0 INSTITUT PASTEURELSEVIER Paris 1997

Res. Micrubiul. 1997, 148, 501-510

Genotyping of Luctobacillus delbrueckii subsp. bulgaricus and determination of the number and forms of rrn operons

in L. delbrueckii and its subspecies

G. Moschetti, G. Blaiotta, M. Aponte, G. Mauriello, F. Villani and S. Coppola (*)

Istituto di Microbiologia Agraria e Stazione di Microbiologia industriale, Universitri degli studi di Nap&i “Federico II”, 80055 Portici (Italy)

SUMMARY

Three different approaches (whole-cell protein profiles, DNA fingerprinting combined with pulsed-field gel electrophoresis and analysis of rDNA genes) were used to charac- terize thirty-one strains of Lactobacihs delbrueckii subsp. bulgaricus from different dairy products, and three type strains belonging to L. delbrueckii subsp. delbrueckii, 1. delbrueckii subsp. lactis and 1. delbrueckii subsp. bulgaricus. Moreover, the number and different forms of rrn operons in L. delbrueckii and its subspecies were defined. At the strain typing level, NotI macrorestriction analysis permitted grouping of the 32 strains of L. delbrueckii subsp. bulgaricus into 23 restriction patterns, providing a high degree of discriminatory power. Among whole-cell protein profiles, PCR analysis of rDNA genes and ribotyping, the latter method seemed to be the most reliable approach to characterizing the subspecies belonging to L. delbrueckii, Ribotyping combined with enzymes such as Hindlll and EcoRl showed that at least six rrn operons were present in L. delbrueckii and its subspecies; two forms of rrn operons were present in the subspe- cies /a&is and bulgaricus and four forms were present in the subspecies delbrueckii.

Key-words: Lactobacillus delbrueckii subsp. bulgaricus, rrn Operon, Lactobacillus delbrueckii, Dairy product; Ribotyping, ARDRA, Genotyping.

INTRODUCTION

Lactobacillus delbrueckii subsp. delbrueckii, bulgaricus and lactis are important microorgan- isms for industrial fermentations. The latter two subspecies are predominantly found in fermented milk products and are used as starter cultures for yogurt and cheese production (Hammes et al., 1991).

The increasing number of available commer- cial strains used as starters requires reliable: meth- ods for distinguishing between closely related strains in pure and mixed cultures in order to eliminate risks of confusion during production, diffusion and cheesemaking of selected bacteria (Ramos and Harlander, 1990).

At present, approximately 60 species belonging to the genus Lmtobacillus have been described.

Submitted February 5, 1997, accepted April 7, 1997.

(*) Corresponding author.

502 G. MOSCHETTI ET AL.

Strain typing has been applied to less than a third of these, with most studies concentrating on homofermentative species (Dykes and von Holy, 1994). However, typing studies on many other important lactobacilli, particularly those asso- ciated with dairy ecosystems, are lacking.

Genetic differentiation of strains belonging to several species of lactic acid bacteria (LAB) such as Luc?ococcus Zuctis (Tanskanen et al., 1990), Streptococcus thermophilus (Salzano et al., 1993), Enterococcus spp. (Moschetti et al., 1995), Leuconostoc mesenteroides (Villani et al., 1997) and Lactobacillus spp. (Dykes and von Holy, 1994; Johansson et al., 1995) has been suc- cessfully performed through DNA digestion by frequently or infrequently cutting enzymes, com- bined with pulsed-field gel electrophoresis (PFGE) or conventional electrophoresis.

Molecular typing based on polymorphism of rRNA genes and their intergenic spacer region, facilitated by restriction analysis of these genes after amplification by polymerase chain reaction (PCR), has shown potential as a taxonomic tech- nique, since ribosomal DNA is both ubiquitous and highly conserved (Grimont and Grimont, 1986). Studies on a variety of microorganisms, including Streptococcus thermophilus (Salzano et al., 1994) and Lactobacillus spp. (Pot et al., 1993; Rodtong and Tannock, 1993), have dem- onstrated that rRNA gene restriction pattern anal- ysis provides a means of distinguishing between strains at the species, subspecies and other taxo- nomic levels. However, analysis of total soluble whole-cell protein has also been frequently applied to taxonomic studies in LAB, including L. delbrueckii and its subspecies (Tsakalidou et al., 1992; Zourari et al., 1992; Pot et al., 1993; Tsakalidou et al., 1994; Mill&e et al., 1996). This technique is rapid, generates a stable pattern and may thus represent a viable tool for typing a large number of isolates (Dykes and von Holy, 1994).

In this paper, we report the leve.ls of genotypic relatedness among strains of L. deZbrueckii subsp. bulgaricus by combined use of a.nalysis of the soluble whole-cell protein pattern, DNA finger- printing and restriction of ribosomal DNA (ARDRA-PCR, 16S-23s spacer analysis and ribotyping) to determine the usefulness of these methods in differentiating between strains. More- over, the L. delbrueckii subsp. bulgaricus type strain DSM 20081 16S-23s spacer region was used as a probe to define the number and the dif- ferent forms of rm operons in L. delbrueckii and its subspecies.

MATERIALS AND METHODS

Bacterial strains and culture media

Thirty-one strains of L. delbrueckii subsp. bul- garicus (30 isolated from different dairy products and one belonging to the Centre National de Recherches Zootechniques, Jouy-en-Josas, France) and three type strains obtained from the Deutsche Sammlung von Mikroorganismen Collection (L. del- brueckii subsp. delbrueckii DSM 20074, L. del- brueckii subsp. lactis DSM 20072 and L. delbrueckii subsp. bulgaricus DSM 20081) were used in this study (table I). Their identification was carried out by morphological and physiological tests as described by Hammes et al. (1991).

The strains were stored at -30°C in skim milk until use. Working cultures were grown in MRS broth (Oxoid) at 37°C.

SDS-PAGE of total soluble cell proteins

Cultures were grown on MRS agar plates at 37°C for 48 h. Soluble whole-cell proteins were prepared by suspending washed cell pellets (approximately 100 mg wet weight) in 1 ml of sample treatment buffer (6.25 mM Tris-HCl, pH 6.8, 10 % glycerol, 2 % sodium dodecyl sulphate (SDS), 5 % P-mercap- toethanol) and disrupting cells with glass beads (0.10-o. 11 mm) on a vortex mixer for 6 min. After

ARDRA = amplified rDNA restriction analysis. LAB = lactic acid bacteria. PCR = polymerase chain reaction. PFGE = pulsed-field gel electrophoresis.

SDS- PAGE = sodium dodecyl sulphate/polyacrylamide gel

electrophoresis.

GENOTYPING OF L. DELBRUECKII SUBSP. BULGARICUS 503

lysis, the cell suspensions were heated for 10 min at 95”C, cooled and pelleted at 1000 g for 10 min. The supernatants (protein extract) were analysted by SDS-PAGE (SDS-polyacrylamide gel electrophore- sis) (10 % in the running gel and 4.5 % in the stack- ing gel) by the method of Laemmli (1970).

Genomic DNA preparation, restriction digestions and PFGE

Genomic DNA of high molecular weight was carried out by the method of Chevallier et al. (1994).

Inserts of intact DNA were dialysed in 10 ml TE (10 mM Tris, 1 mM EDTA, pH 8.00) containing 100 mM phenylmethylsulphonyl fluoride (PMSF) for 1 h at room temperature. After dialysis without PMSF, the samples were maintained in TE at 4°C for 30 min and then digested in 200 ~1 of appropri- ate buffer supplemented with 40 U of enzyme. HindIII, SmaI and NorI were supplied by Promega Co., Madison, WI.

Electrophoresis of the restriction digests was per- formed on the “CHEF” system (BioRad) with 1% (w/v) agarose gel and 0.5xTBE (45 mM Tris- borate, 2 mM EDTA, pH 8.3) as running buffer, at 10°C. h concatamers (Promega) and 5 cleaved with Hind111 were used as molecular size markers. Restriction fragments in about the l-150-kb range were resolved in a single run, at a constant voltage of 6 V/cm, by a single phase procedure for 20 h with a pulse ramping between 1 s and 6 s.

The discrimination ability of this method was evaluated by the use of the discrimination index of Hunter and Gaston (1988) given by the following equation :

where D is the numerical index of discrimination. N is the total number of strains, s is the total number of types described, and nj is the number of strains belonging to the jth type.

DNA amplification

ARDRA

Total DNA was prepared by the method of Mar- mur (1961). Synthetic oligonucleotide primers described by Vaneechoutte et al. (1992) (5’TGGCTCAGATTGAACGCTGGCGGC 3’ and S’CCTTTCCCTCACGGTACTGGT 3’) were used to amplify the fragment (approx. 2.4 kb) encompass- ing the 16S, the spacer region and part of the 23s rDNA.

PCR was carried out in a progr~mable heating incubator for 40 cycles (30 s at 95°C 30 s at 55”C, 1 min at 72°C per cycle) with a final extension period at 72°C for 10 min. The presence of specific PCR products was controlled by gel electrophoresis in 1.2% agarose gel containing ethidium bromide. The final amplification products, approx. 2.4 kb, were digested with Ha&I, Hi?zdIII, EcoRI, RamHI, BgtII, SacII, ApaI, X/z01 and CZaI (Promega), fol- lowing the manufacturer’s instructions. Restriction fragments were analysed by agarose (1.5 % w/v) gel electrophoresis. at 7 V/cm during 2 h.

Synthetic oligonucleotide primers described by Jensen et al. (1993) (5’CAAGGCATCCACCGT 3’ and S’GAAGTCGTAACAAGG 3’) were used to amplify the 16S-23s intergenic spacer region. DNA template preparation was performed as described above. PCR conditions consisted of 25 cycles (1 min at 94”C, 2 min at 55°C 3 min at 72°C) plus one additional cycle with a final lo-min chain elonga- tion. The presence of specific PCR products was controlled by gel electrophoresis in 1.5% agarose gel confining ethidium bromide.

Southern blotting and DNA hybridization

The short PCR fragment, about 320 bp, of the 16S-23s spacer region from L. delbrueckii subsp. bu~~aricu~ DSM 20081 was used as probe. The DNA probe was labelled by nick translation (Mani- atis et al., 1982) with {a-32P]dCTP. Transfer of Hind111 and EcoRI DNA digests to nylon mem- branes (Zeta Probe, BioRad) and DNA hybridization were performed according to Southern (1975). DNA hyb~di~tion was carried out at 65°C.

RESULTS

SDS-PAGE analysis

In order to confirm the results of the physio- logical characterization, we compared SDS- PAGE protein patterns of the 31 strains of L def- br~eckij subsp. bu~gar~c~s, isolated from different dairy products, with respect to type strains belonging to the three subspec:ies of L. delbrueckii.

All the strains showed the same protein pat- tern, with the exception of L. delbr~eck~~ subsp.

504 G. MOSCHETTI ET AL.

kDa

31.0

delbrueckii DSM 20074 and L. delbrueckii subsp. lactis DSM 20072 that differed from strains belonging to the subsp. bzdgaricus by a small variation in protein bands observed over the 94.0 kDa (fig. 1).

Low frequency restriction fragment analysis of genomic DNA

Genomic DNA of high molecular weight from 34 strains of L. delbrueckii and its subspecies were digested with the endonucleases HindIII, SmaI and Not1 and the resulting fragments were separated by PFGE.

The endonuclease Hind111 (A/AGCTT) and SmaI (CCUGGG) produced complex patterns with a large number of fragments located at low molecular weight (~30 kb and ~50 kb, respec- tively). This approach did not provide sufftcient information to distinguish all the strains tested (results not shown).

The endonuclease Not1 (GUGGCCGC) pro- duced clearly restricted enzyme patterns with about 20-30 recognizable fragments ranging in size from 5 to 150 kb. This approach, combined with the electrophoretic conditions applied, per- mitted adequate examination of the diversity and/or the similarity between the strains ana- lysed. Results obtained after digestion of genomic DNA with Not1 and separation by PFGE are depicted in figure 2 and summarized in

Fig. 1. SDS-PAGE of whole-cell proteins of the type strains of the three subspecies of L. del- brueckii (L. d.J and of L. delbrueckii (L. d.) subsp. bulgaricus strains re,presentative of

different dairy products.

Lane a: L. d. subsp. lactis DSM 20072; lane b : L. d. subsp. delbrueckii DSM 20074 ; lane c : L. d. subsp. bulgaricus DSM 20081; lane d: L. d. subsp. bufgaricus CNRZ 369; lane e: L. d. subsp. bulgaricus 4LB; lane f: L. d. subsp. bulgaricus LPI 14; lane g: L. d. subsp. bulgaricus LCM. Low range (Bio-Rad) was used as molecular weight marker.

table I. We obtained 23 restriction patterns (geno- mic groups A to W) among the 32 strains of L. delbrueckii subsp. bulgaricus. All the patterns were strain-specific with the exception of the genomic groups A (that included the strains 1LB and 2LB), C (that included the strains 4LB, 5LB, 7LB, 8LB, 9LB and 20LB) and P (that grouped the strains LCM3, LCS, LCP (and LC128). Finally, L. delbrueckii subsp. lactis DSM 20072 and L. delbrueckii subsp. delbrueckii DSM 20074 showed specific and unique patterns (genomic groups X and Y, respectively) distinct from those of all the strains belonging to the subspecies bul- garicus. The discrimination index of the PFGE typing, applied only to the strains of L. deE- brueckii subsp. bulgaricus, was 0.95.

Analysis of rDNA genes and their 16%23s spacer

PCR was used for the amplification of the DNA fragment encompassing the 16S, the 16S- 23s spacer region and part of the 23s. This frag- ment of approx. 2.4 kb was analysed by digestion with several enzymes as HueIII, HindIII, EcoRI, BarnHI, BgfII, SacII, A@, XhoI and CZaI.

Of the above-mentioned endonucleases, HueIII, ApaI and CluI produced a unique restric- tion pattern (specific to each enzyme) for all the strains analysed (fig. 3, lanes b, c and d), whereas EcoRI cut only the PCR fragment generated from

GENOTYPZNG OF L. DELBRUECKII SUBSP. BULGARICUS 505

Fig. 2. PFGE of DNA restriction pattern after digestion with Not1 from lactobacilli strains represen- ting the genomic groups (in parentheses) reported in table I.

Lanes a to p. L. d. subsp. bulgaricus: LCM (0); LP105 (M); 1LB (A); 1lLB (D); 16LB (G); 17LB (H); 19LB (I); LCC (Q); 13LB (E); 14LB (F); L39 (R); LC112 (S); LC120 (U); 3LB (B); LC128 (P); LC121 (V). Lane q: L. d. subsp. bulguricus DSM 20081 (W); lane r: L. d. subsp. del- brueckii (DSM 20074 (Y); lane s: L. d. subsp. Zactis DSM 20072 (X); lane t: L. d. subsp. bulgari- cus CNRZ 369 (Z). Lanes u to y, L. d. subsp. bulgaricus: LC118 (T); YDL (L); 18LB (K); LP114 (N); 4LB (C). DNA cleaved by Hind111 and h concatamers were used as molecular weight markers. (L. d. = L. delbrueckii).

DNA of L. delbrueckii subsp. delbrueckii DSM 20074 (fig. 3, lane e). The other enzymes assayed did not cut the PCR fragments (fig. 3, lane a).

Two oligonucleotide primers, located on highly conserved regions adjacent to the 16S23S intergenic spacer, were used to amplify the spacer region from DNA of the 34 strains of L. del- brueckii and its subspecies. For all the strains analysed, we obtained two bands migrating at approximately 320 and 520 bp on agarose gels (fig. 3, lane f). In order to confirm the presence of the two classes of spacer and to determine the

number and forms of rm operons in 1,. del- brueckii and its subspecies, two further experi- ments were carried out: (i) reamplification of the purified 520-bp PCR fragment, to exclude the presence of an artefact in PCR amplification, and (ii) hybridization of the short PCR fragment (320 bp) to total DNA (from the type strains of the three subspecies) digested with EcoRI and HindIII, which did not cut in the spacer region. The reamplification experiment produced an intense band of the same size of the template DNA without a shorter band (result not slhown).

506 G. MOSCHETTI ET AL.

Table I. Source and PFGE-Not1 patterns of strains used in this study.

Species Strain

Genomic- group

Source Not1

L. delbrueckii subsp. bulgaricus 1LB

2LB 3LB 4LB 5LB 7LB 8LB 9LB 1lLB 13LB 14LB 16LB 17LB 18LB 19LB 20LB YDL

LP105 LP114 LCM

LCM3 LCS LCC LCP L39

LC112 LC118 LC120 LC121 LC128

CNRZ 369

L. delbrueckii subsp. bulgaricusT DSM 2008 1

L. delbrueckii

Ya Ya Yb Yc Yd Ye Yf Yf Yg Yd Yh Yi Yl

Ym Yn Yo YP PM PM RM RM RM RM RM RM RM RM RM RM RN

CNRZ

DSM

subsp. lactisT

L. delbrueckii

DSM 20072 DSM

subsp. delbrueckiiT DSM 20074 DSM

A A B C C C C C D E F G H K I C L M N 0 P

B R S T U v P Z

W

X

Y

Y = commercial yogurt from different dairy industries (a to p); PM = pasteurized Sardinia sheep milk, RM = raw Sardinia sheep milk (PM and RM strains were provided by Prof. Pietrino Deiana, University of Sassary, Sardinia, Italy); CNRZ = Centre National de Recherches Zootechniques, Jouy-en-Josas (France); DSM = Deutsche Sammlung van Mikroorganismen, Braunsch- weig (Germany).

T = type strain.

4,072 3,054

2,036

1,636

1,018

396

298 220

Fig. 3. Ethidium-bromide-stained agaros,e gel (1.5%) of PCR products.

Lane a: undigested ARDRA-PCR fragment of L. d. subsp. bulgaricus DSM 20081 ; lanes b, c and d : ARDRAPCR fragment of L. d. subsp. bulgaricus DSM 2008 1 digested with HaeIII, ClaI and ApaI, respectively ; lane e: ARDRA-PCR fragment of 15. d. subsp. delbrueckii DSM 20074 digested with EcoRI; lane f: PCR fragments representing 16S23S spacer regions of ,L. d. subsp. bul- garicus DSM 20081. 1-kb DNA ladder was used as mole- cular weight marker. (15. d. = L. delbrueckii).

Hybridization of the short PCR fragment to total DNA digested with EcoRI show’ed two bands located at 2.6 and 2.8 kb for L. delbrueckii subsp. lactis DSM 20072, three bands (2.2, 2.6 and 2.8 kb) for L. delbrueckii subsp. dei’brueckii DSM 20074 and two bands (2.0 and 2.2 kb) for L. del- brueckii subsp. bulgaricus DSM 20081 (fig. 4, lanes a, b and c). These results cor~fixm the pres- ence of two classes of spacer in L. delbrueckii and its subspecies. Therefore, two forms of rRNA

GENO7YPING OF L. DELBRUECKII SUBSP. BULGARICUS 507

abcdef kb

Fig. 4. Autoradiograph of EcoRl (lanes a to c) and Hind111 (lanes d to f) digests of DNA from lactobacilli strains.

Hybridization was performed with 32p-labelled cDNA probe of 320 pb 16s.23s spacer region from L. delbruec- kii subsp. bulgaricus DSM 20081.

Lane a: L. d. subsp. lactis DSM 20072; lane b: L. d. subsp. delbrueckii DSM 20074 ; lane c : L. d. subsp. bulga- ricus DSM 20081; lane d: L. d. subsp. Zactis DSM 20072; lane e: L. d. subsp. delbrueckii DSM 20074; lane f: L. d. subsp. bulgaricus DSM 2008 1. 1 kb DNA ladder was used as molecular weight marker (L. d. = L. delbrueckii).

operons were present in the genomic DNA of L delbrueckii subsp. lactis and bulgaricus, while three forms, two of which were due to the classes of spacer, were present in that of L. defbrueckii subsp. delbrueckii.

Whole-cell protein profiles have been used in taxonomic studies for a variety of lactic acid bac- teria to identify strains at species and subspecies level (Descheemaeker et al., 1994; Mill&e: et al., 1996). This technique permitted L. delbrueckii subsp. lactis and delbrueckii to be differentiated from subsp. bulgaricus (Tsakalidou et al., 1994). By contrast, this approach, when applied to strain typing, was unable to differentiate strains within L. delbrueckii subsp. bulgaricus (Zourari et al., 1992 ; Tsakalidou et al., 1992). Our results are in agreement with the above-mentioned authors, confirming the biochemical and physiological identification of all the strains analysed.

On the basis of preliminary results obtained after digestion with HindIII, SmaI and ZV~~tI, the last restriction enzyme was selected.

Hybridization on Hind111 digests (fig. 4, lanes Of 23 genomic groups obtained with NutI,

d, e and f) produced three distinguishable restric- only three of them (A, C and P) comprised more tion patterns for the three subspecies of L. del- than one strain; in particular, genomic group A brueckii. In this instance, L. delbrueckii subsp. included two strains (1LB and 2LB) which were Zactis DSM 20072 was characterized by 6 frag- isolated from two different preparations of yogurt ments of ca 4.0, 4.2, 5.0, 5.9, 10.0 and 12.0 kb, L. produced by the same dairy industry. Therefore, delbrueckii subsp. delbrueckii DSM 20074 pro- we consider 1LB and 2LB to be the same strain duced 6 fragments located at 3.7, 3.9,4.1,4.3,5.8 used as a starter for yogurt production. Genomic and 8.5 kb and L. delbrueckii subsp. bulgaricus group C comprised six strains (4LB, 5LB, 7LB, DSM 20081 presented 6 fragments of ca 4.2,4.5, 8LB, 9LB and 20LB) isolated from yogurts pro- 5.7, 6.0, 11.5 and 12.0 kb. The presence of six duced by different industries, except for 8L,B and fragments was revealed in all strains of L. del- 9LB strains from the same manufacturer. On the

brueckii subsp. bulgaricus as well, with the exception of two strains (CNRZ 369 and YDL) that showed seven hybridization fragments (results not shown). From these data, we con- cluded that there were at least six rrlz Iloci in L. delbrueckii and its subspecies.

DISCUSSION

Three different techniques (whole-cell protein profiles, DNA fingerprinting combined with PFGE and analysis of rDNA genes) were used in order to identify and characterize industrial and natural strains belonging to L. delbrueckii subsp. bulgaricus. Moreover, the number and different forms of rrn operons in L. delbrueckii and its subspecies were defined.

508 G. MOSCHETTI ET AL.

other hand, the use of the same strain by different dairies is already well evidenced in other species such as Lactobacillus acidophilus (Roussel et al., 1993) and Leuconostoc oenos (Daniel et al., 1993). These authors found that different indus- trial strains showed the same restriction patterns after digestion with several endonucleases. Genomic group P included four strains (LCM3, LCS, LCP and LC128) isolated from raw sheep milk from different dairies in the same province (Sassari, Sardinia, Italy), suggesting four isolates of the same strain.

The discrimination index of PFGE typing was greater than 0.90 and thus it may be considered as satisfactory according to Hunter and Gaston (1988).

Another approach to comparing DNA of dif- ferent isolates of L. delbrueckii and its subspecies was based on the analysis of the polymorphism of ribosomal DNA (rDNA), since rRNA genes contain both highly conserved and hypervariable regions. We therefore used different methods to analyse the rDNA polymorphism in this species: (i) ARDRA-PCR, (ii) amplification of 16S-23s intergenic spacer region and (iii) EcoRl and Hin- dllI ribotyping, according to Rodtong and Tan- neck (1993). However, PCR methods displayed low levels of rDNA polymorphism both among the three subspecies and within the subspecies bulgaricus. Only EcoRI, used in ARDRA analy- sis, allowed differentiation of L. defbrueckii subsp. delbrueckii DSM 20074 from the other two subspecies.

PCR analysis of the 16S-23s intergenic spacer region displayed two amplification fragments of 320 and 520 pb for all the 34 strains analysed, suggesting the existence of two classes of spacer. This result was confirmed using the short PCR fragment as a probe on total DNA digested with EcoRI. On the other hand, two classes of 16S-23s intergenic spacer (a short one without tRNA, and a long one that contains tRNAALA) are reported by Hall ( 1994) for Enterococcus faecaiis.

For the enumeration of rrn operons, we used HindllI, obtaining hybridization fragments of at least 3.5 kb, as also reported by Sechi et al. (1994) for Enterococcus spp. On this basis, we can assume that at least six rrn operons are

present in L. delbrueckii and its, subspecies. Moreover, considering that the length of an rrn operon, 16S-23S-5S, is about 4.5 kb (Sechi and Daneo-Moore, 1993 ; Srivastava and Schles- singer, 1990), the Hind111 fragments at a molecu- lar weight of less than 4.5 kb may be useful to enumerate the different forms of rrn operons. Two forms are present in the subspecies Zuctis and bulgaricus (confirming the results obtained with EcoRI) and four forms are present in the subspecies delbrueckii (one more than that obtained with EcoRI). The latter result could be explained by the fact that the EcoRI fragment at 2.6 kb (fig. 4, lane b) hybridized more strongly than the others, suggesting that this may represent two rrn operons that are on fragments of similar sizes. A similar explanation was reported by Sechi et al. (1994) for Enterococcus spp.

Hind111 digests produced three distinguishable hybridization patterns for the type s,trains belong- ing to the three subspecies of L. delbrueckii, without consistent differences among the strains of L. delbrueckii subsp. bulgaricus. This result suggests that the technique can be considered as a reliable methodological approach to subspecies differentiation in L. delbrueckii.

The results presented in this work show the existence of medium to high restriction polymor- phism in L. delbrueckii subsp. bulgaricus strains. This DNA polymorphism of Not1 restriction frag- ments could be due to a point mutation, causing loss or gain of a recognition site, or more likely, as demonstrated by Hall (1994), to a DNA rear- rangement involving deletion, inversion, excision and insertion of transposable elements such as ISL3 (Germond et al., 1995). On the other hand, rDNA of this subspecies seems to be highly con- served, as demonstrated by PCR. analysis and ribotyping. The above results are: indisputable, since macrorestriction fingerprinting represents the whole chromosome with all possible rear- rangements, which cannot be revealed only at the t-m operon level.

Acknowledgements

Work performed within a research project set up and supported by Regione Campania, Assessorato Agricol-

GENOTYPING OF L. DELBRUECKII SUBSP. BULGARICUS 509

tura, arranged and coordinated by Consorzio per la Ricerca Applicata in Agricoltura (C.R.A.A., Faculty of Agriculture, Portici, Italy). The authors thank Prof. Pie- trino Deiana for providing strains, Ermenegilda Simeoli for technical collaboration and Mark Walters for revision of the manuscript.

GCnotypage de Lactobacillus delbrueckii subsp. bulgaricus et determination du nombre

et de la forme des opkrons rrn chez L.. delbrueckii et ses sous-espkes

Trois techniques diffkrentes (profil des protkines de la cellule entikre, empreinte de 1’ADN combink 5 l’klectrophorkse en champ pulsC et analyse des gknes ADNr codant pour 1’ARN ribosomal) ont CtC utilistes pour caractkiser 3 1 souches de Lactobacil- lus delbrueckii subsp. bulgaricus isolkes de divers produits laitiers, et 3 souches types appartenant & L. delbrueckii subsp. (1) delbrueckii, (2) lactis et (3) bulgaricus. En outre, le nombre et la forme des opkrons rrn ont CtC dkfinis. Pour le typage des souches, l’analyse de macrorestriction par Not1 a permis de classer les 32 souches dans 23 profils, ce qui donne un pouvoir de discrimination ClevC. Pour la caractkrisation des sous-espkces de L. del- brueckii, la mCthode utilisant le ribotypage sem- ble plus fiable que celles utilisant la PCR des g&nes ADNr et 1’Ctude des profils des protkines de la cellule entikre. Le ribotypage combink aux enzymes Hind111 et EcoRI met en Cvidence au moins 6 opkrons rrn diffkents chez L. delbrueckii et ses sous-espkces; deux sont prksents chez les sous-espkces lacti.7 et bulgaricus et quatre chez la sous-espke delbrueckii.

Mets-cl&s : OpCron rrn, Lactobacillus del- brueckii subsp. bulgaricus, Lactobacillus del- brueckii, Produit laitier; Ribotypage, ARDRA, Gknotypage.

References

Chevallier, B., Hubert, J.C. & Kammerer, B. (1994), Determination of chromosome size and number of rrn loci in Lactohacillus plantarum by pulsed-field gel electrophoresis. FEMS Microbial. Lett.. 120, 51-56.

Daniel, P., de Waele, E. & Hallet, J.-N. (1993), Optim- isation of transverse alternating field electrophore- sis for strain identification of L,euconostoc oenos. Appl. Microhiol. Biorechnol., 38, 638-641.

Descheemaeker, P., Pot, B., Ledeboer, A.M., Verrips, T. & Kersters, K. (1994). Comparison of the kzc-

tococcus luctis Differential Medium (DCL) and SDS-PAGE of whole-cell proteins for the identifi- cation of lactococci to subspecies level. Sy.st. Appl. Microhiol., 17, 459-466.

Dykes, G.A. & von Holy, A. (1994), Strain typing in the genus Lactobacillus: a review. Lett. Appl. Microhiol., 19, 63-66.

Germond, J.E., Lapierre, L., Delley, M. & Mollet, B. (1995). A new mobile genetic element in Lactoba- cillus delbrueckii subsp. bulgaricus. Mol. Gen. Genet., 248, 407-416.

Grimont, F. & Grimont, P.A.D. (1986), Ribosomal ribo- nucleic acid gene restriction patterns as rlotential taxonomic tools. Ann. Ins&. Pasfeur (MiErobiol.), 137B. 165-175.

Hall, L.M.C. (1994), Are point mutations or DNA rear- rangements responsible for the restriction fragment length polymorphisms that are used to type bacte- ria? Microbiology, 140, 197-204.

Hammes, W.P., Weiss, N. & Holzapfel, W.H. (1991), Lactobacillus and Carnobacterium, in “The Pro- karyotes”, 2nd ed. (Balows, A., Triiper, H.G., Dworkin, M., Harder, W. and Schleifer, K.-H.) (pp. 1535- 1594). Springer-Verlag, Berlin.

Hunter, P.R. & Gaston, M.A. (1988), Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J. Clin. Microbial., 26, 2465-2466.

Jensen, M.A., Webster, J.A. & Straus, N. (1993), Rapid identification of bacteria on the basis of polyme- rase chain reaction-amplified ribosomaL1 DNA spacer polymorphisms. Appl. Environ. Microbial., 59, 945-952.

Johansson, M.-L., Quednau, M., AhmC, S. & Molin, G. (1995), Classification of Lactobacillus plantarum by restriction endonuclease analysis of total chro- mosomal DNA using conventional agarose gel electrophoresis. Int. J. Syst. Bacterial., 45, 6~70-675.

Laemmli, U.K. (1970), Cleavage of structural Iproteins during the assembly of the head of bacteriophage T4. Nature (Lond.), 227, 680-685.

Maniatis, T., Fritsch, E.F. & Sambrook, J. (1982), Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory, New York.

Marmur, J. (196 l), A procedure for the isolation of deoxyribonucleic acid from microorganisms. J. Mol. Biol., 3, 208-218.

Mill&e, J.B., Abidi, F.Z. & Lefebre, G. (1996). Taxo- nomic characterization of Lactobacillus del- brueckii subsp. bulgaricus isolated from a Came- roonian zebu’s fermented raw milk. .I. Appl. Bacterial., 80, 583-588.

Moschetti, G., Salzano, G., Villani, F., Pepe, O., Andolfi, R., Mauriello, G. & Coppola, S. (1995), Characterization of dairy enterococci by restriction endonuclease and rDNA fingerprinting. Ann. Microbial. Enzimol., 45, 1- 12.

Pot, B., Hertel, C., Ludwig, W., Descheemaeker, P., Kersters, K. & Schleifer, K.-H. (1993), Identifica- tion and classification of Lucrobacillus acidophi- lus, L. gasseri and L. johnsonii strains by SDS- PAGE and rRNA-targeted oligonucleotide probe hybridization. J. Gen. Microbial., 139, 5 13-5 17.

Ramos, M.S. & Harlander, S.K. (1990), DNA finger- printing of lactococci and streptococci used in

510 G. MOSCHETTI ET AL.

dairy fermentations. Appl. Microbial. Biotechnol., 34, 368-374.

Rodtong, S. & Tannock, G.W. (1993), Differentiation of Lactobacillus strains by ribotyping. Appl. Envi- ron. Microbial., 59, 3480-3484.

Roussel, Y., Colmin, C., Simonet, J.M. & Decaris, B. (1993), Strain characterization, genome size and plasmid content in the Lactobacillus acidophilus group (Hansen and Mocquot). J. Appl. Bacterial., 74, 549-556.

Salzano, G., Moschetti, G., Villani, F. & Coppola, S. (1993) Biotyping of Streptococcus thermophilus strains by DNA fingerprinting. Res. Microbial., 144, 381-387.

Salzano, G., Moschetti, G., Villani, F., Pepe, 0.. Mau- riello, G. & Coppola, S. (1994), Genotyping of Streptococcus thermophilus evidenced by restric- tion analysis of ribosomal DNA. Res. Microbial., 145, 651-658.

Sechi, L.A. & Daneo-Moore, L. (1993), Characteriza- tion of intergenic spacers in two rrn operons of Enterococcus hirae ATCC 9790. J. Bacterial., 175, 3213-3219.

Sechi, L.A., Zuccon, F.M., Mortensen, J.E. & Daneo- Moore, L. (1994), Ribosomal RNA gene (rrn) organization in enterococci. FEMS Microbial. Lett., 120, 307-314.

Southern, E. (1975), Detection of specific sequences among DNA fragments separated by gel electro- phoresis. J. Mol. Biol., 98, 503-517.

Srivastava, K.A. & Schlessinger, D. (1990), Mechanism and regulation of bacterial ribosomal RNA pro- cessing. Annu. Rev. Microbial., 44, 105- 129.

Tanskanen, El., Tulloch, D.L., Hillier, A.J. & David-

son, B.E. (1990), Pulsed-field gel electrophoresis of SmaI digests of lactococcal genomic DNA, a novel method of strain identification. Appl. Envi- ron. Microbial., 56, 3 105-3 111.

Tsakalidou, E., Zoidou, E. & Kalantzopoulos, G. (1992) SDS-polyacrylamide gel ellectrophoresis of cell proteins from Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus strains isolated from yogurt and cheese. Milchwissenschaft, 47, 296-298.

Tsakalidou, E., Manopoulou, E., Kabaraki, E., Zoidou, E., Pot, B., Kersters, K. & Kalantzopoulos, G. (1994), The combined use of whole-cell protein extracts for the identification (SDS-PAGE) and enzyme activity screening of lact!lc acid bacteria isolated from traditional Greek dairy products. Syst. Appl. Microbial., 17, 444-458.

Vaneechoutte, M., Rossau, R., De Vos, P., Gillis, M., Janssens, D., Paepe, N., De Rouck, A., Fiers, T., Claeys, G. & Kersters, K. (1992), Rapid identifica- tion of bacteria of the Comamonadaceae with amplified ribosomal DNA-restrrction analysis (ARDRA). FEMS Microbial. Lett., 93, 227-234.

Villani, F., Moschetti, G., Blaiotta, G. & Coppola, S. (1997), Characterization of strains of Leuconostoc mesenteroides by analysis of soluble whole-cell protein pattern, DNA fingerprinting and restriction of ribosomal DNA. J. Appl. Microbial. (in press).

Zourari, A., Commissaire, J. & Desmazeaud, M.J. (1992), SDS-solubilized whole-cell protein pat- terns of Streptococcus sulivarius subsp. thermophi- lus and Lactobacillus delbrueckii subsp. bulguri- cus isolated from Greek yogurts. J. Dairy Res., 39, 105-109.