Nematology, 2009, Vol. 11(3), 355-364

Identification of putative expansin-like genes from the pine woodnematode, Bursaphelenchus xylophilus, and evolution of the

expansin gene family within the Nematoda

Taisei KIKUCHI 1, Hongmei LI 2,3, Nurul KARIM 1, Malcolm W. KENNEDY 4,Maurice MOENS 3,5 and John T. JONES 6,7,∗

1 Forestry and Forest Products Research Institute, Tsukuba, Ibaraki 305-8687, Japan2 Department of Plant Pathology, Nanjing Agricultural University, Nanjing 210095, China

3 ILVO, Burg. Van Gansberghelaan 96, 9820 Merelbeke, Belgium4 Faculty of Biomedical & Life Sciences, Environmental & Evolutionary Biology,

University of Glasgow, Glasgow G12 8QQ, UK5 Laboratory for Agrozoology, Ghent University, Coupure Links 653, 9000 Gent, Belgium

6 PPP Programme, SCRI, Invergowrie, Dundee DD2 5DA, UK7 Biology Department, Ghent University, K.L. Ledeganckstraat 35, 9000 Ghent, Belgium

Received: 28 April 2008; revised: 14 July 2008Accepted for publication: 31 July 2008

Summary – We report the cloning and characterisation of genes encoding expansin-like proteins from the pine wood nematodes,Bursaphelenchus xylophilus and B. mucronatus. A small family of genes is present in both species and the Bursaphelenchus genes aremost similar to expansins and expansin-like proteins from the potato cyst nematode Globodera rostochiensis and root-knot nematodes.Molecular modelling suggests that the genes could encode a protein with a structure similar to that of functionally characterisedexpansins. Expression analysis showed that the Bursaphelenchus expansin-like genes are expressed solely in the pharyngeal glandcells, implying a role in the host-parasite interaction, most likely in assisting migration through the plant. Some G. rostochiensis androot-knot nematode expansins are composed of a carbohydrate-binding domain coupled to an expansin domain but no carbohydratebinding domain is present on any of the Bursaphelenchus sequences. We suggest a model for evolution of the expansin gene familywithin the plant-parasitic nematodes of the Tylenchida and Aphelenchida.

Keywords – evolution, horizontal gene transfer, host-parasite interactions, molecular biology.

Nematodes attack plants using a range of different feed-ing strategies and cause extensive economic losses inagriculture and forestry industries across the world. Re-cent phylogenetic studies on the various groups of plant-parasitic nematodes have shown that parasitism of plantsby nematodes has arisen on several independent occasionswithin the phylum Nematoda (Blaxter et al., 1998; Bald-win et al., 2004, Holterman et al., 2006). Plant-parasiticnematodes are present in various clades distributed acrossthe entire phylum, including the Triplonchida, Dorylaim-ida and Tylenchida (Fig. 1). It is thought that plant para-sitism has arisen twice in one clade: once to give rise toa large group (Tylenchida) that includes the cyst formingand root-knot nematodes, which are sedentary endopara-

∗ Corresponding author, e-mail: jjones@scri.ac.uk

sites that have biotrophic interactions with their hosts, andon another occasion (Aphelenchida) to give rise to migra-tory endoparasitic nematodes including those within thegenus Bursaphelenchus (Fig. 1). Bursaphelenchus spp.are part of the Family Aphelenchoididae and 70 speciesare described for the genus (Ryss et al., 2005; Ye et al.,2007). Almost all the nematodes in this clade are fungalfeeders, including most Bursaphelenchus species, whichare usually found in dead or dying trees feeding on fungicolonising the tree. Cerambycid beetles are used as vec-tors by these nematodes, transmitting them to new dead ordying trees during oviposition by the adult beetles. How-ever, B. xylophilus is unusual in that it is also capable offeeding on live tree material and is transmitted to live trees

© Koninklijke Brill NV, Leiden, 2009 DOI:10.1163/156854109X446953Also available online - www.brill.nl/nemy 355

T. Kikuchi et al.

during feeding episodes of the adult beetles. Bursaphe-lenchus xylophilus is thought to have originated in NorthAmerica where it causes little damage due to the evolu-tion of resistance or tolerance by its native hosts. How-ever, B. xylophilus was introduced into the Far East at thebeginning of the 20th century where it causes extensivedamage to forests. The life cycle and pathology of B. xy-lophilus have recently been reviewed (Jones et al., 2008).

All plant endoparasitic nematodes need to invade andmigrate within their hosts and in order to do so they mustovercome the barrier presented by the plant cell wall.The plant cell wall is a complex but highly organised com-posite of polysaccharides and proteins. Cellulose, formedby β-1-4 linked chains of glucan sugars, is the most abun-dant polymer in the plant cell wall and exists in the form

of microfibrils that are formed from dozens of individ-ual polysaccharide chains hydrogen bonded to one an-other along their length. These microfibrils are furthercross-linked to one another by hydrogen bonded cross-linking glycans and embedded within a matrix formedfrom pectins. It has been shown that many plant-parasiticnematodes contain endogenous cell wall degrading en-zymes that allow them to break down the various compo-nents of the plant cell wall. These enzymes include cellu-lases (ß1,4-endoglucanases) Smant et al., 1998; Kikuchiet al., 2004) and pectate lyases (Popeijus et al., 2000;Kikuchi et al., 2006). The presence of these enzymes isunusual; these genes are not usually present in any ani-mals and it is thought that the genes may have been ac-quired by horizontal gene transfer (Scholl et al., 2003;

Fig. 1. Simplfied phylogenetic tree of the Phylum Nematoda. Clades containing plant-parasitic nematodes are highlighted. Inset:detailed phylogeny of Tylenchida; clades containing root-knot and cyst-forming nematodes are highlighted.

356 Nematology

Expansin-like genes from Bursaphelenchus xylophilus

Jones et al., 2005). Remarkably, there is evidence thatsome of the genes present in cyst and root-knot nema-todes and Bursaphelenchus were acquired in completelyindependent horizontal gene transfer events; the cellu-lases present in cyst and root-knot nematodes appear tohave been acquired from bacteria while those present inBursaphelenchus are likely to have been acquired fromfungi (Kikuchi et al., 2004; Jones et al., 2005). Manyof the cyst and root-knot nematode cellulases are com-posed of a carbohydrate binding domain (CBD) from car-bohydrate binding module family II (CBM2) coupled to acatalytic domain most similar to (bacterial) glycosyl hy-drolase family 5 (GHF5) proteins. In addition, cyst androot-knot nematodes express proteins consisting solely ofthe CBD, and these are also CBM2-like proteins (e.g., Gaoet al., 2004).

Expansins are proteins that are thought to operate byloosening non-covalent interactions between componentsof the plant cell wall, making the individual compo-nents vulnerable to enzymatic attack (Cosgrove, 2000).In plants they consist of an expansin domain fused to aC-terminal carbohydrate binding domain. These proteinswere thought to be specific to plants but recently an en-zymatically active expansin has been identified from thepotato cyst nematode Globodera rostochiensis (Qin et al.,2004). This expansin consists of a carbohydrate bindingdomain fused to an expansin domain and similar pro-teins have been reported from other cyst nematodes androot-knot nematodes (G. Smant, pers. comm.). Expansin-like sequences are also present in cyst and root-knotnematodes that do not have the carbohydrate binding do-main. Here we report the cloning and characterisation ofexpansin-like sequences from B. xylophilus and B. mu-cronatus. The genes are composed of expansin domainsalone, with no carbohydrate binding domains present. Weuse these sequences to examine the evolution of this genefamily within the Nematoda.

Materials and methods

BIOLOGICAL MATERIAL

Several isolates of B. xylophilus and B. mucronatuswere used in this study and are summarised in Table 1.The Ka4 isolate from Ibaraki Prefecture, Japan (B. xylo-philus) and the Un1 strain (B. mucronatus) were used forall gene isolation experiments. The BxPOT isolate fromPortugal (B. xylophilus) and BmNJ from Nanjing, China(B. mucronatus) populations were used for in situ hybridi-

sation studies. As part of this study we also examinedsequence variation in the Bx-expb1 gene in populationsfrom around the world: no significant differences in thesequences were observed (see below) reassuring us thatusing different populations for in situ hybridisation andgene isolation was unlikely to cause problems.

Nematodes were cultured at 25◦C on Botrytis cinereagrown on autoclaved barley grains or on potato dextroseagar plates. Nematodes were collected using a modifiedBaermann funnel technique (Southey, 1986) and cleanedin several rinses of sterile distilled water before use.

GENE ISOLATION

The B. xylophilus and B. mucronatus expansin-like se-quences were identified from ESTs generated from thesespecies (Kikuchi et al., 2007). The B. xylophilus sequencewas identified as a contig consisting of five individualESTs while the B. mucronatus sequence was present asa singleton. The full length coding regions of both se-quences were amplified from cDNA from the originalpopulations and from other Bursaphelenchus populationsfrom around the world (Table 1) using primers BxEXPFand BxEXPR (Table 2). For these experiments mRNAwas extracted from mixed stage nematodes using a Dyn-abeads mRNA DIRECT Micro Kit (DYNAL; Invitrogen,Paisley, UK) following the manufacturer’s instructions,and was converted to cDNA using the Superscript III sys-tem (Invitrogen).

A 5′RACE reaction was performed in order to ascertainthat the sequences were complete at the 5′end. For this,mRNA was extracted from nematodes as described aboveand converted to double stranded cDNA using the LD-PCR protocol described in the SMART cDNA synthesissystem (BD Biosciences, Oxford, UK). A nested PCRreaction using first the BxEXPR and SMART 5′ PCRprimer followed by a second PCR using the BxISHRand SMART 5′ PCR primers was then run and theresulting PCR product was cloned into the pGEM TEasy vector (Promega, Southampton, UK) following themanufacturer’s instructions. All DNA sequences wereobtained using a Big Dye terminator 3.1 sequencing kitaccording to the manufacturer’s instructions, with reactionproducts separated on an ABI 3730 capillary sequencer(Applied Biosystems, Foster City, CA, USA).

Genomic sequences were obtained by PCR using pri-mers BxEXP0f and BxEXP0r on gDNA extracted frommixed stages of B. xylophilus and B. mucronatus. PCRproducts were sequenced directly.

Vol. 11(3), 2009 357

T. Kikuchi et al.

Table 1. Populations of Bursaphelenchus xylophilus and B. mucronatus used in this study.

Species Population code Origin Host

B. xylophilus Ka4 Ibaraki Prefecture, Japan Pinus densifloraB. xylophilus BxSD Shandong, China P. thunbergiiB. xylophilus BxLYG Jiangsu, China P. thunbergiiB. xylophilus BxCAN Canada UnknownB. xylophilus BxJAP Japan P. thunbergiiB. xylophilus BxPOT Portugal P. sylvestrisB. xylophilus T4 Iwate Prefecture, Japan P. densifloraB. xylophilus C14-5 Chiba Prefecture, Japan Monochamus alternatus (vector)B. mucronatus Un1 Nagasaki Prefecture, Japan P. densifloraB. mucronatus BmNJ Nanjing, China P. thunbergii

Table 2. Primers used in this study.

Primer Sequence (5′ → 3′) Use

BxEXPF GACCAGATCACTCCCCAGTTGA In situ hybridisation, gene isolationBxEXPISHR ACAGCAGTTTTTCCCTTGTAC In situ hybridisation, 5′ RACEBxEXPR ACATCCGCTGGCAGGGCTAG Gene isolationBxEXP0f CACCGTAAAGATGAATCGCGT Gene isolationBxEXP0r CTGTTGCCGTCTTAACATCC Gene isolationSMART 5′ PCR AAGCAGTGGTATCAACGCAGAGT 5′RACE

All PCR reactions contained 1× Reaction buffer (Pro-mega), 1.5 mM MgCl2, 200 μM dNTPs, 1 μM eachprimer, 1 unit Taq DNA polymerase (Promega) and an ap-propriate quantity of template DNA. For 5′RACE KODhot-start polymerase (Novagen, Merck, Nottingham, UK)was used with the buffer provided in place of Taq. Ampli-fication was carried out using a Applied Biosystems PCR9700 thermal cycler (Applied Biosystems) employing aninitial denaturation step at 94◦C for 2 min, 30 reaction cy-cles of denaturing at 94◦C for 30 s, annealing at 55◦C for30 s (with the temperature adjusted depending on the T m

of each primer pair) and extension at 72◦C for 1min, fol-lowed by a final extension at 72◦C for 7 min.

SEQUENCE ANALYSIS

Initial sequence comparisons were run using BLASTPand BLASTX searching of protein databases at NCBI(http://www.ncbi.nlm.nih.gov/blast/Blast.cgiURL). Se-quence alignments were generated using Muscle (Edgar,2004) and displayed Boxshade. Signal peptides were pre-dicted using SignalP (Bendtsen et al., 2004).

The sequences described in this study have been sub-mitted to GenBank under the accession numbersAB374536 (Bx-expb-1 mRNA), AB374537 (Bx-expb-1

gDNA), AB374538 (Bm-expb-1 mRNA) and AB374539(Bm-expb-1 gDNA).

PROTEIN 3-D MOLECULAR MODELLING

Multiple amino acid sequence alignments were madeusing MultAlin accessed via the ExPasy server (http://www.expasy.ch) set for either the Blosum62 or Dayhoffevolutionary substitution matrices in order to identify themost highly conserved regions in the sequences fromplant-parasitic nematodes. Homology modelling of themost highly conserved ‘core’ region or the complete se-quence of the mature (excluding the presumptive secre-tory signal peptide) sequence was then carried out us-ing SwissModel (http://swissmodel.expasy.org) or Phyre(http://www.sbg.bio.ic.ac.uk/∼phyre).

SOUTHERN BLOTTING

One μg of nematode genomic DNA was digestedwith EcoRI or HindIII, separated on an agarose geland blotted onto Hybond-N + Nylon membranes (Amer-sham Biosciences, Amersham, UK) using standard pro-tocols. Hybridisation and detection were performed witha digoxigenin-labelled DNA probe from Bx-expb1 made

358 Nematology

Expansin-like genes from Bursaphelenchus xylophilus

by PCR amplification of the full-length cDNA from theoriginal plasmid with primers BxEXP0f and BxEXP0r.

IN SITU HYBRIDISATION

In situ hybridisation was performed as described in DeBoer et al. (1998). Primers BxEXPF and BxEXPISHR(Table 2) were used to amplify a 250 bp fragment ofthe Bx-expb1 or Bm-expb1 gene from plasmid stocks ofthe cDNA clone. Sense or antisense strands were labelledwith digoxigenin by asymmetric PCR and hybridised tofixed, permeabilised fragments of mixed stage B. xylophi-lus and B. mucronatus. After washing to remove unboundprobe, specifically hybridising probe was detected usingAlkaline-phosphatase conjugated Anti-Digoxigenin anti-body (Roche Diagnostics, Burgess Hill, UK).

Results

CHARACTERISATION OF THE BURSAPHELENCHUS

EXPANSIN-LIKE SEQUENCES

Analysis of ESTs from B. xylophilus and B. mucronatusled to the identification of two cDNA sequences thatcould encode expansin-like proteins. The B. xylophiluscDNA sequence was 593 nt in length (excluding thepoly A tail) and could encode a protein of 171 aminoacids with a predicted molecular mass of 17.602 kDa.The B. mucronatus sequence could encode a protein of151 amino acids with a predicted molecular mass of15.845 kDa. A signal peptide is predicted by SignalPat the N-terminus of the predicted proteins from bothB. xylophilus and B. mucronatus. The B. xylophilus andB. mucronatus sequences share 68% identity at the aminoacid level. BLASTP and BLASTX searches showed thatthe Bursaphelenchus sequences were most similar toexpansins and expansin-like sequences from the potatocyst nematode G. rostochiensis (between 50 and 54%identity for the B. xylophilus sequence and 46% identityfor the B. mucronatus sequence) (Qin et al., 2004; Kudlaet al., 2005), to various uncharacterised bacterial proteins,and to secreted proteins from the root-knot nematodeMeloidogyne incognita (approx. 35% identity for both theB. xylophilus and B. mucronatus sequences) (Semblat etal., 2001) (Fig. 2). In addition, a match to a sequenceannotated as a B. xylophilus expansin (accession numberABV60414) was obtained. However, this sequence isnot represented in the extensive EST sequence set fromB. xylophilus (Kikuchi et al., 2007) and in experiments

using our own B. xylophilus cDNA and gDNA stocks wehave been unable to amplify this sequence.

All of the expansin-like sequences from Bursaphelen-chus consisted solely of an expansin-like domain. By con-trast, some of the expansin and expansin-like sequencesfrom G. rostochiensis consist of two domains, a carbo-hydrate binding domain from the CBD2 family coupledto an expansin domain (Fig. 2). No CBM2 domains havepreviously been identified from any B. xylophilus pro-teins and no such domain was present on the expansin-likesequences reported here. The Bursaphelenchus predictedproteins were more similar to beta expansins than alphaexpansins, with the highest (albeit low) similarity to betaexpansin 2 from Arabidopsis thaliana (Accession numberQ9SHY6).

PROTEIN MOLECULAR MODELLING

The B. xylophilus amino acid sequence was alignedwith the GrEXPB1, GrEXPB2 and GrEXP1 sequencesand the region showing greatest conservation (‘core se-quence’; Lys25 to Leu122) extracted for homology mod-elling. Automatic modelling with SwissModel failed be-cause no suitable template could be identified even atthe lowest sequence-comparison BLAST E-value per-mitted. The sequence was therefore submitted to Phyre(www.sbg.bio.ic.ac.uk/∼phyre), which uses fold recog-nition and secondary structure information to search fortemplates. This yielded a model based on the known crys-tal structure of an expansin-related protein from Bacillussubtilis (PDB accession 2BH0). A similar search usingthe complete B. xylophilus sequence excluding the pre-sumptive secretory signal sequence (from Pro22) yieldeda model based on the crystal structure of an expansin frompollen of Timothy grass, Phleum pratense (PDB accession1N10). The two templates exhibit closely similar folds,so are members of the same protein family, both inter-act with carbohydrate structures, so are presumably func-tionally related if not homologous in function. The twomodels had a predicted fold very similar to the N-terminaldomains of the template structures, namely a ß/extendedstucture-rich domain in which the ß structures form a bar-rel with two very short regions of α-helix. Ramachandranplots of both models show good geometry, with the modelbased on the core sequence being the better, having 79.4%of amino acid positions in ideal regions, 17.5% in accept-able regions, and only 3.1% in normally disallowed re-gions. Therefore, it is probable that the B. xylophilus pro-tein folds to form a tertiary structure similar to that of

Vol. 11(3), 2009 359

T. Kikuchi et al.

Fig. 2. Alignment of Bursaphelenchus expansin-like sequences with expansin (GrEXPB1) and expansin-like sequences (GrEXP1 andGrEXPB2) from Globodera rostochiensis. The CBM2 domain from a G. rostochiensis cellulase (accession number AAC63988) isaligned with the CBM2 domains of two of the G. rostochiensis sequences (first two lines). Conserved residues are shaded in black,conserved substitutions are shaded in grey. Residues proposed as conserved between alpha and beta expansins in plants are listedbeneath the alignment. The position of the B. xylophilus and B. mucronatus intron is indicated above the alignment with an asterisk.

N-terminal domain of expansins and, thus, may be func-tionally similar.

Although enzymatic activity has not been proven forthe expansin-like sequences described here, we havetentatively named these genes Bx-expb1 (B. xylophilus)and Bm-expb1 (B. mucronatus) on the basis of theirsimilarity to functionally characterised expansins fromG. rostochiensis and the presence of many conservedresidues present in plant alpha and beta expansins.

CHARACTERISATION OF THE B. XYLOPHILUS GENE

FAMILY

A Southern blot showed that the expansin-like se-quences are present in both B. xylophilus and B. mucro-natus as a small gene family (Fig. 3). This also served

to verify that the sequences were endogenous nematodesequences rather than being derived from contaminatingmicro-organisms. Analysis of the genomic sequences ofBx-expb1 and Bm-expb1 showed that a single intron ispresent at the same position in each sequence (Fig. 2).The intron is 220 bp in length in Bx-expb1 and 875 bpin length in Bm-expb1.

Variation in map1, a gene which encodes a secretedprotein from M. incognita similar to Bx-expb1 and Bm-expb1, has been shown to be associated with virulenceagainst the Mi resistance gene (Semblat et al., 2001).Therefore, we examined whether polymorphisms werepresent in Bx-expb1 in populations of B. xylophilusof varying natural pathogenicity and virulence. Eventhough approximately 40 independently derived cDNAclones from geographically diverse populations (BxSD,

360 Nematology

Expansin-like genes from Bursaphelenchus xylophilus

Fig. 3. Southern blot showing hybridisation of probe derivedfrom expansin-like sequence to gDNA of Bursaphelenchusxylophilus (lanes 1, 2) and B. mucronatus (lanes 3, 4).

BxLYG, BxCAN, BxJAP, BxPOT) were sequenced intheir entirety, less than 0.1% sequence divergence wasobserved, a figure lower than that obtained for an internalhousekeeping control gene (actin). None of the (few)observed polymorphisms led to changes in the predictedamino acid sequences.

TRANSCRIPTIONAL ANALYSIS

In situ hybridisation showed that expression of theexpansin-like genes was restricted to the pharyngeal glandcells in both B. xylophilus and B. mucronatus (Fig. 4).Staining was observed in juvenile and adult nematodesrather than being restricted to a specific life stage. Nohybridisation of a control probe was observed in anysamples (not shown).

Discussion

We have identified a family of genes present in bothB. xylophilus and B. mucronatus encoding expansin-

like proteins. Although we have not demonstrated bio-chemical activity for the Bursaphelenchus expansin-likeproteins (due to the fact that production of functional re-combinant expansin proteins is extremely problematic)molecular modelling of the predicted B. xylophilus se-quence suggests that it could form a similar structure to afunctionally characterised expansin. Expression of at leastone of the genes from each species is restricted to the pha-ryngeal gland cells, proteins from which are known to besecreted into the host (Kikuchi et al., 2004). It thereforeseems likely that the expansin-like proteins facilitate mi-gration through plant tissues by enhancing degradation ofplant cell walls by cell wall degrading enzymes. The factthat the expansin-like sequences, like the previously char-acterised cellulases (Kikuchi et al., 2004), are presentin the pathogenic B. xylophilus and the non-pathogenicB. mucronatus implies that they are used in migrationthrough plant tissues rather than playing a role in patho-genesis per se. The absence of expansin-like sequencesfrom any other (non plant-parasitic) nematodes (or indeedany other animals) and the presence of similar sequencesin bacteria has led to the suggestion that the genes en-coding these proteins were acquired by horizontal genetransfer (Kudla et al., 2005).

The expansin-like sequences of Bursaphelenchus con-sist solely of the expansin domain itself. Expansin-likeproteins consisting solely of this domain are also presentin cyst and root-knot nematodes but these nematodes alsocontain expansin-like proteins composed of the expansindomain with a CBM2 domain at the N-terminus. Plant ex-pansins also usually consist of an expansin domain cou-pled to a CBD, although in these proteins the CBD isnot a CBM2-like protein and is found at the C-terminus.CBM2 domains are present in other cyst and root-knotnematode proteins; in cellulases and as stand-alone pro-teins (Smant et al., 1998; Gao et al., 2004) but no pro-teins containing such domains have been described fromany Bursaphelenchus species, in spite of the availabilityof large EST datasets for B. xylophilus and B. mucronatus(Kikuchi et al., 2007) and characterised cell wall degrad-ing enzymes (Kikuchi et al., 2004, 2006). It is possiblethat future genome sequencing projects will reveal car-bohydrate binding domains within Bursaphelenchus butthe sequence features described to date allow a specula-tive model of evolution of the expansin gene family tobe suggested. It seems likely that a common ancestor ofthe Tylenchida and Aphelenchida clades (Fig. 1) acquiredthe expansin-like domain from bacteria. Alternatively theexpansin-like domain could have evolved from an endoge-

Vol. 11(3), 2009 361

T. Kikuchi et al.

Fig. 4. Hybridisation of DIG-labelled antisense probe (dark staining) from expansin gene to the pharyngeal gland cells ofBursaphelenchus xylophilus (upper two panels) and B. mucronatus (lower panel). m: metacorpus; gc: gland cells.

362 Nematology

Expansin-like genes from Bursaphelenchus xylophilus

nous gene present in a common ancestor. Subsequent tothe divergence of the Aphelenchida and the Tylenchidafurther genes were acquired by both groups. Those ac-quired by the Tylenchida included GHF5 cellulases cou-pled to CBM2 domains. Recent studies on a range ofplant-parasitic nematodes provide support for the idea thatthe GHF5 cellulase and CBM2 domains were acquiredas one gene and that subsequently the gene was dupli-cated repeatedly (T. Kyndt, A. Haegemann, G. Gheysen,pers. commun., 2008). During these duplication events theCBM2 domains and cellulase domains became separated,giving rise to the CBM2 proteins and occasional cellulasesthat lack any discernable CBD that are observed in theTylenchida today. We suggest that CBM2 domains subse-quently became fused to expansin domains in these nema-todes giving rise to the proteins that are observed today.

This work provides further evidence for the idea thatmultiple independent horizontal gene transfer events,followed by active evolution of the gene families, havebeen important for the evolution of plant parasitism withinthe Phylum Nematoda. Analysis of the genes presentin other clades (Fig. 1) will provide further informationabout the number and pattern of horizontal gene transferevents. In addition, ongoing genome sequencing projectsfor M. hapla, M. incognita and Globodera pallida willshed light on the extent to which horizontal gene transferhas shaped the genomes of these pathogens, as well as themechanism by which this process may have occurred.

Acknowledgements

Some of the work described in this article was fundedby an International Joint Project of the Royal Soci-ety awarded to JJ and MM. TK has been funded byJapanese Ministry of Education, Science, Sports and Cul-ture, Grant-in-Aid for Encouragement of Young Scien-tists (B) 18780032 and FFPRI Research grant no. 200302.NK is supported by a JSPS Postdoctoral Fellowship forforeign researchers. HL received a scholarship from theVLIR for PhD studies. SCRI receives funding from theRural and Environment Research and Analysis Direc-torate of the Scottish Government. This work was aidedby links funded through COST Action 872. The first twoauthors contributed equally to this work.

References

BALDWIN, J.G., NADLER, S.A. & ADAMS, B.J. (2004).Evolution of plant parasitism among nematodes. AnnualReview of Phytopathology 42, 83-105.

BENDTSEN, J.D., NIELSEN, H., VON HEIJNE, G. &BRUNAK, S. (2004). Improved detection of signal peptides:SignalP 3.0. Journal of Molecular Biology 340, 783-795.

BLAXTER, M.L., DE LEY, P., GAREY, J.R., LIU, L.X.,SCHELDEMAN, P., VIERSTRAETE, A., VANFLETEREN,J.R., MACKEY, L.Y., DORRIS, M., FRISSE, L.M., VIDA,J.T. & THOMAS, W.K. (1998). A molecular evolutionaryframework for the Phylum Nematoda. Nature 392, 71-75.

COSGROVE, D.J. (2000). Loosening of plant cell walls byexpansins. Nature 407, 321-326.

DE BOER, J.M., YAN, Y., SMANT, G., DAVIS, E.L. &BAUM, T.J. (1998). In-situ hybridization to messenger RNAin Heterodera glycines. Journal of Nematology 30, 309-312.

EDGAR, R.C. (2004). MUSCLE: multiple sequence alignmentwith high accuracy and high throughput. Nucleic AcidsResearch 32, 1792-1797.

GAO, B.G., ALLEN, R., DAVIS, E.L., BAUM, T.J. & HUSSEY,R.S. (2004). Molecular characterisation and developmentalexpression of a cellulose binding protein gene in the soybeancyst nematode Heterodera glycines. International Journal forParasitology 34, 1377-1383.

HOLTERMAN, M., VAN DER WURFF, A., VAN DEN ELSEN, S.,VAN MEGEN, H., BONGERS, T., HOLOVACHOV, O.,BAKKER, J. & HELDER, J. (2006). Phylum-wide analysisof SSU rDNA reveals deep phylogenetic relationships amongnematodes and accelarated evolution towards crown clades.Molecular Biology and Evolution 23, 1792-1800.

JONES, J.T., FURLANETTO, C. & KIKUCHI, T. (2005). Hori-zontal gene transfer from bacteria and fungi as a driving forcein the evolution of plant parasitism in nematodes. Nematology7, 641-646.

JONES, J.T., MOENS, M., MOTA, M., LI, H. & KIKUCHI, T.(2008). Bursaphelenchus xylophilus: opportunities in com-parative genomics and molecular host-parasite interactions.Molecular Plant Pathology 9, 357-368.

KIKUCHI, T., JONES, J.T., AIKAWA, T., KOSAKA, H. &OGURA, N. (2004). A family of GHF45 cellulases fromthe pine wood nematode Bursaphelenchus xylophilus. FEBSLetters 572, 201-205.

KIKUCHI, T., SHIBUYA, H., AIKAWA, T. & JONES, J.T.(2006). Cloning and characterization of pectate lyases se-creted by the pine wood nematode Bursaphelenchus xylophi-lus. Molecular Plant-Microbe Interactions 19, 280-287.

KUDLA, U., QIN, L., MILAC, A., KIELAC, A., MAISSEN, C.,OVERMARS, H., POPEIJUS, H., ROZE, E., PETRESCU, A.,SMANT, G., BAKKER, J. & HELDER, J. (2005). Origin,distribution and 3D-modelling of Gr-EXPB1, an expansinfrom the potato cyst nematode Globodera rostochiensis.FEBS Letters 579, 2451-2457.

Vol. 11(3), 2009 363

T. Kikuchi et al.

POPEIJUS, H., OVERMARS, H., JONES, J., BLOK, V., GO-VERSE, A., HELDER, J., SCHOTS, A., BAKKER, J. &SMANT, G. (2000). Degradation of plant cell walls by a ne-matode. Nature 406, 36-37.

QIN, L., KUDLA, U., ROZE, E., GOVERSE, A., POPEIJUS, H.,NIEUWLAND, J., OVERMARS, H., JONES, J.T., SCHOTS,A., SMANT, G., BAKKER, J. & HELDER, J. (2004). Identi-fication of a functional expansin, a non-enzymatic, cell wall-loosening agent, from the plant parasitic nematode Globoderarostochiensis. Nature 427, 30.

RYSS, A., VIERA, P., MOTA, M. & KULINICH, O. (2005).A synopsis of the genus Bursaphelenchus Fuchs, 1937(Aphelenchida: Parasitaphelenchidae) with keys to species.Nematology 7, 393-458.

SCHOLL, E.H., THORNE, J.L., MCCARTER, J.P. & BIRD,D.M. (2003). Horizontally transferred genes in plant-parasitic nematodes: a high-throughput genomic approach.Genome Biology 4, R39.

SEMBLAT, J.P., ROSSO, M.N., HUSSEY, R.S., ABAD, P. &CASTAGNONE, S.P. (2001). Molecular cloning of a cDNA

encoding an amphid-secreted potential avirulence proteinfrom the root-knot nematode Meloidogyne incognita. Mole-cular Plant-Microbe Interactions 14, 72-79.

SMANT, G., STOKKERMANS, J.P., YAN, Y., DE BOER, J.M.,BAUM, T.J., WANG, X., HUSSEY, R.S., GOMMERS, F.J.,HENRISSAT, B., DAVIS, E.L., HELDER, J., SCHOTS, A. &BAKKER, J. (1998). Endogenous cellulases in animals: iso-lation of beta-1, 4-endoglucanase genes from two species ofplant-parasitic cyst nematodes. Proceedings of the NationalAcademy of Sciences of the USA 95, 4906-4911.

SOUTHEY, J.F. (1986). Laboratory methods for work with plantand soil nematodes, 9th edition, MAFF Publication. London,UK, Her Majesty’s Stationery Office, pp. 1-202.

YE, W., GIBLIN-DAVIES, R.M., BRAASCH, H., MORRIS, K.& THOMAS, W.K. (2007). Phylogenetic relationships amongBursaphelenchus species (Nematoda: Parasitaphelenchidae)inferred from nuclear ribosomal and mitochondrial DNAsequence data. Molecular Phylogenetics and Evolution 43,1185-1197.

364 Nematology