J Med Genet 1992; 29: 647-651

Identification of a new DMD gene deletion byectopic transcript analysis

Frauke Rininsland, Andreas Hahn, Susanne Niemann-Seyde, Ryszard Slomski,Folker Hanefeld, Jochen Reiss

AbstractThe detailed genetic analysis of theDuchenne/Becker muscular dystrophygene is hindered by the large number ofexons involved and their separation byhuge introns. These problems can beovercome by the analysis ofmRNA ratherthan genomic DNA and ectopic tran-scripts derived from peripheral bloodlymphocytes provide a convenient sourceof material. Using reverse transcriptionand nested PCR, we show here a compre-hensive strategy for the rapid and com-plete analysis of the coding sequencesfrom complex genes and illustrate itspotential by the identification of a hith-erto undescribed single exon deletion.(J7 Med Genet 1992;29:647-51)

Institut furHumangenetik,Gosslerstrasse 12d andAbteilungKinderheilkunde:SchwerpunktNeuropadiatrie,Robert-Koch-Strasse40, derUniversitatskliniken,3400 Gottingen,Germany.F RininslandA HahnS Niemann-SeydeR SlomskiF HanefeldJ Reiss

Correspondence to Dr Reiss,Institut fur Humangenetik,Gosslerstrasse 12d, 3400G6ttingen, Germany.Received 4 February 1992.Revised version accepted27 April 1992.

Duchenne muscular dystrophy (DMD) is an Xlinked recessive disorder affecting approxim-ately 1 in 3500 newborn males.' In contrast tothe mild allelic Becker muscular dystrophy(BMD), the Duchenne type is progressive andusually results in death during the seconddecade of life. The cDNA of the gene respon-sible for DMD/BMD has been cloned2 andsequenced.3 The gene product has been named'dystrophin' and is encoded by an mRNA of14 kb derived from at least 74 exons spreadover 2300 kb of the X chromosome.4The extraordinary size of the gene causes

extreme difficulties in molecular analysis. Al-though some 60% of DMD patients exhibitdeletions, detection of these requires Southernblots and hybridisation with six differentradiolabelled cDNA clones.5 Alternatively,98% of the deletions may be detected afteramplification of 19 different genomic frag-ments.' Since both procedures are difficult toperform for quantitative evaluation, and sinceonly 13% of deletions result in a readily de-tectable junction fragment,9 pulsed field gelelectrophoresis is occasionally used for carrierdetection in femnale relatives ofDuchenne patientswith deletions. This laborious procedure mustalso be applied to the detection of duplications,exhibited by another 6% of patients.'0The remaining one-third of patients are

thought to carry mutations in promoter ele-ments or point mutations and microdeletionseither in the coding sequence or in splice siteconsensus sequences. Until recently, thesemutations could not be detected, leaving thefamilies to be counselled with rather unsatis-factory estimates of risk. Although a numberof intragenic RFLPs are known and have beenused for segregation analysis," indirect

approaches are complicated by an intragenicrecombination rate of up to 12%12 and theoccurrence of new mutations in one-third ofisolated cases.'3 The use of flanking RFLPmarkers or the recently reported SSCP analy-sis of deleted regions'4 might prove helpful in afraction of cases, but are limited to informativeallele constellations.Bulman et all5 reported the first point muta-

tion in the DMD gene. Western blot analysisof biopsied muscle material indicated a trun-cated protein. Subsequent cDNA sequenceanalysis in the implicated region of specificallyexpressed muscle transcripts showed a basesubstitution, creating a stop codon within exon26. RNA analysis, in principle, should bemuch more straightforward for the analysis ofthe DMD gene since it reduces the size of thesubstrate to be studied to a coding region ofapproximately 11 kb. Both procedures used bythe above authors, however, required a musclebiopsy to obtain expressing tissue.We and others have previously shown that

'ectopic' or 'illegitimate' transcription16 17 inperipheral blood lymphocytes can be exploitedto circumvent muscle biopsies for RNA stud-ies and that pathological DMD/BMD tran-scripts resulting from a genomic deletion canbe detected in both hemizygous patients andheterozygous carriers.'819 Roberts et al20 havealready shown that this procedure can be usedfor a comprehensive analysis of the completecoding region without the use of radioactivesubstrates. However, all such studies to datewere aimed at deletions already characterisedat the genomic level. We report here a newDMD gene mutation, identified exclusively bymeans of ectopic lymphocyte cDNA analysisin a patient with no apparent deletion afterextended multiplex DNA amplification.

Case reportThe patient is of Polish origin. His early de-velopment was normal, and he was able to walkat 16 months. His family history was unre-markable. Progressive weakness, frequentfalls, and the inability to climb stairs led to aclinical examination at the age of 4 years. Heshowed all the clinical symptoms of musculardystrophy. His CK was raised to 13526 U/I(normal up to 50 U/1). The muscle biopsyshowed the typical dystrophic changes ofDMD with negative staining for dystrophinusing the two antibodies NCL-Dysl andNCL-Dys2 (Novocastra Laboratories). Nogenomic deletion was detected after multiplexamplification of 19 fragments, performed

647

group.bmj.com on July 10, 2011 - Published by jmg.bmj.comDownloaded from

Rininsland, Hahn, Niemann-Seyde, Slomski, Hanefeld, Reiss

according to Chamberlain et al67 and Beggs etal8 with minor modifications.

Materials and methodsRNA was isolated from peripheral blood lym-phocytes and reverse transcribed as describedelsewhere,'8 using eight cDNA primers pooledin two sets of four 'odd' and four 'even' oligo-nucleotides (50 ng each) in a total volume of30 1.l. A total of 7 pl of the cDNA products wasused for first round PCRs with eight oligonuc-leotide pairs spanning the whole coding regionas overlapping fragments. Cycling conditionswere: 30 x one minute at 92'C, 45 seconds at53'C, three minutes at 72'C, final extensionseven minutes, with 50 ng of each oligonucleo-tide, 0-2 mmol/I dNTPs, and 2-5 units Taq-DNA-polymerase (Amersham, UK) in a totalvolume of 50 tLI, according to the manufac-turer's recommendation, in a thermocyclertype 60 (Biomed, FRG).Second round PCR was performed with 1 g1

of the first round product and nested primersas described above. A total of 5 jIl of secondround PCR products was electrophoresed in1-2% agarose and visualised by ethidium bro-mide staining. Direct sequencing of PCR pro-ducts was performed according to Zielenskiet al"l All oligonucleotides were synthesisedautomatically (392 DNA/RNA synthesiser,Applied Biosystems, USA) and purified onNensorb columns (DuPont, FRG). Sequences

and usage of the different oligonucleotides aresummarised in the table.Genomic DNA was isolated by the method

of Miller et a122 and amplified with 50 pmol ofprimers 21F (5'GATGAAGTCAACCGGC-TATC, identical to the first bases of exon 21)and 21R (5'GTCTGTAGCTCTTTCTCTC,two nucleotides upstream of the 3' end of exon21) in 30 cycles (one minute at 92'C, oneminute at 48'C, 90 seconds at 72°C, finalextension seven minutes at 72°C) as describedabove using exon 55 as parallel control(55F: 5'GGCTGCTTTGGAAGAAACTC,55R: 5'TTACGGGTAGCATCCTGTAGGA,10 pmol each).

ResultsReverse transcription of peripheral blood lym-phocyte RNA and two stage PCR amplifica-tion showed a truncated fragment in theDMDpatient indicating the loss of approximately200 bp between DMD gene exons 20 to 23(fragment 3.2, fig 1). Direct sequencing of thisfragment showed that exon 21 was absent in itsentirety and that exon 20 was directly splicedto exon 22 (fig 2). Exon 21 is not included inroutinely performed 'multiplex' genoniicamplifications. Its absence, therefore, couldhave been caused either by a genomic deletionor by the mutation of a splice site junctionleading to exon skipping. In order to distin-guish between these two possibilities, exon 21

Sequences of the oligonucleotides usedfor cDNA synthesis and PCR. The nomenclature refers to the cDNA sequenceposition (according to Koenig et al3) of the first nucleotide. Usage for cDNA synthesis and PCRs (see also fig 1) isindicated. Oligonucleotides homologous to the non-coding strand are marked (R).

Primer sequence (5'-3) cDNA 1st PCR 2nd PCR

30 ACTCAGATCTGGGAGGCAATTA 1 11996 (R) TCTTTAGTCACTTTAGGTGGCC 1-1857 GATGTTGATACCACCTATCCAG 121409 (R) GTAGAATATTACCAACCCGGCCC 1-21437 CCTGTTCCAATCAGCTTAC 'Odd' 11367 TGTAAAACGACGGCCAGTATGGATTTGACAGCCC 2 211916 (R) GGCACTGTTCTTCAGTAAGACG 2-11809 AGGTATTGGGAGATCGATGG 2 22311 (R) CTCTTGAGCATGCTTTACCAG 2 22850 GATAGCCGGTTGACTTCATC 'Even' 22225 CAGCCATCACTAACACAGAC 3 3-12850 (R) GATAGCCGGTTGACTTCATC 312766 TGAAAATCCAACCCACCACC 3 23486 (R) AGTCTGCACTGTTTCAGCTGC 3 23416 TTTCTGAAGGAGGAATGGCC 3-34119 (R) TCAGAGTTTCCTCAGCTCCG 3 34167 GGGTTATCCTCTGAATGTCG 'Odd' 34033 GGAGAAAGCAAACAAGTGGC 4 4-14983 (R) ATATCTGTAGCTGCCAGCC 415283 GTGATGTGGTCCACATTCTGG 'Even' 44918 GAAATTGTCCCGTAAGATGCG 5 515283 (R) GTGATGTGGTCCACATTCTGG 515233 GGAATACCAGAAACACATGG 5 25744 (R) CCTCTCTCTTTCTCTCATCTG 5 25619 GGGTGAATCTGAAAGAGGAAG 5-36579 (R) TCAGCTTCTGTTAGCCACTG 5-36742 GGCATCTGTTTTTGAGGATTGC 'Odd' 56477 AAATGTACAAGGACCGACAAGG 6 6-16742 (R) GGCATCTGTTTTTGAGGATTGC 6-16604 TCCTGAGAATTGGGAACATGCT 6-27562 (R) TAGTAACCACAGGTTGTGTCAC 6-27496 GGACTGACCACTATTGGAG 6-38344 (R) GGCAGTTGTTTCAGCTTCTGTA 6-38370 TTACGGGTAGCATCCTGTAGGA 'Even' 68251 GGCTGCTTTGGAAGAAACTC 7 719084 (R) GATCCCTTGATCACCTCAGCTTGG 718903 AATGTCACTCGGCTTCTACGAAA 7-29785 (R) TCCCTGTTCGTCCCGTATC 7-29830 TACACAGGGAAATGATGCCAG 'Odd' 79706 CAATTTGGTCAACGTCCCTC 8 8-110600 (R) GCTCTCATTAGGAGAGATGC 8-110451 TTCTGGCCAGTAGATTCTGC 8-211321 (R) GATACTAAGGACTCCATCGC 8-211380 CATGCGGGAATCAGGAGTTG 'Even' 8

648

group.bmj.com on July 10, 2011 - Published by jmg.bmj.comDownloaded from

Identification of a new DMD gene deletion by ectopic transcript analysis

A

exons

cDNA primer odd

even

lstroundPCR odd2nd round PCR

|1-11 11-15115-30130-3! 34-44 43-55 155-6060-70?1

1 31.1 31

1-2 3-23-3

lstroundPCR even

2nd round PCR

2

2 12 2

4

4-1

6

6 16-2

6-3

8

8-18-2

CB IN' - N ~-N-- 'n - N, cn cn - N

4 . . . .CtN )' Cn I C L-0 LO wo co C0 r- r- 00 00 CoM 1 2 B

I-1 0 kb 720 bp -

-05 kb 550 bp-

Figure 1 Two stage cDNA amplification of the DMD gene transcript using peripheral blood lymphocyte RNA. (A) Diagram of reversetranscription and amplification strategy. (B) The 18 overlapping fragments of a healthy control after second round PCR and electrophoresis. Bblank (no RNA included), M size standard (1 kb ladder, BRL, USA). The doublet band in lane 1-2 is the result of skipping of exon 9 as alreadyobserved by Roberts et al.'9 This was confirmed by DNA sequencing (data not shown). (C) Aberrant fragment 3 2 (see A). Lane 1 healthycontrol, lane 2 DMD patient.

G A T C G A T C

T

exon 22 TTT

-o-

Gexon 20 A

A w.T

* :*

GT

GA

GAAT

~*

Figure 2 Autoradiograph of direct DNA sequence analysis offragment 3-2.patient's cDNA (left) shows direct joining of exons 20 and 22 (arrow) as cotthe exon 20 to 21 junction in a healthy control (right).

specific amplification was performed on geno-mic DNA (fig 3). This indicated the absence ofexon 21 in the patient's genomic DNA.Another 11 DMD patients without an appar-ent deletion in 'multiplex' amplifications weretested simultaneously, but no other deletion ofexon 21 was detected.

DiscussionThe limited detection rate of DMD gene mu-tations does not only complicate family stud-ies, but also drastically diminishes the value ofnegative results in differential diagnosis.Nevertheless, the screening for deletions alone

exon 21 is extremely laborious and time consuming,since either multiple hybridisations or numer-ous genomic DNA amplifications have to be

exon 20 performed. The latter concentrate on the twodeletion 'hot spots' at the 5' end and in themiddle of the DMD gene. Furthermore, notall exon boundaries are known.We have previously shown the diagnostic

utility of ectopic lymphocyte RNA by thecharacterisation of a new point mutation in theF8 gene causing haemophilia A,23 and thedetection of pathological DMD gene tran-scripts in a female muscular dystrophy car-

The rier.'8 Here we show that the DMD genehpared to transcript, which is distributed over approx-imately 0-1% of the human genome, can be

55 1

5-25-3

77-1

7-2

649

t. ...

group.bmj.com on July 10, 2011 - Published by jmg.bmj.comDownloaded from

Rininsland, Hahn, Niemann-Seyde, Slomski, Hanefeld, Reiss

R AM

- "78 bp- (exon 21:93 brn exor.55

Figure 3 Genomic amplification of exon 21 and 55 (internal control). Lanes 1, 3, 4healthy controls; lane 2 DMD patient; B blank (no genomic DNA), M size marker(1 kb ladder, BRL, USA).

reverse transcribed in only two separate reac-tions and subsequently amplified in 18 over-

lapping fragments. By these means we identi-fied a deletion of exon 21 in the cDNA of aDMD patient, who exhibited no mutation instandard multiplex DNA amplification.

Analysis of the genomic DNA indicated thatthe 'skipping' of exon 21 resulted from achromosomal deletion and direct sequenceanalysis confirmed that exon 20 was preciselyspliced to exon 22. This juxtaposition resultsin a reading frame shift, which in the majorityof cases causes the severe Duchenne pheno-type according to the hypothesis of Monaco etal.24 Here, an in frame termination signal(TGA) is created 14 codons downstream inexon 22. Chelly et at25 showed that ectopiclymphocyte DMD transcripts reflect themRNA structure found in expressing tissueand we have confirmed this observation fortranscripts of the cystic fibrosis transmem-brane conductance regulator (CFTR) gene.26According to these findings, a dystrophin pro-tein truncated after exon 20 can be expected inour DMD patient. This is in agreement withthe absence of detectable dystrophin in immu-nohistochemical analysis and confirms the dia-gnosis of a severe Duchenne type musculardystrophy.To our knowledge, a deletion of exon 21

alone has not been reported so far. The detec-tion of such small deletions outside the deletio-nal hot spots of the DMD gene at the genomiclevel would be extremely laborious. Followingthe above strategy, abnormal splicing patternsowing to mutated junction sequences27 mightbe as readily detectable as the described dele-tion. Furthermore, the number and size of oursecond round PCR products renders themsuitable substrates for point mutation screen-ing. A number of different scanning proced-ures are at hand for this purpose. Plieth et aP8have recently shown that the rapid singlestrand conformation polymorphism (SSCP)analysis detected all five CFTR mutationstested in a retrospective study. Roberts et aP9recently reported seven point mutations in thedystrophin gene identified by chemical mis-match detection.

Thus, all kinds of mutations might be de-tectable in a single comprehensive procedureusing readily accessible lymphocyte RNA. Anincreased detection rate for DMD mutationswould also be a major advantage for differen-tial diagnosis. However, the above proceduresare in no way limited to the DMD gene.Slomski et aP0 have stressed the ubiquitousnature of ectopic transcripts by the ratherextreme example of characterising transcriptsof spermatid specific genes in lymphocytes ofadult non-pregnant females. As peripheralblood can substitute for specifically expressingtissue, ectopic RNA studies are also suitablefor rapid carrier detection in female relatives ofDMD patients carrying a deletion. Since thefamily of our patient currently lives abroad, nosuch analysis was performed here. Such appli-cations, however, have already been describedelsewhere.'9 31

Note added in proofSince submission of this paper, we have identi-fied a genomic deletion of exon 18 in anotherpatient by the same means.

The authors wish to thank David N Cooper forhelpful comments on the manuscript, DorisGrosse for technical assistance, and DorisImmke for secretarial assistance. Our labora-tory is supported by the Deutsche For-schungsgemeinschaft and the DeutscheGesellschaft zur Bekampfung der Muskel-krankheiten.

1 Emery AEH. Population frequencies of inherited neuro-muscular diseases - a world survey. Neuromusc Dis1991;1:19-29.

2 Koenig M, Hoffman EP, Bertelson CJ, Monaco AP, FeenerC, Kunkel LM. Complete cloning of the Duchennemuscular dystrophy (DMD) cDNA and preliminarygenomic organization of the DMD gene in normal andaffected individuals. Cell 1987;50:509-17.

3 Koenig M, Monaco AP, Kunkel LM. The complete se-quence of dystrophin predicts a rod-shaped cytoskeletalprotein. Cell 1988;53:219-28.

4 Den Dunnen JT, Grootscholten PM, Bakker E, et al.Topography of the Duchenne muscular dystrophy(DMD) gene: FIGE and cDNA analysis of 194 casesreveals 115 deletions and 13 duplications. Am J HumGenet 1989;45:835-47.

5 Darras BT, Blattner P, Harper JF, Spiro AJ, Alter S,Francke U. Intragenic deletions in 21 Duchenne muscu-lar dystrophy (DMD)/Becker muscular dystrophy(BMD) families studied with the dystrophin cDNA:location of breakpoints on HindIII and BglII exon-containing fragment maps, meiotic and mitotic origin ofthe mutations. Am J Hum Genet 1988;43:620-9.

6 Chamberlain JS, Gibbs RA, Ranier JE, Nguyen PN, Cas-key CT. Deletion screening of the Duchenne musculardystrophy locus via multiplex DNA amplification. Nuc-leic Acids Res 1988;16:11141-56.

7 Chamberlain JS, Gibbs RA, Ranier JE, Caskey CT. Mul-tiplex PCR for the diagnosis of Duchenne musculardystrophy. In: Innis M, Gelfand D, Sninski J, White T,eds. PCR protocols: a guide to methods and applications.San Diego: Academic Press, 1990;272-81.

8 Beggs AH, Koenig M, Boyce FM, Kunkel LM. Detectionof 98% of DMD/BMD gene deletions by polymerasechain reaction. Hum Genet 1990;86:45-8.

9 LindlofM, Kiuru A, Kiariainen H, et al. Gene deletions inX-linked muscular dystrophy. Am J Hum Genet1989;44:496-503.

10 Hu X, Ray PN, Murphy EG, Thompson MW, Worton RG.Duplicational mutation at the Duchenne muscular dys-trophy locus: its frequency, distribution, origin, and phe-notype/genotype correlation. Am J Hum Genet1989;46:682-95.

11 Roberts RG, Cole CG, Hart KA, Bobrow M, Bentley DR.Rapid carrier and prenatal diagnosis of Duchenne andBecker_ muscular dystrophy. Nucleic Acids Res1990;17:81 1.

12 Abbs S, Roberts RG, Mathew CG, Bentley DR, BobrowM. Accurate assessment of intragenic recombination fre-quence within the Duchenne muscular dystrophy gene.Genomics 1990;7:602-6.

13 Russo A, Barbujani G, Mostacciuolo ML, et al. Sporadiccases in Duchenne muscular dystrophy. Hum Genet1987;76:230-5.

650

group.bmj.com on July 10, 2011 - Published by jmg.bmj.comDownloaded from

Identification of a new DMD gene deletion by ectopic transcript analysis

14 Richards RI, Friend K. Determination of Duchenne mus-cular dystrophy carrier status by single strand conforma-tion polymorphism analysis of deleted regions of thedystrophin locus. I Med Genet 1991;28:856-9.

15 Bulman DE, Gangopadhyay SB, Bebchuck KG, WortonRG, Ray PN. Point mutation in the human dystrophingene: identification through western blot analysis. Geno-mics 1991;10:457-60.

16 Chelly J, Concordet JP, Kaplan JC, Kahn A. Illegitimatetranscription: transcription of any gene in any cell type.Proc Natl Acad Sci USA 1989;86:2617-21.

17 Sarker G, Sommer SS. Access to a messenger RNA se-quence or its protein product is not limited by tissue orspecies specificity. Science 1989;244:331-4.

18 Schloesser M, Slomski R, Wagner M, et al. Characteriza-tion of pathological dystrophin transcripts from the lym-phocytes of a muscular dystrophy carrier. Mol Biol Med1990;7:519-23.

19 Roberts RG, Bentley DR, Barby TF, Manners E, BobrowM. Direct diagnosis of carriers of Duchenne and Beckermuscular dystrophy by amplification of lymphocyteRNA. Lancet 1990;336:1523-6.

20 Roberts RG, Barby TFM, Manners E, Bobrow M, BentleyDR. Direct detection of dystrophin gene rearrangementsby analysis of dystrophin mRNA in peripheral bloodlymphocytes. Am I Hum Genet 1991;49:298-310.

21 Zielenski J, Rozmahel R, Bozon D, et al. Genomic DNAsequence of the cystic fibrosis transmembrane conduc-tance regulator (CFTR) gene. Genomics 1991;10:214-28.

22 Miller SA, Dykes DD, Polesky HF. A sirnple salting outprocedure for extracting DNA from human nucleatedcells. Nucleic Acids Res 1988;16:1215.

23 Berg LP, Wieland K, Miller DS, et al. Detection of a novelpoint mutation causing haemophilia A by PCR/direct

sequencing of ectopically-transcribed factor VIII mRNA.Hum Genet 1990;85:655-8.

24 Monaco AP, Bertelson CJ, Liechti-Gallati S, Moser H,Kunkel LM. An explanation for the phenotypic dif-ferences between patients bearing partial deletions of theDMD locus. Genomics 1988;2:90-5.

25 Chelly J, Gilgenkrantz H, Hugnot JP, et al. Illegitimatetranscription. Application to the analysis of truncatedtranscripts of the dystrophin gene in nonmuscle culturedcells from Duchenne and Becker patients. I Clin Invest1991;88:1 161-6.

26 Slomski R, Schloesser M, Berg LP, et al. Omission of exon12 in CFTR gene transcripts. Hum Genet (in press).

27 Krawczak M, Reiss J, Cooper DN. The mutational spec-trum of single base-pair substitutions in mRNA splicejunctions ofhuman genes: causes and consequences. HumGenet (in press).

28 Plieth J, Rininsland F, Schlosser M, Cooper DN, Reiss J.Single-strand conformation polymorphism (SSCP)analysis of exon 11 of the CFTR gene reliably detectsmore than one third of non-AF508 mutations in Germancystic fibrosis patients. Hum Genet 1992;88:283-7.

29 Roberts RG, Bobrow M, Bentley DR. Point mutations inthe dystrophin gene. Proc Nati Acad Sci USA1992;89:2331-5.

30 Slomski R, Schloesser M, Chlebowska H, Reiss J, Engel W.Detection of human spermatid-specific transcripts in thelymphocytes of males and females. Hum Genet1991;87:307-10.

31 Niemann-Seyde S, Slomski R, Rininsland F, Ellermeyer U,Kwiatkowska T, Reiss J. Molecular genetic analysis of 67patients with Duchenne/Becker muscular dystrophy.Hum Genet (in press).

651

group.bmj.com on July 10, 2011 - Published by jmg.bmj.comDownloaded from

doi: 10.1136/jmg.29.9.647 1992 29: 647-651J Med Genet

 F Rininsland, A Hahn, S Niemann-Seyde, et al. ectopic transcript analysis.Identification of a new DMD gene deletion by

http://jmg.bmj.com/content/29/9/647Updated information and services can be found at:

These include:

References http://jmg.bmj.com/content/29/9/647#related-urls

Article cited in:

serviceEmail alerting

the box at the top right corner of the online article.Receive free email alerts when new articles cite this article. Sign up in

Notes

http://group.bmj.com/group/rights-licensing/permissionsTo request permissions go to:

http://journals.bmj.com/cgi/reprintformTo order reprints go to:

http://group.bmj.com/subscribe/To subscribe to BMJ go to:

group.bmj.com on July 10, 2011 - Published by jmg.bmj.comDownloaded from