Genomic overview of the phytopathogen Pectobacteriumwasabiae strain RNS 08.42.1A suggests horizontal acquisitionof quorum-sensing genes

Slimane Khayi • Yannick Raoul des Essarts •

Angelique Quetu-Laurent • Mohieddine Moumni •

Valerie Helias • Denis Faure

Received: 4 July 2014 / Accepted: 18 September 2014

� Springer International Publishing Switzerland 2014

Abstract The blackleg and soft-rot diseases caused by

pectinolytic enterobacteria such as Pectobacterium and

Dickeya are major causes of losses affecting potato crop in

the field and upon storage. In this work, we report the

isolation, characterization and genome analysis of the

Pectobacterium wasabiae (formely identified as Pecto-

bacterium carotovorum subsp. carotovorum) strain RNS

08.42.1A, that has been isolated from a Solanum tuberosum

host plant in France. Comparative genomics with 3 other P.

wasabiae strains isolated from potato plants in different

areas in North America and Europe, highlighted both a

strong similarity at the whole genome level (ANI [ 99 %)

and a conserved synteny of the virulence genes. In addi-

tion, our analyses evidenced a robust separation between

these four P. wasabiae strains and the type strain P.

wasabiae CFBP 3304T, isolated from horseradish in Japan.

In P. wasabiae RNS 08.42.1A, the expI and expR nucleo-

tidic sequences are more related to those of some Pecto-

bacterium atrosepticum and P. carotovorum strains (90 %

of identity) than to those of the other potato P. wasabiae

strains (70 to 74 % of identity). This could suggest a

recruitment of these genes in the P. wasabiae strain RNS

08.42.1A by an horizontal transfer between pathogens

infecting the same potato host plant.

Keywords P. wasabiae � Soft-rot � Blackleg � Quorum-

sensing � T3SS � Virulence

Introduction

The pectolytic members of the Enterobacteriaceae genera

Pectobacterium and Dickeya are causative agents of dam-

aging diseases that affect a wide range of plants and crops,

including potato (Solanum tuberosum) (Gardan et al. 2003;

Samson et al. 2005). On this plant species, they can induce

soft rot on tubers, blackleg, and aerial stem rot symptoms

that can be associated to wilting and yellowing of the

leaves on potato crops (Perombelon 2002; Czajkowski

et al. 2011).

Virulence cycle of the soft rot bacteria Pectobacterium

or Dickeya alternates between an asymptomatic latent

phase and a virulence phase. The virulence phase is

characterized by the synthesis and secretion of plant cell

wall-degrading enzymes (PCWDEs) such as pectinases,

pectate-lyases, cellulases or proteases which provoke the

disorganization and maceration of the plant cell wall

(Barras et al. 1994). In Pectobacterium species, the pro-

duction of PCWDEs is controlled by quorum sensing and

Electronic supplementary material The online version of thisarticle (doi:10.1007/s10709-014-9793-2) contains supplementarymaterial, which is available to authorized users.

S. Khayi � Y. Raoul des Essarts � D. Faure (&)

Institut des Sciences du Vegetal, UPR2355, Saclay Plant

Sciences, Centre National de la Recherche Scientifique, 1,

Avenue de la Terrasse, 91 198 Gif-sur-Yvette, France

e-mail: faure@isv.cnrs-gif.fr

S. Khayi � M. Moumni

Departement de Biologie, Faculte des Sciences, Universite

Moulay Ismaıl, Meknes, Morocco

Y. Raoul des Essarts � A. Quetu-Laurent � V. Helias (&)

Federation Nationale des Producteurs de Plants de Pomme de

Terre-Recherche Developpement Promotion du Plant de Pomme

de Terre (FN3PT-RD3PT), 75008 Paris, France

e-mail: valerie.helias@fnpppt.fr

A. Quetu-Laurent � V. Helias

UMR 1349 IGEPP INRA - Agrocampus Ouest Rennes,

35653 LeRheu, France

123

Genetica

DOI 10.1007/s10709-014-9793-2

signal molecules of the N-acylhomoserine lactone

(NAHL) class (Smadja et al. 2004; Liu et al. 2008; Crepin

et al. 2012a, b, c). Quorum sensing relies upon the pro-

duction and perception of these signal molecules, the

concentration of which mimics the cell-density, to coor-

dinate gene expression (Fuqua et al. 1994; Whitehead

et al. 2002). In Dickeya, a cell–cell signal is also involved

in the control of virulence factors, but its structure

remains unknown (Nasser et al. 2013). Many studies

demonstrated the involvement of numerous virulence

determinants in soft rot bacteria, such as the cell mem-

brane structure (surface lipopolysaccharides and LPS),

flagella and pilus and secretion systems T1SS,T2SS, T4SS

and T6SS (Toth et al. 2003; Bell et al. 2004; Corbett

et al. 2005; Kim et al. 2009).

Among Pectobacterium, Pectobacterium wasabiae

(Gardan et al. 2003) initially isolated from Japanese

horseradish (wasabi) (Goto and Matsumoto 1987) was

more recently identified on potato in USA, Canada, New

Zealand, Iran, South Africa, Zimbabwe, Finland, Poland

(Ma et al. 2007; Pitman et al. 2010; Baghaee-Ravari et al.

2011; De Boer et al. 2012; Ngadze et al. 2012; Nabhan

et al. 2012; Nykyri et al. 2012; Moleleki et al. 2013; Wa-

leron et al. 2013).

Results of characterization studies conducted on Pec-

tobacterium spp. strains originating from various countries

collected up to 40 years evidenced that P. wasabiae was

not new on potato, and is also present in Peru, Ireland,

Scotland, Ireland, The Netherlands and Germany (De Boer

et al. 2012; Nabhan et al. 2012; Nykyri et al. 2012; Wa-

leron et al. 2013).

Few genomes of P. wasabiae are available in the Gene

Bank database: two of them, P. wasabiae WPP163 and P.

wasabiae SCC3193 are completed in a gapless format,

while those of the others P. wasabiae CFIA1002 (42

contigs) and the type strain P. wasabiae CFBP 3304T (73

contigs) are presented under a draft genome format. The P.

wasabiae strains WPP163, CFIA1002 and SCC3193 were

respectively isolated from potato plants in USA, Canada,

and Finland, respectively (Kim et al. 2009; Koskinen et al.

2012; Nykyri et al. 2012; Yuan et al. 2014).

In this study, we report the isolation, characterization

and genome sequence of the P. wasabiae strain RNS

08.42.1A that was recovered from soft rotted potato stem

in France. Comparative genomics that involved P.

wasabiae isolates from North America, Europe, and

Japan, highlighted the existence of distinctive traits

between strains isolated from potato host and the type

strain isolated from Japanese horseradish. Particularly, the

P. wasabiae strain RNS 08.42.1A exhibited an original

quorum-sensing system that appeared to be possibly

acquired by horizontal transfer from another Pectobacte-

rium species.

Materials and methods

Isolation of the bacterial strain and culture conditions

Pectobacterium wasabiae RNS 08.42.1A was recovered in

2008 from a potato plant (CV Bintje) expressing a backleg

symptom in a glasshouse experiment conducted on Rhi-

zoctonia solani at the INRA Institute of Le Rheu.

Diseased tissues were collected from the plant and

rapidly transferred and incubated into 10 mL of phosphate

buffer (Na2HPO4, 12H2O 0.27 %, NaH2PO4, 2H2O

0.04 %) for 2 h at room temperature under a gentle shaking

to allow bacteria to be released from the tissues. Fifty lL of

diluted bacterial suspensions were plated onto CVP med-

ium (Helias et al. 2012). Plates were incubated 48 h at

26 �C. Bacterial colonies associated to pit formations that

evidenced their pectolytic capability were selected and

transferred onto NBA (nutrient broth agar) medium to be

characterized. The P. wasabiae strain RNS 08.42.1A was

usually cultured in TY medium (tryptone 5 g/L, yeast

extract 3 g/L and agar 1.5 %) at 25 �C.

DNA extraction

DNA extractions were performed from overnight cultures

using a phenol–chloroform purification method followed

by an ethanol precipitation as described by Wilson (1987).

Verification of the quality and quantity of the DNA was

completed using a NanoDrop (ND 1000) device and aga-

rose gel electrophoresis at 1.0 %.

Molecular characterization and genome sequencing

Before genome sequencing, several PCR primers (Table 1)

were used to verify that the strain RNS 08.42.1A indeed

belonged to the P. wasabiae species. They were the ADE

primers identifying Dickeya (Nassar et al. 1996), Y1–Y2

primers identifying Pectobacterium (Darrasse et al. 1994),

Y45–46 primers for detecting Pectobacterium atrosepti-

cum (Frechon et al. 1998) and three couples of primers that

amplify P. wasabiae specific gene markers (Kim et al.

2012; De Boer et al. 2012) and the recombinase subunit A

(recA) gene (Waleron et al. 2002). The primers Y1–Y2 and

recAF-recAR were developed to detect Erwinia carotovo-

rum and the subspecies wasabiae (or Pectobacterium

carotovorum subsp. wasabiae) respectively. However,

since the revision of the classification of the Erwinia genus

by Gardan et al. (2003), Y1–Y2 primers are specific for P.

atrosepticum and P. carotovorum subsp. carotovorum and

recAF-recAR for P. wasabiae.

For genomic sequencing, a shotgun long distance mate-

pair library with an insert size of 8,000 bp was constructed

using the TruSeq (TM) SBS v3 sequencing kit. Sequencing

Genetica

123

of the library was performed using 2 9 100 bp paired-end

read modules by Eurofins Genomics (France). Assembly of

the sequences was carried out using the software CLC

Genomics Wokbench V5.1 (CLC bio, Aarhus, Denmark).

A trimming step was performed to remove the sequences

reads with low quality (limit 0.05), ambiguous nucleotides

(n B 2), and length less than 50 nucleotides. The finishing

of the assembly was carried out using GapFiller version

1.11 to close the gaps. The remaining gaps were resolved

by the mapping of mate-pairs using as a reference the 8 kbp

from each of the contig ends (read length = 0.9, iden-

tity = 0.95). Then, using homemade scripts and fastqse-

lect.tcl from MIRA3 package, the mapped reads for both

orientations (R1 and R2) were retrieved and de novo

assembled (read length = 0.5, identity = 0.8).

ORFs annotation, phylogenetic tree and genomic

comparison

The average nucleotide identity (ANI) values were calcu-

lated as previously proposed (Goris et al. 2007) using the

ANI calculator from the Kostas lab with default settings

(http://enve-omics.ce.gatech.edu/ani/). The synteny com-

parisons were performed using the MAUVE software

(Darling 2004).

The phylogenetic analysis was conducted using the

MEGA software (V6) (Tamura et al. 2013). A multi-locus

sequence analysis (MLSA) was performed using 4 house-

keeping complete genes; fusA, gyrB, recA, and dnaX, from

the P. wasabiae strains SCC9193 (CP003415), CFPB

3304T (AKVS00000000), WP166 (CP001790), and

CFIA1002 (JENG00000000). The strains P. atrosepticum

CFBP 6276 (ASAB00000000), P. atrosepticum SCRI1043

(BX950851), P. carotovorum subsp carotovorum PC1

(CP001657), P. carotovorum subsp carotovorum WPP14

(ABVY00000000), P. carotovorum subsp brasiliensis

PBR1692 (ABVX00000000) and P. carotovorum subsp

carotovorum PCC21 (CP003776), Dickeya dadantii 898T

(CM001976), and Dickeya solani IPO2222T (CM001859)

were also used. After being concatenated in the same order,

the consensus sequences were aligned with ClustalW, and

then a Neighbour-joining tree was created by Bootstrap

method with 1,000 bootstrap replications.

The draft genome sequences were annotated using the

RAST (Rapid Annotation using Subsystem Technology)

(Aziz et al. 2008). Genomic comparisons were conducted

based on RAST functional comparative tool (Aziz et al.

2008). The presence of the genomic clusters in P. wasabiae

RNS 08.42.1A was searched via a nucleotide BLAST

analysis using the sequences of the draft genome as query

against a database constituted by the specific clusters sep-

arately (e-value threshold = 10-30).

Nucleotide sequence accession number

This whole genome shotgun project has been deposited at

DDBJ/EMBL/GenBank under the accession

JMDL00000000. The version described in this paper is

version JMDL01000000.

Results and discussion

Isolation and characterization of P. wasabiae RNS

08.42.1A

The disease symptoms expressed at an early stage of the

plant, as soon as 4 leaflefts have developed. The only stem

Table 1 List of the primers used in this study

Primer Sequence (50–[30) References Taxon PCR assays on P. wasabiae

RNS 08.42.1Aa

ADE1 GATCAGAAAGCCCGCAGCCAG AT Nassar et al.

1996

Dickeya sp. –

ADE2 CTGTGGCCGATCAGGATGGTTTTGTCGTGC

Y1 TTACCGGACGCCGAGCTGTGGCGT Darrasse et al.

1994

P. atrosepticum and P.

carotovorum

1

Y2 CAGGAAGATGTCGTTATCGCGAGT

Y45 TCACCGGACGCCAACTGTGGCGT Frechon et al.

1998

P. atrosepticum –

Y46 TCGCCACGTTTCAGCAGAACAAGT

Phf GGTTCAGTGCGTCAGGAGAG De Boer et al.

2012

P. wasabiae 1

Phr GCGGAGAGGAAGCGGTGAAG

PW7011F CTATGACGCTCGCGGGTTGCTGTT Kim et al.

2012

P. wasabiae 1

PW7011R CGGCGGCGTCGTAGTGGAAAGTC

recAF CCTTCACCATACATAATTTGTATCATGCG Waleron et al.

2002

P. wasabiae 1

recAR CCTTCACCATACATAATTTGGA

a Presence (?) or absence (-) of PCR products using P. wasabiae RNS 08.42.1A total DNA as a target

Genetica

123

presented soft rot symptom appearing green at the basal

level to black at margin of the symptom, at the top level of

the plant (Fig. 1a). A black rotting of the basal leaflet could

also be observed, associated to yellowing of the entire

leaflet (Fig. 1b). PCR-based amplification and sequencing

of some gene markers (Table 1) supported this strain as

belonging to P. wasabiae species. This was a first descrip-

tion of P. wasabiae in France, hence motivating a genome

sequencing and analysis of the strain RNS 08.42.1A.

Pectobacterium wasabiae RNS 08.42.1A genome

sequence

After trimming of the sequences reads, 23 866 905 mate

pair reads were obtained with an average length of 87.8 bp.

The de novo assembly followed by scaffolding and gap

closure generated 27 contigs ([2 000 bp) with an average

coverage of 380 fold. The average length of the contigs

was 177 765 bp, with a maximal contig size of 1 340

431 bp. The N50 contig size reached 448,690 bp. The final

draft genome (5,015,350 bp) consisted in 8 scaffolds

ranging from 2 030 to 3 310 633 bp in size with a G?C

content at 50.0 %. A gene RAST annotation generated a

total number of 4,606 protein coding genes which exhibited

either an assigned (3 398 of them, i.e. 74 %) or hypothet-

ical function (1 208 of them, i.e. 26 %). Among the first

category, 95 genes coding for non-translated RNAs

including 22 ribosomal RNA (rrs) genes were identified

(Table 2). The number of the predicted missing genes

during assembly is estimated to 39 genes (0.8 % of the

total number of protein coding genes). The RNS 08.42.1A

strain exhibited significant number of phage and trans-

posable elements with 48,585 bps in cumulative size.

These acquired horizontal genes play an important role in

the evolution of the bacterial and archaeal genomes

(Gogarten et al. 2002; Lang et al. 2012). The strain RNS

08.42.1A exhibited the largest repertoire of phage elements

amongst all P. wasabiae genomes (Table 2). This feature

suggests that this strain is capable to acquire efficiently

large regions of extracellular DNA.

Positioning P. wasabiae RNS 08.42.1A

within Pectobacterium and Dickeya

A MLSA was performed, based on 4 housekeeping genes

(fusA, gyrB, dnaX, recA) from all P. wasabiae strains

available from the NCBI database. P. wasabiae strain RNS

08.42.1A clustered with all other P. wasabiae strains

(Fig. 2). This analysis also showed that the P. wasabiae

cluster can be divided into 2 phyla, hence separating all the

P. wasabiae strains isolated form potato host plants from

the strain type P. wasabiae CFBP 3304T isolated from

wasabi in Japan. A previous study has proposed that this

phylogenetic separation resulted in the emergence of two

subspecies associated with two different hosts, potato and

horseradish plants (Nykyri et al. 2012).

The existence of the P. wasabiae potato host-cluster is

also supported by the calculation of ANI value. The ANI is

proposed as an alternative to DNA–DNA hybridization in

taxonomic studies: ANI values between genomes of the

same species are above 95 % (Goris et al. 2007). Here, the

ANI values between P. wasabiae RNS 08.42.1A and the

other potato-associated P. wasabiae strains were higher

than 99 %, indicating a very close relatedness of these

strains. In contrast, the ANI value between P. wasabiae

RNS 08.42.1A and P. wasabiae CFBP 3304T reached only

94 %. This value could suggest that the P. wasabiae strains

collected from potato plants would belong to a novel P.

wasabiae subspecies or a novel species (Gardan et al. 2003;

Samson et al. 2005; Nykyri et al. 2012). This hypothesis

however requires additional taxonomic investigations.

Synteny relatedness among P. wasabiae strains

To gain a better view at the relationship of P. wasabiae

strains, we used the MAUVE program to perform a

Fig. 1 Blackleg symptoms in greenhouse plant assay. a Blackleg

symptoms extend from the bottom to the top level of the stem. The

arrow indicates the insertion point of the rotted leaflet observed in

association with stem rotting b Leaf rot symptom appeared as the

blackening of the entire petiole associated with the yellowing and

humid necrosis of the leaflet

Genetica

123

multiple genome alignment of P. wasabiae RNS 08.42.1A

genome and those of P. wasabiae WPP163 and P. wasa-

biae SCC3193 (Fig. 3). Because the genome of the P.

wasabiae RNS 08.42.1A is under a draft-genome format,

we also used a move-contig tool that selects the contig

order to maximize the synteny. The P. wasabiae RNS

08.42.1A genome differs by 9.3 and 8.7 % from P. wasa-

biae WPP163 and SCC3193 genomes, respectively. This

pairwise alignment supports the closeness between these

three P. wasabiae isolates collected from the same host

plant.

PCWDEs and virulence determinants

The genes and clusters that encode virulence factors and

host interacting functions were searched in P. wasabiae

RNS 08.42.1A using the two complete genome sequences

of the P. wasabiae strains WPPP163 and SCC3193 as

references.

Plant cell wall-degrading enzymes of pectolytic bacteria

are responsible for the disorganization and maceration of

the plant cell wall resulting in soft rot and blackleg disease

on several hosts (Hugouvieux-Cotte-Pattat et al. 1996).

Using nucleotide BLAST searches, we have identified all

known or putative pectinases, cellulases and proteases that

were previously described to be shared among the P.

wasabiae species (Nykyri et al. 2012). No less than 99 %

of identity for each gene was calculated, highlighting a

high conservation of these virulence genes amongst

members of the P. wasabiae species. Briefly there were 18

genes coding for pectinases including pectate, pectin lya-

ses, pectine methyl and acetyl esterases and polygalactu-

ronases. Aside, 16 genes coding for proteases and 3 genes

for cellulases were detected (Table 3). The PehK and

Table 2 Some characteristics of the P. wasabiae strains and their genome sequences

Strain Number

of rrs

Number

of tRNA

Phages

elements (bp)

Host plant Year Origin References

P. wasabiae RNS 08.42.1A 22 73 48,585 Potato 2010 France This work

P. wasabiae CFBP 3304T 23 60 58,488 Eutrema wasabi 1985 Japan Goto and Matsumoto (1987)

P. wasabiae CFIA1002 22 73 47,847 Potato 2007 Canada Yuan et al. (2014)

P. wasabiae SCC3193 22 77 19,899 Potato 1980 Finland Koskinen et al. (2012)

P. wasabiae WPP163 22 75 10,536 Potato 2004 USA Kim et al. (2009)

Fig. 2 MLSA-based (fusA, gyrB, recA, dnaX) relation tree and ANI values using P. wasabiae RNS 08.42.1A as a reference. The sequences were

aligned with ClustalW, and then a Neighbour-joining tree was created by Bootstrap method with 1,000 bootstrap replications

Genetica

123

HrpW potential virulence factors and a putative specific

pectate lyase present in other Pectobacterium species

(Nykyri et al. 2012) were absent in P. wasabiae RNS

08.42.1A. It remains unclear whether the lack of PehK,

HrpW and the pectate lyase present in other Pectobacte-

rium has an effect on the virulence of P. wasabiae (Kim

et al. 2009).

Other Pectobacterium virulence determinants were also

shared by all the P. wasabiae strains except the two

putative LPS (liposaccharides) encoding clusters described

in SCC3193 (LPS1:W5S_4520-4538 and

LPS2:W5S_3001-3022) which contained a set of genes not

found in RNS 08.42.1A strain. A total of 19 genes are

composing the LPS1 cluster and 22 genes the LPS2 cluster

of the strain SCC3193. The search of these clusters by

BLASTn in the RNS 08.42.1A genome revealed the con-

servation of only 8 genes for LPS1 and 6 genes for LPS2,

with high similarity (Table 4). In order to check if these

missing LPS genes were absent in P. wasabiae RNS

08.42.1A or just misassembled, we mapped trimmed mate

pair reads of P. wasabiae RNS 08.42.1A strain against each

LPS cluster of SCC3193 strain. As a result, no read mat-

ched the missing genes from LPS clusters.

Interestingly these two LPS clusters were completely

conserved in WPP163 strain and partially present in RNS

08.42.1A and CFIA1002 but they were absent in the type

strain CFBP 3304T. The LPS is a key component of the

outer membrane of the gram-negative bacteria which

comprises three components: the lipid A, an oligosaccha-

ride core and usually a polysaccharide O antigen (Reeves

and Wang 2002). Nykyri et al. (2012) suggested that the

variation of LPS composition within Pectobacterium may

indicate an adaptation of the strains to different

environments.

P. wasabiae RNS 08.42.1A displays an original expI–

expR1 system

The genes coding for the regulation of virulence in soft rot

bacteria have been largely studied and characterized (Toth

et al. 2006). The complex regulatory network of the

P. wasabiae strain described by Nykyri et al. (2012) was

used to search for such genes in RNS 08.42.1A strain. All

these genes were highly conserved, with a percentage of

identity above 99 %, except those of the quorum sensing

(QS) system expI–expR1 that display a lower similarity

(Table 5). The ExpI protein synthesizes diffusible auto

inducers of the NAHL class, while ExpR1 acts as a

repressor (Nasser et al. 1998; Jones et al. 1993). Synteny

and nucletotide identify of the genomic block containing

the determinants of the QS regulatory system (25 kbp) are

highly conserved among the P. wasabiae strains, although

QS locus expI–expR exhibits a low similarity (Fig. 4a).

This feature suggests horizontal acquisition of the expI–

expR only in the P. wasabiae strain RNS 08.42.1A.

Regarding the protein sequence, ExpI and ExpR of P.

wasabiae RNS 08.42.1A are phylogenetically closest to

those of P. atrosepticum and P. carotovorum than those of

others P. wasabiae (Fig. 4b). The discrepancy between the

MLSA-phylogeny (Fig. 2) and ExpI–ExpR1-phylogeny

(Fig. 4a) reinforces the horizontal transfer hypothesis in the

P. wasabiae strain RNS 08.42.1A. The ExpI–ExpR phy-

logeny also designates the other Pectobacterium potato

pathogens as potential donors of the expI–expR genes of P.

Fig. 3 Synteny between P. wasabiae strains RNS 08.42.1A, SCC3193 and WPP163. Pairwise alignments of the genomes were generated using

Mauve

Genetica

123

Table 3 Plant cell wall degrading enzymes in P. wasabiae RNS 08.42.1A

Enzyme features Start End Length (bp) Scaffold Identity (%) P. wasabiae WPP163

Pectate lyase

PelN 1539792 1541105 1,314 1 99.24 Pecwa_2045

PelW 1757608 1759239 1,632 1 100 Pecwa_2201

PelI 3004281 3005324 1,044 1 99.9 Pecwa_3322

PelC 496098 497222 1,125 2 99.82 Pecwa_4037

PelA 492593 493717 1,125 2 99.56 Pecwa_4035

PelB 494266 495390 1,125 2 99.47 Pecwa_4036

PelZ 497385 498662 1,278 2 99.77 Pecwa_4038

PelX 438465 440699 2,235 3 99.82 Pecwa_4562

PelY 2092080 2093786 1,707 1 99.71 Pecwa_2511

Pectin lyase

PnL 1246258 1247202 945 1 99.68 Pecwa_1777

Pectinmethylesterase

PemA 670454 671560 1,107 1 99.73 Pecwa_1228

PemB 595506 596708 1,203 3 98.59 Pecwa_4427

Pectine acetylesterase

PaeX 1751078 1752034 957 1 99.48 Pecwa_2195

Polygalacturonases

PehX 867684 869663 1,980 1 99.9 Pecwa_1410

PehN 2874409 2875791 1,383 1 99.42 Pecwa_3223

PehA 3002505 3003713 1,209 1 99.09 Pecwa_3321

Oligogalacturonide lyase

Ogl 1731650 1732816 1,167 1 99.66 Pecwa_2176

Rhamnogalacturonate lyase

RhiE 305085 306800 1,716 1 99.48 Pecwa_0910

Proteases

Prt1 709940 710983 1,044 1 99.9 Pecwa_1266

PrtW 2525812 2527236 1,425 1 99.93 Pecwa_2909

Peptidase 48 59516 60553 1,038 4 99.81 Pecwa_0429

Peptidase M50 41245 43350 2,106 1 99.1 Pecwa_0567

Putative protease 2107338 2108744 1,407 1 99.57 Pecwa_2529

Putative peptidase 2198707 2199000 294 1 98.98 Pecwa_2605

Peptidase M3A 2501694 2503562 1,869 1 99.04 Pecwa_2881

Peptidase T 2551689 2552918 1,230 1 99.19 Pecwa_2931

Peptidase S53 2635885 2637507 1,623 1 99.75 Pecwa_3008

Dienlactone hydrolase 183665 184843 1,179 2 99.66 Pecwa_3747

Putative protease 390075 393107 3,036 2 99.44 Pecwa_3929

Putative protease 1596291 1596875 585 1 100 Pecwa_2090

Putative protease 302627 304756 2,130 1 99.44 Pecwa_0909

Putative protease 403976 406753 2,778 1 96.72 Pecwa_0998

Putative protease 11298 12305 1,008 5 99.21 Pecwa_4236

Peptidase M15B 2803019 2803693 675 1 99.7 Pecwa_3163

Cellulases

CelV 2204388 2205905 1,518 1 99.6 Pecwa_2612

BcsZ 299299 300414 1,116 3 99.55 Pecwa_0071

CelS 2586453 2587247 795 1 99.25 Pecwa_2966

Genetica

123

wasabiae strain RNS 08.42.1A. Horizontal transfer of the

QS genes was reported in different species such as Pseu-

domonas aeruginosa (Gray and Garey 2001; Lerat and

Moran 2004).

The expI–expR1 genes exhibit another characteristics

which renders the QS system original in P. wasabiae strain

RNS 08.42.1A. The expI–expR1 system in P. wasabiae

RNS 08.42.1A displayed high homology (90 % of identity)

to those of P. atrosepticum SCRI1043 and P. carotovorum

subsp carotovorum PCC21, but a lower identity (70 %) to

that of P. atrosepticum CFBP 6276. Moreover, P. atro-

septicum SCRI1043 ExpI produces N-3-oxo-

hexanoylhomoserine lactone (3O,C6-HSL) as a main QS

signal (Bell et al. 2004), while P. atrosepticum CFBP 6276

ExpI produces N-3-oxo-octanoylhomoserine lactone

(3O,C8-HSL). This sequence similarity suggested that P.

wasabiae RNS 08.42.1A would produce 3O,C6-HSL as a

main QS-signal, but not 3O,C8-HSL. This hypothesis is

confirmed by a previous study reporting that 3O,C6-HSL is

indeed the main signal emitted by P. wasabiae RNS

08.42.1A (Crepin et al. 2012c). The introduction of a

plasmid that encodes a NAHL-lactonase in P. wasabiae

RNS 08.42.1A induced the quenching of the QS signal in

RNS 08.42.1A and a decrease of the virulence symptoms

Table 4 Virulence determinants in P. wasabiae RNS 08.42.1A

Virulence determinantsa Scaffold Start End Identity (%) P. wasabiae SCC3193

Flagella encoding cluster (48/51) Scaffold1 1324372 1369770 99.63 WS5_1760–WS5_1810

Flagella encoding cluster (3/51) Scaffold1 1370307 1370541 95.32

Enterobacterial common antigen (21/21) Scaffold2 666428 686800 99.36 WS5_4355–WS5_4365

Citrate transporter(1/1) Scaffold2 415571 417025 99.45 WS5_4105

Nip(1/1) Scaffold1 891610 892215 99.83 WS5_1316

Svx(1/1) Scaffold1 458640 460508 99.57 WS5_0937

budrab (3/3) Scaffold1 212836 216351 99.57 WS5_0740–WS5_0742

budc(1/1) Scaffold3 45781 46554 99.74 WS5_0317

LPS encoding cluster1(4/19) Scaffold3 648426 652897 98.17 WS5_4520–WS5_4538

LPS encoding cluster 1(2/19) Scaffold3 633689 635512 97.15

LPS encoding cluster 1(2/19) scaffold3 646215 648330 71.42

LPS encoding cluster2(3/22) Scaffold1 1438 3500 89.15 WS5_3001–WS5_3022

LPS encoding cluster2(3/22) Scaffold1 4906 5915 88.47

a Number of genes found/number of genes composing the cluster

Table 5 Virulence regulators in P. wasabiae RNS 08.42.1A

Virulence network or determinant Start End Length Scaffold Identity (%) P. wasabiae SCC3193

PmrAB 470461 472220 1,760 2 99.43 W5S_4173/4174

ExpI 593792 594371 651 3 74.01 W5S_4607

ExpR1 594442 595154 729 3 70.80 W5S_4606

ExpR2 1310935 1311672 738 1 99.86 W5S_1749

KdgR 1733032 1733823 792 1 100 W5S_2118

ExpAS 1154611 1155267 657 1 100 W5S_1457

Hor 2268354 2268791 438 1 100 W5S_2637

RsmA 534243 534428 186 1 100 W5S_1009

ExpAS-2 3266669 3269455 2,787 1 99.86 W5S_3687

LuxS 538608 539123 516 1 99.81 W5S_1019

ExpM 1831462 1832478 1,017 1 99.8 W5S_2224

PehRS-2 1655658 1657118 1,461 1 99.66 W5S_2095

Rcs 2852864 2859034 6,171 1 99.58 W5S_3208/3206

PehRS 1657115 1657804 690 1 99.42 W5S_2096

Genetica

123

on potato tubers (Crepin et al. 2012a). Hence, the 3O,C6-

HSL-mediated QS system is involved in the control of the

virulence functions in P. wasabiae RNS 08.42.1A.

Secretions systems

The protein secretion systems play an important role in the

pathogenicity of the soft rot bacteria. They facilitate

delivery of the virulence determinants across the bacterial

cell wall, outside the cell, to attack host plant and com-

peting bacteria (Charkowski 2006). P. wasabiae species

possesses four of the known gram-negative protein secre-

tion systems and the corresponding genes were highly

conserved in P. wasabiae RNS 08.42.1A. The extracellular

proteases are secreted through a T1SS, while the T2SS

exports the cellulases and pectinases. The role of the T4SS

remains unknown, but in P. atrosepticum it weakly con-

tributes to virulence (Bell et al. 2004). P. wasabiae strains

harbor two T6SS that were highly conserved in P. wasa-

biae RNS 08.42.1A (Nykyri et al. 2012). T6SS would

conduct the delivery of the predicted proteins Hcp

(heamolysin co-regulated proteins) and VgrG (valine-

glycine repeat protein G) which are major virulence

determinants in P. atrosepticum (Liu et al. 2008). We

observed that T3SS was absent in P. wasabiae RNS

08.42.1A, this was also reported for the other P. wasabiae

strains (Kim et al. 2009; Nykyri et al. 2012).

Toxin antitoxin HigA/HigB complex shared

only by RNS 08.42.1A

The Toxin–Antitoxin (TA) system modules are commonly

found on plasmids, as they contribute to their maintenance.

They are also encoded on chromosomes (Gerdes et al.

2005; Magnuson 2007). They play a crucial role in bac-

terial survival during environmental stresses, as they are

implicated in diverse functions such as programmed cell

death, cell division, biofilm formation (Schureck et al.

2014). Using a function based comparison tool from the

RAST server, some TA loci were identified only in P.

wasabiae RNS 08.42.1A and other TA loci are shared just

by the potato isolates (Supplementary data S1). One of

these, the vapBC (virulence associated protein) operon is

shared by P. wasabiae RNS 08.42.1A and the type strains

Fig. 4 The QS regulatory system ExpI–ExpR1 of P. wasabiae RNS 08.23.1A. a Nucleotidic similarity indicating a low identity of expI–expR of

RNS 08.42.1A strain compared to other P. wasabiae strains b ExpI–ExpR1 protein sequences based phylogenetic tree

Genetica

123

CFBP 3304T. It was previously identified on several plas-

mids of pathogenic bacteria where it contributes to their

stability (Gerdes et al. 2005). The cellular targets of the

VapC toxin remain unidentified (Gerdes et al. 2005).

The loci higBA (host inhibition of growth) was present

only in RNS 08.42.1A strain: It is a type II TA system

comprising small adjacent genes that code for a toxin and

an antitoxin proteins. These toxin and antitoxin proteins are

considered unusual compared to other TA systems, because

the toxin encoding gene is located upstream the antitoxin

encoding gene (Gerdes et al. 2005). It is known that the

antitoxins are more labile than the toxins and are readily

degraded under stress conditions, a feature that allows the

toxins to exert their toxic effect. Previous studies reported

that the endoribonuclease HigB protein recognizes AAA

sequences on mRNA. The activity of HigB toxin is

dependent on the association with ribosomes, facilitating

the recognition then the cleavage of specific AAA

sequence (Hurley and Woychik 2009; Bukowski et al.

2011). Exogenous expression of the toxin HigB in Vibrio

cholerae and Escherichia coli led to a drastic growth

limitation and a reduced number of CFU (Budde et al.

2007). Several studies stated the involvement of TA sys-

tems not only in normal bacterial physiology but also in

pathogenicity (Yamaguchi et al. 2011; De la Cruz et al.

2013; Wen et al. 2014). At present, however, there is no

evidence that would suggest the implication of TA systems

in the virulence of soft rot bacteria.

Finally, many genes were found to be specific to P.

wasabiae potato isolates, including genes that encode

maltose, maltodextrin and histidine degradation, or genes

that encode the utilization of galactosamine and that of its

N-acetyl derivative. Also aeorobactin and assembly kit

siderophores were identified only in potato isolate of P.

wasabiae including RNS 08.42.1A strain. They contribute

to iron uptake from the environment, in order to overcome

the starvation phases and enhance bacterial growth. In

relation, it was also shown that siderophores contribute to

the virulence in Dickeya (Boughammoura et al. 2007).

However the role of these features in the ecology and the

virulence of the soft rot bacteria remains unknown. Com-

bined with the whole set of specificity exposed above, these

data support the view that P. wasabiae potato isolates

might delineate a novel species or a novel subspecies.

Conclusions

Several works indicate that P. wasabiae may have been

present on potato fields and misidentified as P. carotovo-

rum in the past, when the biochemical and phenotypic

characteristics where not discriminating enough to allow

the classification of P. wasabiae as a defined species of the

Pectobacterium genus (Nabhan et al. 2012; Nykyri et al.

2012; Waleron et al. 2013). With the data generated by

DNA-based methods, P. wasabiae is now clearly separated

from other clade of soft rot bacteria. The main feature that

separates these bacteria from other Pectobacterium mem-

bers is the lack of a T3SS which is a secondary factor

contributing to pathogenesis in pectolytic bacteria (Toth

et al. 2006). Our study aimed at describing the french P.

wasabiae isolate through whole genome investigation. Our

functional comparative analyses revealed specific traits that

are shared only by potato-associated isolates, a feature that

supports the adaptation to the environment within the host.

Amongst these genes are those encoding maltose, malto-

dextrin, histidine and galactosamine utilization.

Pectobacterium wasabiae RNS 08.42.1A has an original

expI–expR1 complex which showed a low similarity with

those identified in other P. wasabiae strains. It is tempting

to speculate that RNS 08.42.1A has acquired the expI–

expR1 complex from another Pectobacterium by an hori-

zontal gene transfer event.

Acknowledgments This work was supported by a cooperative

project between France and Morocco (PRAD 14-02, Campus France

No. 30229 ZK), the excellence Grant (No. H011/007) awarded by the

Ministry of Higher education of Morocco, and a collaborative project

between Centre National de la Recherche Scientifique (CNRS, Gif sur

Yvette) and Federation Nationale des Producteurs de Plants de

Pomme de Terre-Recherche Developpement Promotion du Plants de

Pomme de Terre (FN3PT-RD3PT, Paris).

References

Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA,

Formsma K, Gerdes S, Glass EM, Kubal M et al (2008) The

RAST server: rapid annotations using subsystems technology.

BMC Genomics 9:75. doi:10.1186/1471-2164-9-75

Baghaee-Ravari S, Rahimian H, Shams-Bakhsh M, Lopez-Solanilla

E, Antunez-Lamas M, Rodrıguez-Palenzuela P (2011) Charac-

terization of Pectobacterium species from Iran using biochem-

ical and molecular methods. Eur J Plant Pathol 129:413–425.

doi:10.1007/s10658-010-9704-z

Barras F, van Gijsegem F, Chatterjee AK (1994) Extracellular

enzymes and pathogenesis of soft-rot Erwinia. Annu Rev

Phytopathol 32:201–234. doi:10.1146/annurev.py.32.090194.

001221

Bell KS, Sebaihia M, Pritchard L, Holden MTG, Hyman LJ, Holeva

MC, Thomson NR, Bentley SD, Churcher LJC, Mungall K et al

(2004) Genome sequence of the enterobacterial phytopathogen

Erwinia carotovora subsp. atroseptica and characterization of

virulence factors. Proc Natl Acad Sci 101:11105–11110. doi:10.

1073/pnas.0402424101

Boughammoura A, Franza T, Dellagi A, Roux C, Matzanke-

Markstein B, Expert D (2007) Ferritins, bacterial virulence and

plant defence. Biometals 20:347–353. doi:10.1007/s10534-006-

9069-0

Budde PP, Davis BM, Yuan J, Waldor MK (2007) Characterization of

a higBA toxin–antitoxin locus in Vibrio cholerae. J Bacteriol

189:491–500. doi:10.1128/JB.00909-06

Genetica

123

Bukowski M, Rojowska A, Wladyka B (2011) Prokaryotic toxin–

antitoxin systems—the role in bacterial physiology and applica-

tion in molecular biology. Acta Biochim Pol 58:1–9

Charkowski AO (2006) The soft rot Erwinia. In: Gnanamanickam S

(ed) Plant-associated bacteria. Springer, Netherlands,

pp 423–505

Corbett M, Virtue S, Bell K, Birch P, Burr T, Hyman L, Lilley K,

Poock S, Toth I, Salmond G (2005) Identification of a new

quorum-sensing-controlled virulence factor in Erwinia caroto-

vora subsp. atroseptica secreted via the type II targeting

pathway. Mol Plant Microbe Interact 18:334–342

Crepin A, Barbey C, Beury-Cirou A, Helias V, Taupin L, Reverchon

S, Nasser W, Faure D, Dufour A, Orange N et al (2012a)

Quorum sensing signaling molecules produced by reference and

emerging soft-rot bacteria (Dickeya and Pectobacterium spp.).

PLoS ONE 7:e35176. doi:10.1371/journal.pone.0035176

Crepin A, Barbey C, Cirou A, Tannieres M, Orange N, Feuilloley M,

Dessaux Y, Burini J-F, Faure D, Latour X (2012b) Biological

control of pathogen communication in the rhizosphere: a novel

approach applied to potato soft rot due to Pectobacterium

atrosepticum. Plant Soil 358:27–37. doi:10.1007/s11104-011-

1030-5

Crepin A, Beury-Cirou A, Barbey C, Farmer C, Helias V, Burini J-F,

Faure D, Latour X (2012c) N-Acyl homoserine lactones in

diverse Pectobacterium and Dickeya plant pathogens: diversity,

abundance, and involvement in virulence. Sensors

12:3484–3497. doi:10.3390/s120303484

Czajkowski R, Perombelon MCM, van Veen JA, van der Wolf JM

(2011) Control of blackleg and tuber soft rot of potato caused by

Pectobacterium and Dickeya species: a review: control of

Dickeya and Pectobacterium species in potato. Plant Pathol

60:999–1013. doi:10.1111/j.1365-3059.2011.02470.x

Darling ACE (2004) Mauve: multiple alignment of conserved

genomic sequence with rearrangements. Genome Res

14:1394–1403. doi:10.1101/gr.2289704

Darrasse A, Priou S, Kotoujansky A, Bertheau Y (1994) PCR and

restriction fragment length polymorphism of a pel gene as a tool

to identify Erwinia carotovora in relation to potato diseases.

Appl Environ Microbiol 60:1437–1443

De Boer SH, Li X, Ward LJ (2012) Pectobacterium spp. associated

with bacterial stem rot syndrome of potato in Canada. Phyto-

pathology 102:937–947

De la Cruz MA, Zhao W, Farenc C, Gimenez G, Raoult D, Cambillau

C, Gorvel J-P, Meresse S (2013) A toxin–antitoxin module of

Salmonella promotes virulence in mice. PLoS Pathog

9:e1003827. doi:10.1371/journal.ppat.1003827

Frechon D, Exbrayat P, Helias V, Hyman LJ, Jouan B, Llop P, Lopez

MM, Payet N, Perombelon MCM, Toth IK (1998) Evaluation of

a PCR kit for the detection of Erwinia carotovora subsp.

atroseptica on potato tubers. Potato Res 41:163–173

Fuqua WC, Winans SC, Greenberg EP (1994) Quorum sensing in

bacteria: the LuxR–LuxI family of cell density-responsive

transcriptional regulators. J Bacteriol 176:269–275

Gardan L, Gouy C, Richard C, Samson R (2003) Elevation of three

subspecies of Pectobacterium carotovorum to species level:

Pectobacterium atrosepticum sp. nov., Pectobacterium betavas-

culorum sp. nov. and Pectobacterium wasabiae sp. nov. Int J

Syst Evol Microbiol 53:381–391. doi:10.1099/ijs.0.02423-0

Gerdes K, Christensen SK, Løbner-Olesen A (2005) Prokaryotic

toxin–antitoxin stress response loci. Nat Rev Microbiol

3:371–382. doi:10.1038/nrmicro1147

Gogarten JP, Doolittle WF, Lawrence JG (2002) Prokaryotic evolu-

tion in light of gene transfer. Mol Biol Evol 19:2226–2238

Goris J, Konstantinidis KT, Klappenbach JA, Coenye T, Vandamme

P, Tiedje JM (2007) DNA–DNA hybridization values and their

relationship to whole-genome sequence similarities. Int J Syst

Evol Microbiol 57:81–91. doi:10.1099/ijs.0.64483-0

Goto M, Matsumoto K (1987) Erwinia carotovora subsp. wasabiae

subsp. nov. Isolated from Diseased Rhizomes and Fibrous Roots

of Japanese Horseradish (Eutrema wasabi Maxim.). Int J Syst

Evol Microbiol 37(2):130–135. doi:10.1099/00207713-37-2-130

Gray KM, Garey JR (2001) The evolution of bacterial LuxI and LuxR

quorum sensing regulators. Microbiology 147:2379–2387

Helias V, Hamon P, Huchet E, Wolf JVD, Andrivon D (2012) Two

new effective semiselective crystal violet pectate media for

isolation of Pectobacterium and Dickeya: isolating pectolytic

bacteria on CVP. Plant Pathol 61:339–345. doi:10.1111/j.1365-

3059.2011.02508.x

Hugouvieux-Cotte-Pattat N, Condemine G, Nasser W, Reverchon S

(1996) Regulation of pectinolysis in Erwinia chrysanthemi.

Annu Rev Microbiol 50:213–257

Hurley JM, Woychik NA (2009) Bacterial toxin HigB associates with

ribosomes and mediates translation-dependent mRNA cleavage

at A-rich sites. J Biol Chem 284:18605–18613. doi:10.1074/jbc.

M109.008763

Jones S, Yu B, Bainton NA, Birdsall M, Bycroft BW, Chhabra SR,

Cox AJ, Golby P, Reeves PJ, Stephens S et al (1993) The Lux

autoinducer regulates the production of exoenzyme virulence

determinants in Erwinia carotovora and Pseudomonas aerugin-

osa. EMBO J 12:2477

Kim H-S, Ma B, Perna NT, Charkowski AO (2009) Phylogeny and

virulence of naturally occurring type III secretion system-

deficient Pectobacterium strains. Appl Environ Microbiol

75:4539–4549. doi:10.1128/AEM.01336-08

Kim MH, Cho MS, Kim BK, Choi HJ, Hahn JH, Kim C, Kang MJ,

Kim SH, Park DS (2012) Quantitative real-time polymerase

chain reaction assay for detection of Pectobacterium wasabiae

using YD repeat protein gene-based primers. Plant Dis

96:253–257

Koskinen JP, Laine P, Niemi O, Nykyri J, Harjunpaa H, Auvinen P,

Paulin L, Pirhonen M, Palva T, Holm L (2012) Genome

sequence of Pectobacterium sp. strain SCC3193. J Bacteriol

194:6004. doi:10.1128/JB.00681-12

Lang AS, Zhaxybayeva O, Beatty JT (2012) Gene transfer agents:

phage-like elements of genetic exchange. Nat Rev Microbiol.

doi:10.1038/nrmicro2802

Lerat E, Moran NA (2004) The evolutionary history of quorum-

sensing systems in bacteria. Mol Biol Evol 21:903–913. doi:10.

1093/molbev/msh097

Liu H, Coulthurst SJ, Pritchard L, Hedley PE, Ravensdale M,

Humphris S, Burr T, Takle G, Brurberg M-B, Birch PRJ et al

(2008) Quorum sensing coordinates rrute force and stealth

modes of infection in the plant pathogen Pectobacterium

atrosepticum. PLoS Pathog 4:e1000093. doi:10.1371/journal.

ppat.1000093

Ma B, Hibbing ME, Kim H-S, Reedy RM, Yedidia I, Breuer J, Breuer

J, Glasner JD, Perna NT, Kelman A et al (2007) Host range and

molecular phylogenies of the soft rot enterobacterial genera

Pectobacterium and Dickeya. Phytopathology 97:1150–1163.

doi:10.1094/PHYTO-97-9-1150

Magnuson RD (2007) Hypothetical functions of toxin-antitoxin

systems. J Bacteriol 189:6089–6092. doi:10.1128/JB.00958-07

Moleleki LN, Onkendi EM, Mongae A, Kubheka GC (2013)

Characterisation of pectobacterium wasabiae causing blackleg

and soft rot diseases in South Africa. Eur J Plant Pathol

135:279–288. doi:10.1007/s10658-012-0084-4

Nabhan S, Wydra K, Linde M, Debener T (2012) The use of two

complementary DNA assays, AFLP and MLSA, for epidemic

and phylogenetic studies of pectolytic enterobacterial strains

with focus on the heterogeneous species Pectobacterium

Genetica

123

carotovorum: phylogenetic focus on soft-rot plant pathogens.

Plant Pathol 61:498–508. doi:10.1111/j.1365-3059.2011.02546.x

Nassar A, Darrasse A, Lemattre M, Kotoujansky A, Dervin C, Vedel

R, Bertheau Y (1996) Characterization of Erwinia chrysanthemi

by pectinolytic isozyme polymorphism and restriction fragment

length polymorphism analysis of PCR-amplified fragments of

pel genes. Appl Environ Microbiol 62:2228–2235

Nasser W, Bouillant ML, Salmond G, Reverchon S (1998) Charac-

terization of the Erwinia chrysanthemi expI–expR locus directing

the synthesis of two N-acyl-homoserine lactone signal mole-

cules. Mol Microbiol 29:1391–1405. doi:10.1046/j.1365-2958.

1998.01022.x

Nasser W, Dorel C, Wawrzyniak J, Van Gijsegem F, Groleau M-C,

Deziel E, Reverchon S (2013) Vfm a new quorum sensing

system controls the virulence of Dickeya dadantii: new quorum

sensing signal in Dickeya. Environ Microbiol 15:865–880.

doi:10.1111/1462-2920.12049

Ngadze E, Brady CL, Coutinho TA, van der Waals JE (2012)

Pectinolytic bacteria associated with potato soft rot and blackleg

in South Africa and Zimbabwe. Eur J Plant Pathol 134:533–549.

doi:10.1007/s10658-012-0036-z

Nykyri J, Niemi O, Koskinen P, Nokso-Koivisto J, Pasanen M,

Broberg M, Plyusnin I, Toronen P, Holm L, Pirhonen M et al

(2012) Revised phylogeny and novel horizontally acquired

virulence determinants of the model soft rot phytopathogen

Pectobacterium wasabiae SCC3193. PLoS Pathog 8:e1003013.

doi:10.1371/journal.ppat.1003013

Perombelon MCM (2002) Potato diseases caused by soft rot erwinias:

an overview of pathogenesis. Plant Pathol 51:1–12

Pitman AR, Harrow SA, Visnovsky SB (2010) Genetic characterisa-

tion of Pectobacterium wasabiae causing soft rot disease of

potato in New Zealand. Eur J Plant Pathol 126:423–435. doi:10.

1007/s10658-009-9551-y

Reeves PP, Wang L (2002) Genomic organization of LPS-specific

loci. In: Hacker J, Kaper JB (eds) Pathogenicity islands and the

evolution of pathogenic microbes. Springer, Berlin, Heidelberg,

pp 109–135

Samson R, Legendre JB, Richard C, Fischer-Le Saux M, Achouak W,

Gardan L et al (2005) Transfer of Pectobacterium chrysanthemi

(Burkholder, 1953) Brenner et al. 1973 and Brenneria paradisi-

aca to the genus Dickeya gen. nov. as Dickeya chrysanthemi

comb. nov. and Dickeya paradisiaca comb. nov. and delineation

of four novel species, Dickeya dadantii sp. nov., Dickeya

dianthicola sp. nov., Dickeya dieffenbachiae sp. nov. and

Dickeya zeae sp. nov. Int J Syst Evol Microbiol

55:1415–1427. doi:10.1099/ijs.0.02791-0

Schureck MA, Maehigashi T, Miles SJ, Marquez J, Cho SE, Erdman

R, Dunham CM (2014) Structure of the Proteus vulgaris HigB-

(HigA)2-HigB toxin-antitoxin complex. J Biol Chem

289:1060–1070. doi:10.1074/jbc.M113.512095

Smadja B, Latour X, Trigui S, Burini JF, Chevalier S, Orange N

(2004) Thermodependence of growth and enzymatic activities

implicated in pathogenicity of two Erwinia carotovora subspe-

cies (Pectobacterium spp.). Can J Microbiol 50:19–27. doi:10.

1139/w03-099

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013)

MEGA6: molecular evolutionary genetics analysis version 6.0.

Mol Biol Evol 30:2725–2729. doi:10.1093/molbev/mst197

Toth IK, Bell KS, Holeva MC, Birch PR (2003) Soft rot erwiniae:

from genes to genomes. Mol Plant Pathol 4:17–30

Toth IK, Pritchard L, Birch PR (2006) Comparative genomics reveals

what makes an enterobacterial plant pathogen. Annu Rev

Phytopathol 44:305–336

Waleron M, Waleron K, Podhajska AJ, Lojkowska E (2002) Genotyping

of bacteria belonging to the former Erwinia genus by PCR-RFLP

analysis of a recA gene fragment. Microbiology 148:583–595

Waleron M, Waleron K, Lojkowska E (2013) Occurrence ofPectobacterium wasabiae in potato field samples. Eur J Plant

Pathol 137:149–158. doi:10.1007/s10658-013-0227-2

Wen Y, Behiels E, Devreese B (2014) Toxin-Antitoxin systems: their

role in persistence, biofilm formation, and pathogenicity. Pathog

Dis 70:240–249. doi:10.1111/2049-632X.12145

Whitehead NA, Byers JT, Commander P, Corbett MJ, Coulthurst SJ,

Everson L, Harris AKP, Pemberton CL, Simpson NJL, Slater H

et al (2002) The regulation of virulence in phytopathogenic

Erwinia species: quorum sensing, antibiotics and ecological

considerations. Antonie Van Leeuwenhoek 81:223–231

Wilson K (1987) Preparation of genomic DNA from bacteria. In:

Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG,

Smith JA, Struhl K (eds) Protocols in molecular biology. Greene

Publishing and Wiley- Interscience, New York, pp 2.4.1–2.4.5

Yamaguchi Y, Park J-H, Inouye M (2011) Toxin–antitoxin systems in

bacteria and archaea. Annu Rev Genet 45:61–79. doi:10.1146/

annurev-genet-110410-132412

Yuan K, Adam Z, Tambong J, Levesque CA, Chen W, Lewis CT, De

Boer SH, Li X (2014) Draft Genome sequence of Pectobacte-

rium wasabiae strain CFIA1002. Genome Announc

2:e00214–14. doi:10.1128/genomeA.00214-14

Genetica

123