HS1,2 Ig Enhancer Alleles Association to AIDS Progression in a Pediatric Cohort Infected with a...

Research ArticleHS12 Ig Enhancer Alleles Association to AIDS Progressionin a Pediatric Cohort Infected with a Monophyletic HIV-Strain

Carla Montesano1 Vincenzo Giambra12 Domenico Frezza1 Paolo Palma3

Eliseo Serone4 Guido Castelli Gattinara5 Maurizio Mattei1 Giorgio Mancino6

Vittorio Colizzi1 and Massimo Amicosante78

1 Department of Biology University of Rome ldquoTor Vergatardquo 00133 Rome Italy2 Terry Fox Laboratory British Columbia Cancer Agency Vancouver BC Canada V5Z 1L33University Department of Pediatrics DPUO Unit of Immune and Infectious Diseases Childrenrsquos Hospital ldquoBambino Gesurdquo00165 Rome Italy

4 Istituto Mario Negri Sud 66030 Chieti Italy5 International Training Unit Childrenrsquos Hospital ldquoBambino Gesurdquo 00165 Rome Italy6 San Pietro Fatebenefratelli Hospital 00189 Rome Italy7 Department of Biomedicine and Prevention University of Rome ldquoTor Vergatardquo 00133 Rome Italy8 ProxAgen Ltd 1505 Sofia Bulgaria

Correspondence should be addressed to Carla Montesano montesanouniroma2it

Received 28 February 2014 Revised 28 April 2014 Accepted 28 April 2014 Published 20 May 2014

Academic Editor Esteban Martinez

Copyright copy 2014 Carla Montesano et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Alteration in the humoral immune response has been observed during HIV infection The polymorphisms of enhancer HS12member of the 31015840 regulatory region of the Ig heavy chain cluster may play a role in the variation of the humoral response leadingto pathological conditions To assess the role of the HS12 polymorphic variants in the progression of AIDS the HS12-A allelicfrequencies were investigated in a cohort of HIV infected pediatric subjects from a nosocomial outbreak with amonophyletic strainof HIV From a total group of 418 HIV infected children in the outbreak cohort 42 nonprogressors and 31 progressors without biasdue to antiretroviral therapy were evaluated HS12 allele lowast1 has been associated with nonprogressors (allelic frequency 5119versus 3387 in progressors OR 05 and 119875 = 00437) while allele lowast2 has been associated with progression (allelic frequency4839 versus 3095 in nonprogressors OR 21 and 119875 = 00393) Further only subjects carrying allele lowast2 in absence of allele lowast1either in homozygous condition for allele lowast2 [nonprogressors 242 (476) Progressors 731 (2258) OR 58 and119875 = 00315] or incombination with other allelic variants [nonprogressors 742 (1667) Progressors 1331 (4193) OR 361 and 119875 = 00321] havebeen associated with HIV progression to AIDS In conclusion while the HS12 allele lowast1 has a protective effect on HIV progressionwhen present allele lowast2 is associated with progression toward AIDS when allele lowast1 is absent

1 Introduction

In HIV infected subjects the progression to AIDS hasbeen associated with a number of host genetic factors [1]and virological variants [2] suggesting that the individualimmune-response to HIVmight be influenced at many levelsof the virus-host interaction

Theprincipal targets ofHIV are theCD4+T-lymphocyteswhose decline causes the impairment of the host immunedefences [3] However alteration in the humoral immune-response mediated by B-cells including hypergammaglobu-linemia [4 5] has been observed during HIV infection inchildren and adults [6 7] particularly in the late stages ofdisease

Hindawi Publishing CorporationBioMed Research InternationalVolume 2014 Article ID 637523 5 pageshttpdxdoiorg1011552014637523

2 BioMed Research International

Alle

les

Alle

les

lowast

1

lowast

2

lowast

3

lowast

4

EcoRI287 bp

339bp

393bp

465bp

lowast

1

lowast

2

lowast

3

lowast

4

lowast

1

lowast

2

lowast

3

lowast

4

lowast

1

lowast

2

lowast

3

lowast

4

CCCCCCGCCCCCTCCCCCAGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGACA

CACCCCCCCACCACCTCCAGATTCGGGGA

CACCCCCCCACCACCACCCCCCCACCACCTCCAGATTCGGGGA

CAGGCAGGCAGGCAGG

---------CTCCAGATTCGGGGA AGGACAAGGACAAGGACA

AGGACA

AGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGACAAGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGACA

CCCCCCCCCCCCAACCCCCCCCCCCCCAAC AGTGTGGCCAGGCTGGCCCAGGC

AGTGTGGCCAGGCTGGCCCAGGCAGTGTGGCCAGGCTGGCCCAGGC

CACCCCCCGCCCCCTCCCCC

CTCCACCTGCAGCTGCAGCCGCCACCCACCC

GGCACATGCAAATGGGGCACATGCAAATGGGGCACATGCAAATGGGGCACATGCAAATGG AGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGA

CCCCCCGCCCCCTCCCCCCCCCCCGCCCCCTCCCCCCCCCCCGCCCCCTCCCCC

CTTGCACGATT

CTTGCACGATT

CTTGCACGATTCTTGCACGATT

AGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGACAAGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGACAAGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGACA


Chrms 14q32 E 120583 120575 1205743 1205741 120595120576 1205721 120595120574 1205742 1205744 120576 1205722

Centromere

V D region J HS3 HS12 HS43998400RR-1

HS3 HS12 HS43998400RR-2

Enhancer HS12

Oct1

Oct1

Core

Sp1

Sp1

End

Sp1

NF-120581B

NF-120581B

NF-120581B

NF-120581B

NF-120581B

18mer

29mer

15mer

12mer

40mer

40mer 40mer

40mer18mer

18mer

(a)

(b)

(c)

Figure 1 Schematic map of the constant heavy chain region (a) location of the two regulatory regions within the heavy chain genes onchromosome 14q32 (b) enlargement of the 31015840RR-1 hs12 polymorphic enhancer and schematic representation of the four alleles (c) nucleotidicsequence of the hs12 enhancer with the differences of the four alleles and the consensus for the Sp1 andNF-kB transcription factor consensus

The humoral response is the result of interactions whosemodulation is partially depending on polymorphic featuresof genes leading to Ig maturation and production The 31015840Igheavy chain regulatory regions mainly control Ig heavy chainexpression [8]

The 31015840 regulatory region at the 31015840 of the Ig 120572-1 constantgene includes three enhancers among which only the centralHS12-A is polymorphic (see Figure 1) [9] This region isinvolved in B lymphocytes maturation and Ig production[10] Furthermore the different allelic variants have beenassociated with a different capability of controlling Ig levels[11]

The HS12-A alleles have a remarkable variability infrequency among world populations [12] and the allele lowast2variant of the HS12-A has been associated with susceptibilityto several immune-related diseases [13ndash16] suggesting that itmight contribute to pathological conditions

A progressive impairment of B cell response to recallantigens the increased polyclonal activation of B cells andthe expression of activation markers on their surface have

been observed in HIV patients [4ndash7] Because no specific Bcell-related factors have been associatedwithHIV protectionin this study we investigated the frequency of the Ig 31015840enhancer HS12-A alleles in the progression toward AIDSTo minimize the influence of genetic background (due toa population originating from different or large geographicareas) and viral strain variability on HIV progression wefocused the analysis on a cohort of HIV infected subjectsfrom a nosocomial outbreak with a monophyletic strain ofHIV in the Benghazi Children Hospital in Libya [17]

2 Patients and Methods

21 Study Population The cohort involved in the outbreak ofHIV infection at the ldquoEl-Fath Childrenrsquos Hospitalrdquo of Beng-hazi includes 418 children 18 mothers and 2 nurses All thechildren were infected after hospitalization or after attend-ing the hospital outpatientsrsquo The HIV infection outbreakimmunological and immunogenetics characterizations ofthe cohort have been previously described [17 20ndash22]

BioMed Research International 3

Table 1 Demographic and clinical characteristics of the study groups classified according to clinical progression [18 19]

Patients Sex ( male) Median age at the firstobservation (IQR1)

Median NadirCD4+ (IQR1)

HIV viral loadmedian (range)

Nonprogressors 42 5710 547 (180ndash1004) 261 (240ndash310) 650 (50ndash17000)Progressors 31 5806 388 (218ndash655) 151 (11ndash18) 73000 (5280ndash500000)1IQR interquartile range

Table 2 Allelic frequency of the HS12-A alleles in HIV-infected nonprogressor and progressor patients

Allele Nonprogressors (84 alleles) Progressors (62 alleles) OR P (Fisherrsquos exact test)N Frequency N Frequency

1 43 05119 21 03387 04884 004372 26 03095 30 04839 20910 003933 6 00714 4 00645 08966 14 9 01071 7 01129 10610 1In bold significant P values

indicating in the cohort the presence of a defined cluster ofHIV-1 clade AG virus (CRF02 AG)

HS12-A typing was performed upon residual bloodsample availability after informed consent [21 22] from asubgroup of 73 children According to CDC classification andthe literature [18 19] patients were divided into nonprogres-sors (119873 = 42) and progressors (119873 = 31) towardAIDS Table 1summarizes the demographic and clinical characteristic ofpatients

The cohort subgroup evaluated in this study does notdiffer substantially from the entire cohort for the mean valueof CD4 cell counts the viral load and the classificationgroups of AIDS progression Thus as far as the infection isconcerned the patients can be considered a homogeneouspool of subjects

22 DNA Extraction DNA was extracted from the serumsamples Briefly 300 microliters of serum was treated withproteinase K and phenol-chloroform by standard proce-dure The supernatant was then reextracted with chloro-formisoamilic alcohol and processed by the ldquomicrocon 100rdquomethod (Millipore Bedford MA USA)

23 PCR Analysis and Genotyping The PCR amplificationswere performed with 50 nanograms of genomic DNA asdescribed by Giambra et al [23] The two nested PCRsdiscriminate the two HS12-A and -B enhancers present inthe regulatory regions at the 31015840 of both constant 120572-1 and 120572-2 genes and the different alleles were analysed by gel agarose25 electrophoresis [23]

24 Statistical Analysis Allelic phenotypic and genotypicfrequencies data are expressed as percentages with odds ratio(OR) when appropriate Comparisons between frequenciesin the study groups have been performed by Fisherrsquos exacttest Hardy-Weinberg equilibrium has been evaluated aspreviously described [12] All the statistical analyses have

been carried out with GraphPad Prism (GraphPad SoftwareInc San Diego CA) packages

3 Results and Discussion

In HIV infection host genetic factors [1 21 22 24ndash27]mostly related to the impairment of T cell response or withthe increase of an inflammatory status have been associatedwith AIDS progression Differently no specific factors havebeen identified or associated with the progression of AIDS interms of production of antibodies although alteration in thehumoral immune response such as progressive impairmentof response to recall antigens and hypergammaglobulinemiaduring late stage of HIV infection has been observed [4ndash6]where Ig 31015840 enhancer HS12-A might play a role

The observed frequencies for the HS12 genotypes in theoverall population are in agreement with Hardy-Weinbergequilibrium (119875 gt 09) suggesting that the population ishomogeneous Further the HS12 allelic frequency distribu-tion of this Libyan population coming from the area of Beng-hazi is not different from other Mediterranean populations(data not shown [12])

Table 2 shows the allelic frequency analysis in the studygroups A statistically significant increase of allele lowast1 fre-quency has been observed in HIV nonprogressors (5119versus 3387 in progressors 119875 = 00437) while allele lowast2 hasbeen found to increase in progressors (4839 versus 3095in nonprogressors 119875 = 00393)

This observation is further supported by the genotypicanalysis (Table 3) where a statistically significant increaseof the 22 genotype in HIV progressor subjects has beenobserved [nonprogressors 242 (476) progressors 731(2258) 119875 = 00315]

Finally the frequency of subjects carrying allele lowast1resulted increased in nonprogressors (8095 versus 5806in progressors 119875 = 00398) (Table 4) whereas the frequencyof subjects carrying allele lowast2 did not differ between the twopatient groups (Table 4) either for the small population sizeevaluated or for a potential protective effect of allele lowast1 In fact


Table 3 Frequency of the HS12-A genotypes in HIV-infected nonprogressor and progressor patients

Genotypes Nonprogressors119873 = 42 Progressors119873 = 31 OR1 P (Fisherrsquos exact test)1N Frequency N Frequency

11 9 02143 3 00968 03929 0216912 17 04048 10 03226 07003 0624413 3 00714 2 00645 08966 114 5 01190 3 00968 07929 122 2 00476 7 02258 58333 0031523 2 00476 2 00645 13793 124 3 00714 4 01290 19259 0448433 0 0 0 0 NA NA34 1 00238 0 0 NA 144 0 0 0 0 NA NA1NA not applicableIn bold significant P-values

Table 4 Frequency of subjects carrying at least one copy of the HS12-A alleles in HIV-infected nonprogressor and progressor patients

Allele Nonprogressors119873 = 42 Progressors119873 = 31 OR P (Fisherrsquos exact test)N Frequency N Frequency


subjects carrying allele lowast2 in the absence of allele lowast1 resultedin significant increase in progressors (1331 4193) ratherthan nonprogressors (742 1667 OR 361 119875 = 00321) (seealso Table 3)

We have already observed in other immune pathologiesa significant increase of the frequency of the enhancer HS12allele lowast2 [13 14] supporting the hypothesis that the specificallelic conformations might trigger the different immuneresponse leading to the hypergammaglobulinemia or othercritical responses to cell-cell interaction and signalling Thishypothesis was confirmed in selective IgA deficiency whereHS12 polymorphism influences Ig serum production [15]This is consistent with both in silico analysis and EMSAexperiments demonstrating the presence of a consensusbinding site for NF-kB in allele lowast2 but not in allele lowast1 [11 2528]

Consequently the allele lowast2 capable of recruiting NF-kB might give a different efficiency to the 31015840 regulatoryregion towards Ig transcription Interestingly NF-kB throughthe consensus on promoters of Bruton tyrosine kinase (Btk)indirectly regulates also the B cellsrsquo activating factor (BAFF)and the B cellsrsquo survival in response to BCR activation [29]Likewise higher level of plasma BAFF has been associatedwith progression status and hypergammaglobulinemia inHIV infected patients [30]

Moreover the presence of NF-kB in allele lowast2 might alsobe responsible of B cell activation by cytokines such as TNF120572IL-6 IFN120572 produced in HIV viremic patients [6] In turn theB cells activated by inflammatory stimuli might themselves

induce activation of other immune cells and contribute toHIV progression

Alternatively the presence (yet to be identified) of specifichaplotypes linked to allele lowast2 might be at the basis ofthe progression to AIDS which is observed in subjectshomozygous for allele lowast2

In conclusion despite possible limitations related to thesize of our population sample this study sheds new lighton the relevance of new genetic factors involved in B cellexhaustion associated with progression of AIDS in childrenThe application of the model developed in this study to alarger population might contribute to further clarification ofthe mechanisms behind the association of genetic suscepti-bility of the HS12 with HIV-1 and to the definition of therole of this marker in the early identification of subjects withHIV infection more prone to progression to AIDS ensuringa proper followup and treatment

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

CarlaMontesano andVincenzo Giambra contributed equallyto the work described in the paper


Acknowledgments

This study has been supported in part by a project of theUniversity of Rome ldquoTor Vergatardquo (ex 60 MIUR 2006)MA and MIUR PRIN no20073RH73W003 DF The authorswould like to thank Mrs Angela Durland for editing thepaper

References

[1] M Carrington G W Nelson M P Martin et al ldquoHLA andHIV-1 heterozygote advantage and Blowast35-Cwlowast04 disadvantagerdquoScience vol 283 no 5408 pp 1748ndash1752 1999

[2] N Casartelli G Di Matteo C Argentini et al ldquoStructuraldefects and variations in the HIV-1 nef gene from rapid slowand non-progressor childrenrdquoAIDS vol 17 no 9 pp 1291ndash13012003

[3] B Rodriguez A K Sethi V K Cheruvu et al ldquoPredictive valueof plasma HIV RNA level on rate of CD4 T-cell decline inuntreated HIV infectionrdquo The Journal of the American MedicalAssociation vol 296 no 12 pp 1498ndash1506 2006

[4] A De Milito ldquoB lymphocyte dysfunctions in HIV infectionrdquoCurrent HIV Research vol 2 no 1 pp 11ndash21 2004

[5] A M Levine ldquoMonoclonal gammopathy associated with HIVinfectionrdquo Clinical Infectious Diseases vol 43 no 9 pp 1206ndash1208 2006

[6] S Moir and A S Fauci ldquoB cells in HIV infection and diseaserdquoNature Reviews Immunology vol 9 no 4 pp 235ndash245 2009

[7] S Pensieroso A Cagigi P Palma et al ldquoTiming of HAARTdefines the integrity of memory B cells and the longevityof humoral responses in HIV-1 vertically-infected childrenrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 106 no 19 pp 7939ndash7944 2009

[8] E Pinaud A A Khamlichi C Le Morvan et al ldquoLocalizationof the 31015840 IgH locus elements that effect long-distance regulationof class switch recombinationrdquo Immunity vol 15 no 2 pp 187ndash199 2001

[9] E Pinaud M Marquet R Fiancette et al ldquoThe IgH locus 31015840regulatory region pulling the strings from behindrdquoAdvances inImmunology vol 110 pp 27ndash70 2011

[10] Y Hu Q Pan E Pardali et al ldquoRegulation of germline pro-moters by the two human Ig heavy chain 31015840 alpha enhancersrdquoJournal of Immunology vol 164 no 12 pp 6380ndash6386 2000

[11] D Frezza V Giambra C Mattioli et al ldquoAllelic frequencies of31015840 Ig heavy chain locus enhancer HS12-A associated with Iglevels in patients with schizophreniardquo International Journal ofImmunopathology and Pharmacology vol 22 no 1 pp 115ndash1232009

[12] V Giambra C Martınez-Labarga M Giufrersquo et alldquoImmunoglobulin enhancer HS12 polymorphism a newpowerful anthropogenetic markerrdquo Annals of Human Geneticsvol 70 no 6 pp 946ndash950 2006

[13] D Frezza V Giambra R Cianci et al ldquoIncreased frequency ofthe immunoglobulin enhancer HS12 allele 2 in coeliac diseaserdquoScandinavian Journal of Gastroenterology vol 39 no 11 pp1083ndash1087 2004

[14] R Cianci V Giambra C Mattioli et al ldquoIncreased frequencyof Ig heavy-chain HS12-A enhancer lowast2 allele in dermatitisherpetiformis plaque psoriasis and psoriatic arthritisrdquo Journalof Investigative Dermatology vol 128 no 8 pp 1920ndash1924 2008

[15] V Giambra R Cianci S Lolli et al ldquoAllele lowast1 of HS12 enhancerassociates with selective IgA deficiency and IgM concentrationrdquoJournal of Immunology vol 183 no 12 pp 8280ndash8285 2009

[16] C Aupetit M Drouet E Pinaud et al ldquoAlleles of the alpha1immunoglobulin gene 31015840 enhancer control evolution of IgAnephropathy toward renal failurerdquoKidney International vol 58no 3 pp 966ndash971 2000

[17] T de Oliveira O G Pybus A Rambaut et al ldquoMolecular epi-demiology HIV-1 and HCV sequences from Libyan outbreakrdquoNature vol 444 no 7121 pp 836ndash837 2006

[18] Centers for Disease Control Prevention ldquoRevised classificationsystem for human immunodeficiency virus infection in chil-dren less than 13 years of agerdquo Morbidity and Mortality WeeklyReport vol 43 pp 1ndash19 1994

[19] A Petrucci M Dorrucci M Alliegro et al ldquoHow manyHIV-infected individuals may be defined as long-term non-progressors A report from the Italian Seroconversion StudyrdquoJournal of Acquired Immune Deficiency Syndromes and HumanRetrovirology vol 14 no 3 pp 243ndash248 1997

[20] S Yerly R Quadri F Negro et al ldquoNosocomial outbreakof multiple bloodborne viral infectionsrdquo Journal of InfectiousDiseases vol 184 no 3 pp 369ndash372 2001

[21] A Grifoni C Montesano P Palma A Salerno V Colizzi andMAmicosante ldquoRole ofHLA-B alfa-3 domain amino acid posi-tion 194 in HIV disease progressionrdquo Molecular Immunologyvol 53 no 4 pp 410ndash413 2013

[22] C Montesano C T Bonanno A Grifoni et al ldquoImpact ofhuman leukocyte antigen polymorphisms in human immun-odeficiency virus progression in a paediatric cohort infectedwith amono-phyletic human immunodeficiency virus-1 strainrdquoJournal of AIDS and Clinical Research vol 5 article 282 pp2155ndash6113 2014

[23] V Giambra A Fruscalzo M Giufrersquo et al ldquoEvolution of humanIgH31015840EC duplicated structures both enhancers HS12 are poly-morphicwith variation of transcription factorrsquos consensus sitesrdquoGene vol 346 pp 105ndash114 2005

[24] G Kaur and N Mehra ldquoGenetic determinants of HIV-1 infec-tion and progression to AIDS immune response genesrdquo TissueAntigens vol 74 no 5 pp 373ndash385 2009

[25] E A Trachtenberg and H A Erlich ldquoA review of therole of the human leukocyte antigen (HLA) system as ahost immunogenetic factor influencing HIV transmission andcourse of infectionwith progression toAIDSrdquo inHIVMolecularImmunology Database B T Korber C Brander B F Haynes etal Eds pp 1ndash60 2001

[26] C G Anastassopoulou and L G Kostrikis ldquoThe impactof human allelic variation on HIV-1 diseaserdquo Current HIVResearch vol 1 no 2 pp 185ndash203 2003

[27] A J McMichael and S L Rowland-Jones ldquoCellular immuneresponses to HIVrdquo Nature vol 410 no 6831 pp 980ndash987 2001

[28] D Frezza B Tolusso V Giambra et al ldquoPolymorphisms of theIgH enhancer HS1 2 and risk of systemic lupus erythematosusrdquoAnnals of the Rheumatic Diseases vol 71 pp 1309ndash1315 2012

[29] L Yu A J Mohamed O E Simonson et al ldquoProteasome-dependent autoregulation of bruton tyrosine kinase (Btk) pro-moter via NF-kBrdquo Blood vol 111 no 9 pp 4617ndash4626 2008

[30] B Rodriguez H Valdez W Freimuth T Butler R Asaad andM M Lederman ldquoPlasma levels of B-lymphocyte stimulatorincrease with HIV disease progressionrdquoAIDS vol 17 no 13 pp1983ndash1985 2003

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014


MEDIATORSINFLAMMATION

of


Behavioural Neurology

EndocrinologyInternational Journal of



Disease Markers


BioMed Research International

OncologyJournal of



Oxidative Medicine and Cellular Longevity


PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of



Computational and Mathematical Methods in Medicine

OphthalmologyJournal of


Diabetes ResearchJournal of



Research and TreatmentAIDS


Gastroenterology Research and Practice


Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom


Alle

les

Alle

les

lowast

1

lowast

2

lowast

3

lowast

4

EcoRI287 bp

339bp

393bp

465bp

lowast

1

lowast

2

lowast

3

lowast

4

lowast

1

lowast

2

lowast

3

lowast

4

lowast

1

lowast

2

lowast

3

lowast

4

CCCCCCGCCCCCTCCCCCAGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGACA

CACCCCCCCACCACCTCCAGATTCGGGGA

CACCCCCCCACCACCACCCCCCCACCACCTCCAGATTCGGGGA

CAGGCAGGCAGGCAGG

---------CTCCAGATTCGGGGA AGGACAAGGACAAGGACA

AGGACA

AGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGACAAGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGACA

CCCCCCCCCCCCAACCCCCCCCCCCCCAAC AGTGTGGCCAGGCTGGCCCAGGC

AGTGTGGCCAGGCTGGCCCAGGCAGTGTGGCCAGGCTGGCCCAGGC

CACCCCCCGCCCCCTCCCCC

CTCCACCTGCAGCTGCAGCCGCCACCCACCC

GGCACATGCAAATGGGGCACATGCAAATGGGGCACATGCAAATGGGGCACATGCAAATGG AGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGA


CTTGCACGATT

CTTGCACGATT

CTTGCACGATTCTTGCACGATT

AGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGACAAGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGACAAGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGACA


Chrms 14q32 E 120583 120575 1205743 1205741 120595120576 1205721 120595120574 1205742 1205744 120576 1205722

Centromere

V D region J HS3 HS12 HS43998400RR-1

HS3 HS12 HS43998400RR-2

Enhancer HS12

Oct1

Oct1

Core

Sp1

Sp1

End

Sp1

NF-120581B

NF-120581B

NF-120581B

NF-120581B

NF-120581B

18mer

29mer

15mer

12mer

40mer

40mer 40mer

40mer18mer

18mer

(a)

(b)

(c)

Figure 1 Schematic map of the constant heavy chain region (a) location of the two regulatory regions within the heavy chain genes onchromosome 14q32 (b) enlargement of the 31015840RR-1 hs12 polymorphic enhancer and schematic representation of the four alleles (c) nucleotidicsequence of the hs12 enhancer with the differences of the four alleles and the consensus for the Sp1 andNF-kB transcription factor consensus

The humoral response is the result of interactions whosemodulation is partially depending on polymorphic featuresof genes leading to Ig maturation and production The 31015840Igheavy chain regulatory regions mainly control Ig heavy chainexpression [8]

The 31015840 regulatory region at the 31015840 of the Ig 120572-1 constantgene includes three enhancers among which only the centralHS12-A is polymorphic (see Figure 1) [9] This region isinvolved in B lymphocytes maturation and Ig production[10] Furthermore the different allelic variants have beenassociated with a different capability of controlling Ig levels[11]

The HS12-A alleles have a remarkable variability infrequency among world populations [12] and the allele lowast2variant of the HS12-A has been associated with susceptibilityto several immune-related diseases [13ndash16] suggesting that itmight contribute to pathological conditions

A progressive impairment of B cell response to recallantigens the increased polyclonal activation of B cells andthe expression of activation markers on their surface have

been observed in HIV patients [4ndash7] Because no specific Bcell-related factors have been associatedwithHIV protectionin this study we investigated the frequency of the Ig 31015840enhancer HS12-A alleles in the progression toward AIDSTo minimize the influence of genetic background (due toa population originating from different or large geographicareas) and viral strain variability on HIV progression wefocused the analysis on a cohort of HIV infected subjectsfrom a nosocomial outbreak with a monophyletic strain ofHIV in the Benghazi Children Hospital in Libya [17]

2 Patients and Methods

21 Study Population The cohort involved in the outbreak ofHIV infection at the ldquoEl-Fath Childrenrsquos Hospitalrdquo of Beng-hazi includes 418 children 18 mothers and 2 nurses All thechildren were infected after hospitalization or after attend-ing the hospital outpatientsrsquo The HIV infection outbreakimmunological and immunogenetics characterizations ofthe cohort have been previously described [17 20ndash22]










































Acknowledgments


References




































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

























































Acknowledgments


References




































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of





















of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















HS1,2 Ig Enhancer Alleles Association to AIDS Progression in a Pediatric Cohort Infected with a...

Documents

Transcript of HS1,2 Ig Enhancer Alleles Association to AIDS Progression in a Pediatric Cohort Infected with a...