Human fibroblast matrices bio-assembled undermacromolecular crowding support stablepropagation of human embryonic stem cellsYanxian Peng1,Michael Thomas Bocker2, JenniferHolm3,Wei Seong Toh4,5, Christopher StephenHughes6,Fahad Kidwai4, Gilles Andre Lajoie6, Tong Cao4, Frank Lyko2 and Michael Raghunath1,7*1Department of Bioengineering, Faculty of Engineering, National University of Singapore, Singapore2Division of Epigenetics, DKFZ-ZMBH Alliance, German Cancer Research Center, Heidelberg, Germany3Department of Biomedical Engineering, Texas A&M University, College Station, Texas, 77843-3120, USA4Dental Research Lab, Discipline of Oral Sciences, Faculty of Dentistry, National University of Singapore, Singapore5Department of Orthopaedic Surgery, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA, 02115, USA6Don Rix Protein Identification Facility, Department of Biochemistry, Schulich School of Medicine and Dentistry, University of WesternOntario, London, ON, Canada7Department of Biochemistry, Yong Loo Lin School of Medicine, National University of Singapore, Singapore

Abstract

Stable pluripotent feeder-free propagation of human embryonic stem cells (hESCs) prior to theirtherapeutic applications remains a major challenge. Matrigel™ (BD Singapore) is a murine sarcoma-derived extracellular matrix (ECM) widely used as a cell-free support combined with conditioned orchemically defined media; however, inherent xenogenic and immunological threats invalidate it forclinical applications. Using human fibrogenic cells to generate ECM is promising but currently suffersfrom inefficient and time-consuming deposition in vitro. We recently showed that macromolecularcrowding (MMC) accelerated ECMdeposition substantially in vitro. In the current study, we used dextransulfate 500 kDa as amacromolecular crowder to induceWI-38 fetal human lungfibroblasts at 0.5% serumcondition to deposit human ECM in three days. After decellularization, the generated ECMs allowedstable propagation of H9 hESCs over 20 passages in chemically-defined medium (mTEsR1) with anoverall improved outcome compared to Matrigel in terms of population doubling while retainingteratoma formation and differentiation capacity. Of significance, only ECMs generated by MMC allowedthe successful propagation of hESCs. ECMs were highly complex and in contrast to Matrigel, containedno vitronectin but did contain collagen XII, ig-h3 and novel for hESC-supporting human matrices,substantial amounts of transglutaminase 2. Genome-wide analysis of promoter DNA methylation statesrevealed high overall similarity between human ECM- and Matrigel-cultured hESCs; however, distinctdifferences were observed with 49 genes associated with a variety of cellular functions. Thus, humanECMs deposited by MMC by selected fibroblast lines are a suitable human microenvironment for stablehESC propagation and clinically translational settings. Copyright © 2012 John Wiley & Sons, Ltd.

Received 29 May 2011; Revised 9 May 2012; Accepted 29 May 2012

Supporting information may be found in the online version of this article.

Keywords human embryonic stem cells; feeder-free culture; extracellular matrix; macromolecular crowding;chemically defined medium; DNA methylated transglutaminase

1. Introduction

Successful propagation of human embryonic stem cells(hESCs) in culture pursues two apparently contradictoryaims, namely increasing cell numbers while preventing

*Correspondence to: Assoc Prof. Michael Raghunath, M.D., Ph.D.,Division of Bioengineering, Faculty of Engineering & Dept ofBiochemistry, Yong Loo Lin School of Medicine, National Universityof Singapore. Tel: (65) 6516 5307; Fax: (65) 6776 5322. E-mail:bierm@nus.edu.sg, website: www.tissuemodulation.com

Copyright © 2012 John Wiley & Sons, Ltd.

JOURNAL OF TISSUE ENGINEERING AND REGENERATIVE MEDICINE RESEARCH ARTICLEJ Tissue Eng Regen Med (2012)Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/term.1560

significant differentiation to preserve hESC pluripotency.Pioneering work by Bongso et al. (1994) made it possibleto propagate hESCs using a co-culture system. Initially,epithelia from human reproductive organs were used.Later, inactivated murine embryonic fibroblast (MEF)feeders were introduced for practical reasons. The notionthat MEFs and culture ingredients of animal originharboured contamination risks and induced expressionof immunogenic non-human sialic acids on hESCs(Martin et al., 2005) intensified the search for humanfeeder fibroblasts (Richards and Bongso, 2006). How-ever, it was found that not every cell line was a suitablefeeder (Richards and Bongso, 2006). Furthermore,co-culture of hESCs with feeders created noise in hESCanalyses and feeder cells admixed with hESCpopulations presented a regulatory obstacle. As a result,feeder-free culture systems became a priority in hESCresearch, and both MEF-derived ECM and humanfibroblast-derived ECM have since been tested for thepropagation of hESCs (Xu et al., 2001; Klimanskayaet al., 2005; Meng et al., 2010).

While in vitro production and secretion of ECM compo-nents does not normally pose a problem, their efficientsupramolecular assembly and stable deposition as aninsoluble matrix represents a major obstacle in conven-tional cell culture (Lareu et al., 2007a). As a result,most ECM components are regularly lost duringculture medium changes and generation of ECMs eitherfromMEFs or human cells is largely inefficient and requiresculture durations of up to 21 days using 10% FBS or 10%human serum, respectively (Klimanskaya et al., 2005;Meng et al., 2010).

As an interim solution, Matrigel™ (BD Biosciences, SanJose, CA, USA) has been widely used as a commerciallyavailable ECM for the propagation of hESCs, preferablyin MEF-conditioned culture medium or in chemicallydefined media (Xu et al., 2001; Ludwig et al., 2006).Matrigel is reconstituted from basement membrane ECMproteins secreted by a murine sarcoma cell line (Kleinmanet al., 1981) but lacks structures typical for native base-ment membrane. It is unclear to what extent this materialcan emulate a native microenvironment for hESCs and itsmurine origin poses a xenogenic threat. This, and the factthat Matrigel-exposed hESCs express non-human sialicacid Neu5Gc, which can cause an immune response inhuman hosts (Lanctot et al., 2007), rules out the use ofMatrigel for clinical applications.

As such, there remains a need to develop human cell-derived matrices that serve as a native microenvironmentfor hESCs, can be rapidly produced and require minimalor no serum. We have shown previously that the additionof 500 kDa dextran sulfate (DxS) (Lareu et al., 2007a;Lareu et al., 2007b) or a mix of 70 and 400 kDa Ficoll(Chen et al., 2009) leads to enhanced and acceleratedECM deposition under low serum conditions. In thecurrent study, we used this technology to generate humanbio-assembled matrices as growth supports for pluripotenthESC culture in conjunction with mTESR-1, a chemicallydefined culture medium.

2. Materials and methods

2.1. Preparation of cell-free matrices

The fibroblast cell culture used was prepared as previouslydescribed (Lareu et al., 2007a; Lareu et al., 2007b; Pengand Raghunath 2010). WI-38 fibroblasts (ATCC; BeijingZhongyuan Limited, Beijing, China) at passage 20-22 wereseeded at 25 000 cells/cm2 in culture plates or flasks(Greiner Bio-one, Monroe, NC, USA) under standardconditions in 10% FBS in DMEM. On the following day,culture medium was switched to DMEM with and without0.5% FBS (GibcoW, Invitrogen China Ltd., Beijing, China)containing 30 mg/ml ascorbic acid phosphate (Wako PureChemical Industries, Ltd., Osaka, Japan) with and without100 mg/ml dextran sulfate 500 kDa (US Biologicals,Swampscott, MA, USA) or 37.5mg/ml Fc 70 kDa and25mg/ml Fc 400k Da. (GE Healthcare, USA). Afterthree DxS or six days Fc, fibroblasts were lysed with aDOC, DOCDOC and NP40 lysis protocol. The DOC lysisprotocol consisted of three 10-min incubations on ice with0.5% (w/v) sodium deoxycholate (Prodotti Chimici EAlimentari S.P.A., Italy) and 0.5x complete protease inhibi-tor (Roche Diagnostics Asia Pacific Pte Ltd., Singapore)dissolved according to manufacturer instructions. TheDOCDOC protocol consisted of six 10-min incubations onice of 0.5% (w/v) sodium deoxycholate and 0.5x completeprotease inhibitor dissolved according to manufacturerinstructions. The NP40 protocol consisted of four 10-minincubations on ice of 1% (v/v) Nonidet P-40 with 0.5xcomplete protease inhibitor and two 30-min incubationsat 37�C of 1X DNase (USBiological, Biomed DiagnosticsPte Ltd., Singapore) dissolved according to manufacturerinstructions. Following lysis, all matrices were washedthree times with PBS and stored at 4�C. 293T humanembryonic kidney cells (ATCC, Beijing), NT2 neuron-committed teratocarcinoma cells (NTera2 clone D1)(Andrews et al., 1984) and human foreskin fibroblasts(ATCC, Beijing) were seeded at 50 000 cells/cm2 each inculture plates or flasks in 10% FBS in DMEM. Culturemediumwas changed to 0.5% FBS in DMEM supplementedwith 30 mg/ml ascorbic acid phosphate and 100 mg/ml DxSon the following day. After three days of incubation, cellswere lysed using the DOC protocol described earlier andthe resulting matrices stored in PBS at 4�C.

2.2. hESC culture

Frozen H9 cells (WiCellW, Madison, WI, USA) at passage 25were obtained from WiCell Research Institute and initiatedon human MEF (Singapore Stem Cell Bank, Singapore)feeders for recovery. After five passages on MEFs, hESCswere passaged using collagenase IV (Gibco, China) ordispase (STEMCELL Technologies™, Singapore PTE Ltd.,Singapore) onto hESC-qualified Matrigel (BD, China)coated according to manufacturer instructions usingDxSDOC and DxSDOCDOC matrices and cultured usingmTeSR-1 (STEMCELL, Singapore).Media changes occurred

Yanxian Peng et al.

Copyright © 2012 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2012)DOI: 10.1002/term

daily and cells were subcultured every 5-7 days. Represen-tative wells were used for cell counting by hemocytometerat each passage to calculate population doublings.

2.3. Characterization of hESCs

Primary antibodies used for flow cytometry using a DakoCyAn Cytomation high-speed cell sorter (SPD ScientificPte Ltd., Singapore) and adherent immunofluorescenceincluded rat anti-SSEA-3, mouse anti-SSEA-4, mouse antiTRA-1-60, mouse anti TRA-1-81 (all from Chemicon;Merck Millipore, Billerica, MA, USA) and goat anti-Oct-4(Santa Cruz Biotechnologies, Singapore). Secondary anti-bodies included Alexa FluorW 488 chicken anti-mouse,Alexa Fluor 488 goat anti-rat, Alexa Fluor 488 donkeyanti-goat and Alexa Fluor 594 goat anti-mouse (allfrom Invitrogen, China). Nuclei were counterstained with4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, China).For in vivo teratoma formation assays, four confluent wells(6-well plate format) of hESCs cultured for 18 passageswere harvested using collagenase IV resuspended in 200ml HBSS and injected intramuscularly into the right hindlimb of SCID mice. Neural differentiation in vitro wasperformed using a standard protocol from WiCell. Briefly,hESCs harvested with collagenase IV were seeded ontonon-adherent plates (Corning, NY, USA) to form embryoidbodies using 20% KnockOut™ serum in Knockout DMEM(Invitrogen, Singapore). After four days, culture mediumwas changed to DMEM/F12 (Invitrogen, Singapore)supplemented with non-essential amino acids, N2, heparin(all from Sigma, Singapore) and FGF-2 (ProSpec, Rehovot,Israel). Embryoid bodies were seeded onto 6-well plates(CellStar, Greiner Bio-One, Practical Mediscience Pte Ltd.,Singapore) for three days and then transferred to laminin-coated wells (Sigma, Singapore) for seven days. Sampleswere formaldehyde-fixed and immunolabeled with rabbitanti-b III tubulin (AbcamW, Cambridge, UK), Alexa Fluor488 chicken anti-rabbit (Invitrogen, Singapore) and DAPI.Karyotyping was performed at the KK Women’s andChildren’s Hospital, Singapore.

For DNA methylation profiling, hESCs were harvestedby scraping, pelleting and snap freezing in liquid nitrogen.Genomic DNA was isolated using the DNeasy Blood &Tissue Kit (QIAGEN Singapore Pte. Ltd., Singapore) andbisulfite-converted using the EZ-96 DNA Methylation™Kit (Zymo Research, SPD Scientific PTE Ltd., Singapore)according to manufacturer recommendations. Genome-wide promoter DNA methylation profiles were obtainedusing HumanMethylation27 bead chip technology(Illumina, Singapore) as described previously (Grönnigeret al., 2010). DNA methylation levels were scored as bvalues ranging from 0 (unmethylated) to 1 (completelymethylated). Genes were scored as differentially methyl-ated if their b value differed by 0.2 or more (Grönnigeret al., 2010). Deep 454 DNA bisulfite sequencing wasperformed from equimolar sample pools as describedpreviously (Grönniger et al., 2010). Primer sequencesfor 454 bisulfite sequencing of the OCT4 promoter region

were adapted from published primers (Deb-Rinkeer et al.,2005). Each 454 primer consisted of a gene specific sequence(Oct4-T1-F: AAGTTTTTGTGGGGGATTTGTAT, Oct4-T1-R:CCACCCACTAACCTTAA CCTCTA, Oct4-T2-F: GTTAGAGGT-TAAGGTTAGTGGGTG and Oct4-T2-R: AAA CCTTAAAAACTTAACCAAATCC), a sample specific multiplex identi-fier (CACACA for Matrigel, GAGAGA for DxSDOC andTATATA for DxSDOCDOC) as well as a 454 Titaniumadaptor sequence.

2.4. Characterization of cell-free matrices

Primary antibodies used to stain ECMsweremouse anti-PDI(Invitrogen, Singapore), mouse anti-collagen I (Sigma,Singapore), rabbit anti-fibronectin (Dakocytomation, SPDScientific Pte Ltd, Singapore, mouse anti-heparan sulfate(Seikagaku, Tokyo, Japan), mouse anti-fibrillin-1 (Chemi-con, USA), LF-136 rabbit anti-decorin and AB39 rabbitanti-LTBP-1. Secondary antibodies were Alexa Fluor 594goat anti-mouse and Alexa Fluor 488 chicken anti-rabbit(Invitrogen, Singapore). Counterstaining was performedwith DAPI and Alexa-Fluor 594 phalloidin (Invitrogen,Singapore).

3. Results

3.1. Generation of NoDxSDOC, DxSDOC,DxSDOCDOC, DxSNP40 and FcNP40 matrices

WI-38 fibroblast cell layers were treated with only ascorbicacid (NoDxS) and DxS or Fc subjected to DOC, DOCDOCand NP40 detergent treatments to obtain NoDxSDOC,DxSDOC, DxSDOCDOC, DxSNP40 and FcNP40 matrices.Immunostaining confirmed the loss of intracellular struc-tures, including endoplasmic reticulum, F-actin and nuclei(Fig. S1), thus demonstrating the successful generation ofcell-free matrices. Matrices were also generated using293Tcells or NT2 cells and subjected to DOC lysis, resultingin 293TDOC and NT2DOC matrices.

The removal of cell layers resulted in losses of ECMproteins corresponding to DOC exposure. However, bothDxSDOC and DxSDOCDOC matrices continued to retaintheir constituent complexity as revealed by immunofluo-rescence (Figure 1) and mass spectrometry (SupportingTable S1). In DxSDOC matrices, collagen I appearedas granular deposits but was barely detectable inDxSDOCDOC matrices. Fibronectin was present in bothmatrices in a heterogeneous distribution but was morepronounced in DxSDOC matrices. The colocalization ofcollagen I staining and fibronectin showed the preservedinteraction between collagen I and fibronectin after deter-gent treatment. LTBP-1 staining intensity and morphologyappeared similar in both matrix preparations. The microfi-brillar component fibrillin-1was found in DxSDOCmatricesas large irregularly shaped aggregates but was undetectablein DxSDOCDOCmatrices. Both matrices showed a speckled

Human fibroblast matrices bioassembled under macromolecular crowding support stable propagationof human embryonic stem cells

Copyright © 2012 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2012)DOI: 10.1002/term

deposition pattern for decorin with weaker intensity inDxSDOCDOCmatrices. Heparan sulfate proteoglycans werefound in DxSDOC matrices as fine aggregates and inDxSDOCDOC as larger more diffuse aggregates.

Mass spectrometry revealed extracellular matrix proteinssuch as collagens, EMILIN-1, fibronectin, fibrillin I, tenascin,transglutaminase 2 and the following remnants of cytoplas-mic elements: heat-shock protein 70 kDa, cytoskeletalproteins actins, tubulins and nucleus-associated proteinssuch as histones (Supporting Table S1).

3.2. 293TDOC, NT2DOC, NoDxSDOC, DxSNP40and FcNP40 matrices did not sustainpluripotent morphology

Assessment of colony morphology of hESC culturesserved as an initial step towards characterization ofhuman cell-derived matrices. hESCs cultured on 293TDOCand NT2DOC matrices exhibited differentiated morpholo-gies after 12 passages (Fig. S2); hESCs grew in eitheroptically dense aggregates resembling embryoid bodies orin monolayers of large flattened fibroblast-like cells. hESCscultured on NoDxSDOC matrices proliferated (Figure 2A)but lost pluripotent morphology by passage 2 (Figure 2B).The majority of hESCs grew in optically dense aggregatesresembling embryoid bodies with outgrowths of sponta-neously differentiated fibroblast-like cells that were largeand flattened. hESCs were unable to adhere to or prolifer-ate on fibroblast matrices produced with either DxSor Fc or those that were decellularized with NP40. Thesecells were easily detached by mechanical disturbances(Figures 2A, 2B).

3.3. DxSDOC and DxSDOCDOC matrices enabledsuperior population doublings in hESCscompared to Matrigel

hESCs were propagated on either Matrigel, DxSDOCor DxSDOCDOC matrices for up to 20 passages usingeither collagenase IV or dispase. Using either enzyme,hESCs cultured on DxSDOC or DxSDOCDOC matricesachieved more population doublings than on Matrigel(Figure 3A). Morphologically, DxSDOC- and DxSDOC-DOC-propagated hESCs retained their typical small size,high nuclear to cytoplasm ratio and grew in distinctround colonies throughout the 20 passages. In contrast,after 20 passages on Matrigel, most hESC colonies losttheir clear borders and larger (differentiated) cells occu-pied the outgrowth between those colonies (Figure 3B,red circles).

3.4. Human ECM-propagated hESCs maintainedkaryotypic stability

In light of enhanced proliferation rates of hESCs DxSDOCor DxSDOCDOC, we sought to assess the karyotype ofhESCs cultured under various experimental conditions.DxSDOCDOC-propagated hESCs subcultured using eithercollagenase IV or dispase retained normal karyotypes forall 20 metaphases tested (Figure 4A). Eighteen of 20collagenase IV-subcultured DxSDOC-propagated hESCsand 19 of 20 metaphases of dispase-subcultured DxSDOC-propagated hESCs were karyotypically normal. Nineteenof 20 metaphases of Matrigel-propagated hESCs were

Figure 1. Characterization of matrices. Immunofluorescence staining showing the presence of several ECM proteins in DxSDOC andDxSDOCDOC matrices. Bar 100 mm

Yanxian Peng et al.

Copyright © 2012 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2012)DOI: 10.1002/term

normal when subcultured by either enzyme. This suggeststhat human fibroblast matrices maintained karyotypicstability in hESCs cultures, a critical characteristic for futureapplication in transplant therapies.

3.5. Human ECM-propagated hESCs retaineddifferentiation capacity after long-term passaging

To ascertain the in vitro differentiation potential of humanECM-cultured hESCs, we induced neural differentiation.Results showed that cells cultured on human fibroblastECM formed long extensions that stained positive for bIII tubulin, a marker for neural differentiation (Figure 4B).This indicated that hESCs propagated on human matricesretained their neural differentiation capacity. Using theteratoma formation assay in vivo, we found that teratomasformed by hESCs propagated on DxSDOC or DxSDOCDOCafter 18 passages. Histological data yielded evidence forrepresentative differentiated tissues derived from each ofthe three germ layers (Figure 4C).

3.6. Human ECM-propagated hESCs maintainedexpression of pluripotency markers

SSEA-3 and SSEA-4 marker population percentage ex-pression of hESCs subcultured using collagenase IV weresimilar during propagation on Matrigel, DxSDOC andDxSDOCDOC (Figure 5A). However, subculturing usingdispase caused an increase in percentage population ofhESCs expressing SSEA-3 on DxSDOCDOC matrices at63 % compared to Matrigel (14%) and DxSDOC (29%)(Figure 5A). SSEA-4 percentage population expressionof DxSDOC- or DxSDOCDOC-cultured hESCs was similar

to Matrigel-cultured hESCs (Figure 5A). Interestingly,SSEA-3 percentage population expression of dispase-passaged hESCs on DxSDOC was significantly lower thandispase-passaged hESCs on DxSDOCDOC (Student’st-test; p-value=0.0002) (Figure 5A), showing down-regulation of SSEA-3 expression in hESCs cultured onDxSDOC matrices. However, SSEA-4 percentage popula-tion expression was not significantly altered betweenhESCs cultured on DxSDOC or DxSDOCDOC. This differ-ence between SSEA-3 and SSEA-4 expression levels couldbe an indication of the impending differentiating state ofhESCs on DxSDOC matrices after an extended number ofpassages. In this regard, hESCs cultured with mTeSR-1and dispase enzymatic passaging could be better main-tained on DxSDOCDOC matrices than on DxSDOC matri-ces. Furthermore, the ubiquitous decrease in SSEA-3 andSSEA-4 percentage population expression in hESCspassaged using dispase compared with collagenaseshowed that collagenase passaging was more compatiblewith long-term passaging in feeder-free culture systemsusing mTeSR-1. In contrast to dispase-passaged hESCs,collagenase-passage hESCs did not show SSEA-3 norSSEA-4 expression differences when cultured onDxSDOC or DxSDOCDOC. This indicated that the suit-ability of both DxSDOC and DxSDOCDOC matrices forhESC culture was dependent on the enzymatic passagingmethod. From this perspective, it appears that theDxSDOCDOC matrix was better suited for hESC culturewhen using mTeSR-1 medium since this system was ableto maintain marker expressions at comparatively highlevels regardless of the enzyme used.

Immunofluorescence staining of adherent hESCs forOct 4, SSEA-4, TRA-1-60, TRA-1-81 and SSEA-3 werein agreement with morphological and flow cytometricdata. With increasing passage numbers, Matrigel-culturedhESC colonies lost their defined margins and an

Figure 2. hESCs propagated on NoDxSDOC, DxSNP40 and FcNP40 matrices differentiated or did not attach. A) Population doublingsof hESCs propagated using NoDxSDOC, DxSNP40 and FcNP40. B) Phase contrast images showing hESCs’ differentiated morphologyand non-attachment during propagation. Bar 500 mm

Human fibroblast matrices bioassembled under macromolecular crowding support stable propagationof human embryonic stem cells

Copyright © 2012 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2012)DOI: 10.1002/term

increasing number of differentiated cells occupied theoutgrowth (compare with Figure 3B). In line with this,immunofluorescence observation demonstrated loss ofpluripotencymarker expressionafter 20passages (Figure5B,arrows). In contrast, hESCs passaged on DxSDOC andDxSDOCDOC showed retention of thesemarkers (Figure 5B,arrows). These results suggest a higher degree of mainte-nance of hESC pluripotency marker expression on humanECM rather than on Matrigel.

3.7. Epigenetic profiling of Matrigel-propagatedhESCs versus human ECM-propagated hESCs

Stem cell-specific DNA methylation patterns are impor-tant molecular markers of pluripotency. A prominentexample in this context was the methylation status ofthe OCT4 promoter region, which was unmethylated inhESCs but methylated in differentiated cells (Barrandand Collas, 2010). We used deep 454 bisulfite sequencing

Figure 3. hESCs propagated on Matrigel, DxSDOC and DxDOCDOC matrices for up to 20 passages. A) Population doublings of hESCspropagated using either collagenase IV or dispase on Matrigel, DxSDOC or DxSDOCDOC. B) Phase contrast images showing hESCmorphology during propagation. Bar 500 mm

Yanxian Peng et al.

Copyright © 2012 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2012)DOI: 10.1002/term

to analyze OCT4 promoter methylation of hESCs culti-vated on Matrigel and human fibroblast matrices. Resultsshowed that the OCT4 promoter was unmethylatedunder all conditions analyzed (Figure 6A).

In the next set of experiments, we used IlluminaW

Infinium HumanMethylation27 (Illumina, San Diego,CA, USA) arrays to determine the methylation status of27 578 CpG dinucleotides representing 14 475 promoters.This analysis was performed with hESCs cultured onMatrigel, DxSDOC and DxSDOCDOC and generated 3million data points with beta values for individualmarkers ranging from 0 (unmethylated) to 1 (completelymethylated). For subsequent analyses, all X-chromosomaldatawere excluded to eliminate the influence of sex-specificX-chromosome methylation differences. Unsupervised hier-archical clustering of the three newly obtained methylationprofiles together with 14 published profiles from other

tissues (mesenchymal stem cells; Bork et al., 2010), kerati-nocytes and fibroblasts (Grönniger et al., 2010) revealed ahigh overall similarity in the methylation patterns ofdefined cell types (Figure 6B).

A comparison of promoter DNA methylation patternsbetween Matrigel and DxSDOC cultures and Matrigeland DxSDOCDOC cultures revealed a high degreeof similarity, with Pearson’s correlation coefficientsexceeding 0.97 (Figure 6C). However, this analysis alsorevealed 426 markers that were differentially methylatedbetween Matrigel and DxSDOC cultures and 194markers differentially methylated between Matrigel andDxSDOCDOC cultures (Supporting Tables S2 and S3).These two data sets showed an overlap of 49 markers thatwere differentially methylated in Matrigel-propagated vs.human ECM-propagated hESCs (Figure 6D). The 49markers represent a diverse group of genes (Supporting

Figure 4. hESCs propagated on DxSDOC and DxSDOCDOC matrices for 18 passages retained karyotypic stability and differentiationcapacity. A) Karyograms of hESCs propagated on Matrigel, DxSDOC and DxSDOCDOC using collagenase IV or dispase. B) hESCs werepositive for neural marker b III Tubulin when induced to undergo neural differentiation, showing that hESCs retained neural differ-entiation capabilities after long term passaging. Bar 100 mm. C) hESCs formed teratomas with differentiated structures representativeof tissues of the three germ layers, indicating retention of pluripotency. Black arrows indicate ciliated structures, red arrows indicategoblet cells. Bar 50 mm

Human fibroblast matrices bioassembled under macromolecular crowding support stable propagationof human embryonic stem cells

Copyright © 2012 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2012)DOI: 10.1002/term

Figure 5. Expression of pluripotency markers in hESCs propagated on Matrigel, DxSDOC and DxSDOCDOC matrices for 20 passages.A) Flow cytometry of SSEA-3 and SSEA-4 expression in hESCs. B) Adherent immunofluorescence analysis for Oct 4, SSEA 4, TRA-1-60,TRA-1-81 and SSEA-3 expression in hESCs. Bar 100 mm. *P value by Student’s T test<0.05

Yanxian Peng et al.

Copyright © 2012 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2012)DOI: 10.1002/term

Table S4) associated with many different cellular func-tions. While the functional significance of this observationwill have to be analyzed in future studies, it is possiblethat the differential methylation of certain genes contrib-uted to the superior pluripotency of hESCs cultured onhuman ECM.

3.8. Human matrices were able to maintainpluripotent morphology of human-inducedpluripotent stem cells for at least five passages

Other than hESCs, induced pluripotent stem cells (iPSCs)were also cultured on human matrices for up to five

Figure 6. DNA methylation analysis. A) 454 bisulfite sequencing of OCT4 promoter shows low DNA methylation levels. Sequencedregions are indicated as bars labeled T1 for amplicon 1 and T2 for amplicon 2. Vertical lines represent individual CpG dinucleotides.Sequencing results are shown as heatmaps and sequencing coverage ranged from 37x to 2028x. B) Unsupervised hierarchical clusteringof newly obtained Infiniummethylation profiles of hESCs onMatrigel (hESCsM), DxSDOC (ESCs D) andDxSDOCDOC (hESCs DD) togetherwith 14 published profiles from other tissues revealed a high overall similarity in the methylation patterns of defined cell types. C) DNAmethylation profiles were compared between hESCs on Matrigel and DxSDOC and DxSDOCDOC. Results show a very high similarity withcorrelation coefficients of r2=0.97 and 0.98, respectively. D) Venn diagram showing overlap of differentially methylated markers inMatrigel-propagated vs. human ECM-propagated hESCs. The 49 markers represent a diverse group of genes with many different functions

Human fibroblast matrices bioassembled under macromolecular crowding support stable propagationof human embryonic stem cells

Copyright © 2012 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2012)DOI: 10.1002/term

passages. Preliminary morphological observations ofcontrol iPSCs cultured on Matrigel showed that Matrigelwas unable to retain the pluripotent morphology of thesecells. Control iPSCs lost their high nuclear to cytoplasmicratio, had reduced colony sizes and diffuse colony edges(Fig. S3). Cells growing on the periphery of the colonieswere large and flattened while the colony centres weredense and resembled embryoid bodies, indicating wide-spread spontaneous differentiation. In contrast, iPSCscultured on human matrices DxSDOC and DxSDOCDOCretained a more distinct pluripotent morphology. Cellsgrew in distinct colonies and displayed high nuclear tocytoplasm ratios (Fig. S3). Some cells at the peripheryof the colonies were larger and flattened (arrows) butthese spontaneously differentiated cells represented amuch smaller percentage of the population compared tothe control iPSCs.

The widespread spontaneous differentiation of controliPSCs indicated the instability of the undifferentiatedstate of iPSCs and sensitivity to their microenvironment;clearly, Matrigel in combination with mTeSR-1 was notcompatible for long-term culture of these iPSCs. Incomparison, human matrices were better able to main-tain iPSCs in mTeSR-1, although the authors recognizethat further optimization was still required to provelong-term culture stability.

3.9. Human matrices from foreskin fibroblasts(HFFs) were able to maintain hESCpluripotent culture

After extended characterization of long-term prolifera-tion of hESCs on ECMs generated from WI-38 fibroblasts(normal human fetal lung fibroblasts), we tested matricesproduced from human foreskin fibroblasts that weresuitable feeders for hESC propagation. Morphologicalobservations for up to eight passages demonstrated thathESCs retained pluripotent morphologies on DOC-lysedHFF matrices. Cells continued to grow in distinct coloniesand individual cells showed high nuclear to cytoplasmratios (Fig. S4A) similar to cells cultured on Matrigel.Furthermore, immunofluorescence staining for Oct-4,SSEA-4 and Tra-1-81 showed maintenance of expressionof these markers for hESC propagated on HFF matrices(Fig. S4B).

3.10. Human ECM deposited under crowdingwithout serum supported hESC culture

Human ECM was also deposited under crowded condi-tions but in the absence of serum to show that humanECM could be made without serum. Preliminary immuno-fluorescence observations of hESCs cultured on thesematrices for two weeks showed that they continued toexpress Oct-4 (Fig. S5).

4. Discussion

This study showed that human ECM bio-assembledin vitro using macromolecular crowding and decellular-ized with the anionic detergent deoxycholate couldsupport hESC culture for up to 20 passages. Two factorsdetermined the efficacy of these matrices: stringency ofthe detergent treatment and cell type depositing thematrix. In general, MMC generated a complex ECM con-taining a wide variety of collagens and non-collagenousECM components, ligands (Chen et al., 2011) and lysyloxidase mediated crosslinks (Lareu et al., 2007b; Chenand Raghunath, 2009). This predicted a greater retentionof selected ECM components and ligands during stringentdetergent treatment but also a preferential loss of lessstable incorporated ECM components. Our findingssuggest that biochemical cues were retained in the decel-lularised ECMs, suppressing spontaneous differentiationof hESCs. In the quest for such cues, we identified LTBP-1 that stores latent TGFb-1 (Raghunath et al., 1998;Annes et al., 2003), decorin and biglycan. Both decorinand biglycan scavenge activated TGFb-1 (Schoenherrand Hausser, 2000). These ligands are capable of main-taining equilibrium between active and latent TGFb-1,which is crucial for maintaining pluripotency (Peifferet al., 2008). We also found evidence of heparan sulfateproteoglycans that bind FGF-2, an important growthfactor for maintaining hESC pluripotency (Xu et al.,2005; Bendall et al., 2007). FGF-2 has a notoriously shorthalf-life as a supplement in culture medium but showedprolonged biological action and protection from degrada-tion when bound to matrix (Saksela et al., 1988).

Another important factor was the origin of matrix-producing cells. Analogous to the situation using feederlayers, not every cell line tested proved capable of layingdown suitable ECM for maintaining hESC pluripotency.We identified the widely used WI-38 human diploid celloriginally derived by Hayflick from normal embryoniclung tissue (Hayflick and Moorhead, 1961) as suitable. Adetailed mass spectrometry analysis of MMC-inducedWI-38 ECM revealed the presence of proteins notdescribed before in other human matrices, Matrigel orcoating procedures suggested for hESC culture purposes;namely collagen XII, transglutaminase 2 and TGFb-induced protein ig-h3 (Table S1). Collagen XII, a non-fibrillar collagen, has been described in developingembryonic tissues (Thierry et al., 2004) and can reflecton the embryonic origin of WI-38 cells. Transglutaminase2 catalyzes protein crosslinking, apoptosis and differentia-tion and plays a role in integrin-mediated cell adhesion(Wang et al., 2011; Nadulatti et al., 2011). Significantactivity of this enzyme is present in ECM deposited underMMC (Chen et al., 2011). The presence of b ig-h3, whichmediates cell adhesion, bound to collagen VI (Hanssenet al., 2003), biglycan and decorin (Reinboth et al.,2006), indicates active TGFb signaling during matrixproduction. The possible role of all three proteins forhESC pluripotency is currently unknown.

Yanxian Peng et al.

Copyright © 2012 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2012)DOI: 10.1002/term

Current surface modification strategies for hESC culturerange from grafting of simple/recombinant peptides orrecombinant mid- or full-length proteins to depositingcomplex matrices on culture plastic. The working principleof simple/recombinant peptide surfaces is to offer RGDmotifs for hESC attachment. However, this strategy by itselfis not sufficient to maintain pluripotency of hESCswith chemically defined culture medium (Villa-Diaz et al.,2010). Melkoumian et al. (2010) maintained H7 hESCs ona peptide acrylate surface that was later developed intoa Corning SynthemaxTM surface (Corning, USA). Thepeptides used were derived from vitronectin and bonesialoprotein, both containing RGD sequences. Since otherRGD-containing peptides derived from laminin and fibro-nectin did not work, it was assumed that neighbouringnon-RGD regions formed an additional crucial context forgenerating or recruiting signals for hESC maintenance(Melkoumian et al., 2010). These additional signals wereprobably the result of hESCs themselves or from the culturemedium (Azarin and Palecek, 2010). Hence, simple compo-nent culture substrates could significantly depend on correctmatching of culture media and cell line and thus would beless robust than complex multiple component substratessuch as ECM. In addition, simple substrates for hESCculture could select for subpopulations of hESCs, inflictinga genetic drift during propagation while complex culturesubstrates potentially present a long-term buffer systemagainst environmental variations. For example, vitronectinwas recommended as a single component for hESC culture(Ludwig et al., 2006;Melkoumian et al., 2010). In our study,vitronectin did not seem to be essential for hESC culture inthe presence of a complex ECM since it was absent inboth Matrigel (Hughes et. al., 2010) and human matrices(Supporting Table S1). A further interesting finding wasthat HFF matrices appeared to work as well as viable HFFfeeder layers. This implies that our technology could beapplied to other successful feeder cell lines. Our systemwas tested under 0.5% FBS during matrix deposition; a20-fold reduction of bovine serum concentration. However,we showed evidence that human ECM could be depositedunder crowding in the complete absence of serum and thathESCs cultured on them retained pluripotent morphologyand expressed Oct-4 (Fig. S5). MMC cut ECM depositiontime down to three days. In contrast, previous studiesreported an ECM generation time of 6-21 days with theadded disadvantage that ECMs were unable to maintain apure population of pluripotent hESCs (Klimanskaya et al.,2005; Meng et al., 2010; Abraham et al., 2010).

A current challenge in hESC research and clinical appli-cations is the apparent heterogeneity of assessment. Someresearch groups conducted 12-15 serial passages (Mallonet al., 2006; Hakala et al., 2009; Villa-Diaz et al., 2010;Melkoumian et al., 2010) to test new hESC substrates. Incontrast, Matrigel was batch-tested for only five passages(manufacturer’s datasheet). Adding to the stringency ofour study, hESCs cultured to 18 passages were used forteratoma formation to show that extensive propagation onhuman ECM did not result in loss of pluripotency. Ourparallel follow-up studies reached more than 20 passages.

Therefore, we believe that this study represents one of thelongest follow-up hESC propagation studies in feeder-freesystems and corroborates the value of complex ECMsubstrates for hESC culture.

5. Conclusions

The culture of hESCs on human bio-assembled ECM(DxSDOC or DxSDOCDOC) increased their achievablenumber of population doublings while retaining theirpluripotency, developmental potential and karyotypicand epigenetic stability. However, as SSEA-3 expressionlevels revealed, hESCs cultured on DxSDOCDOC matriceswere better maintained compared to hESCs on Matrigel orDxSDOC regardless of the enzyme used during passaging.Hence, DxSDOCDOC matrices are better suited for hESCculture. MMC using DxS to produce human ECMs provedto be crucial for long-term pluripotent hESC culture whileconcurrently reducing the amount of time and serumrequired. Additionally, these complex ECMs showedpreservation of ECM-ligand interactions, thus providingan opportunity to study the effects of the human ECMmicroenvironment on hESCs.

Acknowledgements

Work in Frank Lyko’s lab was supported by a grant from theMinisterium fur Wissenschaft, Forschung und Kunst Baden-Württemberg. The authors acknowledge support by the NUSTissue Engineering Programme (Life Science Institute NUS),Faculty Research Committee (Engineering) grant (R-397-000-081-112), a NUS-Baden-Württemberg grant (R-397-000-080-646) and the Natural Sciences and Engineering Research Councilof Canada for funding to CSH and GAL. The research work wasapproved by the NUS Institutional Review Board (08-168). Theauthors state no conflict of interest.

Supporting information on the internet

The following supporting information may be found in the online versionof this article:

Figure S1. Complete decellularization to obtain matrices. Immunofluores-cence staining for intracellular structures reveals the removal of ER, F-actinand nuclei after DOC, DOCDOC and NP40 lysis. Bar 100 µm

Figure S2. hESCs cultured on ECM made by 293T and NT2 cells differen-tiated within 12 passages. ECMs were made by crowding 293T and NT2cells using DxS for 3 days and subjecting ECM to detergent lysis DOCtreatment. Bar 500 µm

Figure S3. DxSDOC and DxSDOCDOC matrices were able to bettermaintain the pluripotent morphology of iPSCs for at least 5 passagescompared to control iPSCs cultured on Matrigel. iPSCs (DL1) were kindlyprovided by Prof Jeremy Crook (Singapore Stem Cell Bank). Bar 500 µm

Figure S4. hESCs cultured on DOC-lysed HFF matrices maintained A)pluripotent morphology and B) expression of pluripotent markers Oct-4,SSEA-4 and Tra-1-81. Bar 500 µm

Figure S5. Maintenance of Oct-4 expression and pluripotent morphologyof hESCs cultured on human ECM made without serum supplementation.Bar 200 µm

Table S1: Consolidated list of protein identifications compiled from massspectrometric analysis of DxSDOC and DxSDOCDOC matrices. Identifi-cations were made using Mascot, OMSSA and X! Tandem after analysis

Human fibroblast matrices bioassembled under macromolecular crowding support stable propagationof human embryonic stem cells

Copyright © 2012 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2012)DOI: 10.1002/term

References

Andrews PW, Damjanov I, Simon D,Banting GS, Carlin C, Dracopoli NC,Føgh J. 1984; Pluripotent embryonalcarcinoma clones derived from the humanteratocarcinoma cell line Tera-2. Differ-entiation in vivo and in vitro. Lab Invest50(2): 147–162.

Annes JP, Munger JS, Rifkin DB. 2003;Making sense of latent TGFb activation.J Cell Sci 116(2): 217–224.

Abraham S, Sheridan SD, Miller B, Rao RR.2010; Stable propagation of humanembryonic and induced pluripotent stemcells on decellularized human substrates.Biotechnol Prog 26(4):1126–1134.

Azarin SM, Palecek SP. 2010; Matrix revolu-tions: a trinity of defined substrates forlong term expansion of human ESCs. CellStem Cell 7: 7–8.

Barrand S, Collas P. 2010; Chromatin states ofcore pluripotency-associated genes in plu-ripotent, multipotent and differentiatedcells. Biochem Biophys Res Commun 391(1):762–767.

Bendall SC, Stewart MH, Mendendez P,George D, Vijayaragavan K, Webowetski-Ogilvie T, Ramos-Mejia V, Rouleau A, YangJ, Bosse M, Lajoie G, Bhatia M. 2007; IGFand FGF cooperatively establish the regula-tory stem cell niche of pluripotent humancells in vitro. Nature 448: 1015–1021.

Bongso A, Fong CY, Ng SC, Ratnam S. 1994;Isolation and culture of inner cell masscells from human blastocysts. Hum Reprod9(11): 2110–2117.

Bork S, Pfister S, Witt H. 2010; DNA methyla-tion pattern changes upon long-termculture and aging of human mesenchymalstromal cells. Aging Cell 9(1): 54–63.

Chen CZC, Raghunath M. 2009; Focus oncollagen: in vitro systems to study fibro-genesis and antifibrosis – state of the art.Fibrogenesis and Tissue Repair 2: 7.

Chen CZC, Peng Y, Wang Z, Fish PV, KaarJL, Koepsel RR, Russell AJ, Lareu RR,Raghunath M. 2009; The scar-in-a-jar:studying antifibrotic lead compounds fromthe epigenetic to extracellular level ina single well. Br J Pharmacol 158(5):1196–1209.

Chen C, Loe F, Blocki A, Peng Y, RaghunathM. 2011; Applying macromolecularcrowding to enhance extracellular matrixdeposition and its remodeling in vitrofor tissue engineering and cell-basedtherapies. Adv Drug Deliv Rev (Epubahead of print)

Deb-Rinker P, Ly D, Jezierski A, Sikorska M,Walker PR. 2005; Sequential DNA methyl-ation of the Nanog and Oct-4 upstreamregions in human NT2 cells during neuro-nal differentiation. J Biol Chem 280(8):6257–6260.

Grönniger E, Weber B, Heil O, Peters N, StäbF, Wenck H, Korn B, Winnefeld M, Lyko F.2010; Aging and chronic sun exposurecause distinct epigenetic changes in hu-man skin. PLoS Genet 6(5): e1000971.

Hakala H, Rajala K, Ojala M, Panula S, ArevaS, Kellomaki M, Suuronen R, Skottman H.2009; Comparison of biomaterials andextracellular matrices as a culture platformfor multiple, independently derived humanembryonic stem cell lines. Tissue Eng PartA 15(7): 1775–1785.

Hanssen E, Reinboth B, Gibson MA. 2003;Covalent and non-covalent interactions ofbeta ig-h3 with collagen VI. Beta ig-h3 iscovalently attached to the amino-terminalregion of collagen VI in tissue microfibrils.J Biol Chem 278(27): 24334–24341.

Hayflick L, Moorhead PS. 1961; The serialcultivation of human diploid cell strains.Exp Cell Res 25:585–620.

Hughes CS, Postovit LM, Lajoie GA. 2010;Matrigel: a complex protein mixturerequired for optimal growth of cell culture.Proteomics 10(9): 1886–1890.

Kleinman HK, McGarvey ML, Liotta LA,Robey PG, Tryggvason K, Martin GR.1981; Isolation and characterization oftype IV procollagen, laminin and heparinsulfate proteoglycan from the EHSsarcoma. Biochem 21: 6188–6193.

Klimanskaya I, Chung Y, Meisner L, JohnsonJ, West MD, Lanza R. 2005; Humanembryonic stem cells derived withoutfeeder cells. Lancet 365: 1636–1641.

Lanctot PM, Gage FH, Varki AP. 2007; Theglycans of stem cells. Curr Opin Chem Biol11: 373–380.

Lareu RR, Arsianti I, Subramhanya HK, PengY, Raghunath M. 2007a; In vitro enhance-ment of collagen matrix formation andcrosslinking for applications in tissue engi-neering: a preliminary study. Tissue Eng13(2): 385–391.

Lareu RR, Subramhanya KH, Peng Y, BennyP, Chen C, Wang Z, Rajagopalan R,Raghunath M. 2007b; Collagen matrixdeposition is dramatically enhancedin vitro when crowded with chargedmacromolecules: the biological relevanceof the excluded volume effect. FEBS Lett581: 2709–2714.

Ludwig T, Levenstein ME, Jones JM,Berggren WT, Mitchen ER, Frane JL,Crandall LJ, Daigh CA, Conard KR,Piekarczyk MS, Llanas RA, Thomson JA.2006; Derivation of human embryonicstem cells in defined conditions. NatBiotechnol 24(2): 185–187.

Mallon BS, Park KY, Chen KG, Hamilton RS,McKay RDG. 2006; Toward xeno-freeculture of human embryonic stem cells.Int J Biochem Cell Biol 38: 1063–1075.

Martin MJ, Muotri A, Gage F, Varki A. 2005;Human embryonic stem cells express amimmunogenic nonhuman sialic acid. NatMed, 11(2): 228–232.

Melkoumian Z, Weber JL, Weber DM,Fadeev AG, Zhou Y, Dolley-Sonneville P,Yang J, Qiu L, Priest CA, Shogbon C,Martin AW, Nelson J, West P, Beltzer JP,Pal S, Brandenberger R. 2010; Syntheticpeptide-acrylate surfaces for long termself-renewal and cardiomyocyte differen-tiation of human embryonic stem cells.Nat Biotechnol 28(6): 606–610.

Meng G, Liu S, Li X, Krawetz R, Rancourt DE.2010; Extracellular matrix isolated fromforeskin fibroblasts supports long-termxeno-free human embryonic stem cellculture. Stem Cells Dev 19(4): 547–556.

Nadalutti C, Viiri KM, Kaukinen K, Maki M,Lindfors K. 2011; Extracellular transgluta-minase 2 has a role in cell adhesion,whereas intracellular transglutaminase 2is involved in regulation of endothelialcell proliferation and apoptosis. Cell Prolif44(1): 49–58.

Peiffer I, Barbet R, Zhou YP, Li ML, MonierMN, Hatzfeld A, Hatzfeld JA. 2008; Useof xenofree matrices and molecularly-defined medium to control human embry-onic stem cell pluripotency: Effect of lowphysiological TGF-b concentrations. StemCells Dev 17: 519–533.

Peng Y, Raghunath M. 2010; Chapter 5:Learning from nature: emulating macromo-lecular crowding to drive extracellularmatrix enhancement for the creation ofconnective tissue in vitro’ in Tissue Engineer-ing, ed. Eberl D, IN-TECH: Croatia.

Raghunath M, Unsold C, Kubitscheck U,Bruckner-Tuderman L, Peters R, Meuli M.1998; The cutaneous microfibrillar appara-tus contains latent transforming growthfactor-b binding protein-1 and is a reposi-tory for latent TGFb1. J Invest Dermatol111(4): 559–564.

Reinboth B, Thomas J, Hanssen E, GibsonMA. 2006; Beta ig-h3 interacts directlywith biglycan and decorin, promotescollagen VI aggregation, and partici-pates in ternary complexing with thesemacromolecules. J Biol Chem 281(12):7816–7824.

Richards M, Bongso A. 2006; Propagation ofhuman embryonic stem cells on humanfeeder cells. Methods Mol Biol 331: 23–41.

Saksela O, Moscatelli D, Sommer A, RifkinDB. 1988; Endothelial cell- derived hepa-rin sulfate binds basic fibroblast growthfactor and protects it from proteolyticdegradation. J Cell Biol 107: 743–751.

Schonherr E, Hausser HJ. 2000; Extracellu-lar matrix and cytokines: a functional unit.Develop Immunol 7(2-4): 89–101.

by mass spectrometer. Scaffold was used to validate MS/MS-based peptideand protein identifications. Protein probabilities were assigned by ProteinPro-phet algorithm. Peptide and protein identifications were accepted if theycould be established at greater than 95 and 99% probabilities, respectively.Proteins that contained similar peptides and could not be differentiated basedonMS/MS analysis alone were grouped to satisfy the principles of parsimony

Table S2. Differentially methylated CpG dinucleotides in Matrigel versusDxSDOC matrices

Table S3. Differentially methylated CpG dinucleotides in Matrigel versusDxSDOCDOC matrices

Table S4. Common differentially methylated CpG dinucleotides in Matrigelversus DxSDOC and Matrigel versus DxSDOCDOC

Yanxian Peng et al.

Copyright © 2012 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2012)DOI: 10.1002/term

Thierry L, Geiser AS, Hansen A, Tesche F,Herken R, Miosge N. 2004; Collagen typesXII and XIV are present in basementmembrane zones during human embryonicdevelopment. JMol Histol35(8-9): 803–810.

Villa-Diaz LG, Nandivada H, Ding J,Nogueira-de-Souza NC, Krebsbach PH,O’Shea KS, Lahann J, Smith GD. 2010;Synthetic polymer coatings for long-term

growth of human embryonic stem cells.Nat Biotechnol 28(6): 581–583.

Xu C, Inokuma MS, Denham J, Golds K,Kundu P, Gold JD, Carpenter MK. 2001;Feeder-free growth of undifferentiatedhuman embryonic stem cells.Nat Biotechnol19: 971–974.

Xu RH, Peck RM, Dong SL, Feng X, Ludwig T,Thomson JA. 2005; Basic FGFand suppression

of BMP signaling sustain undifferentiatedproliferation of human ES cells. Nat Methods2(3): 185–190.

Wang Z, Telci D, Griffin M. 2011;Importance of syndecan-4 and syndecan-2 in osteoblast cell adhesion andsurvival mediated by transglutaminase-fibronectin complex. Exp Cell Res 317(3):367–381.

Human fibroblast matrices bioassembled under macromolecular crowding support stable propagationof human embryonic stem cells

Copyright © 2012 John Wiley & Sons, Ltd. J Tissue Eng Regen Med (2012)DOI: 10.1002/term