Identification of copper-responsive genes in an early life stageof the fathead minnow Pimephales promelas

Solange S. Lewis Æ Stephen J. Keller

Accepted: 28 October 2008 / Published online: 20 November 2008

� Springer Science+Business Media, LLC 2008

Abstract While physiological changes associated with

copper toxicity have been studied in adult fathead minnow,

Pimephales promelas, little is known about the effect of

copper on newly hatched larvae. As a result we initiated an

investigation on the mechanism of copper toxicity in 24 h

post-hatch larvae using gene expression changes to identify

responsive genes. Fish were exposed to copper concentra-

tions of 0, 50, 125 and 200 lg/L in a 48 h toxicity test.

Total RNA from survivors was used in a differential dis-

play assay to screen for differentially expressed gene

products. Altogether, 654 copper-responsive differentially

expressed bands were collected. Database searches found

homology for 261 sequences. One hundred and sixty-one

bands were homologous to NCBI genes of known function,

of which 69 were individual genes. The most abundant

categories of functional genes responding to copper were

involved in protein synthesis/translational machinery and

contractile proteins. Twenty-one dose-responsive genes

were measured for expression changes using real-time

quantitative PCR. Differential gene expression was vali-

dated for 11 of 13 genes, when a 1.2 times qPCR difference

between the copper and control samples was observed.

Transcripts identified as titin, cytochrome b, fast muscle

specific heavy myosin chain 4, fast muscle troponin I,

proteasome 26S subunit and troponin T3a were induced

over twofold. Differential display bands identified as 60S

ribosomal proteins L27 and L12 were repressed approxi-

mately threefold. We conclude that copper exposure affects

several cellular pathways in larval fathead minnows with

protein synthesis, ribosome structure, and muscle contrac-

tile proteins being the most sensitive to this stress.

Keywords Fathead minnow � Differential display �Gene expression � qPCR � Copper � Stress

Introduction

Among metals, copper is the second most toxic metal to

fish after mercury. Even though copper is an essential

cofactor of the biological molecules hemocyanin, cyto-

chrome oxidase, tyrosinase, laccase and ceruloplasmin, in

excess it becomes toxic to living organisms (Moore and

Ramamoorthy 1984). Like many other metals, copper

produces cellular oxidative stress due to the production of

reactive oxygen species, ROS (Valko et al. 2005). Copper

salts are frequently used as aquatic herbicides, algicides,

fungicides and bactericides (Mount 1968; Newman and

Unger 2003). Mining activity for this valuable metal

increased in the latter half of the twentieth century with

307 million metric tons being produced after 1980, thus

increasing copper pollution worldwide. Water pollution by

copper is chiefly associated with mining activities, fertil-

izer production, municipal and industrial sewage, materials

released from brake pads in road runoff and its use as a

biocide in antifouling paints. In water, copper is easily

bound to particulate and organic matter, but a small pro-

portion remains in soluble form and this is especially toxic

to fish. Soluble copper concentrations range from 0.5 to

2.0 lg/L in uncontaminated freshwater and can reach

2,000 lg/L in contaminated waters close to the mines

(David 2003; Moore and Ramamoorthy 1984; Newman

and Unger 2003).

S. S. Lewis � S. J. Keller (&)

Department of Biological Sciences, University of Cincinnati,

Cincinnati, OH 45221, USA

e-mail: kellersj@uc.edu

123

Ecotoxicology (2009) 18:281–292

DOI 10.1007/s10646-008-0280-3

Copper is very toxic to fish with a typical 96 h LC50

value ranging from 0.017 to 1.0 mg/L for most freshwater

fish species (Moore and Ramamoorthy 1984). In copper

toxicity tests, the 96 h median tolerance limit (TLm) for

adult fathead minnows was found to be between 430 and

470 lg/L, while concentrations as low as 11–33 lg/L

affected reproduction, growth and spawning (Mount 1968).

To some extent, the physiological effects of copper toxicity

have been characterized in adult fish. Copper precipitates

mucus secretions from the gills ultimately resulting in

asphyxiation (Carpenter 1927; Karan et al. 1998; Stokes

1979). When copper exposures are acute, gills tend to be

the site of copper accumulation as well as the primary

target organ for toxicity. Due to gill tissue damage, there is

a negative effect on respiratory gas exchange (Baker 1969;

Taylor et al. 1996). A reduced oxygen supply in the fish

leads to acidosis, a switch to anaerobic metabolism and the

accumulation of lactic acid. Gill damage also causes a toxic

buildup of ammonia due to a decrease in diffusion. Other

organs including the liver, kidneys and sensory organs are

damaged by copper exposure (Baker 1969; Gardner and

LaRoche 1973). Over long periods of copper exposure, the

liver and kidneys accumulate this metal whereas the mus-

cles contain relatively low levels (Stokes 1979).

While the mechanism of copper toxicity in adult fish has

been studied at the tissue level, the physiological effects of

copper in fish larvae are not known, except for the devel-

opmental abnormalities associated with long-term exposure.

Chronic exposure of the eggs and larvae to copper concen-

trations greater than 338 lg/L resulted in a decreased

growth rate and a high incidence of developmental abnor-

malities such as failure of eyes to emerge from enclosed

tissue, deformed maxillary bones and mandibles, malformed

lower jaws, misshapen fins reduced in size, kyphosis, lor-

dosis, scoliosis, eye defects in orientation, defective lenses

and microphthalmia (Scudder et al. 1988). More recently,

Brooks et al. (2006) have shown that adults and larvae bind

copper differently suggesting that there are probably dif-

ferent biochemical targets. Many of the adult organs are not

yet formed, so that this might explain the differences

between the larvae and adult. For example, the epithelial

layer of the skin is the site for respiratory gas exchange in

larval fish because the gills are not fully formed at the newly

hatched developmental stage (Blaxter 1988; Devlin et al.

1996). Larval fish have a liver, but the kidneys are not

developed. While ammonia toxicity is induced by copper

exposure in adult fish, teleosts are able to convert ammonia

to urea during early developmental stages and so may be

able to cope with increased plasma ammonia concentrations

(Wright et al. 1995). Because of the lack of complete

development of some larval stage organs and because of

different physiology, we expect a different response of lar-

vae to any stressor when compared with adult fish.

Different life stages of the fathead minnow, Pimephales

promelas, are routinely used to evaluate the potential

hazard posed by environmental pollutants to freshwater fish

in North America (Weber 1993). The early post-hatch stage

is considered one of the most sensitive to environmental

stress due to the loss of the protective chorionic layer of the

egg and its developmental immaturity (Kyle 1926; McKim

1977; McKim et al. 1978). Many studies have successfully

utilized transcriptional profiles to identify specific bio-

marker genes that respond to toxicants in a variety of

organisms (Bartosiewicz et al. 2001; Denslow et al. 2001).

In our study, differential display (Liang and Pardee 1992)

was used to identify candidate genes that showed a

response to copper. Differential display is a technique that

can be used without prior knowledge of an organism’s

genome and hence was ideal for working with the partially

characterized genome of the fathead minnow (Wintz et al.

2006; Larkin et al. 2007). The purpose of this study was to

characterize copper-induced transcriptional changes in fish

larvae and to compare this expression profile to other stress

studies in fish. To gain an insight into the various physio-

logical responses to stress, fathead minnow larvae aged

\24 h post-hatch were exposed to copper for 48 h and

analyzed to identify differentially expressed transcripts.

Materials and methods

Exposure to copper

The fathead minnows used in this experiment were from

the Newtown-USEPA stock population and the copper

exposures were carried out in the Andrew W. Breidenbach

Environmental Research Center in Cincinnati, OH, USA.

Between 100 and 250 fathead minnow larvae \24 h post-

hatch were exposed to copper concentrations of 0, 50, 125

and 200 lg/L in moderately hard reconstituted water in a

48 h static renewal test. The water was changed after 24 h

using criteria described by Weber (1993). The stock solu-

tion of 1 mg copper sulfate per mL was used to prepare

each test solution. Each treatment group was split into

several replicates to maintain a fish density of 25 individ-

uals per container that held 300 mL of test solution. The

copperless control used four containers, 50 lg/L copper

used five containers, 125 lg/L copper used six containers

and 200 lg/L copper used ten containers. Dead larvae were

removed from the test chambers during the water changes

and at the conclusion of the test. Larvae were not fed either

before or during the copper exposure because nutrition was

still available from their yolk sacs. Water chemistry at the

start and conclusion of the experiment was measured in

terms of pH, dissolved oxygen, conductivity and temper-

ature. The copper concentrations and fish density for each

282 S. S. Lewis, S. J. Keller

123

treatment were expected to provide *100 surviving larvae

from each treatment group, with the aim of pooling

*50 fish for two biological replicates within each treat-

ment group. To this end, there were 100 total survivors

from the control group, 110 total survivors from the

50 lg/L copper treatment, 110 total survivors from the

125 lg/L copper treatment, and 140 total survivors from

the 200 lg/L copper treatment. The survivors from each

treatment were divided into two biological replicates by

combining fish from half of the containers to make one of

the replicates. RNA was isolated from each biological

replicate within an hour of its collection.

RNA isolation

Each biological replicate was collected in a single tube and

the larvae were homogenized in Tri-Reagent LS (MRC

Inc., Cincinnati, OH, USA) following the manufacturer’s

protocol with an additional ethanol precipitation step.

Isolated RNA was treated with DNase I (Ambion, Austin,

TX, USA). RNA concentration and purity were measured

using a spectrophotometer to ensure that the 260/280 nm

ratios were above 1.8. All the RNA samples were also

analyzed for integrity on a 1.5% formaldehyde–agarose gel

as assessed by the intensities of the 28S and 18S ribosomal

RNA (rRNA) bands. The RNA was distributed into ali-

quots and stored at -80�C until used for differential

display or real-time quantitative PCR.

Differential display

Differential display on each of the two biological replicates

from each treatment group was performed using the flu-

oroDD HIEROGLYPH mRNA Profile Kit System for

Differential Display (Beckman Coulter Inc., Fullerton, CA,

USA) following the manufacturer’s protocols. Total RNA

(0.1 lg/lL) from each replicate was converted to cDNA

using T7-tagged anchored oligo-dT primers 1–6 (10 lM),

SuperScript II reverse transcriptase (200 units/lL) and

1 mM dinucleotide triphosphates (dNTPs) from the kit.

Polymerase chain reactions (PCRs) were performed with

the same anchored oligo-dT primers (10 lM) labeled with

a fluorescent dye, an M13-tagged 50 random primer (2 lM)

and 1 mM dNTPs. Reactions were heated at 95�C for

2 min, followed by 4 cycles of 92�C for 15 s, 50�C for 30 s

and 72�C for 2 min. This was followed by 30 cycles of

92�C for 15 s, 60�C for 30 s and 72�C for 2 min. There

was a further extension step at 72�C for 7 min. The cDNA

products were resolved on 5.6% denaturing urea poly-

acrylamide gels. Gels were scanned on a GenomyxLT

Fluorescent Imaging Scanner. The candidate bands were

excised from urea-free dried gels, dissolved in 50 lL TLE

buffer (10 mM Tris, 0.1 mM EDTA) and reamplified by

PCR using T7 and M13 primers (2 lM each). The ream-

plified products were run on a 1.5% agarose gel, excised,

purified using the MinElute kit (Qiagen Inc., Valencia, CA,

USA), and sequenced using the BigDye kit (Applied Bio-

systems, Foster City, CA, USA) and 2 lM of M13 primer.

The sequenced products were purified using Performa DTR

gel filtration cartridges (Edge BioSystems, Gaithersburg,

MD, USA) and read on an ABI 3100 Automated Capillary

DNA Sequencer (Applied Biosystems, Foster City, CA,

USA). Database searches were performed to determine the

identity of sequences using the BLASTN tool (Altschul

et al. 1997). Sequence quality was considered high if the

nucleotide reads were over 200 bp long and were evidently

the result of a single reamplified product. BLAST matches

of query sequences were considered significant if the cor-

responding E-value was \10-4.

Validation of differentially expressed cDNA fragments

using real-time qPCR

Real-time qPCR (Opticon 2, MJ Research/Bio-Rad Labo-

ratories, Waltham, MA, USA) was used to validate the

differential expression of 21 candidate genes in 200 lg/L

copper-treated replicates compared to those in the control

replicates of 0 lg/L copper. These candidates were selected

because they appeared to have a dose-response associated

with copper as assessed by differential display, and were

also identified by the same technique in response to zinc

and/or thermal stress (Lewis 2005). The primers for the 21

selected cDNAs were designed using the Primer Express

v2.0 software (Applied Biosystems, Foster City, CA, USA).

The sequences are summarized in Table 1.

The endogenous standard used to normalize gene

expression data was 18S rRNA. The universal primers and

competimer for 18S rRNA were obtained from the

QuantumRNA 18S Internal Standards Kit (Ambion Inc.,

Austin, TX, USA). Total RNA (1–2 lg) from each repli-

cate of pooled fish larvae was reverse transcribed with

MMLV-RT, 10 mM dNTPs and 30 lM random nonamers

from the ProtoScript First Strand cDNA Synthesis Kit

(New England BioLabs, Beverly, MA, USA). A diluted 1:5

solution of the cDNA was used to perform real-time qPCR

using the Platinum SYBR Green qPCR SuperMix-UDG kit

(Invitrogen, Carlsbad, CA, USA) according to the manu-

facturer’s instructions, modified to include 0.01% Tween

20, 0.025% DMSO and 0.1% glycerol. The concentration

of each primer was 4 lM. For reactions with 18S rRNA,

4 lL of 3:7 primer:competimer mixture were used in each

25 lL reaction. The PCR reaction had two initial steps of

50�C for 2 min and 95�C for 10 min, followed by 45 cycles

of 95�C for 30 s, 57�C for 60 s and 72�C for 30 s. The 45

cycles were followed by a melting curve analysis from 65

to 92�C to ensure that a single product was formed in the

Identification of copper-responsive genes in Pimephales promelas 283

123

reaction and that the melting temperature of the amplicon

corresponded to its expected G/C content. The relative

quantification method (2-DDCT) was used to calculate fold-

changes in gene expression using the actual reaction effi-

ciency values for each primer pair (estimated from

preliminary experiments) instead of assuming 100%

amplification efficiency. Each of the biological replicates

(n = 2) was assayed in triplicate and a mean Ct and the

standard error of the mean were calculated. A fold change

of 1.0 represents no change between copper treatment and

the controls (Livak and Schmittgen 2001). Note the fold

change of down-regulated messages has been calculated as

the reciprocal of the expression level relative to the control

level. The fold change for up-regulated messages is equal

to the expression level relative to the control level.

Results

Survival of fish exposed to copper

In the first experiment, we measured the survival of fathead

minnow larvae at different dosages of copper. The percent

survivorship of fish ranged from 56 to 100% in all treatments

(Fig. 1). Mortality was proportional to the copper concen-

tration used and no fish died in the 0 lg/L group, indicating

that no additional stress other than copper contributed to

lethality. A linear regression analysis summarized by the

dashed line in Fig. 1 had an r2 value = 0.9863 and

p \ 0.002. The recovery of surviving larvae from copper

stress was limited by the time necessary for fish collection

Table 1 Primer sequences used for amplifying selected differential display bands

mRNA identity Forward primer (50?30) Reverse primer (50?30)

Skeletal a-actin TGCCCCTCCTGAGCGTAAG TGGAGAGGGAAGCCAGGAT

a-Tropomyosin TTTTCTTCCATGTTTCTGTCTTTTTC TGCTCCATCCCCACTGAGA

b-Thymosin CCGTCAAAAGAAACCATTGAACA TGCATAGAAGAGTGGAGAACGAGTT

Carboxypeptidase B CGCTAGCCATGTGCTCAACA AACCCTGTATTCACAAGGCTTTCT

Chymotrypsinogen B1 TCTCCTGCTCAGATCAACACTCA CCAGGGAAGTCGTCAGTGGTT

Cytochrome c oxidase subunit III ACCTTCTTAGCCGTCTGCCTTA CATGCAGCGGCTTCGAA

Cytochrome b CAGAAAACTTCACCCCAGCAA ACAGGAAATATCACTCGGGTTGA

Translation elongation factor c GCCAGGACCTTGCATTTCC TGCGCCAAGTGTAGGACTCA

Elongation factor-1a CCCTCTTGGTCGCTTTGCT ACGCTCTTGATGACACCAACAG

Fast muscle specific heavy myosin chain 4 CAGAGAGAGGCCGCAAAGTG GAGTGCAGCAGCCCACAAC

Guanine nucleotide-binding protein GGTTTCATGCGTGCGTTTC CCACCCGCAGGACACAA

60S ribosomal protein L12 CAGGCAAGCAGCGATTGAG TTCCTTCAGGGCCTTGATGA

Ribosomal protein L27 TGGTCCTGGCTGGACGTT TGCCATCATCAATGTTCTTAACAA

Proteasome 26S subunit CGGGAGATCCAGAGAACAATG CTCCGCGGGAGTCGAAT

Proteasome subunit 7 beta GCCCAACATGGAGGAGGAT AAGATACCAGCCGCTATTGCA

Survival motor neuron domain containing 1 TCACCTTCGCTGGCTATGGT GCCCTCCTCCACTTCTTTGAG

Stathmin CCAGAAAATGGAAGCCAACAA TTCTCTTTGAATTTCTCGTTCATAGC

Troponin T3a, fast, skeletal muscle GGAGGAGCTTGGCAAATTCA CAGGACGACGCACTTACTTTCTG

Titin TGCCAACATCTCTGGATTTCC GCTCTGGCCAAATGGTTGA

Troponin TnnT3b CCTTCATTCAGCAGGCATCTC CCGCCTTTGATAGCCTCTGAT

Fast muscle troponin I GCCGCAGGCATCATTTG CCGCTTCCAGCAGATTGAA

Primers were determined from the Pimephales promelas sequence reads for each of the listed genes using Primer Express v2.0 software

Fig. 1 Survival of Pimephales promelas larvae to copper. Copper

concentrations were varied by diluting a mg/mL copper sulfate stock

solution into cups containing 300 mL and 25 fish. After 48 h, the dead

fish were removed from each cup and the survivors counted. Solidcircles are the average of the test cups at each copper concentration

and the dashed line is a fitted linear regression

284 S. S. Lewis, S. J. Keller

123

(*1 h). Other than copper concentration, there were no

major differences in water chemistry between different

treatment groups. In all experimental containers, the pH of

the water was 8.02–8.23, dissolved oxygen had a range of

7.6–8.3 mg/L, conductivity was 298–320 lS/cm and tem-

perature was maintained between 24 and 25�C throughout

the 48 h experiment. Extrapolation of the linear regression

in Fig. 1 yielded an estimated copper LD50 = 280 lg/L

for the 96 h larvae. This is consistent with Scudder et al.

(1988), who shows that the 96 h LC50 value for copper was

250 lg/L in larval fathead minnows.

Identification of copper-responsive genes

by differential display

Gene expression between control fish and copper-exposed

fish for three doses was compared by differential display

using two biological replicates within each treatment. It is

usually recommended that two independent samples from

the same treatment group be run in a differential display

gel to minimize the collection of false positives (Liang and

Pardee 1992; Sompayrac et al. 1995). When both replicate

samples from a single treatment group visually showed

similar intensity changes compared to other treatments,

they were selected for further analysis. A portion of a

representative gel (Fig. 2) shows similar bands in lanes

loaded with cDNA recovered from the 200 lg/L copper

treatment. By visual observation, both the 200 lg/L sample

cDNA bands are darker in intensity compared to other

bands isolated from lower copper exposures in the same

row. Therefore, these bands were denoted as up-regulated

by the 200 lg/L copper treatment of the larvae. In the row

below, cDNA band intensity is lighter in samples from the

higher copper-treated larvae and hence the band recovered

from this row would have been denoted as a down-regu-

lated candidate. There was little variation in the band

intensity across the two biological replicates in all of the

2,197 rows of bands resolved by differential display using

40 different random primer combinations. Figure 3

summarizes the selection of differentially expressed bands

through the complete analysis. A comparison of the bio-

logical replicates indicated that fewer than 1% of the 2,197

cDNA bands showed intensity variations. Six hundred and

fifty-four cDNAs of the 2,197 bands were differentially

expressed in copper treated samples and were isolated for

DNA sequencing. The copper-responsive bands were

selected for further analysis only if there was an identical

change in band intensity in both biological replicates

within a treatment group. Some bands showed visually

observable intensity changes in all copper-treated groups

relative to controls, while others showed band intensity

changes only in fish exposed to higher doses of copper

(Fig. 2). If the bands showed intensity changes in replicates

at the highest dosage (bands were either lighter or darker

relative to controls), they were designated as ‘‘dose-

responsive’’.

Of the 654 copper-responsive bands that we collected,

261 cDNA fragments yielded clear sequence data with

accurate reads over 200 bp. One hundred and sixty-one of

the differentially expressed bands had an E-value \ 0.0001

to genes deposited at the NCBI Genbank database.

Inspection of 161 cDNAs indicated that they could be

organized into 69 annotated genes. Of the 261 copper

induced cDNA differential display bands, 155 of these

bands matched with significant homology to 38 of the 69

annotated genes in Genbank. One message is known to

give rise to more than one cDNA and is a common problem

in differential display (Linskens et al. 1995). A flow dia-

gram summarizing the selection of bands for analysis is

presented in Fig. 3. In addition to the genes that had

E-values \0.0001 to annotated genes, we found 67

un-annotated sequences and 8 cDNAs with no homologies

at all. The 69 annotated differential display-derived bands

that responded to copper had high quality sequence reads.

The annotated genes and their induction or repression by

copper are listed in Table 2. Note that the directional

change in gene expression for an identified band was not

always consistent when a gene was identified multiple

Fig. 2 Portion of a representative differential display gel. Differential

display was performed using the cDNA samples prepared from *50

fish larvae from each exposure group. The arrows denote up regulated

or down regulated bands at different copper concentrations compared

to controls

Fig. 3 Analysis of differentially displayed bands in response to

copper. Summary of the differentially displayed bands from their

initial selection on the display gels to the validation by qPCR

Identification of copper-responsive genes in Pimephales promelas 285

123

Table 2 Differentially expressed fathead minnow genes

Expression Identity Species E-value Accession no.

Induced 40S ribosomal protein S4 Ictalurus punctatus 2.00E-50 AF402812.1

Repressed 60S ribosomal protein L12 Danio rerio E-119 AY648813.1

Repressed Acidic (leucine-rich) nuclear phospho protein

32 family

Danio rerio 5.00E-60 NM_212603.1

Repressed Actinin, alpha 2 (ACTN2) Danio rerio 4.00E-14 AY391405.1

Repressed Alpha-amylase Lates calcarifer 2.00E-46 AF416651.1

Induced Alpha-tropomyosin (tpma) Danio rerio 2.00E-37 AF180892.1

Ambiguous Anionic trypsin Oncorhynchus keta 3.00E-80 AB091439.1

Repressed ATPase, Na/K transporting, beta 1a

polypeptide

Danio rerio 3.00E-33 NM_131668.3

Repressed Basic helix-loop-helix transcription factor Danio rerio 4.00E-05 AJ510221.1

Repressed Beta-actin 1 Danio rerio 1.00E-85 BC063950.1

Induced Brefeldin A-inhibited guanine nucleotide-

exchange protein 1 (BIG1)

Homo sapiens 3.00E-20 AB209324.1

Repressed CCAAT/enhancer binding protein (C/EBP),

beta

Danio rerio 5.00E-97 NM_131884.2

Repressed Chymotrypsinogen B1 Danio rerio 1.00E-17 BC055574.1

Induced Complement C3 mRNA Ctenopharyngodon idella 4.00E-45 AY374472.1

Repressed CPB carboxypeptidase B Paralichthys olivaceus 2.00E-09 AB099302.1

Ambiguous Creatine kinase M2-CK Cyprinus carpio E-107 AF055289.1

Induced Cytochrome b mitochondrial Pimephales notatus E-125 U66606.1

Repressed Cyt.C oxidase subunit III gene Carassius auratus 2.00E-65 AY219843.1

Ambiguous Cytochrome oxidase subunit II Hemibarbus maculatus 5.00E-57 AY704455.1

Repressed EF-1a—elongation factor 1a Oreochromis niloticus 4.00E-04 AB075952.1

Repressed Eukaryotic translation elongation factor 1

gamma

Danio rerio \0.0001 NM_173263.1

Repressed Eukaryotic translation initiation factor 2

gamma

Danio rerio 8.00E-34 AY648723.1

Ambiguous Fast muscle troponin T isoform TnnT3b Danio rerio 1.00E-28 AF425741.1

Induced Fast skeletal muscle myosin heavy

polypeptide 1 (myhz1)

Danio rerio 2.00E-98 AF180893.1

Induced Fast skeletal muscle myosin light chain 3 Cyprinus carpio 1.00E-97 D85141.1

Ambiguous Fast skeletal myosin heavy chain 4 (mhc4) Danio rerio \0.0001 AY333450.1

Induced Guanine nucleotide binding protein Danio rerio 5.00E-35 AY423038.1

Repressed Heat shock cognate 70 kDa protein Carassius auratus E-100 AY195744.1

Ambiguous Isolate MOLR19 cytochrome b Luxilus chrysocephalus 7.00E-55 AF117167.1

Induced Keratin 4 (krt4) Danio rerio 1.00E-26 NM_131509.1

Induced LIM domain binding 3 like Danio rerio 4.00E-05 NM_199858.2

Ambiguous Stathmin Gallus gallus 2.00E-28 NM_001001858.1

Repressed Myosin, heavy polypeptide 2, fast muscle

specific

Danio rerio 4.00E-57 NM_152982.2

Induced NADH dehydrogenase subunit 2 Cyprinella gibbsi E-120 AF111219.1

Repressed NADH dehydrogenase subunit I Ctenogobiops feroculus 9.00E-06 AF391435.1

Ambiguous NADH ubiquinone oxidoreductase subunits

4L and 4

Distoechodon tumirostris 5.00E-32 AF036179.1

Induced Parvalbumin isoform 1d Danio rerio 2.00E-77 AF467914.1

Repressed Peptidylprolyl isomerase A (cyclophilin A) Danio rerio 1.00E-08 NM_212758.1

Induced Proteasome (prosome, macropain) 26S

subunit

Homo sapiens 2.00E-31 NM_002810.1

Repressed Proteasome (prosome, macropain) subunit Danio rerio 7.00E-34 NM_131151.1

286 S. S. Lewis, S. J. Keller

123

times by different primers on different gels. In Tables 2

and 3, these bands are listed as ‘‘ambiguous’’ in their

expression response to copper. Of the 38 genes that con-

tributed to redundant bands, 19 had consistent expression

changes and 19 were ambiguous in expression.

Ontology of the copper sensitive genes

The 69 copper sensitive annotated gene sequences from the

P. promelas larvae were analyzed by submitting the gene

list to Gene Ontology Tree Machine (GOTM). GOTM is a

web-based platform for interpreting gene sets using Gene

Ontology (GO) hierarchies. The P. promelas gene list

consisted of 31 repressed genes, 23 induced genes and 15

genes that were ambiguous in their response to copper

(Table 2). These genes were compared to the genome of

Danio rerio using GOTM’s hypergeometric test. The

resulting default analysis at level 4 is summarized in the bar

chart of Fig. 4. Altogether 33 GO classes were found to be

significant at p \ 0.01. Two copper targets were identified

at a level 6 analysis, each having p \ 0.0002: (1) the

ribosome/protein synthesis genes, and (2) the cytoskeleton/

contractile fiber genes. These two targets accounted for

50% of all the copper sensitive sequences. The ribosome/

Table 2 continued

Expression Identity Species E-value Accession no.

Ambiguous Proteasome subunit beta 7 Danio rerio 1.00E-62 AF155581.1

Repressed Protocadherin-9 (PCDH9) Homo sapiens 2.00E-07 NM_020403.3

Repressed Ribosomal protein L18 Ictalurus punctatus 4.00E-33 AF401572.1

Repressed Ribosomal protein L21 Ictalurus punctatus 2.00E-64 AF401575

Induced Ribosomal protein L26 Ictalurus punctatus E-164 AF401580.1

Repressed Ribosomal protein L27 Ictalurus punctatus E-122 AF401581.1

Ambiguous Ribosomal protein L37a Ictalurus punctatus 3.00E-70 AF401594.1

Repressed Ribosomal protein L4 Danio rerio E-178 BC049520.1

Repressed Ribosomal protein L5b Ictalurus punctatus 1.00E-16 AF401557

Ambiguous Ribosomal protein L7 Danio rerio \0.0001 NM_213644.1

Induced Ribosomal protein L7a Ictalurus punctatus 5.00E-35 AF401560.1

Repressed Ribosomal protein S15 Danio rerio 1.00E-04 NM_001001819.1

Ambiguous Ribosomal protein S25 Danio rerio 4.00E-08 NM_200815.1

Ambiguous Ribosomal protein S3A Danio rerio 2.00E-53 NM_200059.1

Induced Ribosomal protein S5 (rps5) Danio rerio 1.00E-17 NM_173232.1

Repressed Similar to ATP synthase H? transporting

mitochondrial FO complex subunit b,

isoform 1

Xenopus laevis 2.00E-06 BC048772.1

Repressed Similar to neuronal transmembrane protein

Slitrk4

Gallus gallus 3.00E-05 XM_420266.1

Repressed Skeletal muscle alpha-actin Cyprinus carpio 7.00E-53 D50028.1

Ambiguous Survival motor neuron domain containing 1

(smndc1),

Danio rerio 2.00E-52 NM_212601.1

Induced Synaptotagmin 1 Rattus rattus 1.00E-69 AJ617615.1

Repressed Thymosin, beta 4, X chromosome Mus musculus 8.00E-09 NM_021278.1

Induced Titin Danio rerio 3.00E-17 AY081167.1

Induced Transforming acidic coiled-containing

protein 2 (TACC2)

Rattus norvegicus 3.00E-21 NM_001004415.1

Ambiguous Translation elongation factor 2 Danio rerio 4.00E-45 AY391422.1

Induced Translation initiation factor 2 Danio rerio 7.00E-19 AY648723.1

Induced Troponin T3a, skeletal fast Danio rerio 3.00E-51 BC053304.1

Induced Type I keratin Danio rerio 5.00E-35 AF174137.1

Repressed Type II cytokeratin (ckii) mRNA Danio rerio 1.00E-07 NM_131156.1

Induced Ubiquinol–cytochrome c reductase core I

protein

Oncorhynchus mykiss 2.00E-37 AF465782.1

cDNA bands which appeared to be induced or repressed by exposure to copper were sequenced and homologies were found in the NCBI

Genbank database having an E-value \ 0.001. Several cDNAs showed both an induction and repression and are designated as ambiguous

Identification of copper-responsive genes in Pimephales promelas 287

123

protein synthesis target was made up of 20 genes, of which

5 were induced, 10 repressed and 5 ambiguous. The cyto-

skeleton/contractile fiber target was made up of 15 genes, of

which 8 were induced, 5 repressed and 2 ambiguous.

Validation of copper altered gene expression

using real-time qPCR

It is necessary to validate observed gene expression chan-

ges in differential display using an alternative more

sensitive technique because a portion of the genes identi-

fied by this method are expected to be false positives

(Linskens et al. 1995). One such alternative technique is

real-time quantitative PCR (qPCR) using gene-specific

primers. Twenty-one of the 200 lg/L dose-responsive

copper genes were arbitrarily selected from the 69 anno-

tated cDNAs for validation. Six of the 21 genes were

induced by copper, 9 genes were repressed and 6 genes

were ambiguous in their gene expression. Untreated copper

control samples were taken as well. The total RNA isolated

from treated and control larvae was reverse transcribed

with random nonamers and used for both differential dis-

play and the qPCR experiments. An internal 18S rRNA

was used to normalize qPCR expression levels. The 18S

rRNA standard was averaged over all the non-treated

controls and the copper treated experimental samples. No

significant difference was noted between the control and

experimental 18S rRNA samples. An identical result was

obtained by measuring the 18S rRNA in different samples

with a RNA 6000 Agilent Nano Labchip (data not shown).

Thus a comparison of the gene levels in the experimental

versus the untreated controls was a consequence of the

change in the level of the gene mRNA. The calculated fold-

change differences for all 21 genes tested are summarized

in Table 3.

Out of the 15 genes whose expression was clearly

induced or repressed in differential display, 11 were vali-

dated by qPCR for the correct directional change in

expression. Two genes, eukaryotic translation elongation

factor gamma and chymotrypsinogen B1, did not have a

greater than a 1.1-fold change difference in qPCR in order

Table 3 Gene expression levels measured by real-time qPCR

mRNA identity Differential display

gel response

Real-time PCR

response

Expression relative

to control (±SE)

Fold-change

Aldolase B Ambiguous Downregulated 0.561 (±0.0318) 1.781

Skeletal a-actin Downregulated Upregulated 1.638 (±0.0063) 1.638

a-Tropomyosin Upregulated Upregulated 1.214 (±0.0198) 1.214

b-Thymosin Downregulated Upregulated 1.482 (±0.0858) 1.482

Carboxypeptidase B Downregulated Downregulated 0.397 (±0.1454) 2.515

Chymotrypsinogen B1 Downregulated Upregulated 1.099 (±0.0060) 1.099

Cytochrome c oxidase subunit III Downregulated Downregulated 0.421 (±0.0801) 2.373

Cytochrome b Upregulated Upregulated 3.685 (±0.0126) 3.685

Elongation factor-1a Downregulated Downregulated 0.539 (±0.0522) 1.853

Eukaryotic translation elongation factor c Downregulated Upregulated 1.035 (±0.0038) 1.035

Guanine nucleotide-binding protein Upregulated Upregulated 1.155 (±0.0039) 1.155

Fast muscle specific heavy myosin chain 4 Ambiguous Upregulated 3.119 (±0.1254) 3.119

60S ribosomal protein L12 Downregulated Downregulated 0.341 (±0.0040) 2.932

Ribosomal protein L27 Downregulated Downregulated 0.195 (±0.0202) 5.128

Proteasome 26S subunit Upregulated Upregulated 2.448 (±0.0175) 2.448

Proteasome subunit 7 beta Ambiguous Upregulated 1.407 (±0.0086) 1.407

Survival motor neuron domain containing 1 Ambiguous Upregulated 1.965 (±0.0122) 1.965

Stathmin Ambiguous Upregulated 1.718 (±0.0172) 1.718

Troponin T3a, fast, skeletal muscle Upregulated Upregulated 2.161 (±0.0135) 2.161

Titin Upregulated Upregulated 11.595 (±0.1768) 11.595

Troponin TnnT3b Ambiguous Downregulated 0.883 (±0.0059) 1.132

Fast muscle troponin I Ambiguous Upregulated 2.898 (±0.0241) 2.898

Twenty-one of the fathead minnow DNA sequences that were found to have homology in the NCBI Genbank were arbitrarily selected for qPCR

analyses. Each gene was assayed 3 times in each of the two biological duplicates using the 200 lg/lL RNA samples. The results are reported

relative to untreated controls using 2-DDCT to calculate the expression levels. Fold changes are reported as positive for both increased and

decreased RNAs relative to the control

288 S. S. Lewis, S. J. Keller

123

to be considered informative (Livak and Schmittgen 2001).

Two genes were clearly in conflict between differential

display and qPCR; skeletal a-actin and b-thymosin. Thus

when there was a clear unambiguous induction or repres-

sion in differential display, it was validated in 11 samples,

unresolved in 2 samples, and contradicted in 2 samples.

When the fold-change criterion in qPCR was raised to 1.7,

a value commonly used in microarray data, all the genes

had the same directional change in expression in both

qPCR and differential display (Tan et al. 2002; Ton et al.

2002). Real time qPCR indicates that genes encoding

contractile proteins such as fast muscle specific myosin

heavy chain 4, troponin T3a, fast muscle troponin I and

titin were all induced by copper exposure. Among mito-

chondrial genes, cytochrome c oxidase subunit III was

repressed while cytochrome b was induced. The genes

encoding translational machinery/protein expression pro-

teins were down-regulated by copper and included

elongation factor-1a, 60S ribosomal protein L12 and

ribosomal protein L27. Proteasome 26S was induced 2.45-

fold, carboxypeptidase B was repressed 2.52-fold, survival

motor neuron domain containing 1 was induced 1.96-fold

and stathmin induced 1.72-fold in response to copper

exposure.

Discussion

In this study, we investigated differential gene expression

in the fathead minnow larvae to ascertain the physiological

effects of copper toxicity in an early life stage. Inspection

of many differential display gels which used 40 different

random primer combinations indicated that copper affected

30% of the observable bands and there was very little band

variation between the experimental duplicates (Figs. 2, 3).

Almost 60% of the collected bands did not produce read-

able DNA sequences because more than one cDNA was

collected at a single band location. Moreover, of the 261

cDNAs that had clear sequences, we only could identify 69

unique annotated genes using the NCBI BLAST algorithm.

Failure to identify all the readable sequences occurred for

two reasons. First the same gene was detected by different

primer combinations. For example, 38 annotated genes in

the NCBI Genbank accounted for 155 of the 261 clear

DNA sequence reads. Secondly, there is no complete

searchable fathead minnow genome in the literature, so that

75 sequences which responded to copper could not be

associated with any annotations in the Genbank. None-

theless, we were able to examine 21 genes and confirm that

whenever differential display predicted induction or

Fig. 4 Ontology of copper-

responsive genes. The 69 genes

that were identified by

homology at NCBI were

submitted to the Gene Ontology

Tree Machine (GOTM) at

Vanderbilt University at their

web site: http://bioinfo.

vanderbilt.edu/gotm. The level

4 analysis is based on the fre-

quency of gene expression in

the Pimephales promelas versus

the complete zebrafish genome

Identification of copper-responsive genes in Pimephales promelas 289

123

repression, qPCR analysis confirmed the direction in 85%

of the sample cDNAs. When all of the annotated genes that

respond to copper are grouped by biological processes, two

larval metabolic pathways are identified by the GOTM

analysis: protein synthesis and muscle contractile fibers.

Four protein synthesis proteins showed induction by

copper exposure: ribosomal proteins S4, S5, L7a and L26.

Ribosomal protein S5 has been implicated as essential for

the accuracy of translation and ribosomal protein L26

appears to be involved in the pathway to terminate the cell

cycle and induce apoptosis. (Galkin et al. 2007; Takagi

et al. 2005). In contrast, many of the down-regulated genes

appear to be associated with the regulation of growth and

longevity (Zhang et al. 2006). These include the 40S

ribosomal protein S15, the 60S ribosomal proteins L4, L5b,

L12, L18, L21, L27, basic helix-loop-helix transcription

factor, CCAAT/enhancer binding protein, translation

elongation factors 1a and 1c, and translation initiation

factor 2c. Five different elongation factors have been

described in the metamorphoses of the Senegalese sole,

suggesting that the larval stage may require tissue specific

translation mechanisms (Infante et al. 2008). Ribosome

biogenesis in mice is known to be regulated by the mTOR

pathway (Hannan et al. 2003). The down-regulation of

several ribosomal proteins probably implies that the TOR

pathway was affected in copper-exposed fish. TOR sig-

naling has been shown to play a role in the oxidative stress

response as increased signaling increases sensitivity to the

stress (Patel and Tamanoi 2006). Therefore, the response of

protein synthesis to copper seems to be a protective

response of the organism to the damaging effects of excess

copper and is analogous to oxidative stress (Ton et al.

2003).

Genes identified in the NCBI Genbank as contractile

proteins were also affected by copper exposure. Overall

there appears to a very significant expression of contractile

protein messages in the presence of copper as compared to

the controls. For example, titin was induced over 11-fold

(Table 3). The genes encoding alpha-tropomyosin, fast

skeletal muscle myosin heavy polypeptide 1, fast skeletal

muscle myosin light chain 3, parvalbumin isoform 1d, and

troponin T3a were all induced in differential display gels.

Real-time qPCR confirmed an up-regulation of fast muscle

specific heavy myosin chain 4, troponin T3a, titin and

troponin I. The up-regulation of muscle genes is in contrast

to the down-regulation of most ribosomal protein genes.

However, titin contains a kinase domain that takes part in a

stress-response signaling pathway and also regulates the

expression of other muscle genes (Lange et al. 2005). An

important implication of copper-induced differential gene

expression for muscle protein genes is that a putative

increase or decrease in the synthesis of proteins could

disturb the myogenesis program. As a result, muscular and

cytoskeletal abnormalities are frequently observed in

young fish stressed by pollutants (Cheung et al. 2004;

Donaldson and Dye 1975; Sanders et al. 1995).

Two hour doses of non-lethal concentrations of copper

(1–50 lM CuSO4) administered to 48–96 h D. rerio larvae

induce cellular damage which is localized to neuromasts

causing apoptosis, and loss of hair cell markers (Hernandez

et al. 2006). This effect is specific to copper, as other

metals did not show these effects. Our results suggest that

copper alters the expression of several neurologically

important genes in the fathead minnow. For example, the

survival motor neuron domain containing 1 gene is induced

by exposure to copper. Survival motor neuron protein is

known to participate in stress granule formation within

cells in combination with several other proteins including

ribosomal proteins S3 and S19 (Hua and Zhou 2004).

Ribosomal protein S3A was also identified as being dif-

ferentially expressed in this study, although the expression

pattern was not consistent. A second neuronal gene induced

by copper exposure was synaptotagmin I. This protein is

associated with synaptic vesicles which play a role in

neurotransmitter release and may function as a Ca2? sensor

(Hilfiker et al. 1999). Synaptotagmin induction is associ-

ated with a variety of stresses and is inversely related to

Hsp70 expression (Fei et al. 2007; Thome et al. 2001). This

trend for decreased Hsp70 gene transcripts was also

observed in our study. Furthermore, synaptotagmin is

known to be a protein that binds copper intracellularly and

responds to stress along with fibroblast growth factor 1

(Landriscina et al. 2001). A third gene that plays a major

role in the nervous system is stathmin, which was induced

by copper in this study. Stathmin is a cytosolic phospho-

protein that regulates cell cycle progression through

microtubule depolymerization. The cell cycle is arrested if

stathmin expression becomes unbalanced by either induc-

tion or repression (Rubin and Atweh 2004). In relation to

stress, stathmin is phosphorylated possibly by mitogen-

activated protein kinases (Beretta et al. 1995). Stathmin

expression within the brain has a huge influence on

behaviors such as fear and anxiety. For example, stathmin

knockout mice show both an acquired and innate decrease

in fear reactions (Shumyatsky et al. 2005). A fourth gene,

similar to neuronal transmembrane protein Slitrk4, was

repressed in copper-exposed fish. The Slitrk genes are

thought to regulate neurite outgrowth (Aruga et al. 2003).

Therefore, exposures to 200 lg/mL copper affect the ner-

vous system potentially changing behavioral responses.

The protein chaperones Hsp70 and peptidylprolyl

isomerase A, were also down-regulated in copper-exposed

fish. However, the typical biomarker gene of metal expo-

sure, metallothionein was not affected by excessive copper.

Metallothionein normally sequesters excess metals and

plays a protective role against their toxicity in living

290 S. S. Lewis, S. J. Keller

123

organisms (Chen et al. 2004; Newman and Unger 2003).

This protein was not identified in our differential display

study, either because it was already present in large

amounts or was not altered in its expression by copper.

Another marker gene of oxidative stress, glutathione S

transferase, also was not identified in this study. The

absence of these two genes in the differential display test

may reflect that the defense mechanisms against metal

toxicity have already been set in place in the early life stage

of the fish. In zebrafish embryos metallothionein transcripts

are abundant and thought to be maternally contributed

because they play a very important role in development

(Chen et al. 2004). However, Chan et al. (2006) report a

1.5- to 3-fold induction of the metallothionein gene in 8 h

post fertilization D. rerio embryos exposed to 4 lM copper

for 24 h.

In summary, the expression of many genes was altered

by copper stress in fathead minnow larvae. The majority of

genes identified in this study encoded the structure of the

ribosome and contractile proteins. Other pathways impli-

cated in the response to copper toxicity include neuron

development, the oxidative stress response pathway, pro-

tein folding, proteolysis, PI3K pathway, MAP-kinase

pathway, and growth. Structural abnormalities are observed

in adult fish when the larvae are chronically exposed to

copper (Scudder et al. 1988). This observation may be

attributed to the perturbations in protein synthesis and the

expression of muscle contractile proteins. In addition, the

sluggish behavior and lack or responsiveness in copper

stressed fish can be attributed to the neuronal genes being

affected as well as a decrease in energy production. A

complete picture of the stress response of larval fish will

require a better definition of the P. promelas genome, a

more sensitive and accurate transcriptional assay, and an

examination of more stressors.

Acknowledgments We acknowledge the contributions of J.

Lazorchak, M. Smith, D. Lattier, M. Bagley, C. Tomlinson, R. Flick,

D. Gordon, S. Jackson, M. Brown-Augustine, R. Haugland, J. Ded-

dens, S. Keely and J. Stringer to this project. Funds for this project

have been provided by the University of Cincinnati Research Foun-

dation through the generosity of the Schlemm Family.

References

Altschul SF, Madden TL, Schaffer AA et al (1997) Gapped BLAST

and PSI-BLAST: a new generation of protein database search

programs. Nucleic Acids Res 25:3389–3402. doi:10.1093/nar/25.

17.3389

Aruga J, Yokota N, Mikoshiba K (2003) Human SLITRK family

genes: genomic organization and expression profiling in normal

brain and brain tumor tissue. Gene 315:87–94. doi:10.1016/

S0378-1119(03)00715-7

Baker JTP (1969) Histological and microscopical observations on

copper poisoning in the winter flounder (Pseudopleuronectesamericanus). J Fish Res Board Can 26:2785–2793

Bartosiewicz M, Penn S, Buckpitt A (2001) Applications of gene

arrays in environmental toxicology: fingerprints of gene regula-

tion associated with cadmium chloride, benzo (a) pyrene, and

trichloroethylene. Environ Health Perspect 109:71–74. doi:

10.2307/3434924

Beretta L, Dubois MF, Sobel A et al (1995) Stathmin is a major

substrate for mitogen-activated protein kinase during heat shock

and chemical stress in HeLa cells. Eur J Biochem 227:388–395.

doi:10.1111/j.1432-1033.1995.tb20401.x

Blaxter JHS (1988) Pattern and variety in development. In: Hoar WS,

Randall DJ (eds) Fish physiology, vol XI, Part A. Academic

Press, San Diego

Brooks ML, Boese CJ, Meyer JS (2006) Complexation and time-

dependent accumulation of copper by larval fathead minnows

(Pimephales promelas): implications for modeling toxicity.

Aquat Toxicol 78:42–49. doi:10.1016/j.aquatox.2006.02.002

Carpenter KE (1927) The lethal action of soluble metallic salts on

fishes. J Exp Biol 4:378–390

Chan KM, Ku LL, Chan C-Y et al (2006) Metallothionein gene

expression in zebrafish embryo-larvae and ZFL cell-line exposed

to heavy metal ions. Mar Environ Res 62:S83–S87. doi:10.1016/

j.marenvres.2006.04.012

Chen WY, John JA, Lin CH et al (2004) Expression of metallothi-

onein gene during embryonic and early larval development in

zebrafish. Aquat Toxicol 69:215–227. doi:10.1016/j.aquatox.

2004.05.004

Cheung AP, Lam TH, Chan KM (2004) Regulation of Tilapia

metallothionein gene expression by heavy metal ions. Mar

Environ Res 58:389–394. doi:10.1016/j.marenvres.2004.03.084

David CPC (2003) Establishing the impact of acid mine drainage

through metal bioaccumulation and taxa richness of benthic

insects in a tropical Asian stream (The Philippines). Environ

Toxicol Chem 22:2952–2959. doi:10.1897/02-529

Denslow ND, Bowman CJ, Ferguson RJ et al (2001) Induction of gene

expression in sheepshead minnows (Cyprinodon variegatus)

treated with 17b-estradiol, diethylstilbestrol, or ethinylestradiol:

the use of mRNA fingerprints as an indicator of gene regulation.

Gen Comp Endocrinol 121:250–260. doi:10.1006/gcen.2001.

7605

Devlin EW, Brammer JD, Puyear RL et al (1996) Prehatching

development of the fathead minnow Pimephales promelasRafinesque. USEPA publication EPA/600/R-96/079, Cincinnati

Donaldson EM, Dye HM (1975) Corticosteroid concentrations in

sockeye salmon (Oncorhynchus nerka) exposed to low concen-

trations of copper. J Fish Res Board Can 32:533–539

Fei G, Guo C, Sun HS et al (2007) Chronic hypoxia stress-induced

differential modulation of heat-shock protein 70 and presynaptic

proteins. J Neurochem 100:50–61. doi:10.1111/j.1471-4159.

2006.04194.x

Galkin O, Bentley AA, Gupta S et al (2007) Roles of the negatively

charged N-terminal extension of Saccharomyces cerevisiaeribosomal protein S5 revealed by characterization of a yeast

strain containing human ribosomal protein S5. RNA 13:2116–

2128. doi:10.1261/rna.688207

Gardner GR, LaRoche G (1973) Copper induced lesions in estuarine

teleosts. J Fish Res Board Can 30:363–368

Hannan KM, Brandenburger Y, Jenkins A et al (2003) mTOR-

dependent regulation of ribosomal gene transcription requires

S6K1 and is mediated by phosphorylation of the carboxy-

terminal activation domain of the nucleolar transcription factor

UBF. Mol Cell Biol 23:8862–8877. doi:10.1128/MCB.23.23.

8862-8877.2003

Hernandez PP, Moreno V, Olivari FA et al (2006) Sub-lethal

concentrations of waterborne copper are toxic to lateral line

neuromasts in zebrafish (Danio rerio). Hear Res 213:1–10. doi:

10.1016/j.heares.2005.10.015

Identification of copper-responsive genes in Pimephales promelas 291

123

Hilfiker S, Pieribone VA, Nordstedt C et al (1999) Regulation of

synaptotagmin I phosphorylation by multiple protein kinases.

J Neurochem 73:921–932. doi:10.1046/j.1471-4159.1999.0730

921.x

Hua Y, Zhou J (2004) Survival motor neuron protein facilitates

assembly of stress granules. FEBS Lett 572:69–74. doi:10.1016/

j.febslet.2004.07.010

Infante C, Asensio E, Canavate JP et al (2008) Molecular character-

ization and expression analysis of five different elongation factor

1 alpha genes in the flatfish Senegalese sole (Solea senegalensisKaup): differential gene expression and thyroid hormones

dependence during metamorphosis. BMC Mol Biol 9:19–36. doi:

10.1186/1471-2199-9-19

Karan V, Vitorovic S, Tutundzic V et al (1998) Functional enzymes

activity and gill histology of carp after copper sulfate exposure

and recovery. Ecotoxicol Environ Saf 40:49–55. doi:10.1006/

eesa.1998.1641

Kyle HM (1926) The biology of fishes. The Macmillan Company,

New York

Landriscina M, Bagala C, Mandinova A et al (2001) Copper induces

the assembly of a multiprotein aggregate implicated in the

release of fibroblast growth factor 1 in response to stress. J Biol

Chem 276:25549–25557. doi:10.1074/jbc.M102925200

Lange S, Xiang F, Yakovenko A et al (2005) The kinase domain of

titin controls muscle gene expression and protein turnover.

Science 308:1599–1603. doi:10.1126/science.1110463

Larkin P, Villeneuve DL, Knoebl I et al (2007) Development and

validation of a 2,000-gene microarray for the fathead minnow

(Pimephales promelas). Environ Toxicol Chem 26:1497–1506.

doi:10.1897/06-501R.1

Lewis SS (2005) Identification of stress-responsive genes in the early

larval stage of the fathead minnow Pimephales promelas. Ph.D.

dissertation. University of Cincinnati, Cincinnati

Liang P, Pardee AB (1992) Differential display of eukaryotic

messenger RNA by means of the polymerase chain reaction.

Science 257:967–971. doi:10.1126/science.1354393

Linskens MH, Feng J, Andrews WH et al (1995) Cataloging altered

gene expression in young and senescent cells using enhanced

differential display. Nucleic Acids Res 23:3244–3251. doi:

10.1093/nar/23.16.3244

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression

data using real-time quantitative PCR and the 2-DDCT method.

Methods 25:402–408. doi:10.1006/meth.2001.1262

McKim JM (1977) Evaluation of tests with early life stages of fish for

predicting long-term toxicity. J Fish Res Board Can 34:1148–

1154

McKim JM, Eaton JG, Holcombe GW (1978) Metal toxicity to

embryos and larvae of eight species of freshwater fish-II: copper.

Bull Environ Contam Toxicol 19:608–616. doi:10.1007/BF016

85847

Moore JW, Ramamoorthy S (1984) Heavy metals in natural waters,

applied monitoring and impact assessment. Springer, New York

Mount DI (1968) Chronic toxicity of copper to fathead minnows

(Pimephales promelas, Rafinesque). Water Res 2:215–223. doi:

10.1016/0043-1354(68)90027-4

Newman MC, Unger MA (2003) Fundamentals of ecotoxicology, 2nd

edn. Lewis, Boca Raton

Patel PH, Tamanoi F (2006) Increased Rheb-TOR signaling enhances

sensitivity of the whole organism to oxidative stress. J Cell Sci

119:4285–4292. doi:10.1242/jcs.03199

Rubin CI, Atweh GF (2004) The role of stathmin in the regulation of

the cell cycle. J Cell Biochem 93:242–250. doi:10.1002/jcb.

20187

Sanders BM, Nguyen J, Martin LS et al (1995) Induction and

subcellular localization of two major stress proteins in response

to copper in the fathead minnow Pimephales promelas. Comp

Biochem Physiol C Pharmacol Toxicol Endocrinol 112:335–343

Scudder BC, Carter JL, Leland HV (1988) Effects of copper on

development of the fathead minnow, Pimephales promelasRafinesque. Aquat Toxicol 12:107–124. doi:10.1016/0166-445X

(88)90029-X

Shumyatsky GP, Malleret G, Shin RM et al (2005) Stathmin, a gene

enriched in the amygdala, controls both learned and innate fear.

Cell 123:697–709. doi:10.1016/j.cell.2005.08.038

Sompayrac L, Jane S, Burn TC et al (1995) Overcoming limitations of

the mRNA differential display technique. Nucleic Acids Res

23:4738–4739. doi:10.1093/nar/23.22.4738

Stokes PM (1979) Copper accumulations in freshwater biota. In:

Nriagu JO (ed) Copper in the environment. Part I. Ecological

cycling. Wiley, New York, pp 358–381

Takagi M, Absalon MJ, McLure KG et al (2005) Regulation of p53

translation and induction after DNA damage by ribosomal

protein L26 and nucleolin. Cell 123:49–63. doi:10.1016/j.cell.

2005.07.034

Tan FL, Moravec CS, Li J et al (2002) The gene expression

fingerprint of human heart failure. Proc Natl Acad Sci USA

99:11387–11392. doi:10.1073/pnas.162370099

Taylor EW, Beaumont MW, Butler PJ (1996) Lethal and sub-lethal

effects of copper upon fish: a role for ammonia toxicity? In:

Taylor EW et al (eds) Toxicology of aquatic pollution:

physiological, cellular and molecular approaches. Cambridge

University Press, New York, pp 85–114

Thome J, Pesold B, Baader M et al (2001) Stress differentially

regulated synaptophysin and synaptotagmin expression in hip-

pocampus. Biol Psychiatry 50:809–812. doi:10.1016/S0006-

3223(01)01229-X

Ton C, Stamatiou D, Dzau VJ et al (2002) Construction of a zebrafish

cDNA microarray: gene expression profiling of the zebrafish

during development. Biochem Biophys Res Commun 296:1134–

1142. doi:10.1016/S0006-291X(02)02010-7

Ton C, Stamatiou D, Liew CC (2003) Gene expression profile of

zebrafish exposed to hypoxia during development. Physiol

Genomics 13:97–106

Valko M, Morris H, Cronin MTD (2005) Metals, toxicity and

oxidative stress. Curr Med Chem 12:1161–1208. doi:10.2174/

0929867053764635

Weber CI (1993) Methods for measuring the acute toxicity of

effluents and receiving waters to freshwater and marine organ-

isms, 4th edn. EPA/600/4–90/027F, Cincinnati

Wintz H, Yoo LJ, Loguinov A et al (2006) Gene expression profiles in

fathead minnow exposed to 2,4-DNT: correlation with toxicity in

mammals. Toxicol Sci 94:71–82. doi:10.1093/toxsci/kfl080

Wright P, Felskie A, Anderson P (1995) Induction of ornithine-urea

cycle enzymes and nitrogen metabolism and excretion in

rainbow trout (Oncorhynchus mykiss) during early life stages.

J Exp Biol 198:127–135

Zhang F, Hamanaka RB, Bobrovnikova-Marjon E et al (2006)

Ribosomal stress couples the unfolded protein response to p53-

dependent cell cycle arrest. J Biol Chem 281:30036–30045. doi:

10.1074/jbc.M604674200

292 S. S. Lewis, S. J. Keller

123