. Takentogether, these phenotypic assays confirmed that we hadmapped the mutations to the correct genes, and thus thesemutants were useful tools for also studying imipenemresistance.

Based on the finding that loss of OprD resulted in loss ofbiofilm formation and increased resistance to imipenem, as

outlined above, we hypothesized that there might be a generallink between loss of biofilm formation and increased resis-tance to this antibiotic. Therefore, we used the Etest method todetermine imipenem resistance profiles for the biofilm-defective mutants isolated in SMC576. In all cases, thebiofilm-deficient mutants isolated showed imipenem resis-tance at levels equivalent to the parent strain (Table 3), sug-gesting that there is no general link between loss of biofilmformation and increased resistance to imipenem.

To extend our findings to a second clinical isolate, wescreened ∼1,500 Mariner transposon mutants of SMC214,a mucoid CF isolate of P. aeruginosa. Similar to SMC576,we identified biofilm-defective mutants that mapped tothe pilX and pilW genes (Fig. 4). These mutations, asexpected, also rendered the strains unable to twitch(Fig. 4), thus the phenotypic assay confirmed the mappingof the mutations.

a d

epilY1pilW pilX

Swarm

Twitch

Biofilm

b

noita

mro

Fmlif

oiB

(A55

0)

0.0

0.2

0.4

0.6

0.8c

***

0.0

0.4

0.8

Bio

film

Fo

rmat

ion

(A

550)

0.2

0.6

*** ***

ns

Fig. 2 Identification of biofilm-deficient mutants in the clinical isolateSMC576. a Schematic diagram of the pilY1, pilX, and pilW genomic lociof P. aeruginosa PAO1 (www.pseudomonas.com/). The transposoninsertions are indicated by inverted triangles above the genes. The darkgray triangles indicate insertions in strain SMC576 and the light graytriangles indicate insertions in strain SMC214. The allele numbers aboveeach inverted triangle correspond to the mutations analyzed in panel B. bRepresentative swarming (top), twitching (middle), and biofilm (bottom)phenotypes of SMC576 and selected transposon mutants. All assays areperformed as described in the “Materials and Methods”. The straincorresponding to the phenotypes is indicated in panel C. cQuantification of crystal violet-stained biofilms for the indicated strains,as described in detail in Figure 1 and the “Materials and Methods”. Errorbars represent standard deviations of the averages of four experiments

with four replicates per experiment. Data were analyzed by ANOVAwithTukey’s post-test comparison. ns, not significantly different; ***, P<0.001 compared to the WT. d Representative swarming (top), twitching(middle), and biofilm (bottom) assays for SMC576, the pilY1::Mar8mutant of SMC576 and the pilY1::Mar8 mutant carrying either thevector alone (pMQ70) or the vector encoding a wild-type, His-taggedvariant of PilY1 (ppilY1), as indicated at the bottom of panel E. eQuantification of crystal violet-stained biofilms for the indicated strains,as described in detail in Figure 1 and the “Materials and Methods”. Errorbars represent standard deviations of the averages of four experimentswith four replicates per experiment. Data were analyzed by ANOVAwithTukey’s post-test comparison. ns not significantly different; ***P<0.001compared to the SMC576


http://www.pseudomonas.com/

As described above, all of the biofilm defective mutants ofSMC214 showed imipenem resistance profiles similar to theparent strain (Table 3), confirming that there is no general linkbetween loss of biofilm formation and increased resistance toimipenem.

Discussion

P. aeruginosa is an opportunistic pathogen that producessessile communities known as biofilms that are highly tolerantto antibiotic treatment [45, 46]. However, the link betweenclassical planktonic resistance mechanisms and biofilm

formation is less clearly established. Here we show thatOprD, which plays a major role in acquired resistance toimipenem also participates in biofilm formation. Loss ofOprD function, which blocks entry of imipenem into the cell,results in resistance to this drug [7]. It appears that one trade-off for acquiring resistance to this antibiotic via loss of OprDmay be a compromised ability to form a biofilm, at least onone model abiotic substratum.

In the experiments here, we utilized an oprD transposonmutant of P. aeruginosa PAO1 and a clinical isolate(SMC631) with a premature stop mutation in oprD, to estab-lish this link between increased imipenem resistance and lossof biofilm formation. This finding prompted us to look morebroadly at the relationship between imipenem resistance/sensitivity and biofilm formation. Thus, we examined bothin vitro-selected imipenem-resistant variants of the sensitiveclinical isolate SMC631, as well as additional clinical isolates

Table 3 Imipenem resistance of biofilm mutants

Parentstrain

Mutation Imipenem MIC(μg/ml)

SMC576 none 1

SMC576 pilY1::Mar8 1





SMC576 pilW::Mar19 1

SMC576 algC::Mar 1

SMC576 pslI::Mar 1

SMC214 none 4

SMC214 pilX::Mar 4

SMC214 pilW::Mar 6

Biofilm

Twitch

** *

0.0

0.2

0.4

0.6

0.8

Bio

film

Fo

rmat

ion

(A

550)

a

b

Fig. 4 Identification of biofilm-deficient mutants in the clinical isolateSMC214. a Representative twitching (top) and biofilm (bottom) assayphenotypes of clinical isolate SMC214 and selected transposon mutants.All assays are performed as described in the “Materials and Methods”.The location of the insertion site is indicated in panel B. bQuantificationof crystal violet-stained biofilms for the indicated strains, as described indetail in Fig. 1 and the “Materials and Methods”. Error bars representstandard deviations of the averages of four experiments with four repli-cates per experiment. Statistical analysis was performed using ANOVAwith Tukey’s post-test comparison. *P<0.05; **P<0.01, compared toSMC214

nsns

nsA

450

0.0

0.4

0.8

0.2

0.6

1.0

1.2

PA14 PAO1 576 AlgC pslI pily*** *** ***

Fig. 3 Quantifying Psl production. Quantification of Psl production byELISA for the indicated strains. The A450 value, a relative measure of Pslproduction as described in the “Materials and Methods”, is plotted on theY-axis, and the strains tested are indicated on the X-axis. Clinical strainSMC576 and three transposon mutants are shown. P. aeruginosa PAO1(PAO1) serves as a Psl-producing positive control, and P. aeruginosaPA14 (PA14) serves as a control for a strain lacking Psl. Data wereanalyzed by ANOVA with Tukey’s post-test comparison. ns not signifi-cantly different; ***P<0.001 compared to the SMC576


of P. aeruginosa isolated from CF patients. As shown inTable 2, the trend of low biofilm formation correlating withhigh imipenem resistance appeared to be maintained (and viceversa), raising the question of whether loss of biofilm forma-tion in general might confer imipenem resistance.

To test this idea, we selected two imipenem-sensitive clinicalisolates which formed robust biofilms (SMC576 andSMC214). Using Mariner mutagenesis, we identified multiplebiofilm-deficient strains, and we used a combination of com-plementation studies, phenotypic tests and biochemical studiesto confirm the apparent defects in these strains and that wemapped the mutations to the correct genes (Figs. 2, 3, and 4).We isolated biofilm-deficient strains with mutations in genesknown to be involved in biofilm formation based on studies ofthe P. aeruginosa PAO1 and PA14 lab strains, including muta-tions in factors required for pili biogenesis and function (pilA,pilO, pilY1, pilW, pilX) [34, 37, 47–50] and exopolysaccharideproduction (pslI, algC) [35, 40–44].While a role for these genesin biofilm formation may not be surprising, they are useful inthat they extend findings from laboratory strains to clinicallyrelevant isolates. Importantly, none of the biofilm-deficientmutants showed imipenem resistance (MIC≥8 μg/ml), thusarguing against a general link between these two phenotypes.

There is little literature available that correlates mecha-nisms of planktonic antimicrobial resistance and biofilm pro-duction. Dheepa et al. indicated that the resistance to antibi-otics such as ceftazidime, cefepime, and pipercillin inAcinetobacter baumannii was comparatively higher amongbiofilm producers than non-biofilm producers [51].Similarly, Rao et al. and Ibrahim et al. investigated clinicalisolates of A. baumannii, and these workers also found asignificant association of biofilm formation withmultiple drugresistance [52, 53]. These data indicate the possibility thatthere may be an under-appreciated link between planktonicresistance mechanisms and biofilm formation.

Acknowledgements We thank MedImmune for generously providingthe Psl antibody used in the ELISA. We also thank D.A. Hogan forproviding some of the P. aeruginosa clinical strains. This work wassupported by a fellowship to H.K.M. from the Iraqi government andNIH grant R01AI083256 to G.A.O.

References

1. O’Toole G, Kaplan HB, Kolter R (2000) Biofilm formation asmicrobial development. Annu Rev Microbiol 54:49–79

2. Davies DG, Parsek MR, Pearson JP, Iglewski BH, Costerton JW,Greenberg EP (1998) The involvement of cell-to-cell signals in thedevelopment of a bacterial biofilm. Science 280:295–298

3. Sanchez-Romero I, Cercenado E, Cuevas O, Garcia-Escribano N,Garcia-Martinez J, Bouza E (2007) Evolution of the antimicrobialresistance of Pseudomonas aeruginosa in Spain: second nationalstudy (2003). Rev Esp Quimioterapia Publ Oficial Soc EspQuimioterapia 20:222–229

4. Ruiz-Martinez L, Lopez-Jimenez L, Fuste E, Vinuesa T, Martinez JP,Vinas M (2011) Class 1 integrons in environmental and clinicalisolates of Pseudomonas aeruginosa. Int J Antimicrob Agents 38:398–402

5. Riera E, Cabot G,Mulet X, Garcia-Castillo M, del Campo R, Juan C,Canton R, Oliver A (2011) Pseudomonas aeruginosa carbapenemresistance mechanisms in Spain: impact on the activity of Imipenem,meropenem and doripenem. J Antimicrob Chemother 66(9):2022–2027

6. LynchMJ, Drusano GL, Mobley HL (1987) Emergence of resistanceto imipenem in Pseudomonas aeruginosa. Antimicrob AgentsChemother 31:1892–1896

7. Wolter DJ, Hanson ND, Lister PD (2004) Insertional inactivation ofoprD in clinical isolates of Pseudomonas aeruginosa leading tocarbapenem resistance. FEMS Microbiol Lett 236:137–143

8. Wolter DJ, Khalaf N, Robledo IE, Vazquez GJ, Sante MI, AquinoEE, Goering RV, Hanson ND (2009) Surveillance of carbapenem-resistant Pseudomonas aeruginosa isolates from Puerto RicanMedical Center Hospitals: dissemination of KPC and IMP-18 beta-lactamases. Antimicrob Agents Chemother 53:1660–1664. doi:10.1128/AAC.01172-08

9. Wolter DJ, AcquazzinoD, Goering RV, Sammut P, Khalaf N, HansonND (2008) Emergence of carbapenem resistance in Pseudomonasaeruginosa isolates from a patient with cystic fibrosis in the absenceof carbapenem therapy. Clin Infect Dis 46:e137–e141

10. Evans JC, Segal H (2007) A novel insertion sequence, ISPA26, inoprD of Pseudomonas aeruginosa is associated with carbapenemresistance. Antimicrob Agents Chemother 51:3776–3777

11. Yoneyama H, Nakae T (1993) Mechanism of efficient elimination ofprotein D2 in outer membrane of imipenem-resistant Pseudomonasaeruginosa. Antimicrob Agents Chemother 37:2385–2390

12. Pirnay JP, De Vos D, Mossialos D, Vanderkelen A, Cornelis P,Zizi M (2002) Analysis of the Pseudomonas aeruginosa oprDgene from clinical and environmental isolates. Environ Microbiol4:872–882

13. El Amin N, Giske CG, Jalal S, Keijser B, Kronvall G, Wretlind B(2005) Carbapenem resistance mechanisms in Pseudomonasaeruginosa: alterations of porin OprD and efflux proteins do not fullyexplain resistance patterns observed in clinical isolates. APMIS 113:187–196

14. Zanetti G, Bally F, GreubG, Garbino J, Kinge T, LewD, Romand JA,Bille J, Aymon D, Stratchounski L, Krawczyk L, Rubinstein E,Schaller MD, Chiolero R, Glauser MP, Cometta A (2003)Cefepime versus Imipenem-cilastatin for treatment of nosocomialpneumonia in intensive care unit patients: a multicenter, evaluator-blind, prospective, randomized study. Antimicrob Agents Chemother47:3442–3447

15. Sanbongi Y, Shimizu A, Suzuki T, Nagaso H, Ida T, Maebashi K,Gotoh N (2009) Classification of OprD sequence and correlationwith antimicrobial activity of carbapenem agents in Pseudomonasaeruginosa clinical isolates collected in Japan. Microbiol Immunol53:361–367

16. Fukuda H, Hosaka M, Iyobe S, Gotoh N, Nishino T, Hirai K (1995)nfxC-type quinolone resistance in a clinical isolate of Pseudomonasaeruginosa. Antimicrob Agents Chemother 39:790–792

17. Kohler T, Michea-Hamzehpour M, Henze U, Gotoh N, Curty LK,Pechere JC (1997) Characterization of MexE-MexF-OprN, a posi-tively regulated multidrug efflux system of Pseudomonasaeruginosa. Mol Microbiol 23:345–354

18. Shanks RM, Caiazza NC, Hinsa SM, Toutain CM, O’Toole GA(2006) Saccharomyces cerevisiae-based molecular tool kit for ma-nipulation of genes from gram-negative bacteria. Appl EnvironMicrobiol 72:5027–5036

19. CLSI (2013) Performance Standards for Antimicrobial SusceptibilityTesting; Twenty-Third Informational Supplement. Clinical andLaboratory Standards Institute, Wayne, CLSI document M100-S23


http://dx.doi.org/10.1128/AAC.01172-08

http://dx.doi.org/10.1128/AAC.01172-08

20. Andrews JM (2001) Determination of minimum inhibitory concen-trations. J Antimicrob Chemother 48(Suppl 1):5–16

21. Wiegand I, Hilpert K, Hancock RE (2008) Agar and broth dilutionmethods to determine the minimal inhibitory concentration (MIC) ofantimicrobial substances. Nat Protoc 3:163–175

22. O'Toole GA, Pratt LA, Watnick PI, Newman DK, Weaver VB,Kolter R (1999) Genetic approaches to the study of biofilms. In:Doyle RJ (ed) Methods in Enzymology. Academic Press, SanDiego, pp 91–109

23. Caetano-Annoles G (1993) Amplifying DNAwith arbitrary oligonu-cleotide primers. PCR Methods Appl 3:85–92

24. O'Toole GA, Kolter R (1998) Initiation of biofilm formation inPseudomonas fluorescens WCS365 proceeds via multiple, con-vergent signalling pathways: a genetic analysis. Mol Microbiol28:449–461

25. Whitchurch CB, Hobbs M, Livingston SP, Krishnapillai V, MattickJS (1990) Characterization of a Pseudomonas aeruginosa twitchingmotility gene and evidence for a specialized protein export systemwidespread in eubacteria. Gene 101:33–44

26. O'Toole GA, Kolter R (1998) Flagellar and twitching motility arenecessary for Pseudomonas aeruginosa biofilm development. MolMicrobiol 30:295–304

27. Caiazza NC, O'Toole GA (2004) SadB is required for the transitionfrom reversible to irreversible attachment during biofilm formationby Pseudomonas aeruginosa PA14. J Bacteriol 186:4476–4485

28. Honko AN, Sriranganathan N, Lees CJ, Mizel SB (2006) Flagellin isan effective adjuvant for immunization against lethal respiratorychallenge with Yersinia pestis. Infect Immun 74:1113–1120

29. Digiandomenico A, Warrener P, Hamilton M, Guillard S, Ravn P,Minter R, Camara MM, Venkatraman V, Macgill RS, Lin J, Wang Q,Keller AE, Bonnell JC, Tomich M, Jermutus L, McCarthy MP,Melnick DA, Suzich JA, Stover CK (2012) Identification of broadlyprotective human antibodies to Pseudomonas aeruginosaexopolysaccharide Psl by phenotypic screening. J Expl Med 209:1273–1287

30. Trias J, Nikaido H (1990) Protein D2 channel of the Pseudomonasaeruginosa outer membrane has a binding site for basic amino acidsand peptides. J Biol Chem 265:15680–15684

31. Trias J, Nikaido H (1990) Outer membrane protein D2 catalyzesfacilitated diffusion of carbapenems and penems through the outermembrane of Pseudomonas aeruginosa. Antimicrob AgentsChemother 34:52–57

32. Mah TF, O'Toole GA (2001) Mechanisms of biofilm resistance toantimicrobial agents. Trends Microbiol 9:34–39

33. Friedman L, Kolter R (2004) Genes involved in matrix formationin Pseudomonas aeruginosa PA14 biofilms. Mol Microbiol 51:675–690

34. Kuchma SL, Griffin EF, O'Toole GA (2012) Minor pilins of the typeIV pilus system participate in the negative regulation of swarmingmotility. J Bacteriol 194:5388–5403

35. ZegansME,WozniakD, Griffin E, Toutain-Kidd CM, Hammond JH,Garfoot A, Lam JS (2012) Pseudomonas aeruginosaexopolysaccharide Psl promotes resistance to the biofilm inhibitorpolysorbate 80. Antimicrob Agents Chemother 56:4112–4122

36. Li Y, Hao G, Galvani CD, Meng Y, De La Fuente L, Hoch HC, BurrTJ (2007) Type I and type IV pili ofXylella fastidiosaaffect twitchingmotility, biofilm formation and cell-cell aggregation. Microbiology153:719–726

37. Kuchma SL, Ballok AE, Merritt JH, Hammond JH, Lu W,Rabinowitz JD, O'Toole GA (2010) Cyclic-di-GMP-mediated re-pression of swarming motility by Pseudomonas aeruginosa: thepilY1 gene and its impact on surface-associated behaviors. JBacteriol 192:2950–2964

38. Goldberg JB, Hatano K, Pier GB (1993) Synthesis of lipopolysac-charide O side chains by Pseudomonas aeruginosa PAO1 requiresthe enzyme phosphomannomutase. J Bacteriol 175:1605–1611

39. Olvera C, Goldberg JB, Sanchez R, Soberon-Chavez G (1999) ThePseudomonas aeruginosa algC gene product participates inrhamnolipid biosynthesis. FEMS Microbiol Lett 179:85–90

40. Friedman L, Kolter R (2004) Two genetic loci produce distinctcarbohydrate-rich structural components of the Pseudomonasaeruginosa biofilm matrix. J Bacteriol 186:4457–4465

41. Davies DG, Geesey GG (1995) Regulation of the alginate biosyn-thesis gene algC in Pseudomonas aeruginosa during biofilm devel-opment in continuous culture. Appl Environ Microbiol 61:860–867

42. Davies DG, Chakabarty AM, Geesey GG (1993) Exopolysaccharideproduction in biofilms: substratum activation of alginate gene expressionby Pseudomonas aeruginosa. Appl Environ Microbiol 59:1181–1186

43. Jackson KD, Starkey M, Kremer S, Parsek MR, Wozniak DJ (2004)Identification of psl, a locus encoding a potential exopolysaccharidethat Is essential for Pseudomonas aeruginosa PAO1 biofilm forma-tion. J Bacteriol 186:4466–4475

44. Matsukawa M, Greenberg EP (2004) Putative exopolysaccharidesynthesis genes influence Pseudomonas aeruginosabiofilm develop-ment. J Bacteriol 186:4449–4456

45. Costerton JW, Stewart PS, Greenberg EP (1999) Bacterial biofilms: acommon cause of persistent infections. Science 284:1318–1322

46. Hoiby N, Bjarnsholt T, Givskov M, Molin S, Ciofu O (2010)Antibiotic resistance of bacterial biofilms. Int J Antimicrob Agents35:322–332

47. Alm RA, Bodero AJ, Free PD, Mattick JS (1996) Identification of anovel gene, pilZ, essential for type 4 fimbrial biogenesis inPseudomonas aeruginosa. J Bacteriol 178:46–53

48. Alm RA, Hallinan JP, Watson AA, Mattick JS (1996) Fimbrialbiogenesis genes ofPseudomonas aeruginosa: pilWand pilX increasethe similarity of type 4 fimbriae to the GSP protein-secretion systemsand pilY1 encodes a gonococcal PilC homologue. Mol Microbiol 22:161–173

49. Bohn YS, Brandes G, Rakhimova E, Horatzek S, Salunkhe P,Munder A, van Barneveld A, Jordan D, Bredenbruch F, Haussler S,Riedel K, Eberl L, Jensen PO, Bjarnsholt T, Moser C, Hoiby N,Tummler B, Wiehlmann L (2009) Multiple roles of Pseudomonasaeruginosa TBCF10839 PilY1 in motility, transport and infection.Mol Microbiol 71:730–747

50. Giltner CL, Habash M, Burrows LL (2010) Pseudomonasaeruginosa minor pilins are incorporated into type IV pili. J MolBiol 398:444–461

51. Dheepa M, Rashme VL, Appalaraju B (2011) Comparision of bio-film production and multiple drug resistance in clinical isolates ofAcinetobacter baumanii from a tertiary care hospital in South India.Int J Pharm Biomed Sci 2:103–107

52. Rao RS, Karthika RU, Singh SP, Shashikala P, Kanungo R,Jayachandran S, Prashanth K (2008) Correlation between biofilmproduction and multiple drug resistance in imipenem resistant clini-cal isolates of Acinetobacter baumannii. Indian Journal MedMicrobiol 26:333–337

53. Ibrahim NH, Somily AM, Bassyouni RH, El-Aabedien AZ (2012)Comparative study assessing the effect of tigecycline andmoxifloxacin in prevention of Acinetobacter baumannii biofilm.Life Sci 9:1016–1024

54. Jacobs MA, Alwood A, Thaipisuttikul I, Spencer D, Haugen E, ErnstS,Will O, Kaul R, Raymond C, LevyR, Chun-Rong L, Guenthner D,Bovee D, Olson MV, Manoil C (2003) Comprehensive transposonmutant library of Pseudomonas aeruginosa. Proc Natl Acad Sci U SA 100:14339–14344

55. Simon R, Priefer U, Pühler A (1983) A broad host rangemobilizationsystem for in vivo genetic engineering: transposon mutagenesis ingram negative bacteria. Nat Biotechnol 1:784–791

56. Kulasekara HD, Ventre I, Kulasekara BR, Lazdunski A, Filloux A,Lory S (2005) A novel two-component system controls the expres-sion of Pseudomonas aeruginosa fimbrial cup genes. Mol Microbiol55:368–380


Investigating the Link Between Imipenem Resistance and Biofilm Formation by Pseudomonas aeruginosa

Documents

Transcript of Investigating the Link Between Imipenem Resistance and Biofilm Formation by Pseudomonas aeruginosa