Increased Estrogen Receptor b Expression Correlates with DecreasedSpine Formation in the Rat Hippocampus

Sylwia Szymczak,1 Katarzyna Kalita,1 Jacek Jaworski,1,2 Basia Mioduszewska,1

Alena Savonenko,3 Alicja Markowska,4 Istvan Merchenthaler,5 and Leszek Kaczmarek1*

ABSTRACT: Estrogens play an important role in the brain function actingthrough two receptor types, ERa and ERb, both well-recognized as tran-scription factors. In this study, we investigated the ERb mRNA and proteinlevels in the rat hippocampus by using two in vivo models that are knownto affect synapse formation. Natural estrous–proestrous cycle was used as amodel in which a marked decrease in the density of hippocampal synapseswas previously observed between proestrus and estrus. We have found thatERb mRNA and protein were displayed in high levels in the estrus and inlow levels in the proestrous phase. By applying kainic acid (KA) to adultrats, we demonstrated that up-regulation of ERb mRNA and protein in hip-pocampal CA regions was vulnerable to KA-induced excitotoxicity. Further-more, we note a concomitant decrease of ERb in the excitotoxicity-resistantdenate gyrus that undergoes intense plastic changes, including synaptogen-esis. These data suggested that decreases in ERb expression correlated withincrease in synapse formation. This notion has been tested in vitro in hippo-campal cultures, in which overexpression of ERb by means of gene transfec-tion resulted in the lowering of the dendritic spine density that was elevatedby estrogen. In summary, our results suggest that ERb inhibits synapse for-mation in hippocampal neurons. VVC 2006 Wiley-Liss, Inc.

KEY WORDS: estrogen receptor b; hippocampus; plasticity

INTRODUCTION

Estrogen, a hormone classically associated with female reproduction,exerts powerful effects on the functioning of the brain, including a signifi-cant role in regulating behavioral and physiological events essential for pro-creation (Kow et al., 1980; Meisel et al., 1984). However, estrogen alsoplays an important trophic and protective role in the developing, adult, andaging brain, protecting against injury and reducing the extent of cell death

(Green et al., 1996; Simpkins et al., 1997; Cardona-Gomez et al., 2001; Kajta and Beyer, 2003; Hilton et al.,2004). Furthermore, estrogen affects hippocampus-dependent cognitive function (Daniel et al., 1997; Simpkinset al., 1997; Luine et al., 1998; Markowska, 1999).

Physiological fluctuations of estrogen, occurring duringthe estrous cycle, result in hippocampal plasticity. It ismanifested in the CA1 as a 30% decrease in the density ofspines observed between the proestrous and estrous phase(Wooley et al., 1990; Woolley and McEwen, 1992; Wool-ley and McEwen, 1993; McEwen and Woolley, 1994).Spine density changes can also be studied in hippocampalneuronal cultures where Segal and Murphy (2001) dem-onstrated an increase in spine density upon treatment withestradiol. Furthermore, estradiol treatment increases thelevels of the NMDA receptor in the hippocampus (Wei-land, 1992), and NMDA receptor-dependent long-termpotentiation (LTP) (long-term potentiation) is enhancedin the proestrous phase (Good et al., 1999).

Since the discovery of the second type of estrogen re-ceptor, ERb (Kuiper et al., 1996), and the localizationof both, the previously known ERa, especially ERb, tothe nonreproductive regions of the brain such as thehippocampus, the amygdala, and the cortex (Li et al.,1996; Shughrue et al., 1997; Zhang et al., 2002), ques-tions have arisen regarding the role of these steroidhormone receptors in the limbic system of the brain. Ingene knockout studies, ERa-deficient mice displayedimpaired reproductive behaviors, while ERb knock outanimals showed only slightly impared reproduction buthad morphological abnormalities in the brain, associatedwith defects in neuronal migration (Lubahn et al., 1993;Krezel et al., 2001; Wang et al., 2001). These resultssuggest that ERb appears to be a good candidate to bethe estrogen receptor participating in the regulation ofnonreproductive brain functions. In this context, it isnoted that Krezel et al. (2001) have provided some cluesto a specific role of ERb by reporting on increased anxi-ety as well as synaptic plasticity in ERb-deficient mice.

We have additionally employed a model of kainate-induced neuronal stimulation, excitotoxicity, and neu-ronal plasticity (Ben-Ari et al., 1979; Sperk et al.,1983; Zagulska-Szymczak et al., 2001). Kainate is apotent agonist of glutamate receptors. When adminis-tered to rats, it causes neuronal depolarization, whichis manifested as epilepsy-like seizures and, after a fewdays, leads to neurodegeneration in hippocampal CA

1Nencki Institute, Pasteura 3, 02-093 Warsaw, Poland; 2 International Insti-tute for Molecular and Cell Biology, ks. Trojdena 4, Warsaw, Poland;3Department of Pathology, Johns Hopkins School of Medicine, Baltimore,Maryland; 4Department of Psychology, Johns Hopkins University, BaltimoreMaryland; 5Department of Epidemiology and Anatomy/Neurobiology, Schoolof Medicine, University of Maryland at Baltimore, Baltimore, MarylandGrant sponsor: State Committee for Scientific Research, KBN (Poland);Grant number: 6 PO4A02121.

*Correspondence to: Leszek Kaczmarek, Nencki Institute, Pasteura 3, 02-093 Warsaw, Poland. E-mail: L.Kaczmarek@nencki.gov.plS.S. and K.K. contributed equally to this work.Accepted for publication 19 December 2005DOI 10.1002/hipo.20172Published online 8 March 2006 in Wiley InterScience (www.interscience.wiley.com).

Abbreviations used: AMPA, a-amino-3-hydroxy-5-methyl-4-propionate;BSA, bovine serum albumin; CA, cornu Ammonis; cAMP, cyclic adeno-sine monophosphate; DG, dentate gyrus; ERb, estrogen receptor b;GAPDH, glyceraldehyde phosphate dehydrogenase; GFP, green fluores-cent protein; GnRH, gonadotrophin-releasing hormone; IGF-I, insulin-likegrowth factor I; KA, kainic acid; MAPK, mitogen activated protein kinase;NMDA, N-methyl-D-aspartate; PKA, protein kinase A

HIPPOCAMPUS 16:453–463 (2006)

VVC 2006 WILEY-LISS, INC.

subfields and in the hilus of the dentate gyrus (DG), as well asto massive gliosis. The granule neurons of the DG, not vulner-able to kainate-induced excitotoxicity, demonstrate neuronalplasticity and synaptic reorganization (Ben-Ari et al., 1979;Sperk et al., 1983; Kaminska et al., 1997).

In the work presented herein, we first analyze the ERbexpression patterns in the hippocampus during the estrous cycleas well as during kainate-induced depolarization and plasticityin the hippocampus. Encouraged by the active response of ERbin both in vivo models, we then proceeded to correlate ERbexpression with synapse formation in vitro.

RESULTS

Effects of Estrous Cycle on HippocampalExpression of ERb mRNA and Protein

The experiments were performed with regularly cyclingfemale rats. Estrous and proestrus phases of the cycle were

determined by vaginal cytology performed every day for 2weeks. We used semiquantitative RT-PCR to estimate the rela-tive amounts of ERb1 and ERb2 in female rat hippocampusduring the estrous cycle (Kalita et al., 2005). These are themain ERb isoforms in rats, and ERb2, not able to bind aligand, has been shown to function as a negative regulator ofestrogen action (Maruyama et al., 1998). The two isoformswere amplified in one reaction, using the same set of primers.A lower level of mRNA of ERb1 and ERb2 isoforms in thehippocampus was observed in the proestrous phase, when estro-gen levels are high (Markowska and Savonenko, 2002), as com-pared with the estrous phase (Fig. 1A). Two-way analysis ofvariance (ANOVA) analyses showed differences in the meanERb mRNA isoforms’ signal across the two estrous phases(F(1.16) ¼ 14.67; P < 0.002). The Newman-Keuls ANOVAPost Hoc Test analyses indicate that the ERb1 and ERb2mRNA is significantly higher in estrus compared with proestrus(P < 0.034 and P < 0.023, respectively). Interestingly, ERamRNA levels were the same in estrous and proestrous phase.

FIGURE 1. Estrous cycle-related fluctuation in the expressionof ERb mRNA and protein in the rat hippocampus. A: Levels ofERb1 and ERb2 mRNA isoforms as verified by RT-PCR in theproestrus and estrus phase of the cycle. The densitometric analysisof ERb1 and ERb2 bands was used for statistical analysis. The ar-bitrary units (a.u.) on the histograms signify the fold increases indensity of the ERb1 and ERb2 bands in estrus vs. proestrus, ascompared with the density of the GAPDH mRNA (a.u. 6 SEM).Two-way ANOVA analyses showed differences in the mean ERbmRNA isoforms’ signal across two estrous phases (F(1.16) = 14.67;

P < 0.002). The Newman-Keuls ANOVA Post Hock Test analysesindicate that ERb1 mRNA (P < 0.034) and ERb2 (P < 0.023)amount is statistically significantly higher in estrus than in proes-trus. B: Levels of ERb protein expression during estrous cycle asdetermined by immunoblotting. The results are expressed in arbi-trary units (a.u. 6 SEM) derived from quantification of the opticaldensity of each immunoreactive band and normalization vs.GAPDH protein levels. The ANOVA analyses showed differencesin the mean ERb protein signal across two estrous groups (F(1.4) =98.09; P < 0.001).

454 SZYMCZAK ET AL.

To analyze the protein levels of ERbin the rat hippocampus dur-ing the estrous cycle, Western blot assay was applied. As was thecase for mRNA, in the estrous phase ERb protein level increasedtwofold as compared to the proestrous phase (Fig. 1B). TheANOVA analyses showed differences in the mean ERb protein sig-nal across two estrus groups (F(1.4)¼ 98.09; P< 0.001), when nor-malized to the housekeeping control protein GAPDH (glyceralde-hyde 3-phosphate dehydrogenase).

Effects of Kainate Treatment on mRNA andProtein of Estrogen Receptor b in Hippocampus

It is known that estradiol potentiates the excitatory effects ofthe glutamate analog, kainic acid (Woolley, 2000; Galanopoulou

et al., 2003). To exclude the interfering effects of naturally flu-ctuating endogenous estrogen in female rats we have used adultmale Wistar rats for experiments with kainic acid.

Semiquantitative RT-PCR showed mRNA expression of both iso-

forms of estrogen receptor b, ERb1, and ERb2, in the normal male

rat hippocampus (Fig. 2A). Upon stimulation with kainic acid, ani-

mals demonstrated an increase in ERb mRNA in the hippocampus,

as compared to mRNA level in control animals (n ¼ 3) (Fig. 2A).

The mRNA of ERb1 and ERb2 behaved similarly showing up-reg-

ulation at 6 h after kainate administration (P ¼ 0.02). It was still

visibly increased at 24 h postkainate treatment (P ¼ 0.02) (Fig. 2A).Applying in situ hybridization, we have localized the up-reg-

ulation in ERb mRNA following administration of kainic acid

FIGURE 2. KA-induced changes in the expression of ERbmRNA in the rat hippocampus. A: Levels of ERb1 and ERb2mRNA isoforms as verified by RT-PCR in the control animals andfollowing application of KA (10 mg/kg). The densitometric analy-sis of ERb1 and ERb2 bands was used for statistical analysis. Thearbitrary units on the histograms signify the fold increases in opti-cal density of the ERb1 and ERb2 bands in control hippocampi

vs. KA-treated as compared to the optical density of the b-actinmRNA. Two-way ANOVA analyses showed differences in the meanERb mRNA isoforms’ signal in the hippocampus between controland KA-stimulatd rats. B: In situ hybridization for ERb in controland KA-stimulated brain. Changes in expression level of ERbmRNA are indicated by arrows.

ERb AND SPINE FORMATION 455

to Wistar rats. At 6 h post-KA treatment, a visible increase inmRNA signal was localized to CA3 subfield of the Ammon’shorn and the hilus of the DG. Furthermore, we noted a con-comitant decrease of ERb mRNA in the DG (Fig. 2B).

Immunohistochemistry on brain sections from kainate-treatedand control animals was used to examine how the protein of ERbbehaves under kainate-induced excitotoxicity. At 6 h after kainateapplication, the ERb protein, similar to its mRNA, was up-regu-lated in the CA regions of the hippocampus (particularly CA3) andthe hilus of the dentate gyru (Fig. 3A) while being simultaneouslydown-regulated in DG (Fig. 3A). The hippocampus was then sepa-rated into two parts: one enriched with the proteins of CA subfieldsand the other, enriched with the proteins of the DG. This was fol-lowed with immunoblotting, which confirmed the previously notedup-regulation of ERb in the CA subfields following kainate treat-ment as well as its simultaneous down-regulation in the DG (Fig.3B). The housekeeping GAPDH protein remained unchanged.

Upon closer examination of the expression of ERb in the hippo-campus, we noted pre-dominant extra-nuclear localization of this hor-mone receptor in control as well as kainate-treated rats (Fig. 4A). Thisis in good agreement with our recent report indicating that within thesame brain sections, ERb was present not only in the nucleus but also

in the cytoplasm (Kalita et al., 2005). Nuclear localization of ERbwas demonstrated in the sensory, perihinal, and entorhinal cortex(EC), in the paraventricular nuclei, as well as in the medial and lateralamygdala, while ERb in the cells of hippocampal CA subfieldsappears to be localized mostly to the peri-nuclear regions, with a veryfew scattered nuclear signal-exhibiting cells (Kalita et al., 2005; Milneret al., 2005).

Upon KA stimulation the expression of ERb increased in theCA subfields and decreased in the DG (see Fig. 2B, 3B). To furtherexplore this phenomenon, we used hippocampal tissue enrichedwith the proteins of the CA subfields, and carried out a series of cellfractionations in order to compare the subcellular location of ERbin control vs. kainate-treated hippocampi. Compared with the con-trol animals, an up-regulation of ERb was noted in the fraction ofcytosolic proteins from CA subfield-enriched tissue of kainate-stimulated rats (Fig. 4B). In contrast to cytosolic fraction, there wasno significant change in nuclear fraction (data not shown).

Effect of ERb on Dendritic Spine Densityin Hippocampal Neurons in Vitro

To explore the possible involvement of ERb protein in the pro-cess of spine formation, the ERb cDNA (and GFP, which served as

FIGURE 3. Effect of KA administration on changes in expres-sion of ERb protein in the hippocampus. A: Levels of ERb proteinexpression in hippocampus of control animals (a) and 6 h afterKA treatment (b), as determined by immunhistochemistry. B: Fol-

lowing separation of DG from the CA subfields, immunoblots withanti-ERb antibodies were performed on total protein fraction fromcontrol and KA-treated hippocampi. Reference to expression ofGAPDH.

456 SZYMCZAK ET AL.

a marker) was introduced to the hippocampal primary neuronal cul-tures by transfection with a plasmid vector. Estrogen at 0.1 lg/mlwas added 24 h after transfection directly to the culture media.Ninety six hours after transfection, hippocampal cells were stainedwith Hoechst 33258 to visualize nuclear chromatin. ERb overex-pression did not cause any signs of apoptosis or necrosis (data notshown; see morphology of neurons on Fig. 5A).

Spine density increased significantly in cultures not trans-fected with ERb after 72 h post-treatment with estradiol(Fig. 5). The estrogen effect was reduced in the presence of theoverexpressed ERb protein in these cells (Fig. 5). Overexpres-sion of ERb without estrogen stimulation does not decrease thenumber of dendritic spines, as compared to the cells transfectedwith the control plasmid (data not shown).

Two-way ANOVA analyses showed differences in the num-bers of spines across experimental groups (F(2.26) ¼ 53.97; P <0.0001). The Newman-Keuls ANOVA Post Hoc Test analysesindicated that the increase in the number of dendritic spines72 h after estrogen stimulation as well as the decrease in thenumber of spines after introducing ERb cDNA was statisticallysignificant (P < 0.001 and P < 0.01).

DISCUSSION

In this report, we present data showing marked variations inthe levels of ERb mRNA and protein in the rat hippocampusduring the estrous cycle as well as in response to kainate. Low

FIGURE 4. Effect of KA administration on expression of ERbprotein in the CA3 subfield of hippocampus (6 h post-KA). A:Confocal image of induction in ERb protein expression followingKA-induced neuronal activation, detected by immunohistochemis-

try. B: Following separation of DG from the CA subfields, immu-noblots with anti-ERb antibody were performed on cytosol frac-tion from control and KA-treated hippocampi. Reference to ex-pression of GAPDH.

ERb AND SPINE FORMATION 457

levels of endogenous estrogen are associated with reduction indendritic spines, higher abundance of ERb1 and ERb2 mRNAisoforms, as well as ERb protein. These findings are in goodagreement with changes observed after kainate administration,where decreased expression of ERb is observed during plasticity-related events in the DG. Moreover, overexpression of ERb inhippocampal cell culture inhibits the increase of dendritic spinedensity following estradiol treatment. Thus, by employing differ-ent models we come to a common observation that a decreasein ERb expression at both mRNA and protein levels occurs con-comitantly with active synaptogenesis. On the other hand, in-creases in ERb expression correlate with decreased spine density.

Effects of Estrogen on Expression of ERb

We find that, during the afternoon of proestrus, in whichthe endogenous estrogen is at highest levels, lower abundance

of ERb1 and ERb2 mRNA isoforms, as well as ERb protein inthe hippocampus is observed compared to estrous phase of thecycle, when endogenous estrogen is at low levels. These find-ings are in good agreement with results reported on ERbmRNA for other brain structures, namely the bed nuclei ofstria terminalis (BNST) and anteroventral periventicular nuclei(AVP) (Osterlund and Hurd, 1998; Zhou et al., 2002). It hasalso been shown previously that one week of estrogen replace-ment down-regulates ERb mRNA expression in PVN of ovar-iectomized females (Suzuki and Handa, 2004). Decrease ofERb mRNA level in response to exogenous estrogen was alsoreported for amygdala (Shima et al., 2003). In the previousstudies, however, the authors measured the ERb mRNA levelin brain structures where the protein was found to be localizedin cell nuclei. Our immunohistochemical analysis of hippocam-pal sections reveals that ERb protein is mainly localized to thecytoplasm of the cell bodies and not in the cell nuclei (Kalita

FIGURE 5. ERb inhibits dendritic spines density increase afterestradiol treatment. A: Hippocampal neurons were transfected atDIV12 with GFP plasmid alone and then cultured either in the ab-sence (2E) or presence (+E) of 0.1 lg/ml estradiol. Cultured neuronswere also cotransfected with estrogen receptor b (ERb)- and GFP-containing plasmids and then treated with estradiol (as before)

(ERb+E) followed by staining for GFP. Shown are examples in theGFP channel of dendrites from transfected neurons (3D recon-structed images). Scale bar: 40 lm. B: Number of spines per 10 lmof dendrite length in neurons transfected with the indicated con-structs. Histograms show mean 6 SEM; (**P < 0.01, ***P < 0.001).

458 SZYMCZAK ET AL.

et al., 2005). This is supported by recent ultrastructural studies(Milner et al., 2005). Notably, these ERb compartmentalizationfindings hold true for the human hippocampus (Savaskan et al.,2001; Lu et al., 2004), as well as the hypothalamus (Ishuninaet al., 2000; Kruijver et al., 2002, 2003).

Effects of Neuronal Stimulation onExpression of ERb

In the hippocampus, neuronal hyperactivity, in the form ofkainic acid-induced seizures, triggers a cascade of events leading toneuronal cell loss in vulnerable CA regions followed by synapticreorganization in the DG—events which engage many genes.Their expression is either induced or down-regulated in a distincttemporal and spatial pattern (for review see Zagulska-Szymczaket al., 2001). Gene expression induced throughout the hippocam-pus within a few hours (1–4 h) after initiation of seizures is linkedto kainic acid-caused depolarization and neuronal activity (Schwobet al., 1980; Kaminska et al., 1994; Riva et al., 1994). The factthat changes in ERb gene expression are specific to either the DGgranule cells (down-regulation) or the CA3 subfield (up-regula-tion) suggests that this event is not just a consequence of en-hanced neuronal activity, observed in all hippocampal subfields.Genes up-regulated in the dentate gyeus between 6 and 24 h arethought to be important in mediating neuronal functional plastic-ity (Nedivi et al., 1993; Zagulska-Szymczak et al., 2001). How-ever, if expressed in the CA subfields of hippocampal neuronsundergoing cell death, such gene products could play a role inneurodegeneration (see, e.g., Hetman et al., 1995).

In this context, the up-regulation of ERb in the CA3 regionand the hilus of the DG within 6–24 h postkainate administra-tion suggests its participation in a cell death-related mechanism,since these neurons will eventually die as a result of apoptosis(Filipkowski et al., 1994; Kaminska et al., 1994; Pollard et al.,1994). In support of this, a study in colon cancer has impli-cated ERb in the inhibition of cancer growth by inducing apo-ptosis (Qiu et al., 2002). According to the results obtained byNilsen et al. (2000), ERb mediates the induction of apoptosisin neuronal cells. Interesting also is the finding by Savaskanet al. (2001) that in the hippocampus of Alzheimer’s diseasevictims the immunoreactivity of ERb, but not ERa, wasincreased, indicating a possible role for ERb in Alzheimer’s dis-ease-related neuropathology.

Contrary to the CA regions, we found that the ERb was simul-taneously down-regulated in the DG granule cells that are resist-ant to excitotoxicity, and proceed to establish novel, though aber-rant, synapses. This differential expression pattern resembles thatseen with dystrophin (Gorecki et al., 1998). The authors point tothe fact that the granule cells in the DG are presynaptic towardsCA3 and postsynaptic with respect to the EC (the two regionsmost severely affected by neuronal cell loss following kainateadministration), it is tempting to speculate that the differentialexpression of ERb at 6 h after kainate insult may reflect itsinvolvement in some unidentified synaptic function, related tothe establishment/preservation of synaptic contacts.

Estradiol has been shown to modulate non-NMDA (AMPA/kainate)-mediated excitation of hippocampal neurons by aug-

menting the glutamatergic transmission in the hippocampus viathe cAMP-PKA pathway (Gu and Moss, 1998). A study byAbraham et al. (2003) provides the first evidence for a role ofERb in nongenomic estrogen signaling in the brain (in GnRHneurons in vivo). Considering our observation of the extra-nu-clear location as well as an up-regulation of ERb, perhaps it isthis receptor through which estradiol mediates the KA-induceddepolarization events initiated at the cell membrane.

Effects of ERb Expression on Density ofDendritic Spines

Changes in estrogen levels mediate fluctuation in the numberand density of dendritic spines as well as synapses on pyramidalneurons in the hippocampal CA1 field in vitro (Wooley et al.,1990; Woolley and McEwen, 1992; Woolley and McEwen, 1993;McEwen and Woolley, 1994) and in vivo (Murphy and Segal,1996; Gazzaley et al., 2002). It is interesting, that this effect ofestrogen on spines is not only limited to the female hippocampus,as it has been shown that estrogen injection increases spine densityin castrated male rats (Lewis et al., 1995). In this report, we pres-ent data showing marked variations in the level of ERb mRNAand protein in the rat hippocampus during estrus-related estrogenfluctuations. Therefore, it was interesting to check whether thepresence of ERb affects the formation of dendritic spines. In ahippocampal cell culture model, spine density increased signifi-cantly after treatment of the cultures with estradiol. The effect wasreduced in the presence of overexpressed ERb protein. This resultresembles a situation observed in vivo, in which the dendriticspines density decreased with an increase in the level of ERb.Prange-Kiel et al. (2003) and Kretz et al. (2004) demonstratedthat local production of estradiol by the principal hippocampalneurons is essential for maintenance of hippocampal spine synap-ses. Furthermore, when aromatase was blocked with letrozole theresulting decrease in estrogen level caused an increase in ERbexpression and a simultaneous reduction in spines. This supportsour observations and suggests that ERb indeed can serve as an en-dogenous inhibitor of dendritic spine formation.

Apart from estrogen, structural plasticity in the adult hippo-campus has been demonstrated following treatment with kainicacid. This is manifested as remodeling of the DG granular cells,including an increase in the number of dendritic spines (Suzukiet al., 1997; Wenzel et al., 2000). In the DG, spines have beenshown to increase in density as early as 24 h following kainate ex-posure (Nadler and Cuthbertson, 1980; Ben-Ari, 2001). Thepreceeding reduction in ERb expression in the DG, demon-strated herein, occurring after 6 h post-KA, might be one of themechanisms contributing to an increase in spine density.

However, we also show that KA causes an increase in ERbin CA pyramidal neurons, which should cause a reduction inspines. Notably, kainate-caused structural plasticity was alsofound to pertain to hippocampal CA3 pyramidal cells. Nadlerand Cuthbertson (1980) demonstrated that within 4 h post-KAdendritic spines have degenerated rapidly in this hippocampalarea. This observation correlates well in time and location withour observation of a robust increase in ERb expression.

ERb AND SPINE FORMATION 459

Concluding, it appears that low level of ERb expressionmight be the common denominator in estradiol-caused increasein spine density in pyramidal neurons (results from hippocam-pal cell culture) and KA-caused increase in plasticity in the DG(in vivo results), demonstrated herein.

MATERIALS AND METHODS

Animals used in KA Application

Experiments on animals were carried out in accordance with theguidelines of Polish ethical committee, and all efforts were madeto minimize animal suffering. Adult male Wistar rats (170–200 g)were housed in animal care facility with free access to food andwater, on a 12-h light/dark cycle. Males were used to eliminate theeffect of fluctuating estrogens on kainate seizures. Animals weregiven intraperitoneal injections of kainic acid (10 mg/kg) in phos-phate buffered saline (PBS) (control animals: PBS only). Most ani-mals have shown symptoms of various intensity epileptic seizures,starting with increased excitability, ‘‘wet-dog’’ shakes, and clonic-tonic seizures (status epilepticus). Only the animals reaching statusepilepticus were used in the experiment. The animals were eutha-nized (following sedation with chloral hydrate) at the followingtime points postseizure initiation: 1, 6, 24, and 72 h. In all experi-ments involving kainic acid injection 4–6 animals were used pertime point and, in parallel, 3–4 control (saline-treated) animals.

Neuronal Culture

Primary hippocampal cultures were prepared from the brainsof embryonic day 19 (E19) rats (Goslin et al., 1990). Cellswere plated on coverslips coated with poly-D-lysine (30 lg/ml)and laminin (2 lg/ml) at a density of 75,000/well. Hippocam-pal cultures were grown in Neurobasal medium (Invitrogen,Carlsbad, CA) supplemented with B27 (Invitrogen), 0.5 mMglutamine, 12.5 lM glutamate and penicillin/streptomycin mix(Invitrogen). At 14 days in vitro, hippocampal neurons weretransfected using Lipofectamine 2000 as described (Ohki et al.,2001). The transfection efficiency was about 2%.

Recombinant DNA

Full-length estrogen receptor b cDNA (Kuiper et al., 1996)was used as a template for the ERb constructs. pBluescript-ERb1plasmid was digested with ClaI and NotI and a 2,550 nt fragmentwas subcloned into the expression plasmid of the b-actin usingthe same enzyme sites.

Image Acquisition and Quantification

Confocal images were obtained using a Leica 633 objectivewith sequential acquisition setting at 1280 3 1024 pixels reso-lution. Each cell was a z series projection of approximately 15images, taken at 0.5 lm depth intervals. Transfected neuronswere chosen randomly for quantification from 5 to 8 coverslipsfrom 3 to 5 independent experiments for each construct. Singledendrites were selected randomly, and each individual spinepresent on dendrite was counted (Image NIH).

Vaginal Cytology

The estrous cycle of female rats was determined by vaginalcytology. Only regularly cycling animals (every 4–5 days) werechosen for experiments (n ¼ 5 animals in proestrus and n ¼ 5 ani-mals in estrus). Vaginal smears were taken every day before noon.The animals marked as a ‘‘proestrus’’ were euthanized late after-noon. Animals denoted as ‘‘estrus’’ were euthanized not during theearly estrous phase (not morning after proestrous) but later (that isthe second day of estrous phase). All experiments were done in thelaboratory of Dr. Alicja Markowska at Johns Hopkins University,which has granted institutional approval for these experiments. Dr.Markowska possesses extensive experience in determining thephase cycle in female rats. Briefly, to distinguish the stage of estouscycle, daily vaginal smears were collected and stained with theWright-Giemsa method (Sigma). The cell samples were observedunder the microscope and diagnosed for estrous cycle stage (estrusand proestrus). Estrus was defined as the homogeneous presence ofcornified cells in the vaginal lumen. Proestrus was defined as thetime during which the vaginal smear was characterized by the pre-dominance of large, round nucleated epithelial cells. The estrouscycle of animals was observed for at least 2 weeks before the experi-ment (Markowska, 1999). In the estrus phase, plasma estradiol lev-els are significantly lower than in the proestrous phase (Markowskaand Savonenko, 2002; data not shown).

Semiquantitative RT-PCR

For total RNA extraction, the animals were sacrificed bydecapitation (following sedation with chloral hydrate) and theirhippocampi were immediately isolated on ice and frozen at–708C. For kainic acid experiments the number of animals wasas follows: 4 control, 3 at 1 h postseizure, 4 at 6 h postseizure,and 6 at 24 h postseizure. For analysis of ERb mRNA duringestrus 5 animals in estrous phase and 5 in proestrous phase wereutilized. Total RNA was isolated using TRIZOL reagent (Sigma),in accordance with manufacturer protocol. Total RNA (1 lg)from each animal was subjected to reverse transcription. Briefly,the RNA was denatured at 658C for 10 min in the presence of50 pmols of poly-T primer, cooled immediately on ice. To eachdenatured RNA-primer mix, the following were added: 53Reverse Transcriptase buffer (Roche), 1 mM of deoxyribonucleo-tides, 10 mM of DTT (Roche), and 50 units of Expand ReverseTransciptase (Roche), in total volume of 20 ll. Synthesis ofcDNA was conducted at 428C for 50 min cDNA was eitherused immediately for PCR or stored at –708C. The cDNA ofthe following genes was analyzed with a semiquantitative PCR:estrogen receptor a (ERa GenBank acc. no. x61098), estrogenreceptor b1 (ERb1 GenBank acc. no.Q62986), estrogen receptorb2 (GenBank acc. no. AB012721), and either b-actin or GAPDH.Primers for ERa (344 bp): 50AATTCTGACAATCGACGCCAG,30GTGCTTCAACATTCTCCCTCCTC; for ERb1 (246 bp) andERb2 (300 bp): 50GAGCTCAGCCTGTTGGACC, 30GGC-CTTCACACAGAGATACTCC; for b-actin: 50TCTACAATG-TCTACAATGAGCTGC, 30ATCTCCTTCTGCATCCTGTC.The PCR was conducted in the presence of 4 lM of each specificprimer, 2 lM of each deoxyribonucleotide, Taq polimerase 103

460 SZYMCZAK ET AL.

buffer (Qiagen), Qiagen’s 53 Q-solution, MgCl2 (25 mM) 1 ll,1 unit of Taq polimerase (Qiagen), and 3 ll of cDNA solution involume of 25 ll and under the following conditions: 1 3 948C for5 min; 30 3 948C for 30 s, and annealing at: ERa �608C, ERb1and ERb2 �658C, b-actin �608C; 30 3 728C for 30 s; finalextention step at 728C for 10 min. Linear relationships betweeninput template and the amount of amplification products wereobtained. The PCR products were resolved in 2% agarose/TBE gelwith ethidium bromide, visualized under UV light and photo-graphed using a high performance CCD camera. The intensity ofethidium bromide intercalation (directly related to the amount ofPCR product) was measured, using the NIH Image software, aspixels per area. To correct for possible uneven amounts of totalRNA added into the reverse transcription reaction, the ERa,ERb1, and ERb2 products from each sample were normalizedagainst their respective b-actin amplification product and expressedas arbitrary units (a.u.) on the histogram.

In Situ Hyridization

In situ hyridization, specific for ERb, was carried out using 20lm frozen brain sections of control (n ¼ 4) and kainate-treated(n ¼ 4 per each time point) animals, attached to polylysine-coated slides. An ERb fragment of 2.6 kb was labeled with S35

using the Megaprime system (Amersham), according to the manu-facturer’s instructions, purified using the G-25 spin columns(Gibco) and used as a probe. Sections were gradually thawed toroom temperature and treated with fresh-made, cold 4% parafor-maldehyde. Following a rinse with PBS, the sections were dehy-drated in increasing concentrations of ethanol and allowed to airdry. Next, the sections were incubated for 2 h at 378C in prehy-bridization solution (23 SSC, 50% dionized formamide, 13Denhardt’s solution, 200 lg/ml single-stranded DNA, 20 mMDTT). At the end of the incubation, the prehybridization solutionwas poured off and replaced with hybridization solution (prehy-bridization solution with added 10% dextran sulfate and 300,000cpm of labeled probe per brain section). The sections were incu-bated with the hybridization solution over night in a humidifiedchamber at 378C. Next day, the sections were rinsed in 13 SSC,followed with a 1 h wash with agitation in 50% formaldehyde/13 SSC at room temperature. Next, the sections were againrinsed well with 13 SSC, dehydrated in increasing ethanol con-centrations, air-dried and exposed to X-ray film for about 1 week.

Western Blotting

Using a protein extraction buffer (10 mM Hepes, 1 mMEDTA, 295 mM sucrose, 5 mM DTT, pH 7.3, cocktail of prote-ase inhibitors; Sigma) proteins were isolated from hippocampi ofcontrol Wistar rats (n ¼ 4) and following kainate-induced seizures(n ¼ 4 per time point) as well as from rats in estrous and proes-trous phases (n ¼ 5). Concentration of proteins was calculatedspectrophotometrically using the Coomassie Protein Assay Reagent(Fluka Biochemica) and visualized on SDS-PAGE. For the immu-noblot, equal amounts of protein (10 lg) were loaded onto a10% SDS-polyacrylamide gel and separated by electrophoresis.The molecular weight markers used were PageRuler pre-stained

protein ladder (Fermentas Life Sciences) and High Range ColorMarkers (Sigma).The proteins were transfered to a nitrocellulose(PVDF) membrane (Amersham), using a semidry transfer appara-tus and the membranes were stained with Ponceau red to visualizethe transfered proteins. The membranes were blocked in 5% milkin PBST (0.02% Tween-20) and incubated overnight at 48C withthe primary antibodies. The primary antibodies were as follows:ERa (MC-20, Santa Cruz, 1:500); ERb (Z8P, Zymed, 1:300);GAPDH (Chemicon, 1:7,000). The ERb antiserum (Shughrueand Merchenthaler, 2001) corresponds to amino acids 468–485(E – ligand binding domain) of the protein and the insertion thatcreates ERb2 is between amino acid 320 and 337. Thus, Z8P rec-ognizes both isoforms, but due to a small difference, the two pro-teins are indistinquishable on regular SDS-PAGE. Following incu-bation with the appropriate peroxidase-conjugated secondary anti-body (Vector, 1:2,000) the immunoblots were developed usingthe ECLplus western blotting detection system (Amersham). TheZ8P antibody gives a single band at a distance corresponding to50–55 kd (Shughrue and Merchenthaler, 2001, Yang et al.,2004). Bands were scanned and analyzed densitometrically usingthe NIH Image program tools.

Immunohistochemistry

Primary antibodies used were the following: ERa (UpstateBiotechnology, 1:50,000), ERb (Z8P, Zymed, 1:3,000).

Control (n ¼ 3) as well as kainate-treated (n ¼ 4, per time point)animals were anesthetized with chloral hydrate and perfused throughthe heart with 2% paraformaldehyde/15% picric acid solution (Krit-zer, 2002). Brains were fixed for 24 h in the perfusion solution, cryo-protected in 30% sucrose, and frozen on dry ice. Coronal brain sec-tions (35 lm, rostral hippocampus, distance from Bregma: –2.8 to –3.9) were cut on a cryostat. For immunohistochemistry (based onprotocol by Shughrue and Merchenthaler, 2001), the sections wererinsed 3 times 5 min in cold PBS (0.1 M pH Sigma) followed withan incubation in 0.1 M glycine. Following a 2 h 48C blocking step(10% Normal Goat Serum, 1% bovine serum albumin (BSA), 1%H2O2 in PBS with 0.3% Triton X-100) the sections were incubatedwith primary antibodies for 48 h at 48C. Reactions were visualizedeither with 3,30-diaminobenzidine (DAB staining kit, Vector) orusing flourochrome-conjugated secondary antibodies (Vector,1:500). Tyramid-conjugated flourochromes (TSA cyn3, PerkinElmer Life Sciences 1:100) were used to visualize the ERa and ERbproteins. The stained sections were examined under a light micro-scope (Olympus IX70), equipped with a color camera (OlympusDP50), and with a confocal laser microscope (Leica TCS SP2).

Cell Fractionation

The hippocampus of 3 control and 3 kainate-treated (6 h post-seizures) animals were isolated and immediately frozen on dry ice.The tissue was thawed in homogenization buffer (10 mM Hepes,1 mM EDTA, 295 mM sucrose, 5 mM DTT, pH 7.3) and ho-mogenized on ice 303 in a glass homogenizer with a tight pestle.The tissues of the 3 animals from the control and kainate-treatedgroups were pooled. The fractionation protocol used was one basedon the procedure from Gray and Whittaker (1962) and modified

ERb AND SPINE FORMATION 461

by Dr. Jan Platenik (Charles University, Prague). Briefly, the ho-mogenates were centrifuged for 10 min (1,000g) and the superna-tant was subjected to centrifugation of 55 min (17,000g) to isolatethe mitochondria. The nuclear (P1) and mitochondrial (P2) pelletswere diluted in homogenization buffer, 5 and 2.5 times, respec-tively. The supernatant from the second centrifugation was againcentrifuged (100,000g) for 60 min to obtain the endoplasmic retic-ulum (P3 pellet, suspended in homogenization buffer) and thecytosol (S). The collected fractions were treated with 53 SDS solu-tion (100 lM Tris-Cl, 4% SDS, 0.2% bromophenol blue dye,20% glicerol, 200 lM DTT), denatured at 1008C for 10 min,chilled on ice, and stored at –208C, until used. Additional proteinsamples was collected prior SDS-treatment and were used for cal-culation of concentration using the Bradford method. The proteinfractions were used for immunoblotting (as detailed earlier) (Zhanget al., 2002).

Acknowledgments

The authors extend their gratitude to Dr. Hoogenraad forproviding construct expressing GFP under the control of theb-actin promoter.

REFERENCES

Abraham IM, Han SK, Todman MG, Korach KS, Herbison AE. 2003.Estrogen receptor b mediates rapid estrogen actions on gonadotro-pin-releasing hormone neurons in vivo. J Neurosci 23:5771–5777.

Ben-Ari Y. 2001. Cell death and synaptic reorganizations produced byseizures. Epilepsia 42(Suppl. 3):5–7.

Ben-Ari Y, Lagowska J, Tremblay E, Le Gal La Salle G. 1979. A newmodel of focal status epilepticus: Intra-amygdaloid application ofkainic acid elicits repetitive secondarily generalized convulsive seiz-ures. Brain Res 163:176–179.

Cardona-Gomez GP, Mendez P, DonCarlos LL, Azcoitia I, Garcia-Segura LM. 2001. Interactions of estrogens and insulin-like growthfactor-I in the brain: Implications for neuroprotection. Brain ResBrain Res Rev 37:320–323.

Daniel JM, Fader AJ, Spencer AL, Dohanich GP. 1997. Estrogenenhances performance of female rats during acquisition of a radialarm maze. Horm Behav 32:217–225.

Filipkowski RK, Hetman M, Kaminska B, Kaczmarek L. 1994. DNAfragmentation in rat brain after intraperitoneal administration ofkainate. Neuroreport 5:1538–1540.

Galanopoulou AS, Alm EM, Veliskova J. 2003. Estradiol reduces sei-zure-induced hippocampal injury in ovariectomized female but notin male rats. Neurosci Lett 342:201–205.

Gazzaley A, Kay S, Benson DL. 2002. Dendritic spine plasticity inhippocampus. Neuroscience 111:853–862.

Good M, Day M, Muir JL. 1999. Cyclical changes in endogenous lev-els of oestrogen modulate the induction of LTD, LTP in the hip-pocampal CA1 region. Eur J Neurosci 11:4476–4480.

Gorecki DC, Lukasiuk K, Szklarczyk AW, Kaczmarek L. 1998. Kai-nate-evoked changes in dystrophin mRNA levels in the rat hippo-campus. Neuroscience 84:467–477.

Goslin K, Schreyer DJ, Skene JH, Banker G. 1990. Changes in thedistribution of GAP-43 during the development of neuronal polar-ity. J Neurosci 10:588–602.

Gray EG, Whittaker VP. 1962. The isolation of nerve endings frombrain: An electron-microscopic study of cell fragments derived byhomogenization and centrifugation. J Anat 96:79–88.

Green PS, Gridley KE, Simpkins JW. 1996. Estradiol protects againstb-amyloid (25–35)-induced toxicity in SK-N-SH human neuro-blastoma cells. Neurosci Lett 218:165–168.

Gu Q, Moss RL. 1998. Novel mechanism for non-genomic action of17b-oestradiol on kainate-induced currents in isolated rat CA1 hip-pocampal neurones. J Physiol 506:745–754.

Hetman M, Filipkowski RK, Domagala W, Kaczmarek L. 1995. Ele-vated cathepsin D expression in kainate-evoked rat brain neurode-generation. Exp Neurol 136:53–63.

Hilton GD, Ndubuizu AN, McCarthy MM. 2004. Neuroprotectiveeffects of estradiol in newborn female rat hippocampus. Brain ResDev Brain Res 150:191–198.

Ishunina TA, Kruijver FP, Balesar R, Swaab DF. 2000. Differentialexpression of estrogen receptor a and b immunoreactivity in the hu-man supraoptic nucleus in relation to sex and aging. J Clin Endocri-nol Metab 85:3283–3291.

Kajta M, Beyer C. 2003. Cellular strategies of estrogen-mediated neu-roprotection during brain development. Endocrine 21:3–9.

Kalita K, Szymczak S, Kaczmarek K. 2005. Non-nuclear estrogen re-ceptor b and a in the hippocampus of male and female rats. Hip-pocampus 15:404–412.

Kaminska B, Filipkowski RK, Zurkowska G, Lason W, Przewlocki R,Kaczmarek L. 1994. Dynamic changes in composition of AP-1transcription factor DNA binding activity in rat brain followingkainate induced seizures and cell death. Eur J Neurosci 6:1558–1566.

Kaminska B, Filipkowski RK, Biedermann IW, Konopka D, NowickaD, Hetman M, Dabrowski M, Gorecki DC, Lukasiuk K, Szklarc-zyk AW, Kaczmarek L. 1997. Kainate-evoked modulation of geneexpression in rat brain. Acta Biochim Pol 44:781–789.

Kow LM, Zemlan FP, Pfaff DW. 1980. Responses of lumbosacral spi-nal units to mechanical stimuli related to analysis of lordosis reflexin female rats. J Neurophysiol 43:27–45.

Kretz O, Fester L, Wehrenberg U, Zhou L, Brauckmann S, Zhao S,Prange-Kiel J, Naumann T, Jarry H, Frotscher M, Rune GM.2004. Hippocampal synapses depend on hippocampal estrogensynthesis. J Neurosci 24:5913–5921.

Krezel W, Dupont S, Krust A, Chambon P, Chapman PF. 2001.Increased anxiety and synaptic plasticity in estrogen receptor b-defi-cient mice. Proc Natl Acad Sci USA 98:12278–12282.

Kritzer MF. 2002. Regional, laminar, and cellular distribution of immu-noreactivity for ER a and ER b in the cerebral cortex of hormonallyintact, adult male and female rats. Cereb Cortex 12:116–128.

Kruijver FP, Balesar R, Espila AM, Unmehopa UA, Swaab DF.2002. Estrogen receptor-a distribution in the human hypothala-mus in relation to sex and endocrine status. J Comp Neurol 454:115–139.

Kruijver FP, Balesar R, Espila AM, Unmehopa UA, Swaab DF. 2003.Estrogen-receptor-b distribution in the human hypothalamus: Simi-larities and differences with ER a distribution. J Comp Neurol 466:251–277.

Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA.1996. Cloning of a novel receptor expressed in rat prostate andovary. Proc Natl Acad Sci USA 93:5925–5930.

Lewis C, McEwen BS, Frankfurt M. 1995. Estrogen-induction of den-dritic spines in ventromedial hypothalamus and hippocampus:Effects of neonatal aromatase blockade and adult GDX. Brain ResDev Brain Res 87:91–95.

Li X, Schwartz PE, Rissman EF. 1996. Distribution of estrogen receptor-b-like immunoreactivity in rat forebrain. Neuroendocrinology 66:63–67.

Lu YP, Zeng M, Swaab DF, Ravid R, Zhou JN. 2004. Colocalizationand alteration of estrogen receptor-a and -b in the hippocampusin Alzheimer’s disease. Hum Pathol 35:275–280.

Lubahn DB, Moyer JS, Golding TS, Couse JF, Korach KS, SmithiesO. 1993. Alteration of reproductive function but not prenatal sex-ual development after insertional disruption of the mouse estrogenreceptor gene. Proc Natl Acad Sci USA 90:11162–11166.

462 SZYMCZAK ET AL.

Luine VN, Richards ST, Wu VY, Beck KD. 1998. Estradiol enhanceslearning and memory in a spatial memory task and effects levels ofmonoaminergic neurotransmitters. Horm Behav 34:149–162.

Markowska LA. 1999. Sex dimorphism in the rate of age-relateddecline in spatial memory: Relevance to alternation in the estrouscycle. J. Neurosci 19:8122–8133.

Markowska AL, Savonenko AV. 2002. Effectiveness of estrogenreplacement in restoration of cognitive function after long-termestrogen withdrawal in aging rats. J Neurosci 22:10985–10995.

Maruyama K, Endoh H, Sasaki-Iwaoka H, Kanou H, Shimaya E,Hashimoto S, Kato S, Kawashima H. 1998. A novel isoform of ratestrogen receptor b with 18 amino acid insertion in the ligandbinding domain as a putative dominant negative regular of estro-gen action. Biochem Biophys Res Commun 246:142–147.

McEwen BS, Woolley CS. 1994. Estradiol and progesterone regulateneuronal structure and synaptic connectivity in adult as well asdeveloping brain. Exp Gerontol 29:431–436.

Meisel RL, O’Hanlon JK, Sachs BD. 1984. Differential maintenanceof penile responses and copulatory behavior by gonadal hormonesin castrated male rats. Horm Behav 18:56–64.

Milner TA, Ayoola K, Drake CT, Herrick SP, Tabori NE, McEwenBS, Warrier S, Alves SE. 2005. Ultrastructural localization of estro-gen receptor b immunoreactivity in the rat hippocampal formation.J Comp Neurol 491:81–95.

Murphy DD, Segal M. 1996. Regulation of dendritic spine density incultured rat hippocampal neurons by steroid hormones. J Neurosci16:4059–4068.

Nadler JV, Cuthbertson GJ. 1980. Kainic acid neurotoxicity towardhippocampal formation: Dependence on specific excitatory path-ways. Brain Res 195:47–56.

Nedivi E, Hevroni D, Naot D, Israeli D, Citri Y. 1993. Numerous can-didate plasticity-related genes revealed by differential cDNA cloning.Nature 363:718–722.

Nilsen J, Mor G, Naftolin F. 2000. Estrogen-regulated developmentalneuronal apoptosis is determined by estrogen receptor subtype andthe Fas/Fas ligand system. J Neurobiol 43:64–78.

Ohki EC, Tilkins ML, Ciccarone VC, Price PJ. 2001. Improving thetransfection efficiency of post-mitotic neurons. J Neurosci Methods112:95–99.

Osterlund MK, Hurd YL. 1998. Acute 17b-estradiol treatment down-regulates serotonin 5HT1A receptor mRNA expression in the limbicsystem of female rats. Brain Res Mol Brain Res 55:169–172.

Pollard H, Charriaut-Marlangue C, Cantagrel S, Represa A, RobainO, Moreau J, Ben-Ari Y. 1994. Kainate-induced apoptotic celldeath in hippocampal neurons. Neuroscience 63:7–18.

Prange-Kiel J, Wehrenberg U, Jarry H, Rune GM. 2003. Para/autocrineregulation of estrogen receptors in hippocampal neurons. Hippocam-pus 13:226–234.

Qiu Y, Waters CE, Lewis AE, Langman MJ, Eggo MC. 2002. Oestro-gen-induced apoptosis in colonocytes expressing oestrogen receptor b.J Endocrinol 174:369–377.

Riva MA, Donati E, Tascedda F, Zolli M, Racagni G. 1994. Short-and long-term induction of basic fibroblast growth factor geneexpression in rat central nervous system following kainate injection.Neuroscience 59:55–65.

Savaskan E, Olivieri G, Meier F, Ravid R, Muller-Spahn F. 2001. Hip-pocampal estrogen b-receptor immunoreactivity is increased in Alz-heimer’s disease. Brain Res 908:113–119.

Schwob JE, Fuller T, Price JL, Olney JW. 1980. Widespread patternsof neuronal damage following systemic or intracerebral injectionsof kainic acid: A histological study. Neuroscience 5:991–1014.

Segal M, Murphy D. 2001. Estradiol induces formation of dendriticspines in hippocampal neurons: Functional correlates. Horm Behav40:156–159.

Shima N, Yamaguchi Y, Yuri K. 2003. Distribution of estrogen recep-tor b mRNA-containing cells in ovariectomized and estrogen-treated female rat brain. Anat Sci Int 278:85–97.

Shughrue PJ, Lane MV, Merchenthaler I. 1997. Comparative distribu-tion of estrogen receptor-a and -b mRNA in the rat central nerv-ous system. J Comp Neurol 388:507–525.

Shughrue PJ, Merchenthaler I. 2001. Distribution of estrogen receptorbeta immunoreactivity in the rat central nervous system. J CompNeurol 436:64–81.

Simpkins JW, Rajakumar G, Zhang YQ, Simpkins CE, Greenwald D,Yu CJ, Bodor N, Day AL. 1997. Estrogens may reduce mortalityand ischemic damage caused by middle cerebral artery occlusion inthe female rat. J Neurosurg 87:724–730.

Sperk G, Lassmann H, Baran H, Kish SJ, Seitelberger F, HornykiewiczO. 1983. Kainic acid induced seizures: Neurochemical and histo-pathological changes. Neuroscience 10:1301–1315.

Suzuki F, Makiura Y, Guilhem D, Sorensen JC, Onteniente B. 1997.Correlated axonal sprouting and dendritic spine formation duringkainate-induced neuronal morphogenesis in the dentate gyrus ofadult mice. Exp Neurol 145:203–213.

Suzuki S, Handa RJ. 2004. Regulation of estrogen receptor-b expressionin the female rat hypothalamus: Differential effects of dexamethasoneand estradiol. Endocrinology 145:3658–3670.

Wang L, Andersson S, Warner M, Gustafsson JA. 2001. Morphologi-cal abnormalities in the brains of estrogen receptor b knockoutmice. Proc Natl Acad Sci USA 98:2792–2796.

Weiland NG. 1992. Estradiol selectively regulates agonist binding siteson the N-methyl-D-aspartate receptor complex in the CA1 regionof the hippocampus. Endocrinology 131:662–668.

Wenzel HJ, Woolley CS, Robbins CA, Schwartzkroin PA. 2000.Kainic acid-induced mossy fiber sprouting and synapse formationin the dentate gyrus of rats. Hippocampus 10:244–260.

Woolley CS. 2000. Estradiol facilitates kainic acid-induced, but notflurothyl-induced, behavioral seizure activity in adult female rats.Epilepsia 41:510–515.

Woolley CS, Gould E, Frankfurt M, McEwen BS. 1990. Naturallyoccurring fluctuation in dendritic spine density on adult hippocam-pal pyramidal neurons. J Neurosci 10:4035–4039.

Woolley CS, McEwen BS. 1992. Estradiol mediates fluctuation in hip-pocampal synapse density during the estrous cycle in the adult rat.J Neurosci 12:2549–2554.

Woolley CS, McEwen BS. 1993. Roles of estradiol and progesteronein regulation of hippocampal dendritic spine density during theestrous cycle in the rat. J Comp Neurol 336:293–306.

Yang SH, Liu R, Perez EJ, Wen Y, Stevens SM Jr, Valencia T, Brun-Zinkernagel AM, Prokai L, Will Y, Dykens J, Koulen P, SimpkinsJW. 2004. Mitochondrial localization of estrogen receptor b. ProcNatl Acad Sci USA 101:4130–4135.

Zagulska-Szymczak S, Filipkowski RK, Kaczmarek L. 2001. Kainate-induced genes in the hippocampus: Lessons from expression patterns.Neurochem Int 38:485–501.

Zhang JQ, Cai WQ, Zhou de S, Su BY. 2002. Distribution and differ-ences of estrogen receptor b immunoreactivity in the brain of adultmale and female rats. Brain Res 935:73–80.

Zhou W, Cunningham KA, Thomas ML. 2002. Estrogen regulationof gene expression in the brain: A possible mechanism altering theresponse to psychostimulants in female rats. Mol Brain Res 100:75–83.

ERb AND SPINE FORMATION 463