Virology 434 (2012) 251–256

Contents lists available at SciVerse ScienceDirect

Virology

0042-68

http://d

n Corr

E-m

journal homepage: www.elsevier.com/locate/yviro

Identification of EPS-degrading activity within the tail spikes of the novelPseudomonas putida phage AF

Anneleen Cornelissen a, Pieter-Jan Ceyssens a, Victor N. Krylov b, Jean-Paul Noben c, Guido Volckaert a,Rob Lavigne a,n

a Laboratory of Gene Technology, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, Box 2462, Leuven B-3001, Belgiumb Laboratory for Bacteriophage Genetics, I.I. Mechnikov Research Institute for Vaccines & Sera, RAMS, Maly Kazenny per., 5a, Moscow 105064, Russiac School of Life Sciences, Biomedical Research Institute and Transnational University Limburg, Hasselt University, Diepenbeek B-3590, Belgium

a r t i c l e i n f o

Available online 16 October 2012

Keywords:

Bacteriophage

P. putida

Exopolysaccharide-degrading enzyme

Biofilm degradation

Horizontal gene transfer

22/$ - see front matter & 2012 Elsevier Inc. A

x.doi.org/10.1016/j.virol.2012.09.030

esponding author. Fax: þ32 16 32 19 65.

ail address: rob.lavigne@biw.kuleuven.be (R.

a b s t r a c t

We report the study of phage AF, the first member of the canonical lambdoid phage group infecting

Pseudomonas putida. Its 42.6 kb genome is related to the ‘‘epsilon15-like viruses’’ and the ‘‘BPP-1-like

viruses’’, a clade of bacteriophages shaped by extensive horizontal gene transfer. The AF virions display

exopolysaccharide (EPS)-degrading activity, which originates from the action of the C-terminal domain

of the tail spike (Gp19). This protein shows high similarity to the tail spike of the T7-like P. putida-

infecting phage j15. These unrelated phages have an identical host spectrum and EPS degradation

characteristics, designating the C-terminal part of Gp19 as sole determinant for these functions. While

intact AF particles have biofilm-degrading properties, Gp19 and non-infectious AF particles do not,

emphasizing the role of phage amplification in biofilm degradation.

& 2012 Elsevier Inc. All rights reserved.

P. putida is a metabolic versatile soil bacterium which isapplied in bioremediation of contaminated soils, biocatalysis ofspecific chemicals, biopesticides and as plant growth promotingagents (Dejonghe et al., 2001; Lehrbach et al., 1984; Timmis et al.,1994). Human infections caused by P. putida have been reportedin immunocompromised patients (Bouall �egue et al., 2004;Ladhani and Bhutta, 1998) and patients with invasive medicaldevices (Martino et al., 1996). The ability to form a biofilm, aprotective cell-enclosed environment, is a key feature in thepathogenicity of P. putida (von Eiff et al., 2005).

In the search for novel anti-biofilm agents, there is a risinginterest in the biofilm-degrading properties of phages. Adams andPark already reported in 1956 the phages which display thisenzymatic tail-associated activity to enable them to reach thebacterial cell surface receptors (Adams and Park, 1956). For a longtime, research on these phage enzymes was focused on thecapsulated neuroinvasive Escherichia coli K1 strains (Bull et al.,2010; Scholl et al., 2005). Very recently, novel phages infectingE. coli and Acinetobacter baumannii strains were isolated andshown to degrade bacterial biofilms (Chibeu et al., 2012; Yeleet al., 2012). Likewise, the isolation and preliminary characteriza-tion of biofilm-degrading phages targeting Pseudomonas specieswas reported (Glonti et al., 2010; Shaburova et al., 2009).Among these, the T7-related phage j15 was found to contain

ll rights reserved.

Lavigne).

EPS-degrading tail spike proteins (Cornelissen et al., 2011;Shaburova et al., 2009). Here, we describe the genomic andmicrobiological characterization of P. putida phage AF originallyisolated from a soil sample in Chicago (Illinois, USA) in 1977 byShaburova et al. (2009).

Phage characteristics and halo formation

Based on structural characteristics, AF can be classified withinthe Podoviridae family of short-tailed phages consisting of iso-metric heads and short noncontractile tails with tail spikes lyingat each side (59.9 nm head; 12�8 nm tails) (SupplementaryFig. 1A). Phage AF is stable in a relatively broad pH range withmore than 66.0% infective phage particles after 24 h incubation atpH 5–11 and about 11.5% at the extreme boundaries of pH 4 and12 (Supplementary Fig. 1B).Within the first minute of infection,97.3% of administered AF virions adsorbed irreversibly to P. putida

host PpG1 (ka¼2.34E�7) (Supplementary Fig. 1C). PpG1 infectedhost cells are lysed 50 min post infection, releasing on average 53new phage particles (Supplementary Fig. 1D).

Host range analysis (Gill et al., 2003) on a set of 53 P. putida

strains (described in Cornelissen et al. (2011)) identified threeP. putida strains – PpG1, PpN and PpN3 – on which AF forms smallclear plaques, while small turbid plaques are formed on four ricerhizosphere strains (RD6PR1, RD5PR2, RD8PR2 and RD8PR3).Independent of the type of plaques formed, AF zones of infection

Fig. 1. Plaques of P. putida phage AF on the host PpG1. With increasing incubation at 30 1C, the diameter of the halo zone, surrounding the plaque with constant diameter,

increases every 24 h. Scale bar represents 1 cm.

A. Cornelissen et al. / Virology 434 (2012) 251–256252

are always surrounded by an opaque-looking halo zone whichincreases in diameter upon overnight incubation at 30 1C (Fig. 1).Interestingly, these seven AF-susceptible strains match perfectlywith the host range of the T7-related phage j15 (Cornelissenet al., 2011). To investigate these halo zones, 108 pfu of phage AFwas dropped on a bacterial lawn of PpG1. In contrast to thecentral zone of infection, which retained its diameter, the halozone expanded up to 3 mm in diameter every 24 h. On equallylarge surface areas, only about a twenty fold less phage wasidentified in the halo zone (1.6571.46Eþ6 pfu/cm2) compared tothe lysis zone (3.3772.30Eþ7 pfu/cm2), while no phages wereobserved outside the halo zone. Conversely, no viable bacterialcells were observed within the lysis zone (except for the fewresistant colonies), while the halo zone (5.1072.25Eþ7 CFU/cm2)and the outside bacterial zone (4.5872.32Eþ7 CFU/cm2) containalmost equal bacterial counts. So, both infective phage particlesand viable bacterial cells are present in the halo zone of phage AF.This is consistent with the observations for P. putida phage j15(Cornelissen et al., 2011) and suggest an inability or decreasedability of phage AF to replicate on bacterial cells in the stationaryphase of growth. The halo zone hints at the presence of a virion-associated tail spike which degrades the bacterial EPS layer. Phagediffusion out of the lysis zone over time further explains theincreasing diameter of the halo zone.

Genome and proteome analysis of phage AF

The AF genome (GenBank accession number JX676771) encom-passes 42,689 bp encoding 65 gene products, and is tightly organizedwith a predicted 3.5% noncoding sequence and 35 overlapping ORFs(Fig. 2, Supplementary Table 1). The overall GC-content of 58.44% isonly slightly lower than that of P. putida genomes (61% GþC).However, six early genes display an atypical low GþC average(r51%) (Supplementary Table 1). These genes were probablyacquired recently through horizontal gene transfer from an AþT richorganism and do not display any sequence similarity, except for theHNH endonuclease Gp36 which is similar to Lactobacillus phage geneproducts. No tRNA genes were predicted.

The genome is organized into two major clusters (left and rightarms) that differ according to the direction of transcription. Theearly/middle region consists of a rightward expression unit ofseventeen ORFs predominately involved in DNA replication, whilethe leftward recombination expression unit consists of 23 ORFs.Apart from limited similarity to the P. putida GB-1 prophage(4 gene products), these genes are similar to genes of (pro)phagesinfecting all three families of the Caudovirales. In this region, AFencodes protein (domains) typical for members of the lambdoidphage group. These include the restriction alleviation protein Lar(Gp28), two proteins involved in recombination (ERF familyprotein (Gp39) and NinB (Gp37)), domains of the replication

protein O and the CI repressor homologous to the N-terminalparts of Gp49 and Gp51 (Fig. 2; Supplementary Table 1).

The late region involved in virion morphogenesis and host celllysis is encoded by the rightward unit of expression, comprising25 putative genes (gene 1 to 25). It displays high similarity to the‘‘epsilon15-like viruses’’ (the Salmonella enterica serovar Anatum-specific phage e15 (Kropinski et al., 2007) and the E. coli O157:H7-specific phage jV10 (Perry et al., 2009)), the ‘‘BPP-1-like viruses’’(the Burkholderia cepacia-specific phage BcepC6B and the Borde-

tella bronchiseptica-specific BPP-1 related phages (Liu et al., 2004))and the putative P. putida GB-1 prophage. Arrangement of thesehomologous genes is identical, but subjected to deletions, inser-tions and replacements (Supplementary Table 1). Using ESI-MS/MSanalysis of CsCl purified phage particles (Ceyssens et al., 2008), 21 AFgene products were identified as being part of the structural particle(diamonds, Fig. 2). Twelve of these represent predicted structuralgene products. Interestingly, nine proteins encoded by genes dis-persed throughout the early and middle regions of the AF genomewere picked up by MS analysis. As we used a phage preparationwhich was purified by CsCl purification, the possibility that theseproteins are impurities is small. However, the role of these proteinsand the reason of incorporation into the phage particle is unknown.

The AF tail spike protein displays EPS-degrading activity

Gene 19 encodes the tail spike protein of phage AF. This tailspike contains an N-terminal domain which is widely conservedwithin the tail spike homologs of all members of the ‘‘epsilon15-like viruses’’ and the ‘‘BPP-1-like viruses’’ (SupplementaryTable 1) and the ‘‘T7-like viruses’’ (Pfam; AA 1–170; phageT7_tail; PF03906; 7.6E�23). It serves to connect the C-terminalcatalytic module interacting with the host cell receptor and thephage tail (Garcia-Doval and van Raaij, 2012; Steven et al., 1988).Moreover, similarity to the T7 N-terminus extends further intothe C-terminal domain of the tail spike protein Gp17 of the T7-like phage j15 resulting in an overall protein similarity (BLASTP;E-value 0.0; 48% identity) (Supplementary Fig. 2). While theC-terminal moiety of both ‘‘epsilon15-like viruses’’ shows endor-hamnosidase activity degrading the O-antigen of the bacterialouter membrane (Kanegasaki and Wright, 1973; Takeda andUetake, 1973), the C-terminal domain of j15-Gp17 is probablyinvolved in EPS degradation (Cornelissen et al., 2011). Based onthis observation it is reasonable to assume that the tail spikeprotein of phage AF also performs this EPS-degrading activity.

To analyze the catalytic activity of AF-Gp19, we cloned theC-terminal gene segment (gp19ND137) (50-ATGGATTACTTCGA-CGCTCTC-30 and 50-CTACCCGAGAAGATCAACCA-30; Eurogentec,Seraing, Belgium) into the pEXP5-NT/TOPOs vector (InvitrogenCorporation), with a 6�His-tag to facilitate protein purification.Expression occurred at 16 1C overnight in E. coli BL21(DE3)pLysS

Fig. 2. Genomic map of P. putida phage AF. According to the ‘‘epsilon15-like viruses’’, the AF genome was arbitrarily opened adjacent to the putative terminator sequence

(GCCCTCTTCGGAGGGCTTTTT), located upstream of the gene encoding for the putative terminase small subunit (referred to as gene 1). Numbering of the other genes

occurred sequentially in clockwise direction starting from gene 1. The genomic map consists of a rightward unit of expression with seventeen and 25 ORFs of the early/

middle (purple) and late region (blue), respectively. The leftward expression unit consists of 23 ORFs expressed in the early/middle phase of gene expression (green).

Structural proteins experimentally confirmed with ESI-MS/MS (threshold of minimum of two independent peptides and 5% sequence coverage) are marked with diamond

(~). Promoters are depicted by single arrowheads indicating the orientation of transcription. White spheres above the map indicate r-independent terminators.

Sequencing and in silico analyses of the AF genome were performed according to Cornelissen et al. (2011). (For interpretation of the references to color in this figure legend,

the reader is referred to the web version of this article.)

A. Cornelissen et al. / Virology 434 (2012) 251–256 253

(Invitrogen Corporation) after induction of 0.5 L exponentiallygrowing cells with 0.5 mM isopropyl-b-D-thiogalactopyranoside(OD600 nm¼0.6) in 2� TY medium. Protein purification wasessentially performed as described previously (Briers et al.,2006) with the wash and elution buffers composed of 20 mMNaH2PO4 pH 8.5, 0.5 M NaCl, 10% glycerol supplemented with75 mM and 0.5 M imidazole and yielded 1.4–2.5 mg per literexpression culture (Fig. 3A). Protein purity was at least 95% asestimated by SDS-PAGE. Purified protein was dialyzed overnightagainst a volume of PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mMNaHPO4, 2 mM KH2PO4 pH 7.4) that was 1000� the volume ofthe protein sample using Slide-A-Lyzers MINI Dialysis units(Pierce Biotechnology, Rockford, IL, USA).

Gp19ND137 forms a SDS-resistant homotrimer (193.2 kDa),which is observed when unheated samples were loaded on a 9%(w/v) SDS-PAGE gel, at room temperature. In contrast, a band ofabout 65 kDa (corresponding to the monomer mass) wasobserved when the sample was heated for 5 min at 95 1C beforeloading (Fig. 3A). This mobility change in the absence or presenceof heating prior to SDS gel electrophoresis is also observed forother tail spike proteins interacting with lipopolysaccharides(Freiberg et al., 2003; Walter et al., 2008) or EPS (Muhlenhoffet al., 2003; Stummeyer et al., 2006). These and many others areshown to undergo true trimerization in solution (Freiberg et al.,2003; Garcia-Doval and van Raaij, 2012; Hallenbeck et al., 1987;Miller et al., 1998; Muhlenhoff et al., 2003; Stummeyer et al.,2006; Walter et al., 2008). This experiment clearly shows that the

N-terminal domain is not obligatory for the trimerization processas observed on the SDS-PAGE gel.

The presence of the EPS-degrading activity within the tailspike protein of phage AF was confirmed by dropping 10 ml of0.1 mg/ml Gp19ND137 in PBS-buffer on a bacterial lawn of PpG1(Fig. 3A). After overnight incubation at 30 1C, Gp19 formed anidentical opaque-looking zone as the halo zone identified aroundthe lytic zone of phage infection. Microscopic comparison ofbacterial cells found in and outside these halo zones was per-formed by capsule staining (Fig. 3B). These recordings show thatcells outside the halo zone are encapsulated by EPS materialwhich further seems to hold the bacterial cells together in cellclusters. However, cells in the halo zone are separated from eachother and their EPS material is almost completely removed ordegraded due to the EPS-degrading activity of the tail spikeprotein.

Biofilm degradation requires phage amplification

To assess the biofilm-degradative properties of AF virions andthe EPS-degrading tail spike protein, single-species PpG1 biofilmswere grown for 24 h (Cornelissen et al., 2011). After infectionwith phage AF (102, 104 or 106 pfu/well), we observed time- anddose-dependent biofilm degradation (Fig. 3C). While initial inocu-lation with 102 phages did not influence the biofilm, additionof 104 phages yielded significant biofilm degradation of 22.0%

Fig. 3. EPS-degrading activity of Gp19 and AF-mediated biofilm degradation. (A) Formation of halo zones by the AF tail spike derivative, Gp19ND137. (left) SDS-PAGE gel of

purified protein samples (P) and corresponding reference ladder (kDa). (center) Trimerization characteristic of Gp19ND137. Protein bands corresponding to the

Gp19ND137 monomer (64.4 kDA, M) and homotrimer (193.2 kDa, T) were observed on a 9% (w/v) SDS-PAGE gel with and without heating (5 min, 95 1C) prior to

electrophoresis. RL: Precision plus protein reference ladder (kDa; Bio-rad, Hercules, CA, USA). (right) A 10 ml drop of 0.1 mg/ml of Gp19ND137 (below) on a bacterial lawn of

PpG1 creates after overnight incubation at 30 1C an opaque area identical to the halo zone formed around the zone of phage infection (drop of 10 ml of 108 pfu of phage AF,

above). Scale bar represent 1 cm. (B) Capsule staining (according to Cornelissen et al. (2011)). In contrast to the outside bacterial zone (left), bacterial cells in the halo zone

are lying separately and have lost their white capsule (right). (C) AF-mediated biofilm degradation. PpG1 biofilms grown on cones for 24 h were inoculated with 102, 104

and 106 pfu and subsequently incubated for 2, 4, 8 and 24 h at 30 1C. Mean biofilm (BT: biofilm treatment) and planktonic survival (PCT: planktonic culture treatment) for

n¼20 cones or corresponding microtiter plate wells were scored by an optical density measurement at 600 nm (OD) relative to untreated control samples (OD0) and

represented on the Y-axes. Five independent experiments were performed, each starting from a different overnight culture and each with four repeats for each parameter

combination giving rise to an overall twenty fold repetition. Significant values (two-tailed t test; Po0.01) are marked by an asterisk (*). Error bars indicate SEM.

A. Cornelissen et al. / Virology 434 (2012) 251–256254

after 24 h. For the highest phage dose of 106 pfu, up to 36.7%biofilm mass was degraded after 24 h. The planktonic cultureresponded more rapidly and more pronounced to phage infectionthan the biofilm. For example, for 106 phages, a decrease of25.0% was reached after 4 h at which time point no biofilmdegradation was yet noted. Moreover, after 8 h, this amount of

phage was sufficient for almost complete eradication of theplanktonic culture.

In the next step, the purified tail spike derivative Gp19ND137was applied to 24 h old PpG1 biofilms in a concentration range of0.1–10 mM, and incubated at 30 1C for up to 24 h. However, nobiofilm-degradative effect of the recombinant protein was

A. Cornelissen et al. / Virology 434 (2012) 251–256 255

observed (data not shown). To measure the biofilm-degradingeffect of the wild-type virion-associated enzyme, phage non-infective AF particles were generated by UV-induced mutagen-esis. These particles were still able to create opaque-looking halozones in which the EPS material surrounding the bacterial cellshad been partially or fully removed. However, inoculation of 24 hpre-grown PpG1 biofilms with 102, 104 or 106 non-infectiveparticles did not affect the pre-grown biofilm up to 24 h incuba-tion periods (data not shown).

In an attempt to isolate PpG1 strains resistant to AF infection(according to Cornelissen et al. (2011)), but still susceptible forhalo formation, we observed that similar to phage j15(Cornelissen et al., 2011), all isolated infection-resistant strainsalso resisted halo-formation. This indicates again that modifica-tion or loss of the EPS of PpG1 is easily obtained, as mutationalinactivation of only one EPS-biosynthetic gene can be enough todisrupt the original EPS structure. Furthermore, these double-resistant strains also reflect the primary and essential role of EPSin AF infection.

In this communication, we described the P. putida phage AF.Based on its genomic organization, protein sequence homologyand the mosaic nature of its genome, AF can be considered as acanonical lambdoid phage. We focused on its virion-associatedEPS-degrading properties, which could be attributed to the enzy-matic activity of the tail spike protein Gp19. The high degree ofsimilarity between the EPS-degrading tail spike proteins of theT7-related phage j15 (Cornelissen et al., 2011) and phage AFreflects horizontal transfer of this gene within the group of theP. putida-infecting phages. This horizontal exchange of tail spike/fiber proteins has been reported before and occurs across phagegenera and even (sub)families, as exemplified by the endosiali-dase module present in P22-, SP6- and T7-related phages (Deszoet al., 2005; Scholl and Merril, 2005; Scholl et al., 2004) and theconserved acetyl esterase domain in several Salmonella-infectingphages (Pickard et al., 2010).

We observed that the lambdoid phage AF and the T7-likephage j15 share only the gene encoding the tail spike protein anddisplay an identical host spectrum. This suggests that their sharedtail spike is the only structural component of the viral particlewhich determines host specificity. In addition, this indicates thatEPS serves as a primary receptor function for phage infection. Thisconsideration is further reinforced by the observation that strainssusceptible for j15 and AF infections are also susceptible for haloformation and vice versa, while no strains only susceptible forhalo formation or infection were encountered. In addition,infection-resistant isolates of PpG1 for both phages were alwaysalso resistant to halo-formation. This pinpoints that the EPS-molecule as the sole primary receptor is easily modified/lost upondevelopment of resistance.

Overall, these observations reflect the flexibility towardsintegration of tail spike/fiber catalytic domains in the virionstructure which may benefit future applications in engineeringphages. At the same time, the high enzymatic specificity(reflected in the high diversity of the EPS) and the high genomiccontext (influencing phage amplification characteristics) can beconsidered as major parameters towards efficient phage therapy.

Acknowledgments

The authors thank Prof. M. Vaneechoutte (Laboratory Bacter-iology, Ghent University Hospital, Belgium), Prof. R. De Mot(Centre of Microbial and Plant Genetics, K.U. Leuven, Belgium)and Prof. D. Springael (Division Soil and Water Management,K.U. Leuven, Belgium) for providing bacteria for this study. Theauthors are also grateful to Dr. Hans-W. Ackermann (Laval

University, Quebec, Canada) for expert electron microscopy andto Dr. Y. Briers and Y. Born for providing information on thecapsule staining assay (Institute of Food Science and Nutrition,ETH Zurich, Switzerland). The predoctoral fellowship of AC wasfunded by the ‘Instituut voor de aanmoediging van Innovatie door

Wetenschap en Technologie in Vlaanderen’ (I.W.T., Belgium). PC isa postdoctoral fellow of the ‘Fonds voor WetenschappelijkOnderzoek-Vlaanderen’ (FWO-Vlaanderen, Belgium). RL and VKare members of the ‘‘PhageBiotics’’ research community (FWOVlaanderen Grant WO.022.09).

Appendix A. Supporting information

Supplementary data associated with this article can be found inthe online version at http://dx.doi.org/10.1016/j.virol.2012.09.030.

References

Adams, M.H., Park, B.H., 1956. An enzyme produced by a phage host-cell system. II.The properties of the polysaccharide depolymerase. Virology 2, 719–736.

Bouall�egue, O., Mzoughi, R., Weill, F.-X., Mahdhaoui, N., Ben Salem, Y., Sboui, H.,Grimont, F., Grimont, P.A., 2004. Outbreak of Pseudomonas putida bacteraemiain a neonatal intensive care unit. J. Hosp. Infect. 57, 88–91.

Briers, Y., Lavigne, R., Plessers, P., Hertveldt, K., Hanssens, I., Engelborghs, Y.,Volckaert, G., 2006. Stability analysis of het bacteriophage phiKMV lysin gp36Cand its putative role during infection. Cell. Mol. Life Sci. 63, 1899–1905.

Bull, J.J., Vimr, E.R., Molineux, I.J., 2010. A tale of tails: sialidase is key to success ina model of phage therapy against K1-capsulated Escherichia coli. Virology 398,79–86.

Ceyssens, P.J., Mesyanzhinov, V., Sykilinda, N., Briers, Y., Roucourt, B., Lavigne, R.,Robben, J., Domashin, A., Miroshnikov, K., Volckaert, G., Hertveldt, K., 2008.The genome and structural proteome of YuA, a new Pseudomonas aeruginosaphage resembling M6. J. Bacteriol. 190, 1429–1435.

Chibeu, A., Lingohr, E.J., Masson, L., Manges, A., Harel, J., Ackermann, H.W.,Kropinski, A.M., Boerlin, P., 2012. Bacteriophages with the ability to degradeuropathogenic Escherichia coli biofilms. Viruses 4, 471–487.

Cornelissen, A., Ceyssens, P.J., T’Syen, J., Van Praet, H., Noben, J.P., Shaburova, O.V.,Krylov, V.N., Volckaert, G., Lavigne, R., 2011. The T7-related Pseudomonasputida phage j15 displays virion-associated biofilm degradation properties.PLoS One 6, e18597.

Dejonghe, W., Boon, N., Seghers, D., Top, E.M., Verstraete, W., 2001. Bioaugmenta-tion of soils by increasing microbial richness: missing links. Environ. Micro-biol. 3, 649–657.

Deszo, E.L., Steenbergen, S.M., Freedberg, D.I., Vimr, E.R., 2005. Escherichia coli K1polysialic acid O-acteyltransferase gene, neuO, and the mechanism of capsulefrom variation involving a mobile contingency locus. Proc. Natl. Acad. Sci. USA102, 5564–5569.

Freiberg, A., Morona, R., Van Den Bosch, L., Jung, C., Behlke, J., Carlin, N., Seckler, R.,Baxa, U., 2003. The tailspike protein of Shigella phage Sf6. A structural homologof Salmonella phage P22 tailspike protein without sequence similarity in theb-helix domain. J. Biol. Chem. 278, 1542–1548.

Garcia-Doval, C., van Raaij, M.J., 2012. Structure of the receptor-binding carboxy-terminal domain of bacteriophage T7 tail fibers. Proc. Natl. Acad. Sci. USA 109,9390–9395.

Gill, J.J., Scircev, A.M., Smith, R., Castle, A.J., 2003. Bacteriophages of Erwiniaamylovora. Appl. Environ. Microbiol. 69, 2133–2138.

Glonti, T., Chanishvili, N., Taylor, P.W., 2010. Bacteriophage-derived enzyme thatdepolymerizes the alginic acid capsule associated with cystic fibrosis isolatesof Pseudomonas aeruginosa. J. Appl. Microbiol. 108, 695–702.

Hallenbeck, P.C., Vimr, E.R., Yu, F., Bassler, B., Troy, F.A., 1987. Purification andproperties of a bacteriophage-induced endo-N-acteylneuramidase specific forpoly-alpha-2,8-sialosyl carbohydrate units. J. Biol. Chem. 262, 3553–3561.

Kanegasaki, S., Wright, A., 1973. Studies on the mechanism of phage adsorption:interaction between epsilon15 and its cellular receptor. Virology 52, 160–173.

Kropinski, A.M., Kovalyova, I.V., Billington, S.J., Patrick, A.N., Butts, B.D., Guichard, J.A.,Pitcher, T.J., Guthrie, C.C., Sydlaske, A.D., Barnhill, L.M., Havens, K.A., Day, K.R.,Falk, D.R., McConnell, M.R., 2007. The genome of e15, a serotype-converting,group E1 Salmonella enterica-specific bacteriophage. Virology 369, 234–244.

Ladhani, S., Bhutta, A., 1998. Neonatal Pseudomonas putida infection presenting asstaphylococcal scalded skin syndrome. Eur. J. Clin. Microbiol. Infect. Dis. 17,642–644.

Lehrbach, P.R., Zeyer, J., Reineke, W., Knackmuss, H.J., Timmis, K.N., 1984. Enzymerecruitment in vitro: use of cloned genes to extend the range of haloaromaticsdegraded by Pseudomonas sp. Strain B13. J. Bacteriol. 158, 1025–1032.

Liu, M., Gingery, M., Doulatov, S.R., Liu, Y., Hodes, A., Baker, S., Davis, P., Simmonds, M.,Churcher, C., Mungall, K., Quail, M.A., Preston, A., Harvill, E.T., Maskell, D.J.,Eiserling, F.A., Parkhill, J., Miller, J.F., 2004. Genomic and genetic analysis of

A. Cornelissen et al. / Virology 434 (2012) 251–256256

Bordetella bacteriophages encoding reverse transcriptase-mediated tropism-switching cassettes. J. Bacteriol. 186, 1503–1517.

Martino, R., Martinez, C., Pericas, R., Salazar, R., Sola, C., Brunet, S., Sureda, A.,Domingo-Albos, A., 1996. Bacteremia due to glucose non-fermenting gram-negative bacilli in patients with hematological neoplasias and solid tumors.Eur. J. Clin. Microbiol. Infect. Dis. 15, 610–615.

Miller, S., Schuler, B., Seckler, R., 1998. Phage P22 tailspike protein: removal ofhead-binding domain unmasks effects of folding mutations on native-statethermal stability. Protein Sci. 7, 2223–2232.

Muhlenhoff, M., Stummeyer, K., Grove, M., Sauerborn, M., Gerardy-Schahn, R.,2003. Proteolytic processing and oligomerization of bacteriophage-derivedendosialidases. J. Biol. Chem. 278, 12634–12644.

Perry, L.L., SanMiguel, P., Minocha, U., Terekhov, A.I., Shroyer, M.L., Farris, L.A.,Bright, N., Reuhs, B.L., Applegate, B.M., 2009. Sequence analysis of Escherichia

coli O157:H7 bacteriophage jV10 and identification of a phage-encodedimmunity protein that modifies the O157 antigen. FEMS Microbiol. Lett. 292,182–186.

Pickard, D., Toribio, A.L., Petty, N.K., van Tonder, A., Yu, L., Goulding, D., Barrell, B.,Rance, R., Harris, D., Wetter, M., Wain, J., Choudhary, J., Thomson, N., Dougan, G.,2010. A conserved acetyl esterase domain targets diverse bacteriophages to theVi capsular receptor of Salmonella enterica serovar Typhi. J. Bacteriol. 192,5746–5764.

Shaburova, O.V., Krylov, S.V., Veiko, V.P., Pleteneva, E.A., Burkal’tseva, M.V.,Miroshnikov, K.A., Cornelissen, A., Lavigne, R., Sykilinda, N.N., Kadykov, V.A.,Mesyanzhinov, V.V., Volckaert, G., Krylov, V.N., 2009. Search for destructionfactors of bacterial biofilms: comparison of phage properties in a group ofPseudomonas putida bacteriophages and specificity of their halo-formationproducts. Russ. J. Genet. 45, 161–170.

Scholl, D., Merril, C., 2005. The genome of bacteriophage K1F, a T7-like phage thathas acquired the ability to replicate on K2 strains of Escherichia coli. J. Bacteriol.187, 8499–8503.

Scholl, D., Adhya, S., Merril, C., 2005. Escherichia coli K1’s capsule is a barrier tobacteriophage T7. Appl. Environ. Microbiol. 71, 4872–4874.

Scholl, D., Kieleczawa, J., Kemp, P., Rush, J., Richardson, C.C., Merril, C., Adhya, S.,Molineux, I.J., 2004. Genomic analysis of bacteriophages SP6 and K1-5, anestranged subgroup of the T7 supergroup. J. Mol. Biol. 335, 1151–1171.

Steven, A.C., Trus, B.L., Maizel, J.V., Unser, M., Parry, D.A., Wall, J.S., Hainfeld, J.F.,Studier, F.W., 1988. Molecular substructure of a viral receptor-recognitionprotein. The gp17 tail fiber of bacteriophage T7. J. Mol. Biol. 200, 351–365.

Stummeyer, K., Schwarzer, D., Claus, H., Vogel, U., Gerardy-Schahn, R., Muhlenhof, M.,2006. Evolution of bacteriophages infecting encapsulated bacteria: lessons fromEscherichia coli K1-specific phages. Mol. Microbiol. 60, 1123–1135.

Takeda, K., Uetake, H., 1973. In vitro interaction between phage and lipopolysac-charide: a novel glycosidase associated with Salmonella phage e15. Virology52, 148–159.

Timmis, K.N., Steffan, R.J., Unterman, R., 1994. Designing microorganisms for thetreatment of toxic wastes. Annu. Rev. Microbiol. 48, 525–557.

von Eiff, C., Jansen, B., Kohnen, W., Becker, K., 2005. Infections associated withmedical devices: pathogenesis, management and prophylaxis. Drugs 65,179–214.

Walter, M., Fiedler, C., Grassl, R., Biebl, M., Rachel, R., Hermo-Parrado, X.L., Llamas-Saiz, A.L., Seckler, R., Miller, S., van Raaij, M.J., 2008. Structure of the receptor-binding protein of bacteriophage Det7: a podoviral tail spike in a myovirus.J. Virol. 82, 2265–2273.

Yele, A.B., Thawal, N.D., Sahu, P.K., Chopade, B.A., 2012. Novel lytic bacteriophageAB7-IBB1 of Acinetobacter baumannii: isolation, characterization and its effecton biofilm. Arch. Virol. 157, 1441–1450.