generation and analysis of expressed sequence tag's (est's)

GENERATION AND ANALYSIS OF EXPRESSED SEQUENCE TAG’S (EST’S) FROM TWO DIFFERENT VARIETIES OF BRINJAL (Solanum melongena L.)

DURING FRUIT DEVELOPMENTAL STAGES AND EVALUATION OF THEIR UTILITY IN GENETIC AND MOLECULAR STUDIES

Thesis submitted to

Bharathidasan University for the award of the degree of

Doctor of Philosophy in

Plant Biotechnology

Submitted by Mr. MOGILICHERLA KANAKACHARI M.Sc.,

(Ref.No. 25794/Ph.D.1/Plant Biotechnology/Part Time/January 2011; Date: 29.12.2010)

Under the Guidance of

Prof. N. JAYABALAN UGC-BSR Faculty Fellow

Department of Plant Science

School of Life Sciences Bharathidasan University Tiruchirappalli, Tamil Nadu

&

Under the Co-guidance of Dr. P. ANANDA KUMAR

Principal Scientist

National Research Centre on Plant Biotechnology (NRCPB)

Pusa Campus, New Delhi-110 012

March, 2015

CERTIFICATE

This is to certify that the thesis entitled “Generation and Analysis

of Expressed Sequence Tag’s (EST’s) from Two Different Varieties of

Brinjal (Solanum melongena L.) During Fruit Developmental Stages

and Evaluation of Their Utility in Genetic and Molecular Studies” that

is being submitted by Mr. MOGILICHERLA KANAKACHARI in

partial fulfilment for the award of Doctor of Philosophy in the Department

of Plant Science, Bharathidasan University, Tiruchirappalli, Tamil Nadu,

India–620024 is a record of bonafide work carried out by him under our

guidance and supervision. The results embodied in this thesis have not

been submitted to any other university or institute for the award of any

degree or diploma.

Signature of Co-Supervisor Signature of Supervisor Dr. P. ANANDA KUMAR Prof. N. JAYABALAN Principal Scientist UGC-BSR Faculty Fellow NRC on Plant Biotechnology Department of Plant Science PUSA Campus Bharathidasan University New Delhi-110 012 Tiruchirappalli-620 024 INDIA Tamil Nadu, INDIA

CERTIFICATE

This is certify that the Ph.D., thesis entitled “Generation and Analysis of

Expressed Sequence Tag’s (EST’s) from Two Different Varieties of Brinjal

(Solanum melongena L.) During Fruit Developmental Stages and Evaluation of

Their Utility in Genetic and Molecular Studies” submitted to the Bharathidasan

University, Tiruchirapalli- 620 024, Tamil Nadu, India, for the award of the Degree of

Doctor of Philosophy in Plant Biotechnology, is an authentic record of original work

carried out by Mr. MOGILICHERLA KANAKACHARI, under my supervision and

guidance at the Department of Plant Science, School of Life Sciences, Bharathidasan

University, Tiruchirappalli- 620 024, Tamil Nadu, India.

I further certify that no part of this thesis has previously formed the basis for the

award to the candidate of any degree, diploma, associate-ship, fellowship or other

similar titles of this or any other University or Society.

Tiruchirappalli (N. JAYABALAN)

Date:

DECLARATION

I hereby declare that this thesis entitled “Generation and Analysis of

Expressed Sequence Tag’s (EST’s) from Two Different Varieties of Brinjal

(Solanum melongena L.) During Fruit Developmental Stages and Evaluation of

Their Utility in Genetic and Molecular Studies” is a bonafide record of original

research work embodied by me under the supervision and guidance of

Prof. N. JAYABALAN, UGC-BSR Faculty Fellow, Department of Plant Science,

School of Life Sciences, Bharathidasan University, Tiruchirappalli- 620 024, Tamil

Nadu, India. I further assure that this work has not been submitted either in whole or

part for any other degree or diploma at any other university.

Tiruchirappalli (M. KANAKACHARI)

Date:

ACKNOWLEDGEMENT

First and foremost I would like to thank God. In the process of putting this book together I realized how true this gift of writing is for me. You given me the power to believe in my passion and pursue my dreams. I could never have done this without the faith I have in you the Almighty.

Foremost, I would like to express my sincere gratitude to my advisor Prof. N. Jayabalan, UGC-BSR Faculty Fellow, Department of Plat Science, Bharathidasan University, Tiruchirappalli- 620 024 for the continuous support during my Ph.D study, for his patience, enthusiasm, and immense knowledge. He always motivated me with a word "you can" and "focus on the work until you achieve it" that helped to overcome the obstacles during the hard times. His guidance helped me in all the time of research and writing of this thesis and apart from research, he has impressed me with his vast experience gained in his life. I could not have imagined having a better advisor and mentor for my Ph.D study.

I humbly express my ineffable sense of gratitude and heartfelt thanks to my Co-Supervisor Dr. P. Ananda Kumar, Principal Scientist, National Research Centre on Plant Biotechnology (NRCPB), LBS Building, Pusa Campus, New Delhi (on deputation as a Director to Institute of Biotechnology, Acharya N. G. Ranga Agricultural University, Hyderabad) who has given me the opportunity to carry out the research work in NRCPB. I feel highly elated in expressing my deep sense of gratitude for his eminent and adroit guidance with sustained interest, learned counsel, incessant and steadfast inspiration, scintillating suggestions, benevolent and noble ideas, inestimable patience, cordiality and constant encouragement and manifold help bestowed throughout the progress of my research work, without his consistent and illuminating instruction, I could not have reached the present form in my research carrier.

It also gives me immense pleasure to acknowledge the members of my advisory committee Dr. A. Ganapathi, BSR Emeritus Professor, Department of Biotechnology and Genetic Engineering, Bharathidasan University, Tiruchirappalli and Dr. T. Senthil Kumar, Assistant Professor, Department of Industry University Collaboration, Bharathidasan University, Tiruchirappalli for their valuable suggestions, encouragement and support.

I would like to extend my special thanks to Dr. A. U. Solanke, Scientist, National Research centre on Plant Biotechnology, New Delhi for his valuable suggestions and support. I wish to express my profound sense of gratitude and sincere thanks to Dr Debasis Pattanayak, Dr (Mrs.) Rohini Sreevathsa, Dr Ajay Jain, Ms. Suman Bala and other Scientists of NRCPB and IARI Divisions for their kind help, persistent encouragement and cooperation during my research.

I humbly express my ineffable sense of gratitude and heartfelt thanks to the Dr V. Siva Reddy, Group Leader-Plant Biology: Plant Transformation, International Centre for Genetic Engineering and Biotechnology (ICGEB), New Delhi and Prof. I. S. Katageri, Principal Scientist (Cotton), Agriculture Research Station, University of Agricultural Sciences, Dharwad Farm, Dharwad, Karnataka for their inspiring guidance and sustained interest shown during my study period.

I extend my sincere gratitude to Dr. M. B. Viswanathan, Professor & Head, Dr. M. V. Rao, Honorary Professor, Prof. B. D. Ranjitha Kumari, Dr. M. Sathiyabama, Assistant Professor and Dr. S. R. Sivakumar, Assistant Professor, Dept. of Plant Science for providing all facilities, valuable suggestions, persistent encouragement and support for my Ph.D programme.

I am immensely thankful to my lab seniors, Dr Vikrant Nain, B. Kiran Kumar, Dr (Mrs.) K. V. Padmalatha, Dr (Mrs.) C. Anuradha, Dr (Mrs.) Shabana Khan, Dr (Mrs.) Sushmita, Dr. K. P. Raghavendra and my colleagues, Dr. R. Lakshmi Kanth, Mr. Vivek Kumar Singh, Dr. M. L. V. Phanindra, Mr. S. Raghavendra Rao, Mr. Venkat Raman, Dr. Israr Ahamed, Mr. Sushil Chhapekar, Mr. Ch. Ramakrishna, Mr. C. Pavan, Mr. Srinivasa Rao, Mr. Harikishore, Mr. Rajeev Kumar Singh, Mrs. Shruthi Yadav, Mrs. C. Liji, Ms. Sonam, Mrs. Dikshi Aggarwal, post graduate and training students in Bt lab and friends at various labs in NRCPB and IARI Divisions for their timely help and support.

My special word of thanks goes to my friends Mr. V. Naresh, Mr. Madhu, Mr. Janikiramappa, Mr. B. Baskar, Mr. Pradeep, Mr. Prasad and DNR College friends Mr. Raghu, Dr. Viswajith, Dr. Vijayendar, Mr. M. Ravikumar, Mr. Salil, Mr. S. Gothandapani, Mr. N. Prabhakaran, Mr. D. Rama Doss, Mr. G. Boopalakrishnan, Mr. Arul Prakash for their unlimited help and support throughout my research programme.

My acknowledgement will never be complete without the special mention of my lab seniors, who have taught me the lab culture and have lived by example to make me understand the hard facts of life. I would like to especially acknowledge Dr. P. Durai, Dr. Ganesh Kumari, Dr. Fr. Roy John, Dr. S. Vinod kanna, Dr. A. Raja, Dr. P. Gurusaravanan, and Dr. S. Vinoth.

My heartfelt thanks to friends and my fellow lab mates, Mr. S. Sivakumar, Mr. G. Siva, Mr. G. Premkumar and Mr. M. Vigneswaran for their scientific inputs, personal helps and friendly nature which always made me feel at ease with them during my wonderful days of Ph.D.

I would like to express my sincere thanks to Dr. M. K. Reddy, Research Scientist, Dr. (Mrs.) Leelavathi Sadhu, Staff Research Scientist, Dr. Palakolanu Sudhakar Reddy, DST-Inspire Faculty Fellow, ICRISAT, Dr. Amit Bhardwaj, PDF, ICGEB, Italy, Mr. Abhishek Dass, Mr. Saravanan Kumar, Mrs. R. Vijayalakshmi, Mr. Krishan Kumar, Ms. Ranjana Pathak,

Mr. Deepak Patil, Research Scholars and Mr. Bhupendra Rawat, Research Technician, ICGEB, New Delhi for their constant support and timely help during my research tenure in New Delhi.

I would like to convey my special thanks to non-teaching staff Mr. M. Vijaya Venkatesh, Mr. K. Muthukumar, Mr. Maamundi and Mrs. Pushpa, Dept. of Plant Science, Bharathidasan University, Tiruchirappalli for their valuable help during my PhD study.

I take immense pleasure in thanking my BDU friends Mr. R. Rajesh Kumar (Dept. of NFMC), Mr. C. Prem Kumar (Dept. of Marine Science), Mr. Senthil, Mr. M. Prathap, Mr. M. Subramanian (Dept. of NFMC), and friends from various Departments for their constant help and support during my study.

I would like to acknowledge M.Sc and M. Tech project students Mr. Dushyanth, Ms. Prachi Goel, Mr. Parul, Ms. Ishitha and Mr. Vignesh for their co-operation during my research work.

On a personal note, I would like to thank my beloved father Mr. M. Maniyya and mother, Mrs. M. Sarojini, wife Mrs. M. T. G. Sowmya, son Master Hemasri Sainath, brother Mr. M. Rambabu and his wife Mrs. M. Naga Lakshmi, Ms. M. Sandhya, Mr. M. Siva Kumar, my sister Mrs. K. Pushpavathi and her husband Mr. K. Veerachari, Mr. K. Mahesh, Mr. K. Jyothi and my uncle family members Mr. L.V.V. Sathyanarayana and his wife Mrs. L. Lakshmi, Mr. L. Eeshwar and Mr. L. Harsha for their everlasting and abundant love, moral support, care and supreme sacrifice that helped me to accomplish this task.

I wish to acknowledge the Indian Council for Agricultural Research (ICAR), New Delhi and National Agricultural Innovative Project (NAIP) for providing me with the necessary funding and fellowship through NAIP-SRF to pursue research at National Research Centre on Plant Biotechnology and Bharathidasan University.

I am grateful to Mr. S. A. Shafiullah, ASP computers, Tiruchirappalli – 620 020, who rendered valuable service for completion of my thesis in a perfect way.

I convey my whole hearted thanks to many of my well-wishers and friends.

Place: TIRUCHIRAPPALLI

Date: (M. KANAKACHARI)

ABBREVIATIONS

% : Percentage

°C : Degree Celsius

ACO : ACC oxidase

AFLP : Amplified Fragment Length Polymorphism

AOX : Alternative oxidase

APX : Ascorbate peroxidase

ATEXLB1 : Arabidopsis Expansin like B1

ATLP : Arabidopsis Thaumatin-like protein

ATP : Adenosine triphosphate

BAC : Bacterial artificial chromosome

BAP : 6-Benzyl Amino Purine

BAP : 6-Benzyl amino purine

BCAA : Branched-chain amino acids

bHLH : Basic helix loop helix

BLAST : Basic Local Alignment Search Tool

bp : Base pair

BR : Brassinosteroids

BSA : Bovine serum albumin

CAD : Cinnamyl Alcohol Dehydrogenase

CaMV : 35S Cauliflower Mosaic Virus 35S Promoter

cDNA : coding Deoxyribonucleic Acid

CDPK : Calcium-dependent protein kinase

CESA : Cellulose Synthase

Chr : Chromosome

CHS : Chalcone Synthase

CM : Centimetre

CMT : Caffeoyl-CoA 3-O-methyltransferase

DEPC : Diethyl pyrocarbonate

DETS : Differentially Expressed Transcripts

DMSO : Dimethyl sulfoxide

DNA : Deoxyribonucleic Acid

DNase : Deoxyribonuclease

dNTP : Deoxynucleotide Triphosphate

DPA : Days Post Anthesis

DTT : Dithiothreitol

EB : Elution buffer

EDTA : Ehtylenediaminetetraacetic acid

ERF : Ethylene Response Factor

EST : Expressed sequence tag

EtBr : Ethidium bromide

Exo-SAP : Exonuclease I + Shrimph Alkaline Phasphatase

FA : Fatty Acid

FLA : Fasciclin-like Arabinogalactan Proteins

FLS : Flavonol synthase

g : Gram

gDNA : Genomic DNA

GUS : β-glucuronidase

h : Hour

HCCA : α-Cyano-4-Hydroxy Cinnamic Acid

HSP : Heat shock protein

HTGS : High Throughput Genome Sequencing

IPTG : Isopropyl-P -D-Thiogalactopyranoside

IPTG : Isopropyl-β-D-galactoside

IR : Inverted repeat

KAT : 3-Ketoacyl-CoA thiolase

Kb : Kilobase

kDa : Kilo Dalton

KKM-1 : Killikulam-1

LB : Luria Bertini

Lox : Lipoxygenase

M : Molar

MAPK : Mitogen Activated Protein Kinase

Mb : Mega base

MCS : Multiple Cloning Site

MCT : Micro centrifuge tube

MDH : Malate Dehydrogenase

Mg : Milligram

min : Minute

Ml : Millilitre

Mm : Millimolar

MOPS : 3-(N-Morphilino)-ethane sulfonic acid

MQ : Milli-Q-water

Ms : Murashige and Skoog medium

N : Normal

NCBI : National Center for Bioinformatics Information

NDPK : Nucleoside diphosphate kinase

ng : Nano gram

Nos : Nopaline synthase gene

npt II : Neomycin phosphotranferase gene

OD : Optical density

ORF : Open reading frame

p : Plasmid

PCR : Polymerase chain reaction

PDC : Pyruvate Decarboxylase

Ph : -1og [H+]

PK : Pyruvate Kinase

PPL : Pusa Purple Long

PSY : Phytoene Synthase

RAPD : Random Amplified Polymorphic DNA

RFLP : Restriction Fragment Length Polymorphism

RNA : Ribonucleic Acid

Rnase A : Ribonuclease A

ROS : Reactive oxygen species

rpm : Revolutions per minute

s : Second

SNPs : Single nucleotide polymorphisms

SOD : Superoxide dismutase

SSH : Suppression Substractive Hybridization

SSR : Simple sequence repeats

TAE : Tris-acetate-EDTA

TAIR : The Arabidopsis Information Resource

Taq : Thermus aquaticus

TIGR : The Institute of Genome Research

TIP : Tonoplast intrinsic proteins

TPI : Triose-phosphate isomerase

Tris : Tris (hydrooxymethyl) aminomethane

U : Unit

WGS : Whole Genome Sequencing

X-gal : 5-Bromo-4-chloro-3-indolyl-β-D-galactoside

XTR : Xyloglucan Endotransglycosylase

YAC : Yeast artificial chromosome

YEM : Yeast Extract Mannitol

α : Alpha

β : Beta

β-ME : β- Mercaptoethanol

μ : Micro

μg : Microgram

μl : Microliter

CONTENTS

Chapters Contents Page No.

Chapter - I General Introduction 1 – 15

Chapter - II Differential gene expression during fruit development determines variation in fruit size, shape and colour in Brinjal (Solanum melongena L.)

16 – 57

2.1 Introduction 16

2.2 Materials and Methods 19

2.3 Results 31

2.4 Discussion 47

2.5 Conclusion 57

Chapter -III Evaluation of suitable reference genes for normalization of qRT-PCR gene expression during fruit development stages in Brinjal (Solanum melongena L.)

58 – 85

3.1 Introduction 58


3.3 Results 72

3.4 Discussion 82

3.5 Conclusion 85

Chapter -IV Characterization of antioxidant genes during fruit development and ripening in Brinjal (Solanum melongena L.)

86 – 96

4.1 Introduction 86


4.3 Results 89

4.4 Discussion 94

4.5 Conclusion 96

Chapter -V Isolation and characterization of fruit specific genes of Brinjal (Solanum melongena L.)

97 – 129

5.1 Introduction 97


5.3 Results 111

5.4 Discussion 126

5.5 Conclusion 129

Chapter - VI Summary and Conclusion 130 – 141

References i - xix

LIST OF FIGURES

Figure No.

Figure Title Page No.

1.1 Brinjal crop (Solanum melongena L.) varieties 2

1.2 Top Brinjal producing countries in 2012 (FAOSTAT, 2014) 5

1.3 Indian production of Brinjal (Source: National Horticulture Board) 5

2.1 Fruit development stages of Brinjal (PPL and KKM-1) 20

2.2 RNA quality and quantity checking by using denatured agarose gel and bioanalyzer 2100

22

2.3 Schematic diagram of SMARTer cDNA synthesis preparation 23

2.4 Schematic diagram of PCR-Select cDNA subtraction library preparation

23

2.5 Preparing adaptor-ligated tester cDNAs for hybridization and PCR 24

2.6 Overview of the PCR-select SSH library results 24

2.7 Selection of transformed colonies based on blue and white selection

26

2.8 Screening of SSH library by colony PCR 26

2.9 3730xl sequencer machine (Applied Biosystem, USA) 27

2.10 Sanger sequencing principle 27

2.11 Brinjal fruit developmental stages considered for SSH library construction

32

2.12 Summary of the number of unigenes in ten cDNA libraries from two different varities (PPL and KKM-1) of Brinjal

34

2.13 Overlapping of unigenes detected in ten cDNA libraries from two different varieties

35

2.14 Distribution of Brinjal PPL and KKM-1 ESTs among unigenes 35

2.15 BLAST hits as retrieved from NCBI databases 36

2.16 GO terms distribution in two different varieties of Brinjal (PPL and KKM-1)

38

2.17 Number of ESTs encoding putative transcription factors at various fruit development stages of PPL and KKM-1

44

2.18 Number of ESTs involved in phytohormone signaling at various fruit development stages of PPL and KKM-1

44

2.19 Validation of EST data using qRT-PCR during fruit development stages (0, 5, 10, 20, 30 and 50 dpa) in two different varieties of Brinjal (PPL and KKM-1)

45

3.1 Strategy for the identification of reference genes for qRT-PCR normalization in Brinjal (Solanum melongena L.)

61

3.2 Cluster Alignment of referred genes in Brinjal, Tomato, Potato and Tobacco

64

3.3 Real time PCR primer efficiency 65

3.4 Stratagene Mx3005P qRT-PCR system was used in this study 69

3.5 Real-time amplification specificity 70

3.6 RT-qPCR Ct values for the candidate reference genesp 75

3.7 Expression pattern of candidate reference genes in Brinjal fruit developmental stages

75

3.8 Heat map showing expression pattern of reference genes in Brinjal fruit development

76

3.9 Average expression stability values (M) calculated by geNorm in different fruit developmental stages.

78

3.10 Pairwise variation analysis of candidate genes in different fruit developmental stages

78

3.11 Ranking of candidate reference genes in order of their expression stability as calculated by NormFinder in Brinjal fruit developmental stages

81

3.12 Relative quantification of lipoxygenase expression normalized using validated reference genes

81

4.1 Amplification plots for 8 antioxidant genes 90

4.2 Real-Time amplification specificity 91

4.3 Expression analysis of antioxidant genes during fruit development stages (5, 10, 20 and 50 dpa) in Brinjal (Solanum melongena L.) cv. PPL compared with 0 dpa.

92

4.4 Expression analysis of Antioxidant genes during fruit development stages (5, 10, 20 and 50 dpa) in Brinjal (Solanum melongena L.) cv. KKM-1 compared with 0 dpa

93

5.1 Amplification of lipoxygenase gene from gDNA and cDNA 112

5.2 Amplification of p40 like protein gene from gDNA and cDNA 112

5.3 Gel elution of lipoxygenase gene 114

5.4 Gel elution of p40 like protein gene 114

5.5 Colony PCR analysis of lipoxygenase gene 115

5.6 Colony PCR analysis of p40 like protein gene 115

5.7 Plasmid DNA isolated from pGEM-T Easy vector carrying lipoxygenase

118

5.8 Restriction digestion analysis of pGEM-T Easy vector carrying plasmid isolated from lipoxygenase gene with EcoRI

118

5.9 Plasmid DNA isolated from pGEM T-Easy vector carrying p40 like protein gene

119

5.10 Restriction digestion analysis of pGEM T-Easy vector carrying p40 like protein with EcoRI

119

5.11 Full length lipoxygenase (TC7446) gene sequence 120

5.12 Full length p40 like protein (TC9609) gene sequence 121

5.13 Expression analysis of lipoxygenase gene in different fruit developmental stages of PPL and KKM-1 varieties of Brinjal compared with their expression of leaf tissue

123

5.14 Expression analysis of p40- like protein gene in different fruit developmental stages of PPL and KKM-1 varieties of Brinjal compared with their expression of leaf tissue

123

5.15 Plasmid DNA isolated from pBI121 binary vector (14.7 kb) 124

5.16 Restriction digestion analysis of pGEM T-Easy vector carrying p40 like protein gene and binary vector pBI121 with double digestion of BamHI and SacI

124

5.17 Agarose gel electrophoresis analysis of gel eluted and purified product of p40 like protein gene and pBI121 binary vector

125

5.18a Linear and circular map of pBI121 binary vector carrying p40 like protein gene from Brinjal

127

5.18b Circular map of pBI121 binary vector carrying p40 like protein gene from Brinjal.

127

5.19 Agarose gel electrophoresis analysis shows colony PCR confirmation of pBI121 binary vector carrying p40-like gene

128

LIST OF TABLE

Table No.

Table Title Page No.

1.1 Scientific classification of Brinjal 4

1.2 Composition per 100 g of edible portion of Brinjal (National Institute of Nutrition, 2007)

6

2.1 Master mix of sequencing PCR 30

2.2 Primers used for quantitative Real-Time PCR 30

2.3 Brinjal fruit developmental stages considered for SSH library preparation

32

2.4 Summary of ESTs derived from PPL and KKM-1 of Brinjal 34

2.5 List of enzymes involved in carbohydrate metabolism along with the library of origin of the correspondent EST clones

39

2.6 List of enzymes involved in fatty acid metabolism along with the library of origin of the correspondent EST clones

40

2.7 List of enzymes involved in amino acid metabolism along with the library of origin of the correspondent EST clones

41

2.8 List of enzymes involved in secondary metabolites biosynthesis and metabolism along with the library of origin of the correspondent EST clones

42

2.9 EST-SSR identified from Brinjal ESTs 46

2.10 Selected list of relevant candidate genes function during fruit development in Brinjal

48

3.1 Reference samples evaluated in this study 62

3.2 Reference genes evaluated in this study 66

3.3 Selected candidate reference genes, primers and different parameters derived from qRT-PCR analysis

67

3.4 Values of efficiency ± standard deviation (SD) of the primers of the housekeeping genes and average values of quantification cycle (Cq) ± standard deviation (SD) of biological replicates generated by the Miner to the genes of reference of Brinjal

71

3.5 geNorm analysis 73

3.6 NormFinder analysis 80

4.1 List of antioxidant primers used in this study 88

5.1 Composition of Luria Bertini (LB) medium 100

5.2 Reaction mixture for PCR using Taq polymerase 100

5.3 Ligation reaction mixture for ligation in pGEM T-Easy vector 103

5.4 Reaction mixture for restriction digestion 103

5.5 Reaction mixture for Real-Time PCR 109

5.6 Reaction conditions for Real-Time PCR 109

5.7 Ligation reaction mixture for ligation in a binary vector 109

5.8 Primers used for full length lipoxygenase gene isolation 117

5.9 Primers used for full length p40 like protein gene isolation 117

Chapter I

General Introduction

1.1 GENERAL BACKGROUND

Vegetables/fruits are important components of the human diet, providing

carbohydrates, vitamins, minerals, fibers and other beneficial compounds such as

antioxidants. Fruits are typically considered as enlarged organs that surround the

developing seeds or the ripened ovary of a flower together with any associated

accessory parts. The development and final form of the fruit is varied, ranging from

small expanded dehiscent (non-fleshy) fruit of Arabidopsis, through expanded ovaries

of brinjal, to complex fruiting organs with several different expanded tissues, such as

pome fruit (Esau 1977). Fruit development can be divided into four distinct phases

(Gillaspy et al. 1993). The first phase generally referred as fruit set that begins after

anthesis and involves fertilization and development of the ovary. In the second phase,

fruit grows by rapid cell division accompanied by seed and early embryo formation.

In the third phase, fruit growth is mainly due to an increase in cell volume and fruits

stores metabolites and energy, in the form of starch or sugars and embryo passes

through a maturation phase. This phase often leads to the induction of seed dormancy

and is characterized by accumulation of storage products, suppression of precocious

germination, desiccation tolerance and water loss (Bewley and Black 1994; Giovannoni

2001; Giovannoni 2004).

Fruit development is the result of genetically programmed processes influenced

by environmental factors. In all fruits, common developmental processes are involved

which results in expansion of tissue near the seed after fertilization in a coordinated

manner with seed development. At early, tissues at fruit development stages undergoes

several rounds of cell division, followed by cell expansion during which the fruit stores

metabolites and energy, in the form of starch or sugars (Giovannoni 2001; Giovannoni

2004). Subsequently, after the seeds mature, the fruit undergoes a series of biochemical

changes that convert starch into sugars and produces several volatile secondary

metabolites that are thought to function as attractants for animals or insects which

disperse the seed. To identify and characterize genes involved in these processes,

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. 1

Chapter I

different genomic approaches such as Expressed sequence tags (ESTs), large-scale

microarrays, deep transcriptome profiling, proteomics etc. has been used in several fruit

species and the body of information concerning transcriptional networks and regulatory

circuits involved in important physiological and developmental processes increased

tremendously during the last two decades.

1.2 BOTANICAL DESCRIPTION OF EXPERIMENTAL CROP

Brinjal or eggplant (Solanum melongena L.) is a fruit crop of significant

commercial value and is the third most important economic plant in the Solanaceae

family after potato and tomato. The name brinjal popular in Indian subcontinents is

derived from Arabic and Sanskrit whereas the name eggplant has been derived from the

fruit shape of some varieties, which resemble in shape to chicken eggs. It is also known

as aubergine in Europe (Figure 1.1). It is a versatile crop adapted to different agro-

climatic regions and can be grown all over the year. It is a perennial but grown

commercially as an annual crop. It is an autogamous diploid with 12 chromosomes

(2n = 24). The brinjal nuclear contains 1100Mb of DNA (Arumugan and Earle 1991).

Figure 1.1: Brinjal crop (Solanum melongena L.) varieties A. Pusa purple long B. Killikulam-1 variety.

Unripe brinjal fruit is primarily consumed as cooked vegetable in various ways.

It mostly contains water, carbohydrates, fibres, some protein and is low in energy and

lipids. It is a good source of minerals and vitamins and is rich in water, proteins,

reducing sugars, among other nutrients (Gopalan et al. 2007). The phenolics, minerals,

dry matter and protein content vary in different accessions of brinjal (Raigon et al.

A B


Chapter I

2008). But the most fascinating thing about brinjal is a large range of variation present

for fruit morphology. The fruit shape ranges from oval or egg-shaped to long club-

shaped, whereas the fruit color varies from white, yellow, green and through degrees of

purple pigmentation to almost black. Fruit length is between 4-45 cm and thickness

2-35 cm and weight ranging between 15-1500 g. The fruits are set as single or in

clusters of up to 5 fruits. Physiologically ripened fruits become brown, red or yellow

(Swarup 1995; Kumar et al. 2008; Gangopadhyay et al. 2010). Even during

domestication and evolution of brinjal in China, the size, shape and taste were principal

fruit quality aspects where the cultivation of brinjal took place from 1st century BC

(Wang et al. 2008). The fruit size changed from small to large, the taste changed from

not palatable to what was termed at the time sweetish and wide varieties of fruit shapes

was cultivated.

However, a few reports are available on the molecular basis of brinjal fruit

development which is an essential pre-requisite for future improvement by molecular

breeding or genetic modification. In terms of fruit development and ripening, fleshy

fruits are classified as either climacteric or non-climacteric. In climacteric fruits, such

as tomato, bananas and apples, biosynthesis of ethylene and an increase in the rate of

respiration is observed at ripening stage. Conversely, non-climacteric fruits such as

brinjal lack the autocatalytic ethylene burst and the increase in respiration. Although

the physiological changes that occur during brinjal fruit development are known, little

is known about the molecular events that govern brinjal fruit development and ripening.

Doganlar et al. (2002b) used quantitative trait loci (QTL) analysis and showed

that fruit size of the brinjal was controlled primarily by only two loci (fw2.1 and fw9.1)

on linkage groups 2 and 9, respectively whereas the fruit shape was controlled by two

loci (fs2.1 and fs7.1) on linkage groups 2 and 7 and fruit prickliness and colour

determined by a single locus on linkage group 6 (lp6.1) and a major locus on linkage

group 10 (fap10.1and pa10.1), respectively. They also observed that fruit taste of

weedy forms are bitter than advanced cultivars with large fruit size. A genetic

divergence in 98 accessions for fruit traits along with morpho-agronomic characters

were studied in Solanum melongena, S. aethiopicum and S. macrocarpon (Polignano et

al. 2010).


Chapter I

1.2.1 TAXONOMIC CLASSIFICATION

Brinjal having botanical name Solanum melongena L. belongs to the family

Solanaceae, which is a very large plant family containing 2300 species, nearly one-half

of which are placed under a single genus, Solanum (D’Arcy 1991), which is one of the

ten most species-rich genera of flowering plants (Frodin 2004) (Table 1.1).

Table 1.1: Scientific classification of Brinjal

Kingdom Plantae (Plant) Subkingdom Tracheobionta (Vascular plants) Superdivision Spermatophyta (Seed plants) Division Magnoliophyta (Dicotyledons) Class Magnoliopsida (Dicotyledons) Subclass Asteridae Order Solanales Family Solanaceae (Potato family) Genus Solanum (Nightshade) Species Melongena

There are three main botanical varieties under the species melongena

(Choudhury 1976). The ordinary brinjal which has big, round or egg-shaped fruits are

grouped under var. esculentum, the elongated slender types are grouped under var.

serpentinum and the dwarf brinjal plants are placed under var. depressum.

1.2.2 ECONOMIC IMPORTANCE OF BRINJAL AND WORLD SCENARIO

The brinjal crop originated in India (Gleddie et al. 1986) and is now cultivated

around the world. It is grown as a vegetable crop in India, Japan, Indonesia, China,

Bulgaria, Italy, France, USA and many African countries (Kalloo 1993). At present

brinjal, after potato and tomato, is the third most important crop of Solanaceae family,

with an annual worldwide production of 48.42 million tones and 18.5x105 hectares area

under its cultivation (FAOSTAT 2012) (Figure 1.2).

India produces 12.2 million tonnes of brinjal from 7x105 hectares area, which is

equivalent to one quarter of the worldwide production, making India the second largest

producer of brinjal in the world, after China (FAOSTAT 2012). The following states


Chapter I

are producing the brinjal i.e. India, Orissa, Bihar, Karnataka, West Bengal, Andhra

Pradesh, Maharashtra and Uttar Pradesh. West Bengal is the largest producer as can be

seen in figure (Figure 1.3).

Figure 1.2: Top Brinjal producing countries in 2012 (FAOSTAT, 2012).

Figure 1.3: Indian production of Brinjal (Source: National Horticulture Board).


Chapter I

Commonly cultivated varieties of brinjal include pusa purple long (PPL),

killikulam-1 (KKM-1), MDV1, pusa purple cluster (PPC), pusa kranti (PK), pusa

barsati (PB), arka sheel (AS), arka kusmukar (AK), arka neelkanth (AN), pusa ankur

(PA) and arka nidhi (AN).

1.2.3 NUTRITIONAL COMPOSITION AND USES

Brinjal is a good source of vitamins and minerals, providing a nutritional value

comparable to that of tomato (Kalloo 1993). It is particularly rich in iron. It has low

calories and fats, and contains mostly water, proteins, fibre and carbohydrates (Table

1.2).

Table 1.2. Composition per 100 g of edible portion of brinjal (National Institute of

Nutrition, 2007)

Calories 24.0 Sodium (mg) 3.0 Moisture content (%) 92.7 Copper (mg) 0.12 Carbohydrates (%) 4.0 Potassium (mg) 2.0 Protein (g) 1.4 Sulphur (mg) 44.0 Fat (g) 0.3 Chlorine (mg) 52.0 Fiber (g) 1.3 Vitamin A (I.U.) 124.0 Oxalic acid (mg) 18.0 Folic Acid (μg) 34.0 Calcium (mg) 18.0 Thiamine (mg) 0.04 Magnesium (mg) 15.0 Riboflavin (mg) 0.11 Phosphorus (mg) 47.0 B-carotene (μg) 0.74 Iron (mg) 0.38 Vitamin C (mg) 12.0 Zinc (mg) 0.22 Amino Acids 0.22

Brinjal is known to have ayurvedic medicinal properties and is good for diabetic

patients. A brinjal based diet with its high fiber and low carbohydrate content has been

suggested for management of Type 2 diabetes (Kwon et al. 2008). It has also been

suggested as an outstanding remedy for those suffering from liver complaints (Shukla

and Naik 1993).


Chapter I

From a study on human volunteers, it was found that an infusion of brinjal has a

slight effect on the reduction of cholesterolemia (Guimaraes et al. 2000). It reduces

LDL-c with no change in HDL-c. A study on mice showed that dry residue of brinjal

leaf juice produced significant antipyretic and analgesic effect (Mutalik et al. 2003).

Root extract of brinjal is also found to show analgesic effects (Srivastava and Sanjay

2011). A study evaluated methanol extracts from the peels of brinjal against five human

cancer cell lines and the results showed moderate to potent activities against the tested

cancer cell lines signifying a dose dependent anticancer activity (Shabana et al. 2013).

1.3 ANTIOXIDANTS AND ITS MEDICINAL IMPORTANCE

Antioxidants are substances that may protect cells from the damage caused by

unstable molecules known as free radicals. Antioxidants interact with and stabilize free

radicals otherwise free radical damage may lead to cancer. Examples of antioxidants

include beta-carotene, lycopene, vitamins C, E, A and other substances (Sies 1997).

Antioxidants are abundant in fruits and vegetables, as well as in other foods including

nuts, grains and some meats, poultry and fish. Beta-carotene is found in many foods

that are orange in color, including sweet potatoes, carrots, cantaloupe, squash, apricots,

pumpkin and mangoes. Some green leafy vegetables including collard greens, spinach

and kale are also rich in beta carotene (Borek 1991). Lycopene is a potent antioxidant

found in tomatoes, watermelon, guava, papaya, apricots, pink grapefruit, blood oranges

and other foods. Estimates suggest 85% of American dietary intake of lycopene comes

from tomatoes and tomato products (Rodriguez-Amaya 2003; Xianquan et al. 2005).

Oxidation is a chemical reaction that transfers electrons from a substance to an

oxidizing agent. Oxidation reactions can produce free radicals, which start chain

reactions that damage cells. Antioxidants terminate these chain reactions by removing

free radical intermediates and inhibit other oxidation reactions by being oxidized

themselves. An antioxidant is a molecule capable of slowing or preventing the

oxidation of other molecules. As a result, antioxidants are often reducing agents such as

thiols, ascorbic acid or polyphenols (Sies 1997). Although oxidation reactions are

crucial for life, they can also be damaging; hence, plants and animals can also be

damaging and maintain complex systems of multiple types of antioxidants such as


Chapter I

glutathione, vitamin C and vitamin E as well as enzymes such as catalase, superoxide

dismutase and various peroxidases. Low levels of antioxidants, or inhibition of the

antioxidant enzymes, causes oxidative stress and may damage or kill cells. As oxidative

stress might be an important part of many human diseases, the use of antioxidants in

pharmacology is intensively studied, particularly as treatments for stroke and neuro

degenerative diseases. However, it is unknown whether oxidative stress is the cause or

the consequence of disease. Antioxidants are also widely used as ingredients in dietary

supplements in the hope of maintaining health and preventing diseases such as cancer

and coronary heart disease. In addition to these uses of natural antioxidants in

medicine, these compounds have many industrial uses, such as preservatives in food

and cosmetics and preventing the degradation of rubber and gasoline.

1.4 ABIOTIC AND BIOTIC FACTORS INFLUNCING BRINJAL

PRODUCTION

Most of brinjal cultivars are susceptible to a number of biotic and abiotic

stresses. There are a number of economically important diseases for which control is

either absent or prohibitively costly (e.g., soilborne wilt diseases such as bacterial wilt,

verticillium wilt and little leaf). Exploitation of host-plant resistance in breeding gives

rise to resistant cultivars which will make production in infected fields economically

feasible. In collaboration with plant pathologists, brinjal breeders have successfully

developed disease-resistant breeding lines. Progress in developing disease-resistant

brinjal would not have been possible without the genetic resources to sustain the

breeding efforts. Genes for resistance to various diseases have been identified in

cultivated and wild relatives of brinjal.

1.5 CURRENT STATUS OF TRANSGENIC BRINJAL

In brinjal genetic engineering studies need to be improving for the introduction

of new genes, resistance to biotic and abiotic stress, secondary metabolites production

and nutritional quality of fruits, so far Bt endotoxin (Arpaia et al. 1997; Jelenkovic et

al. 1998; Kumar et al. 1998) and parthenocarpy (Rotino et al. 1997) genes have been

successfully introduced in brinjal. Transgenic plants have so many advantages, like low

cost, flexibility and rapidity, recombinant proteins production for medical and


Chapter I

pharmaceutic interest (Artsaenko et al. 1998; Zeitlin et al. 1998; Vaquero et al. 1999),

such as single-chain Fv (scFv) antibodies (Bird et al. 1988). The use of selectable

marker genes, like phospho-mannose isomerase (Joersbo et al. 1998) or xylose

isomerase (Haldrup et al. 1998), mannose-6-phosphate and xylose respectively against

antibiotics or herbicides resistance conformation, these markers have no role beyond

the laboratory and more public concern presence in transgenic food crops. In brinjal

and many crop plants biotechnology progress is needed and collaboration and

interaction will be essential between biotechnologists, plant breeders, pathologists and

agronomists to transfer the laboratory findings to the fields (reviewed by Collonnier et

al. 2001).

In 2001, Acciarrin et al. developed genetically engineered parthenocarpy brinjal

by using DefH9-iaaM gene. The iaaM gene conforms auxin synthesis by coding

monoxygenase and DefH9 controls drive expression of gene in the ovules and placenta.

Main advantages of DefH9-iaaM gene have been achieved without the use of either

male or female sterility genes. They are: i) Adverse for fruit-set and growth for

marketable fruit production ii) In off-season for open field brinjal cultivation to reduce

the cultivation costs (energy, phytohormones and labor) and iii) Enhancement of fruit

quality.

1.6 FRUIT SPECIFIC GENES

The study of fruit development and ripening has received great attention due to

their uniqueness as plant developmental processes and because of the significance that

fruits have in the human diet. Widespread genetic and molecular analyses have

provided significant information about genes participating in numerous aspects of fruit

ripening, such as the cell wall disassembly, variation in soluble sugars, pigment

biosynthesis, and the production of antioxidants, vitamins, flavour, and aromatic

volatiles (Giovannoni 2001). In addition to elucidating the biochemical pathways that

determine fruit ripening, the alteration of gene expression offers the potential to

improve fruit quality by altering biochemical pathways that contribute to flavor, color,

size and shape of fruits.


Chapter I

A number of fruit-specific genes that are activated and expressed during

ripening have been isolated from tomato and other fruits (Chen et al. 2004; Karaaslan

and Hrazdina 2010). Meyer et al. (1996) have isolated and characterized a fruit-specific

bell pepper cDNA that codes for a J1-1 protein the level of which increases

significantly in the fully ripe fruit.

In 2002, the role of phosphoenolpyruvate carboxylase (PEPCase) in organic

acid accumulation and tomato fruit development was investigated and it was reported

that S1PPC2 gene was strongly and specifically expressed in fruit from the end of cell

division to ripening (Guillet et al. 2002). This indicated that in developing tomato fruit,

PEPCase is possibly important in permitting the synthesis of organic acids to provide

the turgor pressure needed for cell expansion (Guillet et al. 2012). It was recently

shown that a 1966 bp DNA fragment located upstream of the ATG codon of the

SlPPC2 gene confers fruit-specificity in transgenic tomato. An expansin gene (CsExp)

from Cucumis sativus has been identified to be specifically expressed in ripened fruit

(Sindhu et al. 2012).

1.7 CURRENT STATUS OF BRINJAL GENOMICS

The estimated genome size of brinjal is 1100 Mb (2n = 2x = 24) with 12

chromosomes similar to tomato (Arumuganathan and Earle 1991). Because of this, the

saturated linkage map of tomato provided a basis for brinjal linkage map through

comparative genomics. In the year 2008, Wang et al. described about domestication

and evolution of the brinjal based on ancient Chinese literature. In China, the

cultivation of brinjal took place from 1st century BC involved three principal aspects of

fruit quality: size, shape and taste. The fruit size is changed from small to large, the

taste changed from not palatable to what was termed at the time sweetish and a wider

variety of fruit shapes was cultivated. Doglanar et al. 2002b used QTL analysis and

showed that fruit size of the brinjal was controlled primarily by only two loci (fw2.1

and fw9.1) on linkage groups 2 and 9, fruit shape primarily controlled by two loci (fs2.1

and fs7.1) on linkage groups 2 and 7 and fruit prickliness and colour determined

primarily by a single locus on linkage group 6 (lp6.1), and a major locus on linkage

group 10 (fap10.1 and pa10.1), respectively. They find fruit taste of weedy forms are


Chapter I

bitter then advanced cultivars with large fruit, it will be interesting to explore the

genetics of taste modification from bitter to less bitter (sweet) taste in brinjal

domestication caused by two kinds of steroidic saponosides (Aubert et al. 1989). In

2010, Polignano et al. studied and explained about Genetic divergence in 98 accessions

of Solanum melongena L., S. aethiopicum L. and S. macrocarpon L. for 16 morpho-

agronomic and fruit traits.

In brinjal, the identification, localization, marker-assisted selection and isolation

of qualitative and quantitative traits, a molecular genetics linkage map is essential. To

develop a RFLP linkage map using genomic DNA, cDNA and EST probes, to compare

the chromosomal organization among the four major crops of the Solanaceae and

provided genome evolution in Solanaceae family. The combination of somaclonal

variation, somatic hybridization, haploid production and genetic transformation

(reviewed in Collonnier et al. 2001) techniques and the molecular linkage map will

facilitate brinjal breeding and genetics (Doganlar et al. 2002a).

Comparative genome studies between pairs of solanaceous species were widely

performed. Single-copy conserved orthologous (COSII) markers allowed to combine

data from multiple species describe the whole family chromosomal evolution patterns.

In the year 2010, Wu et al. described the advantages of COSII studies, broad features

and outcomes of chromosomal evolution in the Solanaceae species. The results reveal

across the family, the chromosomal changes with a higher frequency of inversions than

translocations. They also identified hot spots of chromosomal breakages, imagined that

chromosomal rearrangement breakpoints are not randomly distributed. They

reconstructed ancestors of genome configuration of these Solanaceous species. This

study provides the first broad overview of chromosomal evolution for plant families

and the Solanaceae families.

Doganlar et al. (2002) published brinjal map of 12 linkage groups and 232

markers, based on this map, Wu et al. (2009) was mapped a set of 115 PCR-based

orthologous markers, including 110 COSII markers. COSII markers was mapping

between brinjal and tomato genomes, the high-resolution synteny map will provide a


Chapter I

platform for cross-reference of genetic and genome information and facilitate applied

and basic research in brinjal.

In plant genetic analysis, microsatellites (SSR) is a demotic tool and they

consists of short stretches of DNA tandemly repeated several times and highly variably

within and between species and they have high mutation rate. Because, these are used

as molecular markers to fingerprinting, genome mapping, phylogenic and genetic

relationship studies, marker assisted breading and population genetics (Tautz 1989;

Rongwen et al. 1995). In brinjal, few useful molecular markers have been reported.

Nunome et al. (2009) constructed SSR enriched genomic libraries, and sequenced

14,000 clones and designed 2,265 primer pairs to Xank SSR motifs. They identified

1,054 SSR markers from 1,399 randomly selected primer pairs. 214 segregated in an

intraspecific mapping population from out of 1,054 SSR markers. They also identified

6 SSR markers from 144 EST sequences, from these sequences they designed 209

primers, 7 segregated in the mapping population. Based on this segregation data they

constructed a linkage map. This data is very useful for marker-assisted selection in

brinjal breeding.

In brinjal, so far evaluation of genetic resources based up on phenotype,

revealed useful traits in its wild types, but very few molecular markers are available for

their characterization. RFLP, RAPD and AFLP studies allow for enrichment of genetic

linkage map and acceleration of the identification and isolation of markers and genes

involved in resistance to pests and pathogens, useful for further gene transfers. The

plant tissue culture technique is a powerful biotechnological technique for management

of genetic resources and improvement of brinjal crop. Haploids and somaclonal

variants production have been reported in brinjal. In brinjal somatic hybrids, herbicide

resistance, bacterial and fungal wilts have been successfully expressed (Sihachakr et al.

1994).

In brinjal germplasm, by using RAPD and AFLP markers the molecular genetic

polymorphism and marker-assisted selection is limited (Mace et al. 1999; Nunome et

al. 2001). For determining the genetic relationships in the Solanaceae, first report on


Chapter I

the effectiveness of the AFLP technique for most comprehensive studies of DNA

diversity in the brinjal (Karp et al. 1996; Mace et al. 1999).

Fukuoka et al. (2010) has developed 60,000 cDNA clones from various tissues

and treatments of brinjal. Based on the functional annotations revealed a distribution of

functional categories almost similar to tomato, while 1316 unigenes were suggested to

be brinjal specific. This Expressed sequence tags (ESTs) and 16k unigene set is very

useful resource for expanding the scope of comparative biology not only in brinjal but

also in Solanum species.

The brinjal genome is not evaluated compared to other Solanaceae crops

tomato, potato and pepper, in especial, 1,000 Simple Sequence Repeat (SSR) markers

were developed and no Single Nucleotide Polymorphism (SNP) markers are publicly

available. Barchi et al. (2011) used Restriction-site Associated DNA (RAD) approach

and Illumina DNA sequencing for rapid and mass discovery of both SNP and SSR

markers for brinjal. They generated ~17.5 Mb of RAD tags and arranged in to ~78,000

contigs from a pair of brinjal mapping parents genomic DNA. From this data they

discovered ~10,000 SNPs and nearly 1,000 indels and they mapped 2,000 SNPs by

using Illumina GoldenGate assay. They also discovered 2,000 putative SSRs from this

data. The RAD was highly successful method for large scale DNA markers discovery,

which will useful for organizing of brinjal genome and comparative genome analysis in

Solanaceae family.

Among flowering plants, Solanaceae is highly important that have absence of

whole-genome duplications (WGD). For last two decades comparative genomics is a

powerful tool in Solanaceae for finding genomic function and evolution (Tanksley et

al. 1988). Due to limited availability of Solanaceous ESTs (Hoeven et al. 2002;

Ronning et al. 2003; Blanc and Wolfe 2004; Rensink et al. 2005) data large-scale

comparative analysis of genomic sequences has not been possible. Wang et al. (2008)

was reported the generation and analysis of sequences for five important Solanaceae

family genomes for an unduplicated conserved syntenic segment (CSS), this contain

105-kb region of tomato chromosome 2 and orthologous regions of the potato, brinjal,


Chapter I

pepper, and petunia genomes. They identified genes and analyze hundreds of conserved

non coding regions and this data provides a window into 30 million years of plant

evolution in the absence of polyploidization.

1.8 NEED FOR THE STUDY

The availability of genomic resources in brinjal is limited (98,089 ESTs

known). Attractive characteristics of the brinjal fruit are not only colour, size, aroma

and texture, but also its chemical composition (contents of minerals, vitamins and

antioxidants). Brinjal fruit contains many compounds with antioxidant activity such as

anthocyanins, flavonoids, phenolic acids. There is no information about the activities of

significant antioxidant enzymes in brinjal fruits at different development and ripening

stages. Brinjal is a non-climacteric fruit, it does not have an autocatalytic ethylene burst

during ripening and exogenous application of ethylene does not rapidly accelerate fruit

ripening. Therefore, it is required to prepare the complete transcriptome map of fruit

development to characterize the transcripts differentially expressed in relation to fruit

character. Suppression Subtractive Hybridization (SSH) method coupled with qRT-

PCR can identify such differentially expressed transcripts during fruit development. In

qRT-PCR, unstable reference genes are used for normalization, they can dramatically

change the expression pattern of a given target gene, and introduce flaws in the

understanding of the function of the gene. Therefore, before qRT-PCR analysis,

appropriate reference genes are essential and should be standardized for expression

relative to the test samples. By keeping these views in the mind two varieties of brinjal

i.e. Pusa Purple Long (PPL) and Killikulam-1 (KKM-1) are selected to study the

transcriptome profile of the fruit development at different development stages. PPL is a

variety with long purple coloured fruits, while KKM-1 bears round white fruits. Hence

brinjal varieties with two different contrasting characters are selected for the present

study.

With the above said importance, in the present study attempt was made to

identify genes governing the fruit size, shape and colour across the fruit developmental

stages (0 to 50 dpa) by comparing the two varieties PPL and KKM-1 with the following

objectives.


Chapter I

Objectives :

Generation, sequencing and annotation of EST libraries from different fruit

developmental stages of two contrasting brinjal varieties (PPL vs. KKM-1) by

Suppression Subtractive Hybridization (SSH) method.

Identification and standardization of housekeeping genes for qRT-PCR in

brinjal during fruit development.

Characterization of antioxidant genes during fruit development and ripening in

brinjal (Solanum melongena L.)

Identification and isolation of most variable genes between two contrasting

brinjal varieties (PPL vs. KKM-1) and construction of plant transformation

vectors.


Chapter II

Generation, sequencing and annotation of EST libraries from different fruit developmental stages of two contrasting Brinjal varieties Pusa Purple Long (PPL) vs. Killikulam-1 (KKM-1) by Suppression Subtractive Hybridization (SSH) method.

2.1 INTRODUCTION

Brinjal (Solanum melongena L.) is a fruit bearing vegetable crop, belonging to

the family Solanaceae. This is one of the plant families, the most involved in our daily

lives. It includes economically important crops such as tomato, potato and pepper along

with brinjal. While the most solanaceous crops are believed to have originated in the

America, brinjal is originated in India (Kallo 1993) and it is endemic to the Old World

(Daunay 2008). It is also mentioned that brinjals arose in Africa and were dispersed

throughout the Middle East to Asia (Weese and Bhos 2010). World production of

brinjal have been growing year by year during the last two decades, and reached to

47 million tons in 2011, which was roughly one-third of the total tomato production

(FAOSTAT, http://faostat.fao.org/). Brinjal have many unique traits, including extra

large fruit size, high temperature and water-stress tolerance, parthenocarpy without any

negative pleiotropic effects, and stable verticillium and bacterial wilt resistance (Sakata

et al. 1996; Saito et al. 2009). Despite of this, brinjal has been less recognized as a

target for molecular genetics studies than other solanaceous species. One reason for

this may be that many of the agronomically important traits in brinjal are also shared by

tomato, potato and pepper and in most cases; the genetics of these traits has been

investigated in more detail in those species (Wu et al. 2009a). But with advances in

genomics techniques the molecular dissection of important traits in a crop like brinjal is

now possible.

The estimated genome size of brinjal is 1.1 Gbp (2n = 2x = 24) with

12 chromosomes similar in tomato (Arumuganathan and Earle 1991). Because of this,

the saturated linkage map of tomato provided a basis for brinjal linkage map through

comparative genomics. Doganlar et al. (2002a) generated brinjal map of 12 linkage

groups with 232 markers, which was further saturated with total 869 markers in the


Chapter II

brinjal genome by mapping a set of 115 PCR-based orthologous markers, including 110

COSII markers. The map shows that brinjal and tomato genomes differentiated by 24

inversions and 5 chromosomal translocations (Wu et al. 2009b; Wu et al. 2010). This

high-resolution synteny map provided a platform for cross-reference of genetic and

genome information and facilitate applied and basic research in brinjal.

First effort of large scale EST sequencing was carried out in brinjal by Fukuoka

et al. in 2010. More than 60,000 cDNA clones from various tissues and treatments of

brinjal were sequenced and 16000 unigenes were generated. Based on functional

annotations it showed that a distribution of functional categories are almost similar to

tomato, while 1316 unigenes were suggested to be brinjal specific. Earlier 14,000

clones were sequenced from SSR enriched genomic libraries out of which 1,054 SSR

markers were designed. An brinjal linkage map was constructed using 214 segregating

SSR markers in an intraspecific mapping population (Nunome et al. 2009). Further

Restriction-site Associated DNA (RAD) approach was used through Illumina DNA

sequencing for rapid and mass discovery of both SNP and SSR markers for brinjal

(Barchi et al. 2011). In this study 17.5 Mb of RAD tags were generated and arranged in

to 78,000 contigs from a pair of mapping parents genomic DNA of brinjal. Along with

these 10,000 SNPs and nearly 1,000 InDels were discovered and 2,000 SNPs mapped

by Illumina GoldenGate assay. About 2,000 putative SSR markers were also

discovered from this data. Further RNA-Seq approach was used for sequenced the

transcriptomes of brinjal and turkey berry and this information provides a foundation

for further investigations of brinjal biology (Yang et al. 2014).

In brinjal few studies related to genetic engineering like the introduction of new

genes, resistance to biotic and abiotic stress, secondary metabolites production and

nutritional quality of fruits were carried out. So far Bt endotoxin (Arpaia et al. 1997)

and parthenocarpy (Rotino et al. 1997; Jelenkovic et al. 1998; Kumar et al. 1998) genes

have been successfully introduced in brinjal. The combination of somaclonal variation,

somatic hybridization, haploid production and genetic transformation has also been

reported in brinjal (Acciarri et al. 2002).


Chapter II

Brinjal fruit is non-climacteric in nature. Unlike tomato, ethylene production

remained low during whole fruit development period (Rodriguez et al. 1999;

Collonnier et al. 2001). The phenolics, minerals, dry matter and protein content vary

from accessions to accessions in brinjal (Raigon et al. 2008). But the most fascinating

thing about brinjal is a large range of variation present for fruit morphology. It produce

fruits with many different shapes and sizes after full development and it ranges from a

few grams or centimetres to more than 1 kg or up to 60 cm in length (Kumar et al.

2008; Gangopadhyay et al. 2010). Even during domestication and evolution of the

brinjal in China, the size, shape and taste were principal fruit quality aspects where the

cultivation of brinjal took place from 1st century BC (Wang et al. 2008). The fruit size

is changed from small to large, the taste changed from not palatable to what was termed

at the time sweetish, and a wider variety of fruit shapes was cultivated. Doganlar et al.

(2002b) used QTL analysis and showed that fruit size of the brinjal was controlled

primarily by only two loci (fw2.1 and fw9.1) on linkage groups 2 and 9, fruit shape

primarily controlled by two loci (fs2.1 and fs7.1) on linkage groups 2 and 7 and fruit

prickliness and colour determined primarily by a single locus on linkage group 6

(lp6.1), and a major locus on linkage group 10 (fap10.1, pa10.1), respectively. They

also observed that fruit taste of weedy forms are bitter than advanced cultivars with

large fruit. A genetic divergence in 98 accessions for fruit traits along with morpho-

agronomic characters were studied in Solanum melongena, S. aethiopicum and S.

macrocarpon (Polignano et al. 2010).

Functional genomics approaches have been widely used in recent years to

understand the fruit development mechanism in plants. Candidate genes involved in

fruit development have been identified, characterized, and assessed for their

comparative transcriptional activity by using whole genome sequencing or expressed

sequence tag (EST) libraries. Several research studies focussed to identify various

metabolic pathways involved in fruit development and ripening of tomato and potato.

However, very less work has been carried out to identify genes governing the brinjal

fruit development. The accumulation of genomic information about brinjal will not

only facilitate genetics and molecular breeding methodology in brinjal itself but also

make it as a valuable and unique member of the solanaceae plant group, for

comparative biological studies of genetics, physiology, development, and evolution.


Chapter II

Therefore, in the present study attempt was made to identify genes governing the fruit

size, shape and colour across the fruit developmental stages starting from initial fruit

development (0 dpa) to ripening stage (50 dpa) by comparing the two varieties Pusa

Purple Long (PPL) and Killikulam-1 (KKM-1), which differ in their fruit size, shape

and colour. Reciprocal SSH libraries were generated from five different fruit

developmental stages in each variety to identify variety and tissue specific genes. Thus,

the EST set developed in this study is novel and represents genes that are differentially

regulated in response to fruit development in two brinjal varieties.

2.2 MATERIALS AND METHODS

2.2.1 Plant material

Two brinjal varieties, Pusa Purple Long (PPL) and Killikulam-1 (KKM-1) were

used in the current investigation. These varieties differ in their fruit size, shape and

colour. Fruit of PPL is elongated in shape with small diameter and purple in colour,

where as KKM-1 is round in shape with double diameter than PPL and white in colour.

Seeds of PPL were obtained from Division of Vegetable and Horticulture crops, Indian

Agricultural Research Institute, New Delhi where as seeds of KKM-1 received from

Agricultural College and Research Institute, Killikulam, Affiliated by Tamil Nadu

Agricultural University, Tamilnadu, India. To obtain fully grown plants, seeds of both

varieties were germinated in pots containing a soil mixture (peat: sand: pumice, 1:1:1,

v/v/v) and grown in National Phytotron Facility at IARI, New Delhi under same growth

conditions (24oC at 16/8 hours light/dark cycle at 80% humidity). Fertile flowers from

both varieties were tagged after anthesis and fruit samples were collected from more

than three different plants at 0, 10, 20, 30 and 50 day post anthesis ( dpa) (Figure 2.1).

Collected fruit samples were frozen in liquid nitrogen immediately, and stored at -80o C

until total RNA isolation.

2.2.2 Extraction of total RNA and cDNA synthesis

RNA was isolated from 5 fruit developmental stages of both varieties. Tissues

from three or more independent fruit samples collected were pooled to isolate RNA and

considered as one biological replicate to minimize plant to plant variation. For 20, 30

and 50 dpa fruits, vertical slices, representing all fruit parts of from three or more fruits

were used.


Chapter II

Figure 2.1: Fruit development stages of brinjal (PPL and KKM-1).


Chapter II

Total RNA was isolated using SpectrumTM Plant Total RNA Kit (Sigma, USA)

according to the manufacturer's protocol. During RNA purification on-column DNase

treatment was given for removing trace amount of DNA. RNA was quantified by both

NanoDrop 1000 Spectrophotometer (Thermo Scientific, USA) and gel electrophoresis

on a 1.2% denaturing agarose gel. Quality of total RNA was assessed by checking 200-

300 ng of total RNA on a RNA Nano Chip using an Agilent Bioanalyzer 2100 (Agilent

technologies, USA) (Figure 2.2). Purified total RNA from all samples reverse

transcribed to cDNA using SMARTerTM Pico PCR cDNA Synthesis Kit (Clontech,

USA), following the manufacturer's instructions (Figure 2.3).

2.2.3 Subtractive cDNA library construction

To identify variety and tissue-specific transcripts related to fruit size, shape and

colour, 10 subtractive cDNA libraries were constructed. PCR-SelectTM cDNA

Subtraction Kit (Clontech, USA) was used for Suppression Subtractive Hybridization

(Figure 2.4). The tester and driver cDNA populations were digested with the restriction

enzyme RsaI to obtain short, blunt-ended fragments. The tester pool was then divided

into two populations. One population was ligated to adaptor-1 and the other to adaptor

2R. Each tester pool was then hybridized with an excess of driver cDNA, and the two

reactions were mixed together for a second hybridization (Figure 2.5).

Fragments in tester (PPL) cDNA, but not in the driver (KKM-1) cDNA, were

then specifically amplified after primary and secondary PCRs for PPL specific genes

and vice-versa for KKM-1 specific genes (Figure 2.6). The subtracted double stranded

cDNA were purified by the MinElute PCR purification kit (Qiagen, USA) and ligated

into pGEM-T easy vector (Promega, USA) by T4 ligase. The ligation mix was

transformed into Escherichia coli DH5α by electroporation at 1700 KV, cultured

overnight in 37oC after directly applying onto a media plate with ampicillin 100 mg/l,

50 mg/l X-gal and 50 mg/l IPTG for blue-white selection (Figure 2.7). After plating

onto LB media plates, the white colonies were picked and glycerol stocks were

prepared in LB freezing medium. Microtitre plates of 96 wells were used to store

glycerol stock. Plates were wrapped in plastic wrap and incubated overnight at 37oC.

Next day, plates were sealed with platemax aluminium sealing film (Axygen, USA)

and stored at -80o C till further use.


Chapter II

Figure 2.2: RNA quality and quantity checking by using denatured agarose gel and bioanalyzer 2100.


Chapter II

Figure 2.3: Schematic diagram of SMARTer cDNA synthesis preparation

Figure 2.4: Schematic diagram of PCR-Select cDNA subtraction library preparation


Chapter II

Figure 2.5: Preparing adaptor-ligated tester cDNAs for hybridization and PCR

Figure 2.6: Overview of the PCR-Select SSH library results


Chapter II

2.2.4 PCR amplification and sequencing

The insert cDNAs were amplified by PCR using nested PCR primers (Nested

PCR primer 1: 5'-TCGAGCGGCCGCCCGGGCAGGT-3' and Nested PCR primer

2R: 5'-AGCGTGGTCGCGGCCGAGGT-3') provided in the PCR-Select cDNA

Subtraction Kit (Clontech, USA). Reactions were performed for 30 cycles of

denaturation at 95oC for 60s, annealing at 70oC for 60s, and extension at 72oC for

1 min, followed by a final 7 min extension at 72oC. 3µl of each reaction was

fractionated in an agarose gel electrophoresis (1%) to confirm amplification quality and

quantity (Figure 2.8).

The PCR products were cleaned-up prior to sequencing by Exo-SAP treatment,

an enzymatic purification method (Exonuclease I and Shrimp Alkaline Phosphatise-IT,

USB). 2µl of Exo-SAP IT was added to 5µl of each reaction mixer and incubated at

37oC and followed by 80oC to inhibit the enzymatic activity. The purified PCR product

is used for sequencing with reverse nested primer (Nested PCR primer 2R). Reactions

were performed for 30 cycles of denaturation at 96oC for 10s, annealing at 55oC for 5s,

and extension at 60oC for 4 min. Sequencing was performed using BigDye v3

sequencing premix at 3730xl DNA sequencer machine (Applied Biosystems, USA)

(Figure 2.9; Table 2.1; Figure 2.10).

2.2.5 Sequence assembly and analysis

All EST sequences obtained from 10 libraries, 5 from PPL and 5 from

KKM-1were checked for quality and then analyzed by Seqman (DNA STAR,

Lasergene 10) to detect and remove pGEMT-Easy vector sequences, low quality bases

and adaptor sequences. EST sequences less than 100bp long were removed. Manual

sequence removal was also carried out to improve quality of assembly. ESTs from

individual libraries were assembled into contigs and singletons using default

parameters of Seqman. Incorporation of ESTs in to a contig required at least 95%

sequence identity and a minimum 40-bp overlap. ESTs from all 10 libraries were

assembled separately as well as in combined way for different purposes.


Chapter II

Figure 2.7: Selection of transformed colonies based on blue and white selection

Figure 2.8: Screening of SSH library by colony PCR. A. Plasmid isolated from overnight grown E.coli (DH5-α) culture. B. Colony PCR analysis of SSH library


Chapter II

Figure 2.9: 3730xl sequencer machine (Applied Biosystem, USA)

Figure 2.10: Sanger sequencing principle


Chapter II

2.2.6 Sequence annotation, Functional categorization and GO enrichment

analysis

The NCBI BLAST program version 2.2.6 was used to perform BLASTN and

BLASTX similarity searches. BLASTN analysis was performed to determine sequence

homology at the nucleotide level of this unigene set with EST databases of

S.tuberosum, S.lycopersicum, Capsicum annuum, Nicotiana tabacum and also with

ESTs of model plant species such as Arabidopsis thaliana and Oryza sativa

downloaded from NCBI. The cut-off expectation (E) value threshold for BLASTN

searches was ≤1e-10 with bit score >250. BLASTX was performed against NCBI non-

redundant (nr) database using Blast2GO Version 3 (Conesa et al. 2005), following the

standard procedure of BLASTX for unigenes dataset (parameters: nr database, high

scoring segment pair (HSP) cut-off length 33, report 5 hits, maximum E-value 1.0E-3),

followed by mapping and annotation (parameters: E-value hit filter 1.0E-6, annotation

cut-off 55, GO weight 5, HSP-hit coverage cut-off 20). GO terms were summarized

according to their molecular functions, biological process, and cellular components.

Enzyme mapping of annotated sequences was performed by using direct GO to

Enzyme mapping and used to query the Kyoto Encyclopaedia of Genes and Genomes

(KEEG) to define the KEEG orthologs (KOs). These KOs were then plotted in to the

whole metabolic atlas by using the KEGG mapping tool (Okuda et al. 2008). GO

enrichment analysis was performed by using the Fisher exact test, as implemented in

the GOSSIP module (Bluthgen et al. 2005) integrated in Blast2GO package. For GO

enrichment analysis, all GO terms with a cut-off threshold of pFDR (p) ≤ 0.05 were

considered differentially enriched between 2 set of EST libraries. To study the variety-

specific response for PPL and KKM-1, GO enrichment analysis was performed

between ESTs developed from the SSH libraries.

To identify the putative transcription factors in differentially expressed ESTs,

the brinjal EST sequences were compared with Sol Genomics Network database

(http://solgenomics.net/) using TBLASTX with E- value cut off ≤ e−10 and also

compared with Arabidopsis transcription factor database (http://plntfdb.bio.uni-

potsdam.de, version 3.0) using BLASTX with E value cut off ≤ e−10. Further to identify

the transcripts involved in phytohormone biosynthesis and signal transduction

pathways, consensus sequences of differentially expressed ESTs were searched using


Chapter II

BLASTX (E- value ≤ e−10) against amino acid sequences of Arabidopsis hormone

database (http://ahd.cbi.pku.edu.cn, version 2.0).

2.2.7 SSR detection from ESTs

Simple sequence repeats (SSR) motifs were identified using WebSat software

(http://purl.oclc.org/NET/websat/) (Martins et al. 2009). All ESTs from 10 libraries

were considered for the SSR identification. Both perfect and imperfect mono, di-, tri-,

tetra-, penta- and hexanucleotide motifs were targeted. Primer pairs were designed from

the flanking sequences using PRIMER3 software (Rozen and Skaletsky 2000) in batch

mode, as implemented in the WebSat package. The target amplicon size range was set

as 100-400bp, the optimal annealing temperature was kept 60oC, and the optimal

primer length was 20bp.

2.2.8 Quantitative Real-Time RT PCR

Quantitative real-time PCR primers were designed using Primer Quest software

(http://eu.idtdna.com) based on corresponding sequences generated in this study (Table

2.2). Primers designed with following parameters: optimum GC content of 50%, primer

Tm of 60oC, primer length 18-30 nucleotides, and an expected amplicon size of 80-200

bp. ESTs data was validated using two step qRT-PCR. First strand cDNA was

synthesized from 1μg of total RNA using Affinity Script qPCR cDNA synthesis kit

(Agilent Technologies, USA). qRT-PCR was performed using the Brilliant-III SYBR

Green qPCR master mix in Stratagene MX 3005P (Agilent Technologies, USA)

detection system. The qRT-PCR was performed under the following program; 5 min at

95oC, followed by 40 cycles of amplification with 30s of denaturation at 95oC, 30s of

annealing at 60oC and 30s of extension at 72oC. All qPCR reactions were run in

triplicates along with a no template control. Finally, a melting curve analysis was

performed from 65oC to 95oC in increments of 0.5oC, each lasting 5s, to confirm the

presence of a single product and absence of primer-dimers. The relative expression

level of each gene was calculated by the 2− (ΔΔCt) and Sm APRT (Adenine

phosphoribosyl transferase 1, JX448345.1) gene was used as housekeeping gene to

normalize the variations in cDNA samples.


http://purl.oclc.org/NET/websat/

http://www.ncbi.nlm.nih.gov/pubmed/?term=Martins%20WS%5Bauth%5D

http://eu.idtdna.com/

Chapter II

Table 2.1: Master mix of sequencing PCR

Table 2.2: Primers used for Quantitative Real-Time PCR.

S. No. Components required for sequencing PCR

1 DNA (Plasmid, PCR product etc.

2 Primer (Forward/Reverse)

3 4 dNTPs

4 4 dideoxy terminator nucleotides (4 ddNTPs)

fluorescently labeled with 4 different dyes

5 Enzyme buffer containing Mg++, K+

Library Name Accession No.

Annotation (sequence homology)

Primer sequence (5'→3') Product length

Sm20PPL04A01 JZ716953 Lipoxygenase F:GACCAGTGTATCTGGGATATGTG 117bp R:TGATGAAGTAGTTGTCCATGCT Sm10PPL01F01 JZ716693 Dioxygenase F:GATGACCTTACTCAGCCTTCTC 121bp R:GTTGGAACATAGCGCCAATC Sm0KKM1 01B08 JZ715521 Putative puroindoline b

protein F:TCCGAGACCAGCGTAACATAC 120bp

R:CATTAAGAGGCGGGCAAAGA Sm0KKM1 02B02 JZ715560 Putative splicing factor Prp8 F:GATCTGCTTACTGACCACTTACA 107bp R:GGTCAGTCAAGATCCAGCATTA Sm10PPL11B12 JZ716824 Cytosolic nucleoside

diphosphate kinase F:TCCCAGACCATAGCAACAAC 102bp

R:TGCATTTGCTGAGAAGCATTAC Sm10PPL01F06 JZ716697 Chlorophyll a-b binding

protein 3C F:CCGTTGAGGGATACCGTATTG 102bp

R:CTGGATCATCAGCAAGACCTAAT Sm10PPL01D11 JZ716689 Pectin methyl esterase F:CCCAACCAGCTGGATCAATAA 109bp R:CCAGTCGTGGACGAATTCAA Sm10PPL01C06 JZ716681 P40-like protein F:ATTGCGCCTCAGGGATTT 110bp R:GGAGCAAGAAGAGGAAGTAGTG Sm10PPL02A08 JZ716719 LOX11_Linoleate 9S-

lipoxygenase 1 F:TGGCGTTCGTTTACTGATAGAG 119bp

R:TCTCTTCGTCCGATCCATAGT Sm20KKM1 03B07 JZ715896 Proteinase inhibitor

precursor F:CTATGGAATTTGCCCACTTTCAG 139bp

R:TTCAGGGTCAGATTCTCCTTTG Sm50PPL02E05 JZ717350 Similar to aquaporin F:GGACTCACCAATGGGTATACTG 97bp R:CGCTCATGAGTGTGGCTAAT


Chapter II

2.3 RESULTS

To investigate fruit development in brinjal with respect to identify fruit-specific

and tissue-specific genes, two different varieties of brinjal i.e. PPL and KKM-1 which

are different in their size, shape and colour have been selected. Fruits of PPL are

elongated in shape and purple in colour where as fruits of KKM-1 are round in shape

and white in colour. Ten SSH libraries (5 from each variety) in PPL and KKM-1 at

various fruit developmental stages representing initial fruit set (0 dpa), fruit elongation

(10 dpa), fruit maturation (20 dpa), complete fruit growth (30 dpa) and veraison

(50 dpa). These libraries were further used for sequencing of ESTs, preparation of

assemblies and gene annotation.

2.3.1 Subtractive cDNA libraries

Subtractive cDNA libraries were constructed by considering PPL as tester and

KKM-1 as driver to obtain PPL specific genes in each fruit developmental stage and

vice versa to get KKM-1 specific genes (Figure 2.11). This process was carried out for

all five fruit developmental stages (0, 10, 20, 30 and 50 dpa) to enrich variety and tissue

specific transcripts. For five forward libraries, namely A, B, C, D and E, cDNA from

PPL at 0, 10, 20, 30 and 50 dpa were used as tester and respectively cDNA from KKM-

1 at 0, 10, 20, 30 and 50 dpa were used as drivers, and vice versa for the KKM-1

specific F, G, H, I and J libraries (Table 2.3).

PCR-SelectTM cDNA Subtraction Kit (Clontech, USA) was used for the

subtraction. All cDNA libraries of brinjal were cloned in the pGEM T-Easy vector

(Promega, USA). The primary titer of the constructed cDNA libraries were around

1.4X106 pfu/mL, while the recombination rate was about 97.5%, and the distribution of

insert size in all libraries was about 1.0-2.0kb based on random PCR analysis of 30

clones from each library. These results indicated that the constructed brinjal cDNA

libraries were of high quality (high titer, high recombination rate and optimum inserted

fragments). Before large scale sequencing, PCR reaction was initially conducted with

nested PCR primers provided in the PCR-Select cDNA Subtraction Kit (Clontech,

USA) to check the size of inserted fragments using random selection of 30 clones. A

total of 3840 clones were randomly picked and subjected to sequencing from all ten

libraries of PPL and KKM-1 including 1920 from PPL and 1920 from KKM-1.


Chapter II

Figure 2.11: Brinjal fruit developmental stages considered for SSH library construction Table 2.3: Brinjal fruit developmental stages considered for SSH library preparation.

Name of the library Tester Driver Library A 00 dpa PPL 00 dpa KKM-1 Library B 10 dpa PPL 10 dpa KKM-1 Library C 20 dpa PPL 20 dpa KKM-1 Library D 30 dpa PPL 30 dpa KKM-1 Library E 50 dpa PPL 50 dpa KKM-1 Library F 00 dpa KKM-1 00 dpa PPL Library G 10 dpa KKM-1 10 dpa PPL Library H 20 dpa KKM-1 20 dpa PPL Library I 30 dpa KKM-1 30 dpa PPL Library J 50 dpa KKM-1 50 dpa PPL


Chapter II

2.3.2 Sequencing and Assembly

All 3840 colonies were first amplified by M13 Forward and reverse primers of

pGEM T-Easy vector and further checked on agarose gel for the presence of amplicons.

Exo-SAP treatment was given to all amplicons and then directly used for sequencing.

2,122 sequences were used for final assembly after removing vector, tailing and poor-

quality sequences. First sequences were assemble library wise, details of which are

described in Table 2.4. Further, 1114 sequences from all PPL specific libraries were

assembled in 125 contigs (containing 2 or more ESTs in each contig) and 558

singletons (containing only 1 EST) whereas 1008 sequences from KKM-1 specific

libraries were assembled in 82 contigs and 468 singletons. The average length of ESTs

without vector was 400-450bp. All together the clustering of ESTs generated 207

contigs and 1026 singletons, yielding total 1233 unigenes. The composition of ten

subtractive libraries shows that the number of differentially expressed sequences varied

from a minimum of 46 to a maximum of 232 per library (Figure 2.12). The redundancy

of the library was calculated as 49.08% [(1-Number of Unigenes/Number of ESTs) ×

100%]. The overlapping of unigenes with adjacent stages was carried out for each

variety (Figure 2.13). It ranges from minimum overlapping of 1 unigene in between

10 dpa and 20 dpa of PPL and 0 dpa and 10 dpa of KKM-1 to maximum overlapping of

20 unigenes in 30 dpa and 50 dpa in PPL variety. In variety PPL, 8 unigenes were

common in 0 and 10 dpa libraries, 1 unigenes were common in 10 and 20 dpa libraries,

3 unigenes were common in 20 and 30 dpa libraries, and 20 unigenes were common in

30 and 50 dpa libraries. Similar way 1, 16, 12 and 4 unigenes were common in

respective adjacent stages in KKM-1. Figure 2.14 showed the distribution of ESTs in

unigenes after assembling all ESTs from five stages single variety together. EST data

were submitted to the NCBI and their accession numbers are dbEST JZ715513-

JZ717572 and JZ722901-JZ722962.

2.3.3 EST annotation and functional classification

All contigs and singletons were annotated by Blast2Go software. Around 75%

of the BLAST hits of the brinjal fruit sequences showed similarity with genes present

in potato, tomato, tobacco, capsicum, brinjal, carrot, maize and soybean genomes, with

more than 5 hits per species considering top hit for analysis (Figure 2.15).


Chapter II

Table 2.4: Summary of ESTs derived from PPL and KKM-1 of Brinjal.

Figure 2.12 Summary of the number of unigenes in ten cDNA libraries from two different varities (PPL and KKM-1) of brinjal.

Library No. of plates

sequenced

Sequences taken to assembly

Sequences in

assembly

Unigenes Contigs Singletons

Library A 4 384 151 128 9 119 Library B 4 384 269 80 45 35 Library C 4 384 87 46 2 44 Library D 4 384 300 197 24 173 Library E 4 384 307 232 45 187

Total in PPL 20 1920 1114 683 125 558 Library F 4 384 140 93 8 85 Library G 4 384 158 99 23 76 Library H 4 384 231 113 20 93 Library I 4 384 231 184 20 164 Library J 4 384 248 61 11 50

Total in KKM-1 20 1920 1008 550 82 468 All libraries 40 3840 2122 1233 207 1026


Chapter II

Figure 2.13: Overlapping of unigenes detected in ten cDNA libraries from two different varieties ( PPL (a) and KKM-1 (b)) of Brinjal.

Figure 2.14: Distribution of Brinjal PPL and KKM-1 ESTs among unigenes.


Chapter II

Figure 2.15: BLAST hits as retrieved from NCBI databases. Number of BLAST hits retrieved from NCBI databases and their

distribution among different plant species and different organisms. It is worthy to note that the majority of BLAST hits were recorded for Potato, Tomato, Grapevine, Tobacco, Black cotton, Capsicum, Caster oil, Barrel medic and Soybean, while only 16 were the entries identified for Brinjal.


Chapter II

Only 13 BLAST hits showed homology with brinjal genes out of which 8 were

from PPL and 5 were from KKM-1. The Blast2GO allowed the annotation of the

expressed sequences according to the terms of the three main Gene Ontology

vocabularies, i.e. biological process, molecular function and cellular compartments.

These are shown in Figure 2.16. More than 20 categories were found in PPL and KKM-

1 for the biological process vocabulary, biological, metabolic, cellular, cellular

metabolic, organic substance, primary metabolic, biosynthetic, macromolecule and

response to stimulus processes most represented. Categories namely localization and

establishment of localization are more represented in KKM-1 than PPL (Figure 2.16

A). Concerning the molecular function, the most represented categories were those of

molecular function, followed by catalytic activity, binding, ion binding,

oxidoreductase activity, transferase activity and hydrolase activity. Although

numerically less represented, it is worth to mention the presence of enzyme regulator

activity, peptidase activity and protein binding are more represented in KKM-1 than

PPL (Figure 2.16 B). As far as cellular compartments are concerned, the most

represented are cellular component, cell, cell part, intracellular, intracellular part,

organelle, intracellular organelle, cytoplasm and cytoplasmic part with more than 50%

of the total annotations, followed by organelle lumen, intracellular organelle part,

nuclear lumen, nucleolus, mitochondrion and golgi apparatus (Figure 2.16 C).

Differentially expressed genes involved in various metabolic and/or

biosynthetic pathways under fruit development were identified using the KEGG

database included in Blast2GO software. 2,122 ESTs were used for identification of

statistically enriched pathways at each stage in two different verities of brinjal (Table

2.5, Table 2.6, Table 2.7 and Table 2.8). Carbohydrate, fatty acid, amino acid and

secondary metabolites related pathways were differentially regulated in both PPL and

KKM-1 varieties. Starch and sucrose metabolism, pentose and glucuronate

interconversions, glyoxylate and dicarboxylate metabolism, linoleic and α-linolenic

acid metabolism, glycerolipid and glycerophospholipid metabolism, tryptophan

metabolism, phenylalanine metabolism, steroid hormone biosynthesis, methane

metabolism were found to be induced at different stages of brinjal fruit development.


Chapter II

Figure 2.16: GO terms distribution in two different varieties of brinjal (PPL and KKM-1). GO terms distribution in the biological process (A), molecular function (B), and cellular components (C) vocabularies.


Chapter II

Table 2.5: List of enzymes involved in carbohydrate metabolism along with the library of origin of the correspondent EST clones.

Metabolic pathways Enzyme Enzyme ID 0 dpa 10 dpa 20 dpa 30 dpa 50 dpa P K P K P K P K P K Amino sugar and nucleotide sugar metabolism Hexosaminidase EC:3.2.1.52 Y Amino sugar and nucleotide sugar metabolism Chitodextrinase EC:3.2.1.14 Y Y Y Citrate cycle (TCA cycle) Carboxykinase (ATP) EC:4.1.1.49 Y Citrate cycle (TCA cycle) Dehydrogenase (acetyl-transferring) EC:1.2.4.1 Y Fructose and mannose metabolism Aldolase EC:4.1.2.13 Y Glycolysis / Gluconeogenesis Carboxykinase (ATP) EC:4.1.1.49 Y Glycolysis / Gluconeogenesis Dehydrogenase (NAD+) EC:1.2.1.3 Y Glycolysis / Gluconeogenesis Kinase EC:2.7.2.3 Y Glycolysis / Gluconeogenesis Dehydrogenase (acetyl-transferring) EC:1.2.4.1 Y Glycolysis / Gluconeogenesis Aldolase EC:4.1.2.13 Y Glycosaminoglycan degradation Hexosaminidase EC:3.2.1.52 Y Glyoxylate and dicarboxylate metabolism Carboxylase EC:4.1.1.39 Y Y Y Y Glyoxylate and dicarboxylate metabolism Equilase EC:1.11.1.6 Y Y Y Y Y Pentose and glucuronate interconversions Pectin demethoxylase EC:3.1.1.11 Y Y Y Y Y Y Y Pentose and glucuronate interconversions Dehydrogenase (NAD+) EC:1.2.1.3 Y Pentose and glucuronate interconversions Lyase EC:4.2.2.2 Y Y Pentose phosphate pathway Aldolase EC:4.1.2.13 Y Starch and sucrose metabolism Synthase (UDP-forming) EC:2.4.1.12 Y Y Y Y Starch and sucrose metabolism Pectin demethoxylase EC:3.1.1.11 Y Y Y Y Y Y Y Starch and sucrose metabolism Pectin depolymerase EC:3.2.1.15 Y Starch and sucrose metabolism Diphosphatase EC:3.6.1.9 Y


Chapter II

Table 2.6: List of enzymes involved in fatty acid metabolism along with the library of origin of the correspondent EST clones.

Metabolic pathways Enzyme Enzyme ID 0 dpa 10 dpa 20 dpa 30 dpa 50 dpa

P K P K P K P K P K

Alpha-Linolenic acid metabolism 13S-lipoxygenase EC:1.13.11.12 Y Y Y

Alpha-Linolenic acid metabolism Hydratase EC:4.2.1.17 Y

Alpha-Linolenic acid metabolism A1 EC:3.1.1.32 Y

Arachidonic acid metabolism Peroxidase EC:1.11.1.9 Y

Glycerolipid metabolism Lipase EC:3.1.1.3 Y

Glycerolipid metabolism Dehydrogenase (NAD+) EC:1.2.1.3 Y

Glycerolipid metabolism O-acyltransferase EC:2.3.1.22 Y

Glycerolipid metabolism Lipase EC:3.1.1.23 Y Y

Glycerophospholipid metabolism A1 EC:3.1.1.32 Y

Glycerophospholipid metabolism Lecithinase B EC:3.1.1.5 Y

Glycosphingolipid biosynthesis - ganglio series Hexosaminidase EC:3.2.1.52 Y

Glycosphingolipid biosynthesis - globo series Hexosaminidase EC:3.2.1.52 Y

Linoleic acid metabolism 13S-lipoxygenase EC:1.13.11.12 Y Y Y


Chapter II

Table 2.7: List of enzymes involved in amino acid metabolism along with the library of origin of the correspondent EST clones.

Metabolic pathways Enzyme Enzyme ID 0 dpa 10 dpa 20 dpa 30 dpa 50 dpa P K P K P K P K P K Aminoacyl-tRNA biosynthesis Ligase EC:6.1.1.19 Y Arginine and proline metabolism Decarboxylase EC:4.1.1.50 Y Y Arginine and proline metabolism Dehydrogenase EC:1.2.1.19 Y Arginine and proline metabolism Dehydrogenase (NAD+) EC:1.2.1.3 Y Arginine and proline metabolism Transaminase EC:2.6.1.1 Y Arginine and proline metabolism Acid amidohydrolase EC:3.5.1.14 Y Ascorbate and aldarate metabolism Dehydrogenase (NAD+) EC:1.2.1.3 Y Ascorbate and aldarate metabolism Peroxidase EC:1.11.1.11 Y Beta-Alanine metabolism Decarboxylase EC:4.1.1.15 Y Y Beta-Alanine metabolism Dehydrogenase EC:1.2.1.19 Y Beta-Alanine metabolism Dehydrogenase (NAD+) EC:1.2.1.3 Y Beta-Alanine metabolism Hydratase EC:4.2.1.17 Y Butanoate metabolism Decarboxylase EC:4.1.1.15 Y Y Butanoate metabolism Hydratase EC:4.2.1.17 Y Cysteine and methionine metabolism Decarboxylase EC:4.1.1.50 Y Y Cysteine and methionine metabolism S-adenosylhomocysteine synthase EC:3.3.1.1 Y Cysteine and methionine metabolism Oxidase EC:1.14.17.4 Y Y Cysteine and methionine metabolism Transaminase EC:2.6.1.5 Y Cysteine and methionine metabolism Adenosyltransferase EC:2.5.1.6 Y Glutathione metabolism Transferase EC:2.5.1.18 Y Y Glutathione metabolism Peroxidase EC:1.11.1.9 Y Phenylalanine metabolism Lactoperoxidase EC:1.11.1.7 Y Y Y Y Y Y Phenylalanine metabolism Hydratase EC:4.2.1.17 Y Phenylalanine metabolism Ligase EC:6.2.1.12 Y Phenylalanine metabolism Transaminase EC:2.6.1.9 Y Phenylalanine, tyrosine and tryptophan biosynthesis Synthase EC:4.1.3.27 Y Y Phenylalanine, tyrosine and tryptophan biosynthesis Transaminase EC:2.6.1.9 Y Phenylalanine, tyrosine and tryptophan biosynthesis Dehydratase EC:4.2.1.10 Y Phenylalanine, tyrosine and tryptophan biosynthesis Dehydrogenase EC:1.1.1.282 Y Phenylpropanoid biosynthesis Lactoperoxidase EC:1.11.1.7 Y Y Y Y Y Y Phenylpropanoid biosynthesis Ligase EC:6.2.1.12 Y Taurine and hypotaurine metabolism Decarboxylase EC:4.1.1.15 Y Y Tryptophan metabolism Dehydrogenase (NAD+) EC:1.2.1.3 Y Tryptophan metabolism Equilase EC:1.11.1.6 Y Y Y Y Y Tryptophan metabolism Hydratase EC:4.2.1.17 Y Tyrosine metabolism Transaminase EC:2.6.1.9 Y


Chapter II

Table 2.8: List of enzymes involved in secondary metabolites biosynthesis and metabolism along with the library of origin of the correspondent EST clones.

Metabolic pathways Enzyme Enzyme ID 0 dpa 10 dpa 20 dpa 30 dpa 50 dpa

P K P K P K P K P K Aminobenzoate degradation Hydratase EC:4.2.1.17 Y Aminobenzoate degradation Phosphatase EC:3.1.3.2 Y Aminobenzoate degradation Nitrophenyl phosphatase EC:3.1.3.41 Y Y Drug metabolism - cytochrome P450 Transferase EC:2.5.1.18 Y Y Drug metabolism - other enzymes Ali-esterase EC:3.1.1.1 Y Y Y Y Y Y Y Metabolism of xenobiotics by cytochrome P450 Transferase EC:2.5.1.18 Y Y Methane metabolism Aldolase EC:4.1.2.13 Y Various types of N-glycan biosynthesis Hexosaminidase EC:3.2.1.52 Y Nicotinate and nicotinamide metabolism Diphosphorylase (carboxylating) EC:2.4.2.19 Y Nicotinate and nicotinamide metabolism Diphosphatase EC:3.6.1.9 Y One carbon pool by folate Synthase EC:2.1.1.45 Y One carbon pool by folate Reductase [NAD(P)H] EC:1.5.1.20 Y Other glycan degradation Hexosaminidase EC:3.2.1.52 Y Pantothenate and CoA biosynthesis Diphosphatase EC:3.6.1.9 Y Steroid degradation Dehydrogenase EC:1.1.1.145 Y Steroid hormone biosynthesis Dehydrogenase EC:1.1.1.145 Y Taurine and hypotaurine metabolism Decarboxylase EC:4.1.1.15 Y Y Ubiquinone and other terpenoid-quinone biosynthesis

Ligase EC:6.2.1.12 Y Y

Various types of N-glycan biosynthesis Hexosaminidase EC:3.2.1.52 Y


Chapter II

Sol Genomics Network database (http://solgenomics.net/) and Arabidopsis

transcription factor database (http://plntfdb.bio.uni-potsdam.de) were used to search

differentially expressed fruit specific transcription factors in PPL and KKM-1. The

maximun gene expression was observed for MIKC and MYB type in KKM-1 whereas

ERF, WRKY and MYB types in PPL. Genes representing B3, C2H2, RAV, TALE and

Trihelix were observed only in KKM-1 whereas genes representing ARF, bHLH, bZIP,

DBB, GeBP, NAC and ZF-HD observed only in PPL variety (Figure 2.17).

Phytohormones, such as, Auxins, ABA, brassinosteroids (BR), cytokinins (CK),

ethylene (ET), gibberellins (GA), JA, SA related differentially expressed transcripts

under fruit developmental stages were identified using Arabidopsis Hormone Database

(AHD, http://ahd.cbi.pku.edu.cn). During fruit initiation, elongation and ripening

stages, a large number of ABA responsive transcripts followed by those responsive to

AUXIN, ETHYLENE, GA, JA, BR, SA and CYTOKININS were highly expressed

(Figure 2.18).

2.3.4 Development of Genic SSR markers

A set of functional microsatellite (SSR) markers was identified from present

data, via in silico analysis of SSH cDNA sequences. From 1233 EST sequences, 12

simple sequence repeats containing candidate genes were recovered (Table 2.9). Five of

these sequences have di-nucleotide motifs whereas six have tri-nucleotide motifs. One

sequence has both di- as well as tri-nucleotide motif. The repetition of motifs were

from 6 to 10 times. AT and CTT motif found more as compare to other motifs.

Suitable primers were designed for SSR markers using Websat software.

2.3.5 Validation of differentially expressed genes by qRT-PCR

To confirm the expression profile of differentially expressing genes in PPL and

KKM-1 varieties Quantitative Real-Time PCR (qRT-PCR) was carried out at all fruit

developmental stages and compared it with leaf (PPL+KKM-1). Along with all fruit

developmental stages 5 dpa was also included in qRT-PCR analysis in both varieties

(Figure 2.19).


http://solgenomics.net/

http://plntfdb.bio.uni-potsdam.de/

Chapter II

Figure 2.17: Number of ESTs encoding putative transcription factors at various fruit development stages of PPL and KKM-1.

Figure 2.18: Number of ESTs involved in phytohormone signaling at various fruit development stages of PPL and KKM-1


Chapter II

Figure 2.19: Validation of EST data using qRT-PCR during fruit development stages (0, 5, 10, 20, 30 and 50 dpa) in two different varieties of brinjal (PPL and KKM-1). Y-axis represents the log2 fold change values at various stages in the PPL and KKM-1 varieties as compared to their leaf.


Chapter II

Table 2.9: EST-SSR identified from Brinjal ESTs.

F is the forward and R is the reverse primer.

EST Accession No. Repeat motif Primer sequence Tm(°C) Expected product(bp)

SM00KKM01B12 (AAG)6 F: ATTTTGAGGCGATTTGTAGAGC 59.763 238 R: TCACGTTCTATCATTTTCTCCG 59.225 SM00PPL05G03 (CAC)8 F: TATGAGGAAGGAATTGAAGGGA 59.903 297 R: TTGATATTCTGAGGAGGAAGCA 58.928 SM20PPL03G12 (CT)7 F: GTGTCTTCAGTCCTTTATTCTTTGG 59.611 393 R: AGCCTGATTCTCTATGGCAAAC 59.752 SM30KKM04B10 (CTT)6 F: GGAACCAAGGAAGATGATTTGA 60.299 316 R: ATCAGCAACAGGGTAGGAAGAA 60.13 SM30PPL05D11 (CTT)7 F: CATGGGGAAGTAGGGAGTTGTA 60.234 321 R: AGGAAAAGGAAGAGCACTGATG 59.886 SM50KKM03F02 (AT)8 F: ATGGTTCCTGTTTGTGGAAAAG 60.254 215 R: GCGGATGAAGAAGAAGAAGAAG 59.615 SM50KKM04A07 (AGA)10 F: AATTCATCCCTTCTCTTCTCCC 59.912 285 R: TAAATGGGCCTGTATTTCTTGG 60.194 SM50PPL02G02 (AC)7 F: ACATGGGGACACTCCAACTTC 61.196 346 R: TTTCCAAGCAAGAGGAGGATTA 60.197 SM50PPL03H07 (AT)6 F: GAACAAGAATGGGCAAAACTC 58.684 178 R: GAAGAAGAAGAAGAAGAAGGGG 57.78 SM50PPL04G02 (CTT)7 F: ATGGTTCCTGTTTGTGGAAAAG 60.254 368 R: TAGGTTGGACTTGATGCAGATG 60.132 SM50PPL04H04 (AT)6, (CTT)7 F: ATGGTTCCTGTTTGTGGAAAAG 60.254 222 R: ATATGGCGGATGAAGAAGAAGA 60.061 SM50PPL05B07 (AC)8 F: ACATGGGACACTCCAACTTCA 60.415 143 R: TGTTTCCATTTGTTACCAGCAC 59.904


Chapter II

Eleven candidate genes on the basis of maximum ESTs with differential

expression in studied varieties were selected for the validation. These genes are

lipoxygenase, dioxygenase, putative puroindoline b protein, putative splicing factor

Prp8, cytosolic nucleoside diphosphate kinase, Chlorophyll a-b binding protein, pectin

methyl esterase, P40-like protein, Linoleate 9S-Lipoxygenase 1, proteinase inhibitor,

similar to aquaporin. For all genes, the qRT-PCR results were generally in accordance

with the SSH expression data.

2.4 DISCUSSION

Fruit development and ripening is a complex phenomenon unique to plant

species. It is highly coordinated, genetically programmed and irreversible process

which involves a series of physiological, biochemical and organoleptic changes alter

the fruit colour, size, aroma, shape and nutritional values. These changes are a

combination of events, which are under strict genetic control and influenced by several

environmental conditions (Guo et al. 2011; Yu et al. 2012; Seymour et al. 2013). The

current available information regarding the physiology, biochemistry and molecular

biology of fruit development and ripening of brinjal, a non-climacteric fruit, is very

limited. To gain detail insights in to molecular mechanism of brinjal fruit development

and ripening, 10 reciprocal SSH libraries from five stages were prepared from varieties

PPL and KKM-1which are distinct from each other in fruit shape, size and colour. In

the present study 2122 ESTs from five fruit developmental stages were generated from

both varieties, to identify the tissue and variety specific genes.

A large number of the genes identified varied in their level of expression over

the course of fruit development and ripening in studied varieties, reflecting the

occurrence of a massive genetic re-programming in studied varieties of brinjal. These

genes expressed in a stage-specific manner, which implicates their involvement in

physiological process which takes place only at specific developmental stages (Table

2.10). This study extended our understanding of the global and dynamic changes during

brinjal fruit development and ripening.


Chapter II

Table 2.10: Selected list of relevant candidate genes function during fruit development in brinjal

Gene Function 0 dpa 10 dpa 20 dpa 30 dpa 50 dpa

P K P K P K P K P K 1. Cell division s-adenosylmethionine decarboxylase proenzyme Y s-adenosylmethionine partial Y Auxin response factor 5 Y Auxin-responsive protein iaa16 Y Auxin-induced protein 15a-like Y 2. Floral development Agamous-like mads-box protein agl9 homolog Y Mads-box protein Y SEPALLATA1-like MADS-box Y Glucan endo- -beta-glucosidase Y Cyanidin-3-o-glucoside 2-o-glucuronosyltransferase-like Y Scopoletin glucosyltransferase-like Y Homeobox-leucine zipper protein athb-15 Y Leucine-rich repeat receptor-like serine threonine-protein kinase bam1 Y Probable polygalacturonase-like Y Ubiquitin-like partial Y Plasma membrane-associated cation-binding protein 1-like isoform x1 Y Y UDP-glycosyltransferase 74f2-like Y Profilin Y Y Y Trans-resveratrol di-o-methyltransferase-like Y Y 3. Fruit development Heat shock cognate protein 80 Y Heat shock protein 90 Y Y Heat shock protein 70 Y Y Y Y Heat shock factor-binding protein 1-like Y Heat shock protein hsp70- partial Y Heat shock cognate 70 kda protein 2-like Y Y Y Y Benzyl alcohol o-benzoyltransferase-like Y Glucan endo- -beta-glucosidase Y Probable xyloglucan endotransglucosylase hydrolase protein 8-like Y Cyanidin-3-o-glucoside 2-o-glucuronosyl transferase Y Protein nim1-interacting 2-like Y Rpm1-interacting protein 4-like Y Aquaporin tip1-1-like Y Y Y Aquaporin pip2-1-like Y Aquaporin pip2-4-like Y Armadillo beta-catenin repeat family protein Y Proline dehydrogenase mitochondrial-like Y NADH dehydrogenase Y Pyruvate dehydrogenase e1 component subunit mitochondrial-like Y


Chapter II

Cytosolic glyceraldehyde-3-phosphate dehydrogenase Y Mitogen-activated protein kinase kinase 9-like Y Phosphoenolpyruvate carboxykinase Y Serine threonine-protein kinase-like protein at1g28390-like Y Serine-threonine kinase Y Serine threonine-protein kinase 16-like Y Serine-threonine kinase Y Tubulin alpha Y Copper chaperone Y Vacuolar protein 8-like Y Vacuolar-processing enzyme-like Y Y Protein phosphatase 2c 37-like Y 3a. Transport V-type proton atpase subunit e1-like Y V-type proton atpase 16 kda proteolipid subunit Y ATP synthase subunit delta mitochondrial-like Y V-type proton atpase 16 kda proteolipid subunit c1 Y Aquaporin pip2-1-like Y Aquaporin pip2-4-like Y Aquaporin tip1-1-like Y Y Y Major intrinsic protein 2 Y Y Y 3b. Pigmentation ABC transporter F family member 1-like Y Y Y ABC transporter g family member 11-like Y Glutathione s-transferase t1-like Y Y Y Glutathione s-transferase l1-like Y Glutathione peroxidase Y Lactoylglutathione lyase Y Glutamate decarboxylase Y Glutaredoxin family Y Monothiol glutaredoxin- mitochondrial Y Monothiol glutaredoxin-s9-like Y Acetyl- -benzylalcohol acetyltransferase-like Y Y Benzyl alcohol o-benzoyltransferase-like Y Phenylalanine ammonia-lyase Y 4-coumarate-- ligase 1 Y Anthranilate synthase beta subunit Y Senescence-specific cysteine protease sag39-like Y Cysteine protease Y Cysteine protease inhibitor 8-like Y Cysteine proteinase inhibitor b-like Y Cysteine proteinase inhibitor 5-like Y Y Phosphopantothenate--cysteine ligase 2-like Y 4. Fruit ripening Agamous-like mads-box protein agl9 homolog Y MADS-box protein Y


Chapter II

P is PPL and K is KKM-1

Sepallata1-like mads-box Y Probable polygalacturonase-like Y 4a. Ethylene S-adenosylmethionine decarboxylase proenzyme Y S-adenosylmethionine partial Y S-adenosylmethionine decarboxylase uorf Y Y Y Y 1-aminocyclopropane-1-carboxylate oxidase Y Y Calmodulin Y Y 4b. Cell wall modification Proline dehydrogenase mitochondrial-like Y 14 kda proline-rich Y Y Y Y Late embryogenesis abundant hydroxyproline-rich glycoprotein isoform 1 Y Fasciclin-like arabinogalactan protein 1 Y Fasciclin-like arabinogalactan protein 10-like Y Probable xyloglucan endotransglucosylase hydrolase protein 8-like Y Xyloglucan endotransglucosylase hydrolase protein 9 Y Y Y Xyloglucan endotransglucosylase-hydrolase xth7 Y Xyloglucan galactosyltransferase katamari1 homolog Y Xyloglucan:xyloglucosyl transferase, putative Y Xyloglucan endotransglycosylase Y Probable polygalacturonase-like Y Pectate lyase Y Probable pectate lyase 5 Y Y Pectin methylesterase Y Y Y Y Y Probable pectinesterase 53 Y Probable pectinesterase pectinesterase inhibitor 34 Y Probable pectinesterase pectinesterase inhibitor 12 Y Expansin partial Y Expansin 2 Y Probable xyloglucan endotransglucosylase hydrolase protein 8-like Y Xyloglucan endotransglucosylase-hydrolase xth7 Y Xyloglucan endotransglucosylase hydrolase protein 9 Y Y Y Xyloglucan endotransglycosylase Y Glucan endo- -beta-glucosidase 11-like Y Beta-galactosidase 3-like Y Y 4c. Aroma Trans-resveratrol di-o-methyltransferase-like Y Y Methyltransferase-like protein Y S-adenosyl-l-methionine:salicylic acid carboxyl methyltransferase Y Acetyl- -benzylalcohol acetyltransferase-like Y Y Benzyl alcohol o-benzoyltransferase-like Y Cytochrome p450 76a2-like Y


Chapter II

Differences present in initial floral tissue and organ development are

responsible for final size and shapes of the fruits. Flowers are produced in the plants

through floral meristem activity and this is different from vegetative meristem. MADS

box C-, D-, and E-type proteins are responsible for flower determinacy within the floral

meristem to control the stem cell population. To regulate the process of flower and

ovule development, Inhibitor of Meristem Activity (IMA) gene encoding a mini zinc

finger (MIF) protein from tomato was reported (Hu and Ma 2006; Sicard et al. 2008).

In present data mini zinc finger protein 2-like was expressed in 10 dpa PPL and KKM-

1, may be this gene is involved in ovule development. To control the number of carpels

during the floral development, IMA inhibits cell proliferation during floral termination

and act as a repressor of the meristem organizing centre gene WUSCHEL. MADS-box

genes are ubiquitous among eukaryotes and play fundamental roles in floral

determination and fruit development (Shore and Sharrocks 1995). Seven MADS-box

genes from apple fruit were expressed and suggested the role of MADS-box genes in

flower and fruit development (Yao et al. 1999). Indeed, several MADS-box genes

characterized in tomato fruit ripening (http://ted.bti.cornell.edu) (Giovannoni 2004). In

our data, we found MADS-box encoded gene, mads-box transcription factor 6-like in

0 dpa of KKM-1, agamous-like MADS-box protein agl9 homolog in 10 dpa KKM-1 of

MADS-box protein present in 20 dpa of KKM-1 and SEPALLATA1-like MADS-box

gene in 50 dpa PPL. Differential expression of these MADS-box genes suggest its role

in fruit bulging in KKM-1. Plant reproductive development is affected by zinc finger

motif containing nucleic acid binding proteins (Takatsuji 1998). In Arabidopsis stamen

and carpel identity is regulated by HUA1, a cch-type zinc-finger protein and an

RNA-binding protein (Li et al. 2001). In the present data, zinc finger ccch domain-

containing protein 29-like gene is expressed at 0 dpa of KKM-1 and 30 dpa of PPL,

zinc finger protein 2 is expressed at 20 dpa of KKM-1, zinc finger hit domain-

containing protein 2 is expressed at 30 dpa of KKM-1 and b-box type zinc finger

family protein is expressed at 0 dpa of PPL and it may be involved in stamen and carpel

formation.

WRKY zinc-finger transcription factors also have been shown to be involved in

trichome and seed coat development (Eulgem et al. 2000; Johnson et al. 2002). In


Chapter II

present experiment probable WRKY transcription factor 40 is expressed in 30 dpa of

KKM-1 and WRKY transcription factor is expressed at 50 dpa of PPL.

Phytohormones such as auxin and gibberellic acid play a major role in fruit

development and for the co-ordination of cell division and expansion during the early

stages of this process (Gillaspy et al. 1993). However, fruit set is regulated by not only

positive growth factors, but also by negative regulators (Vivian-Smith et al. 2001).

Auxin response factors (ARFs) are transcriptional activators and repressors which

binds to the specific site TGTCTC present in promoters of primary or early auxin

response genes (Guilfoyle and Hagen 2001). In parthenocarpic transgenic lines, auxin-

regulated cell division phase was bypassed and fruit growth mainly depended on cell

expansion (Marti et al. 2007). In the year 2011, Jong et al. developed transgenic tomato

plants containing SlARF7 and observed that during fruit growth SlARF7 mRNA levels

was decreased and both auxin and gibberellic acid responses were increased. It

produced parthenocarpic (seed less) fruits which looked like heart shape, containing

pseudoembroys, thick pericarp and empty locules. In 2009, Pascual et al. suggested that

SlARF7 may only regulate auxin signalling pathway involved in tomato fruit set and

development and the expression of other auxin-related genes such as SlARF9, SlIAA2

and SlIAA14 requires for pollination and fertilization. Ethylene and ABA also plays an

important role in regulation of fruit set and development through a complex network

(Vriezen et al. 2008; Pascual et al. 2009; wang et al. 2009; Xiao et al. 2009). In this

present study Auxin responsive factor 5 was expressed in 0 dpa of PPL, it may be

involved in fruit set of brinjal where as auxin-induced protein 15a-like and auxin-

responsive protein iaa16 was expressed in 30 dpa KKM-1, which may be involved in

further growth of brinjal fruit.

Both, early enlargement of the brinjal fruit driven by cell expansion and latter

ripening process requires the presence of expansins to loosen the cell walls (Brummell

et al. 1999). Expansins induces the plant cell wall extension by disrupting non covalent

interactions between hemicellulose and cellulose micro fibrils. Several genes encoding

expansins were detected in the present study and their expression was higher at the


Chapter II

latter stages of fruit development and ripening. Expansin partial and expansin 2 genes

present in 30 dpa PPL may contribute for its elongated shape of PPL fruit.

A major group of the differentially expressed genes during brinjal fruit

development and ripening are involved in cell wall modification, as major textural

changes associated with the softening of fruit are due to enzyme-mediated alterations in

the structure and composition of the cell wall. Changes in the activity of several cell

wall-related genes were known to result in the abnormal development of fruit sac (Yu

et al. 2012). Pectins and hemicelluloses typically undergo solubilisation and

depolymerisation during the fruit softening, which contribute to cell wall loosening and

disassembly (Wakabayashi 2000). During the green stages, solid synthesis of methyl-

esterified pectin and the increase in cell number and volume underline the presence of

high pectin methylesterase activity at early stages in fruit (Draye and Van Cutsem

2008). In fruit softening, pectin methylesterase plays an important role due to the

hydrolysis of methyl ester groups in cell wall pectins. Cacao et al. (2012) studied the

CaPME4 mRNA expression in coffee plant and suggested that pectin methylesterase

activity increases progressively from initial stage until the end of fruit ripening. Similar

observations were also reported in several other fruit crops including kiwifruit, papaya,

avocado and peach (Redgwell et al. 1990; Paull et al. 1999; Wakabayashi et al. 2000;

Brummell et al. 2004). In our data, cell wall-related genes like pectin methylesterase,

probable pectinesterase 53, probable pectinesterase pectinesterase inhibitor 34 and

probable pectinesterase pectinesterase inhibitor 12 were observed. Pectin methyl

esterase was expressed only in 0 dpa of PPL where as in 10 and 30 dpa of both PPL and

KKM-1, probable pectinesterase 53 was expressed in 20 dpa of PPL, probably

pectinesterase inhibitor 34 expressed in 30 dpa PPL, probable pectinesterase inhibitor

12 expressed in 30 dpa of KKM-1. In tomato, the gene for pectin esterase was highly

expressed prior to ripening, and was down-regulated by ethylene as ripening begins

(Giovannoni 2004). Since brinjal is non-climacteric, expression of the gene encoding

the pectin esterase genes expressed up to 30 dpa and down regulated during the

ripening (50 dpa) stage in both PPL and KKM-1. The hemicellulose xyloglucan is a

common component of the cell wall, and is hydrolysed and transglycosylated by

xyloglucan endotransglycosylase hydrolase in growing tissues and ripening fruits


Chapter II

(Catala et al. 2001). In the present investigation xyloglucan endotransglucosylase

hydrolase protein 9 was expressed in 10 dpa PPL and KKM-1 where as xyloglucan

endotransglycosylase was expressed in 50 dpa PPL. Likewise probable xyloglucan

endotransglucosylase hydrolase protein 8-like was expressed in 30 dpa of KKM-1 and

xyloglucan:xyloglucosyl transferase, putative and xyloglucan endotransglucosylase-

hydrolase xth7 were expressed in 30 dpa of PPL. It was suggested that

polygalacturonase, a cell wall degrading enzyme, mRNA of which is developmentally

regulated during tomato fruit ripening (Penna et al. 1986). In current data, probable

polygalacturonase-like gene was expressed in 30 dpa of KKM-1, exactly the colour of

KKM-1 fruit which turn yellow from egg white and fruit get little soften. Expression of

cell wall related enzymes in fruit development and ripening indicate its probable role in

cell wall degradation during fruit maturation and ripening related changes.

Aquaporins or major intrinsic proteins have a central role in metabolism in fruit

cells and determining fruit size through water transport in to fruit cells and vacuoles.

The aquaporin family is mainly classified in to four subfamilies: plasma membrane

intrinsic protein (PIP), tonoplast intrinsic protein (TIP), NOD26-like intrinsic protein

(NIP) and small basic intrinsic protein (SIP) (Johanson et al. 2001; Gupta and

Sankararamakrishnan 2009). An over-expression of tomato PIP, a ripening associated

protein (TRAMP) showed little effect on acid and sugar balance, where as suppression

of TRAMP increases organic acids and decreases sugars (Shiratake and Martinoia

2007). In our data, plasma membrane intrinsic protein 1b was present in 30 dpa PPL;

major intrinsic protein 2 was present in 10, 20 and 30 dpa of KKM-1. Recent studies

suggested that role of aquaporins in transportation of other molecules than water like

CO2, H2O2, glycerol, ammonia and boron (Tyerman et al. 2002). Aquaporin related

genes like probable aquaporin TIP1-1 present in 10, 20 dpa of KKM-1 and 50 dpa of

PPL, probable aquaporin pip-type ptom75 was present in 10, 20 dpa PPL, 30 dpa PPL,

and 20 dpa KKM-1, aquaporin pip2-1-like was present in 30 dpa KKM-1 and

aquaporin pip2-4-like gene is present in 50 dpa of PPL. This shows delayed expression

of these genes in PPL as compared with KKM-1. Over ally, water channel proteins are

highly expressed in KKM-1 which may be a cause of bulged and round shape of KKM-

1. In our study, ABC transporter F family member 1-like was expressed in 0, 50 dpa of


Chapter II

PPL and 30 dpa in KKM-1variety. ABC transporters of multidrug resistance-associated

protein (MRP) subfamily along with glutathione transferases are anthocyanin

transporters and these might be implicated in fruit pigmentation in PPL.

For fruit quality the vacuole is important organelle because of its large size and

the compounds stored in vacuole at high concentration responsible for taste and flavour

such as sugars, organic acids and secondary metabolites. Secondary metabolites such as

phenolics, main flavonoids, terpenoids and alkaloids are the main compounds

responsible for flavours and tastes of fruits. Secondary metabolites responsible for

flavours are often unique to particular fruit but sugars and organic acids are common in

many fruits. This material is to be transported in to the vacuole by a specific

transporters such as proton pumps, aquaporins, sugars, organic acid and secondary

metabolite transporters (Shiratake and Martinoia 2007). Fruit specific vacuolar H+-

ATPase (V-ATPase) has unique properties that increases fruit size and contributes to

fruit enlargement and accumulation of sugar and organic acids (Muller et al. 1996;

Muller et al. 1997). Amemiya et al. (2006) developed antisense-transgenic tomato

plants, in which the V-ATPase was suppressed specifically in fruits and resulting

tomato fruits were smaller in size with less number of seeds. V-ATPase gene

expression and protein level changes in phytohormone treated fruit tissue, suggesting

that phytohormones regulate V-ATPase synthesis. In our data v-type proton atpase

subunit e1-like, v-type proton atpase 16 kda proteolipid subunit is present in 20 dpa of

KKM-1 and V-type proton atpase 16 kda proteolipid subunit C1 present in 50 dpa of

PPL. This differential expression of V-ATPases may contribute to differential fruit

sugar and/or organic acid accumulation. In fruit, alcohol dehydrogenases involved in

aroma volatiles biosynthetic pathway by inter converting aldehydes to alcohols and to

form the esters for substrates and expressed in developmental tissues particularly

during fruit ripening (Speirs et al. 1998; Speirs et al. 2002; Echeverria et al. 2004). In

both climacteric and non-climacteric fruit, ethylene is regulated same alcohol

dehydrogenases (Tesniere and Verries 2000; Moyano et al. 2004;Tesniere et al. 2004).

In the present experiment quinone oxidoreductase-like protein 2 homolog was

expressed in 50 dpa PPL and this gene may be involved in aroma production during

fruit ripening.


Chapter II

Ripening physiology has been classically defined as either ‘climacteric’ or

‘non-climacteric’. Climacteric fruits show a sudden increase in respiration at the onset

of ripening, usually in concert with increased production of the gaseous hormone

ethylene. Whereas, non-climacteric fruits do not increase respiration at ripening, and

often have no requirement for ethylene to complete maturation. The responsiveness of

some non-climacteric fruits to ethylene, particularly in the area of colour development,

is well documented (El-Kereamy et al. 2003). In the present data observed that ethylene

synthesis related genes like 1-aminocyclopropane-1-carboxylate oxidase 1 in 30 dpa

KKM-1 and 50 dpa PPL, s-adenosylmethionine partial, s-adenosyl-l-

methionine:salicylic acid carboxyl methyltransferase and ethylene-responsive

transcription factor rap2-4-like in 50 dpa PPL and ethylene-responsive transcription

factor 5-like in 30 dpa KKM-1. Based on these observations ethylene may be playing

some role in brinjal, a non-climacteric fruit at least some aspects of ripening and also

differentially in these two varieties. Although it is observed that there is no sudden

increase in ethylene content in brinjal fruits (Raigon et al. 2008).

SSRs also identified from obtained EST data. Microsatellites (SSRs) are short

tandem repeats of simple (1–6nt) motifs, and their value for genetic analysis lies in

their multi-allelism, codominant inheritance, relative abundance, genome coverage and

suitability for high-throughput PCR-based platforms (Powell et al. 1996). Earlier it was

long believed that SSRs were associated only with non-coding DNA, but now it is

clear that they are also present in the coding region of the genome (Toth et al. 2000;

Morgante et al. 2002). These SSRs are commonly referred to as "genic SSRs" or "EST-

SSRs" and are present in 1 to 5% of the expressed plant DNA sequence. They provide a

powerful means to link the genetic maps of related species, and since many of them are

located within genes of known or at least putative function, any allelic variation present

can be exploited to generate perfect markers (Andersen and Lubberstedt 2003). Very

few reports have been available to determine the genetic diversity in brinjal at the

cDNA level. As for the other Solanaceae crop species (potato, tomato and pepper), the

level of intra-specific polymorphism appears to be rather limited, and so it is important

that an effort is made to develop more informative cDNA markers to make progress in

understanding the genetics of brinjal and to advance its breeding. In this study, the


http://www.ncbi.nlm.nih.gov/pubmed/?term=T%26%23x000f3%3Bth%20G%5Bauth%5D

Chapter II

abundance of SSRs in two varieties PPL and KKM-1 showing the motifs AC/CT/TG,

and AAG/AGA/CTT/CAC/ATT were the predominant di-, and tri-nucleotide SSRs,

respectively. The majority of di- and tri-nucleotide SSRs contained 6–10 repeats. The

comprehensive SSR survey data presented here demonstrates the potential of in silico

mining of ESTs for rapid development of SSR markers for genetic analysis and

applications in solanaceae crops.

2.5 CONCLUSION

The present study has provided a dynamic view of the transcriptome analysis

during fruit development and ripening stages of brinjal in two morphologically distinct

varieties of PPL and KKM-1. Reciprocal subtractive cDNA libraries in 5

developmental stages in both varieties provide tissue and variety specific genes. Cell

wall biosynthesis, carbohydrate metabolism, TCA cycle, and carotenoid biosynthesis

were all differentially regulated during fruit development and ripening. These

differentially regulated processes may well be important for the pleiotropic fruit trait of

brinjal PPL and KKM-1. The set of brinjal EST-SSR markers was informative for

phylogenetic analysis and genetic mapping. Since EST-SSRs lie within expressed

sequence, they have the potential to serve as perfect markers for genes determining

variation in phenotype.


Chapter III

Evaluation of suitable reference genes for normalization of qRT-PCR gene expression during fruit development stages in Brinjal (Solanum melongena L.)

3.1 INTRODUCTION

Brinjal (Solanum melongena L.) also called eggplant or aubergine is a major

Solanaceous crop and fourth most consumed vegetable fruit globally after potato,

pepper and tomato. According to FAO (http://www.fao.org/statistics/en/) 2012

statistics, China and India are the major countries of brinjal production. The availability

of genome sequence and transcriptome data will greatly facilitate molecular biology

studies in brinjal (Collonnier et al. 2001; Doganlar et al. 2002; Kumar et al. 2008;

Nunome et al. 2009; Fukuoka et al. 2010; Polignano et al. 2010; Barchi et al. 2011).

Gene profiling or expression analysis is an effective and widely used approach

to elucidate the complex regulatory networks of the genetic, signaling and metabolic

pathways underlying developmental, biological and cellular processes in biological

organisms including plants. Northern blotting, reverse northern, ribonuclease protection

assay, semi-quantitative RT-PCR, DNA microarrays and real time-quantitative PCR

(qRT-PCR) have all been applied in the analysis of gene expression (Rieu and Powers

2009; Guenin et al. 2009; Le et al. 2012; Imai et al. 2014). Real-time quantitative

reverse transcription PCR (qRT-PCR) has become the preferred method for the

validation of high-throughput arrays and transcriptome results of large sample sets, for

a limited number of genes, because of its outstanding advantages of speed, sensitivity,

specificity, accuracy and reliability (Bustin 2002; Vandesompele et al. 2002; Gachon et

al. 2004; Nolan et al. 2006; Kubista et al. 2006; Cassan-wang et al. 2012; Yeap et al.

2014). However, the accuracy of qRT-PCR generated results depends on accurate

transcript normalization using stably expressed reference genes, which allows the

regulation of possible non-biological variations when the reference genes and genes of

interest are exposed to the same preparation processes (Dheda et al. 2005; Gutierrez et

al. 2008). Unstable reference genes if used for normalization, can dramatically change

the expression pattern of a given target gene, and introduce flaws in results and thereby,


http://www.fao.org/statistics/en/

Chapter III

understanding of gene function (Gutierrez et al. 2008; Ferguson et al. 2010; Kong et al.

2014). Therefore, before carrying out qRT-PCR analysis, identification of appropriate

reference genes is essential and should be standardized for expression relative to the

test samples (Guenin et al. 2009).

Housekeeping genes are constitutively expressed in all tissues to maintain

cellular functions (Watson et al. 1965; Warrington et al. 2000). Genes the most

frequently used as references in qRT-PCR studies include Ubiquitin, elongation factor,

GAPDH, Actin, 18S rRNA and Tubulin. Moreover, they are presumed to produce

minimally essential transcripts necessary for normal cellular physiology. However, the

expression level of the housekeeping genes may vary among tissues or cells and may

alter under certain circumstances (Silver et al. 2006). On the other hand, the highly

specific tissue expression of a gene indicates that the gene performs a tissue-specific

function (Kouadjo et al. 2007).

No validated reference genes have been reported so far for normalization of

gene expression during fruit development in brinjal. In this study, twenty-one candidate

reference genes from brinjal or those validated in other crops were selected, and their

transcripts were quantified in the fruit developmental stages by qRT-PCR. Most

commonly used statistical algorithms involves the use of normalizing to more than one

housekeeping gene, where an algorithm based computer program, geNorm is used to

determine the most stable control genes from a panel of candidate housekeeping genes

via a stepwise exclusion or ranking process, and this is then followed by geometric

averaging of a selection of the most stable control genes (Vandesompele et al. 2002).

Other software-based approaches include NormFinder, an add-in for Microsoft Excel,

which adds the NormFinder functionality directly to the Excel software package. So in

order to address these problems it is critically necessary to select the best internal

reference gene to monitor the accurate gene expression with great precision (Andersen

et al. 2004).

The reliability of the identified reference genes was further validated by

analyzing the expression patterns of lipoxygenase family genes during fruit

development in brinjal using the stable and unstable genes for normalization. The


Chapter III

results provide valuable information for suitable reference selection in gene expression

studies in brinjal.


3.2.1 Plant materials and growth conditions

Seeds of brinjal (Solanum melongena L.) variety Pusa Purple Long (PPL) were

procured from the National Seed Corporation of India, New Delhi, India. Seeds were

washed three times with tap water, and then sown in plastic pots filled with composite

Soilrite in a growth chamber with a 16 h light/ 8 h dark photoperiod at 28 ± 2 °C day/

night temperatures, relative humidity 80% and irrigated daily with water and Hoagland

solution on alternate days. Flowers were hand-pollinated at anthesis (percentage of fruit

set 90%). Samples were collected at 0, 5, 10, 20, 30 and 50 days post anthesis ( dpa)

(Table 3.1; Figure 3.1). For 0 and 5 dpa samples (n= 30) buds were stripped of sepals,

petals and style but otherwise not further dissected. For samples taken at 10, 20, 30 and

50 dpa (n=5) whole fruit was sampled with only the sepals removed. Fruits were

vertically divided into two equal parts and one part was used for total RNA isolation.

All samples were frozen in liquid nitrogen at the time of harvest and then stored at

-70 °C. for subsequent RNA extraction.

3.2.2 Total RNA isolation, quality control and cDNA synthesis

Frozen samples were ground to fine powder in liquid nitrogen using a mortar

and a pestle. Total RNA was isolated using SpectrumTM Plant Total RNA kit (Sigma,

USA), to remove any traces of genomic DNA, then treated with DNase I (Sigma, USA)

according to the manufacturer’s protocol. The purity and quantity of RNA was

monitored on 1.2% denatured agarose gels and NanoDrop 1000 Spectrophotometer

(Thermo Scientific, USA). The quality and quantity of total RNA were assessed by

checking 300 ng of total RNA on a RNA Nano Chip using an Agilent Bioanalyzer 2100

(Agilent technologies, USA) according to the manufacturer’s instructions. For each

sample, 1 µg of total RNA was reverse transcribed using the Affinity Script qPCR

cDNA Synthesis Kit (Stratagene, Agilent Technologies, USA) in a 20µl reaction using

oligodT and Random primers according to manufacturer’s instructions. The cDNAs

were diluted 1:10 with nuclease-free water prior to the qPCR analysis.


Chapter III

Figure 3.1: Strategy for the identification of reference genes for qRT-PCR normalization in Brinjal (Solanum melongena L.).


Chapter III

Table 3.1: Reference samples evaluated in this study

Group Sample no. Materials

Fruit developmental stages

1 Leaf

2

0 dpa

3 5 dpa

4

10 dpa

5 20 dpa

6

30 dpa

7 50 dpa


Chapter III

3.2.3 Selection of candidate reference genes

A total of 21 candidate reference genes were evaluated. These genes were

chosen based on their previous use in brinjal or their validation as the best reference

genes in other crops, including TC4492 (18S rRNA), TC9855 (Elongation Factor 1

alpha), TC2644 (APRT), TC3622 (Actin), TC5698 (Cyclophilin), TC5340 (Ubiquitin),

TC3464 (L25 ribosomal protein), TC3798 (Beta-Tubulin), TC3930 (Alpha-Tubulin),

TC4490 (GAPDH), TC183 (PP2A), TC13326 (RUBP), TC11691 (TATA binding

protein), TC2063 (RPL8), TC9010 (DNAJ), TC9397 (TIP41), TC829 (SAND), TC6154

(CAC), FS088008 (Expressed sequence), TC1689 (HSP20.2) and TC12362 (Cysteine

Protease) (Table 3.2). For reference genes, cluster alignment was done by using

MEGA software (Figure 3.2).

3.2.4 PCR primer design and test of amplification efficiency

For each candidate reference gene, BLASTN was carried out in the Brinjal

Plant Gene Indices database (compbio.dfci.harvard.edu/tgi/plant.html) against brinjal

coding DNA sequences (CDS). The CDS was uploaded to IDT PrimerQuest software

(http://eu.idtdna.comwebcite) for primer designing with the following parameters:

optimal length 25 base pairs, GC content 50-55%, melting temperature 60 0C, amplicon

length range 100-160 base pairs, maximum self complementary at 3’ end – 5

nucleotides and then checked for the absence of stable hairpins and dimmers using

OligoAnalyzer (Table 3.3). The generated primer pair for each gene was then aligned

against all brinjal CDS to confirm its specificity in silico. All primer sets were checked

for amplification specificity and annealing temperature by RT-PCR using synthesized

cDNA. The specificity of the PCR amplification product for each primer pair was

further determined by electrophoresis using 2% agarose gel. Primer sets that amplified

a single, specific product were chosen for qPCR amplification efficiency test. For each

primer pair, amplification efficiency estimates were derived from a standard curve

generated from a serial dilution of pooled cDNA (1, 10,102, 103, 104, 105 X dilutions;

each gene in triplicate) (Figure 3.3). Mean quantification cycle (Cq) values of each ten-

fold dilution were plotted against the logarithm of the pooled cDNA dilution factor.


Chapter III

Figure 3.2: Cluster alignment of referred genes in Brinjal, Tomato, Potato and

Tobacco


Chapter III

Figure 3.3. Real-time PCR primer efficiency


Chapter III

Table 3.2: Reference genes evaluated in this study S No.

Transcript ID

Symbol Gene name Accession number Function

1 TC4492 18S rRNA 18S ribosomal protein X67238 Constituent of the small ribosomal subunit 2 TC9855 EF1α Elongation factor 1 alpha DQ228328 Protein synthesis 3 TC2644 APRT Adenine phosphoribosyl transferase XM_006361995 Purine nucleotide salvage pathway 4 TC3622 Act Actin XM_004236699 Cytoskeletal protein 5 TC5698 Cyp Cyclophilin DQ235183 Peptidyl prolyl isomerase activity 6 TC5340 Ubi Ubiquitin XM_006344322 Protein degradation 7 TC3464 L25 L25 Ribosomal protein L18908 Cellular process of translation 8 TC3930 α Tub Alpha Tubulin XM_006356736 Major constituent of microtubules 9 TC3798 β Tub Beta Tubulin XM_006339193 Major constituent of microtubules 10 TC4490 GAPDH Glyceraldehyde 3-phosphate dehydrogenase DQ252489 Break down the glucose in glycolysis process 11 TC183 PP2A Protein phosphatase 2A X97913 Oncogenic signaling cascades 12 TC13326 RUBP Ribulose 1,5 bisphosphate XM_004233446 Carbon fixation 13 TC11691 TBP TATA binding protein NM_001288161 Binds specifically to a DNA sequence 14 TC2063 RPL8 Ribosomal protein L8 XM_006362853 Protein synthesis 15 TC9010 DNAJ DNAJ-like protein XM_006365610 Protein folding, transport and cellular function 16 TC9397 TIP4I TIP4I-like family protein XM_006356428 Protein binding 17 TC829 SAND SAND family protein XM_006364519 Endocytosis 18 TC6154 CAC Clathrin adaptor complexes medium subunit XM_006362441 Intracellular trafficking and function 19 FS088008 Expressed Expressed sequence XM_006354841 Gene expression 20 TC1689 HSP20.2 Heat shock protein 20.2 XM_006362602 Abiotic stress 21 TC12362 CysPro Cysteine protease XM_006342320 Ectopic expression of cystatin


Chapter III

Table 3.3: Selected candidate reference genes, primers and different parameters derived from qRT-PCR analysis

S No. Internal Reference Primers (F/R) Amplicon

length (bp) Tm (°C)

PCR efficiency

(%) 1 18S rRNA TGGAGCGATTTGTCTGGTTAAT

AAAGGCCGTAGTCCCTCTAA 109 62

62 78.7

2 EF1α AACCCTCCTTGAAGCTCTTGACCA AGGTCACAACCATACCAGGCTTGA

161 62 62

83.5

3 APRT CCTTAGGTGCTTTCAGTTGAATTAG CAGTAGGAAGAGAGGAGCAAAC

104 62 62

83.2

4 Actin GGAGCATCCAGTCCTTCTAAC CAGTGAGAGTACAGCCTGAATAG

130 62 62

160.2

5 Cyclophilin CCGACGAGAACTTCAAGAAGAA TAGCGGTGCAGATGAAGAAC

102 62 62

80.4

6 Ubiquitin GTTGCAGCTATACTTACATCCATTC CGGTTGTACTCCCGCTTATT

113 62 62

73.0

7 L25 RP TTGACCAGTACAAGGTCCTAATG CATCTTCTTCACGGCATCCT

137 62 62

98

8 α Tubulin ATCCTATGCTCCCGTCATTTC TGGCGAGGATCACACTTAAC

117 62 62

76.8

9 β Tubulin TGGTACACAGGTGAAGGAATG AGCAGTGGCGTCTTGATATT

102 62 62

85.9

10 GAPDH TGACAACTGTCCACGCTATG GTGCTGCTAGGGATGATGTT

109 62 62

171.3

11 PP2A GTGGTTGTTACTGCATCAAAGG GATTTCTCCACCACCGAGTT

107 62 62

135.4

12 RUBP CTGACAATGGTGGACGTATCA TCGGACAAATCAGGAAGGTATG

94 62 62

88.1

13 TATA binding protein CAAGCTACGAGCCAGAACTATT TCTAATCTTGGCACCTGTGATG

113 62 62

94.4

14 RPL8 CGTACTGAGAAACCCATGCTTA GGATGCTCCACAGGATTCATAG

110 62 62

78.9

15 DNAJ GCTCAAAGTGCAAGGGTAAAG GATGGACCAAGCTGTCTGAT

103 62 62

104.9

16 TIP41 ATTCAGTGGGAGGATTGTGAG CAGCCAGTTCATCCTCGTATAA

106 62 62

116.3

17 SAND AATTTGACTCGGACCTCGATAC GAGACAGCTCTTCGGAGTTATG

120 62 62

104.9

18 CAC GGCAGAGCTTGATCCTCTTT CCAGGAACCACTCAAGATACAG

141 62 62

122.2

19 Expressed GCATATTTCAGCCAGCATTCC CAAGCTAAGCAAGCCAAACC

125 62 62

82.7

20 HSP 20.2 GCTCTGCTGACATCTGGTTT AGCTTCCTCTTCCTCCTCTATG

105 62 62

78.9

21 Cysteine Protease GGAGAGAGGCTGGTATTGTTAG AGAGAGATTCCCTTCCCAAATG

124 62 62

80.5

22 Lipoxygenase GACCAGTGTATCTGGGATATGTG TGATGAAGTAGTTGTCCATGCT

117 62 62

98


Chapter III

Only primer sets that amplified with efficiencies above 87% as calculated by

the formula Efficiency (E) = -1+10(-1/slope) were shortlisted, to reduce any error from

different amplification efficiencies in Cq data collections. Data on the selected

reference genes and their amplification characters are listed in Table 3.3.

3.2.5 Quantitative real-time RT-PCR

qRT-PCRs were performed in 96-well plates on a Stratagene MX 3005P

(Agilent Technologies, USA) detection system in a 25 µl reaction volume [containing 1

µl diluted cDNA, 12.5 µl 2 X TaKaRa SYBR Premix Ex TaqTM (TliRNaseH Plus),

0.4 µl each primer] (Figure 3.4). The qRT-PCR was performed under the following

program; an initial denaturation step of 5 min at 95 °C, followed by 40 cycles of

amplification with 30 s of denaturation at 95 °C, 60 s of annealing/ extension at 60 °C.

The dissociation curve was obtained by heating the amplicon from 55 °C to 95 °C

(Figure 3.5). All qPCR reactions were carried out in three biological and three technical

replicates. A non-template control and a non-primer control were also included in each

run for each gene.

3.2.6 Statistical analysis

The stability level of the 21 candidate reference genes from brinjal fruit

developmental stages was determined by using two statistical algorithms, geNorm

(Vandesompele et al. 2002) and NormFinder (Andersen et al. 2004). The geNorm

program generates a stability measure (the M value) for every gene allowing ranking

them according to their expression stability (with lower value indicating increased gene

stability across samples). It also generates a pair-wise stability (v) measure to decide

the benefit of adding extra reference genes for the normalization. NormFinder generates

a stability measure and groups samples to allow direct estimation of expression

variation, ranking genes according to their stability using a model-based approach. Raw

Ct values were converted by the comparative Ct method for both algorithms (Table

3.4). The data for each time post-exposure were analyzed separately.


Chapter III

Figure 3.4: Stratagene Mx3005P qRT-PCR system was used in this study


Chapter III

Figure 3.5: Real-time amplification specificity. Melt curves with single peak

generated for each of the 21 reference genes.


Chapter III

Table 3.4: Values of efficiency ± standard deviation (SD) of the primers of the housekeeping genes and average values of quantification cycle (Cq) ± standard deviation (SD) of biological replicates generated by the Miner to the genes of reference of Brinjal.

S. No

Genes Developmental stages

Leaf 0 dpa 5 dpa 10 dpa 20 dpa 30 dpa 50 dpa 1 18s rRNA 17.11±0.45 15.61±0.40 16.0±0.60 10.68±0.26 11.35±0.57 12.80±0.40 12.92±0.29 2 EF1α 21.16±0.50 18.80±0.43 18.98±0.41 17.09±0.36 17.38±0.14 20.50±0.74 22.58±1.09 3 APRT 29.09±0.79 27.27±0.81 25.77±0.34 24.84±0.13 31.33±0.35 22.89±0.27 29.08±0.28 4 Actin 30.78±0.29 29.89±0.53 28.37±0.40 24.73±0.28 25.44±0.17 30.28±0.28 28.11±0.32 5 Cyclophilin 31.11±0.40 25.61±0.31 30.27±0.25 32.09±0.21 26.47±0.34 26.68±0.29 23.62±0.12 6 Ubiquitin 30.85±0.35 27.69±0.11 29.39±0.29 27.13±0.23 25.0±0.51 38.73±0.23 25.51±0.10 7 L25 RP 26.42±0.57 21.61±0.25 23.32±0.33 20.41±0.13 20.94±0.11 20.36±0.45 22.84±0.46 8 α Tubulin 29.31±0.55 28.51±0.42 27.35±0.22 23.60±0.42 26.62±0.33 22.24±0.17 25.81±0.51 9 β Tubulin 26.48±0.37 23.48±0.51 21.48±0.20 19.59±0.22 20.84±0.20 18.35±0.66 19.16±0.22 10 GAPDH 23.42±0.24 24.61±0.39 22.02±0.65 19.56±0.33 22.45±0.42 23.70±0.23 24.26±0.24 11 PP2A 28.65±0.76 33.21±0.68 27.04±0.26 24.15±0.50 27.09±0.13 24.39±0.51 28.16±0.68 12 RUBP 21.96±0.75 30.88±0.48 23.68±0.31 28.53±0.35 25.89±0.33 24.04±0.23 24.50±0.42 13 TBP 28.91±0.35 28.22±0.18 24.28±0.24 24.16±0.51 23.96±0.33 24.98±0.16 24.25±0.52 14 RPL8 28.14±0.52 23.15±0.34 21.70±0.56 18.86±0.52 19.82±0.70 20.03±0.69 26.15±0.41 15 DNAJ 27.62±0.31 25.61±0.27 25.22±0.80 24.96±0.44 20.78±0.57 23.61±0.29 21.16±0.33 16 TIP4I 27.51±0.43 28.27±0.49 25.36±0.19 22.46±0.09 24.64±0.32 25.65±0.26 24.71±0.16 17 SAND 29.0±0.27 28.90±0.16 26.30±0.35 25.90±0.38 25.47±0.44 25.03±0.40 25.76±0.80 18 CAL 27.94±0.33 25.18±0.65 23.09±0.41 22.87±0.31 23.86±0.67 25.06±0.63 23.40±0.33 19 Expressed 28.22±0.68 25.99±0.57 24.80±0.17 22.61±0.34 24.63±0.32 23.98±0.45 24.15±0.64


Chapter III

3.2.7 Normalization of Lipoxygenase gene

Lipoxygenase genes are involved in number of diverse aspects of plant

development including growth, pest resistance, senescence and responses to wounding.

Expression of the tissue and stress inducible gene, lipoxygenase, was used as a target

gene to demonstrate the usefulness of the validated candidate reference genes in qRT-

PCR. Gene expression levels of lipoxygenase genes were quantified in different fruit

developmental stages using two most stable reference genes for each condition

determined by geNorm and NormFinder in the same qRT-PCR conditions mentioned

above. Primer pairs (Table 3.3) of lipoxygenase gene were also verified by primer

efficiency and melting curve analysis as described for reference genes.

3.3. RESULTS

3.3.1 Source and selection of candidate reference genes and primer design

To identify suitable reference genes for brinjal fruit development, twenty-one

candidate reference genes with a wide range of biological functions, based on previous

citation in public domain and a few traditional house-keeping or reference genes

(Ubiquitin, elongation factor, GAPDH, Actin, 18S rRNA and Tubulin) were selected for

qRT-PCR analysis. The brinjal orthologous genes were obtained by searching for

brinjal CDS using Arabidopsis genes as queries. The best hit for each query was

selected, and the same annotation as that in the Arabidopsis query was found in the

brinjal genome database for each orthologous gene. Information on the selected

reference genes is listed in Table 3.2. During primer designing, the forward and reverse

primers were specifically located on exon region, to prevent the interference of gDNA

contamination on qRT-PCR results. After primer design, for confirming their

specificity, primer pairs were aligned with all eggplant CDS using BLASTN and the

target reference gene was the only output result of BLASTN, the primer pair was

selected.


Chapter III

Table 3.5: geNorm analysis

Gene Name M-Value

Ubiquitin 2.718669246

RUBP 2.488649828

Cyclophilin 2.32170216

APRT 2.152263331

RP L8 2.029119344

EF1 1.944324629

PP2A 1.86431031

DNAJ 1.782575641

GAPDH 1.710723376

Actin 1.649865219

L25 RP 1.58190694

Alpha Tubulin 1.535098656

HSP 20.2 1.485715131

Beta Tubulin 1.419675786

CYSPR 1.344497271

18s rRNA 1.240253182

TIP4I 1.074780774

CAL 1.017163828

Expressed 0.954810917

TBP 0.802131667

SAND 0.802131667


Chapter III

3.3.2 Verification of primer specificity and their amplification particulars

For all the primer pairs melting curve analysis was conducted to confirm the

specific amplification for each reference gene and observed a single peak with no

visible primer-dimer formation and no signals were detected in the no-template controls

(Figure 3.5). The candidate reference genes specificity validated primer sequences and

amplification characters are summarized in Table 3.3. For each primer pair, the

qRT-PCR efficiency was determined by standard curve analysis, ranging from 90% to

100%. For the selected reference genes, the aforementioned results prove that specific

and high-efficiency qRT-PCR systems were established (Figure 3.3; Table 3.3).

3.3.3 Expression profile of the candidate reference genes

By using qRT-PCR, expression levels of all candidate reference genes were

measured in the 7 samples collected from brinjal fruit developmental stages and leaf

under normal growth conditions. We observed that all selected reference genes were

not expressing uniformly across different fruit developmental stages and leaf (Figure

3.6). Differential transcription abundance levels were observed among all 21 genes.

The mean Ct values of the selected reference gene ranged from 10.68-38.73

irrespective of fruit developmental stages and leaf conditions. 18S rRNA (TC4492) and

Ubiquitin (TC5340) genes showed most (Ct = 10.68) and least (Ct = 38.73) abundant

transcripts respectively. Each reference gene had a different expression ranges across

all sample sets. Surprisingly, it is worthy to notice that SAND (TC829) gene was the

most abundant reference gene with least variation irrespective of fruit developmental

stages and leaf. Ubiquitin (TC5340) gene showed much higher expression variation

with mean Ct values ranging from 25.00-38.73 across all sample sets. It is important to

note that there was wide range of variation among selected reference genes and it

shows that not a single reference gene express constantly across whole sample set of

brinjal in present study (Figure 3.7; Figure 3.8). So, it is pivotal importance to choose

the most reliable reference gene for expression profiling of gene/s in different fruit

developmental stages in brinjal.


Chapter III

Figure 3.6: RT-qPCR Ct values for the candidate reference genes. Expression data

displayed as Ct values for each reference gene in Brinjal fruit development (Leaf, 0, 5, 10, 20, 30 and 50 dpa). A line across the box is depicted as the median. The box indicates the 25th and 75th percentiles. Whisker caps represent the maximum and minimum values.

Figure 3.7: Expression pattern of candidate reference genes in Brinjal fruit

developmental stages.


Chapter III

Figure 3.8: Heat map showing expression pattern of reference genes in Brinjal fruit development.


Chapter III

3.3.4 Stability analysis and ranking of reference gene

In order to select the best and most reliable reference genes and rank all

candidate reference genes according to their stability value for accurate gene

expression, the commonly used statistical programs geNorm and NormFinder were

used for analysis. It is important to rank the stabilities of 21 genes and to confirm the

number of reference genes necessary for accurate gene expression profiling under

different fruit developmental stages.

3.3.5 geNorm analysis

geNorm is a visual basic application tool for Microsoft Excel, it generate a

stability measure (the M value) for every gene allowing ranking them according to their

expression stability (with lower value indicating increased gene stability across

samples). It also generates a pair-wise stability measure to decide the benefit of adding

extra reference genes for the normalization. Taking into consideration of data obtained

from different fruit developmental stages and leaf, SAND and TBP were the most stable

genes (M value 0.8021), followed by Expressed (M value 0.9548) (Table 3.5; Figure

3.9).

3.3.6 Minimal number of reference genes for optimal normalization in different

experimental sets

The pair-wise variation (Vn/Vn+1) was analyzed between normalization factors

NFn and NFn+1 to determined the optimal number of reference genes required for

reliable normalization. We found that the optimal number (V) of reference genes,

which differed in each experimental condition but a combination of them, is supposed

to be a reliable reference gene. Accordingly, in tissue type analysis, V10/11 was the

lowest pair-wise variation value of 0.124. So in this case, the hypothetical

normalization factor would be the geometric mean of the ten or eleven more stable

genes (Figure 3.10).


Chapter III

Figure 3.9: Average expression stability values (M) calculated by geNorm in

different fruit developmental stages. Lower average expression stability (M value) indicates more stable expression.

Figure 3.10: Pairwise variation analysis of candidate genes in different fruit

developmental stages. Pairwise variation (V) was calculated by geNorm to determine the minimum number of reference genes required for accurate normalization in different fruit development stages.


Chapter III

In general practice, pair-wise variation analysis gives a minimal number of

genes for effective normalization without compromising affordability and accuracy of

experiment. It means that if pair-wise variation of n reference gene is below

recommended cut-off of 0.15, then adding extra gene will not improve the

normalization (Vandesompele et al. 2002). Our data suggest that in tissue type analysis,

a minimum of 9 (V9/10 value of 0.144) genes are required to normalize the data in

gene expression study (Figure 3.10).

3.3.7 NormFinder analysis

NormFinder is another Excel application. It generates a stability measure and

groups samples to allow direct estimation of expression variation, ranking genes

according to their stability using a model-based approach (Andersen et al. 2004).

NormFinder analysis results were slightly different from geNorm analysis (Table 3.6;

Figure 3.11). However, in the different fruit developmental stages, Expressed and TBP

emerged as the most stably expressed ranked 1st and 2nd, whereas they were ranked 2nd

and 1st, respectively, by geNorm.

It has been evident that the inappropriate reference genes used for target gene

validation can dramatically change the interpretation of the expression pattern (Guenin

et al. 2009). In qRT-PCR, to demonstrate the usefulness of the validated candidate

reference genes, the relative expression level of one brinjal gene, lipoxygenase, was

investigated at different fruit developmental stages, using two stable reference genes

and a unstable gene for normalization, which had been validated by geNorm or

NormFinder as described above. We analyzed and calculated relative expression of

lipoxygenase gene in fruit developmental stages of brinjal by using two stable genes

(i.e. SAND and Expressed) and it was found to be stable. In contrast, when we used

unstable gene (i.e. Ubiquitin), the relative expression was varied significantly. These

differences in the results of assessment of gene expression stability revealed a stability

of expression of lipoxygenase gene in different fruit developmental stages of brinjal

(Figure 3.12).


http://www.sciencedirect.com/science/article/pii/S0168165610018833%23bib0005

Chapter III

Table 3.6: NormFinder analysis

Gene Name SD Acc. SD

Expressed 0.2927 0.2927

SAND 0.4643 0.2744

TBP 0.7265 0.3035

TIP4I 0.7286 0.2915

CAL 0.9068 0.2954

18s rRNA 1.1939 0.3166

L25 RP 1.3464 0.3326

CYSPR 1.45 0.3428

Actin 1.5133 0.3481

GAPDH 1.5298 0.3486

Beta Tubulin 1.5707 0.3476

HSP 20.2 1.5829 0.3449

Alpha Tubulin 1.6083 0.3415

DNAJ 1.8387 0.3433

EF1 2.0434 0.3481

PP2A 2.2586 0.3556

RP L8 2.5597 0.367

APRT 3.0342 0.3854

Cyclophilin 3.5875 0.4111

RUBP 3.8442 0.4352

Ubiquitin 4.9812 0.4776


Chapter III

Figure 3.11: Ranking of candidate reference genes in order of their expression

stability as calculated by NormFinder in Brinjal fruit developmental stages.

Figure 3.12: Relative quantification of lipoxygenase expression normalized using

validated reference genes (Two stable genes, SAND and Expressed and one unstable gene Ubiquitin) in Brinjal fruit developmental stages as compared to 0 dpa.


Chapter III

3.4 DISCUSSION

For rapid and reliable quantification of gene expression, the quantitative real-

time RT-PCR (qRT-PCR) is currently one of the most sensitive tools that contribute to

substantial improvement in the understanding of gene functions. The accuracy and

reliability of the quantitative gene expression analysis is mainly affected by one of the

key factor called normalization. To normalize the gene expression data, endogenous

reference genes are used to achieve reliable results. The selection of stable reference

genes may vary among different species, different varieties, experimental conditions

and tissues tested. Prior to gene expression study, there is a need to validate reference

genes in targeted tissues.

This study describes a comprehensive analysis on the validation of brinjal

candidate reference genes for normalization of gene expression data during fruit

developmental stages. Our analysis was based on geNorm and NormFinder algorithm

for determination of the expression stability. Analysis by both geNorm and

NormFinder showed some differences, especially in the stability ranking of stable

reference genes. This divergence is probably due to the differences in the statistical

algorithms for each program. The geNorm determines the reference gene stability in

specific experimental set of tissues by pair-wise comparison of expression ratio

variation of among reference genes and also provides information on the optimal

number of genes in a given experimental dataset. The sensitivity to co-regulation is the

main limitation in geNorm and similar expression patterns of co-regulated genes might

not stably express in different tissues but these genes may have similar M values in the

pair-wise approach (Exposito-Rodriguez et al. 2008; Paolacci et al. 2009). We selected

different cellular function genes and many of these genes are yet to be fully

characterized, keeping open the possibility that some of the selected genes may be co-

regulated. With this in mind, for complement the analysis of reference gene stability,

another method, NormFinder were used. NormFinder, measures the overall expression

variation and variation across sample in order to reduce sensitivity towards co-

regulation (Exposito-Rodriguez et al. 2008). However, NormFinder also has some

limitations. Many studies reported that it does not account for systematic errors during

sample preparation (Hellemans et al. 2007). The stability of candidate reference genes

was determined, in order to overcome different limitations of each software program,


Chapter III

based on the consensus ranking from all different computation programs for gene

expression normalization under different fruit developmental stages tested in brinjal.

Interestingly, across different stages of the fruit development of brinjal (fruit

initiation to ripening), 2 genes namely SAND and Expressed were selected as ideal for

normalization of the gene expression. Ubiquitin expression was found to be less stable

with ranking of 21 from the consensus rankings in the brinjal fruit developmental

tissues arrangement. For normalization, these observations further strengthen the

necessity to analyze the stability of candidate reference genes as suitable references, as

the best normalizer gene varied depending on experimental conditions. Besides that,

18S rRNA, APRT and Cyclophilin have been previously reported as the most stable

normalization factors in brinjal vegetative tissues (Leaf, shoot, root, bud and flower)

using geNorm, NormFinder and BestKeeper (Gantasala et al. 2013). Our study

indicated that 18S rRNA, APRT and Cyclophilin were not the most stable genes in the

brinjal fruit development tissues tested. This experiment also demonstrated that the

tissues of the plants also affect selection of reliable reference genes as normalization

factors.

Among the top reference genes, SAND was determined as the most stable

reference gene followed by Expressed gene and TBP. The SAND gene expressed in all

of the brinjal growth and developmental stages (Leaf, pollen, flower, petal, sepal, root,

shoot and seed). The SAND domain protein ULTRAPETALA1 acts as a trithorax group

factor to regulate cell fate in plants (Carles and Fletcher 2009). This gene is commonly

used as a reference gene in plants due to its high expression in active tissues. Earlier

studies support to our results, which validated the stability of internal control genes

during tomato developmental process, different experimental conditions in citrus

genotypes and also tomato transgenic expression study (Exposito-Rodriguez et al.

2008; Mafra et al. 2012; Nakano et al. 2014). Another stable candidate reference gene,

Expressed is an uncharacterized gene and previous studies proofed that this gene is a

suitable reference gene for tomato and buckwheat gene expression study (Exposito-

Rodriguez et al. 2008; Demidenko et al. 2011).TBP, a 3rd ranked stable candidate

reference gene is a transcription factor, which is shown to be a suitable reference gene

for papaya in different experimental conditions (Zhu et al. 2012).


Chapter III

The expression stability of commonly used housekeeping genes including

Ubiquitin, elongation factor, GAPDH, Actin, 18S rRNA and Tubulin were also tested in

this study. Our results showed that, the above-mentioned genes are unsuitable reference

genes across all fruit developmental stages in brinjal. The expression stability of

Ubiquitin was ranked late in geNorm and NormFinder in different fruit developmental

stages, while the elongation factor, GAPDH and Actin was ranked in the middle (Table

3.5 and Table 3.6).Earlier studies used that Ubiquitin as the best normalizer gene for

gene expression study in cotton plants under drought stress, bud, flower, fruit, fibre

development and somatic embryogenesis and also showed expression stability in

pepper under abiotic and hormonal stress treatments (LiLi et al. 2007; Artico et al.

2010; Wan et al. 2011; Padmalatha et al. 2012 ). However, a report in soybean showed

that Ubiquitin gene was not a good normalizer gene for gene expression analysis (Jian

et al. 2008). Earlier studies proved that in tobacco, during development and abiotic

stress conditions Elongation factor was the suitable normalizer gene (Schmidt et al.

2010; Reddy et al. 2013). Likewise, GAPDH has been reported as a stable reference

gene in coffee, Brassica juncea and strawberry plants under different experimental

conditions (Barsalobres-Cavallari et al. 2009; Chandna et al. 2012; Amil-Ruiz et al.

2013). However, tomato, soybean and peach studies have reported that GAPDH is not

recommended for normalization of gene expression (Exposito-Rodriguez et al. 2008;

Jian et al. 2008; Tong et al. 2009).

Finally, the suitability of reference genes identified in this study was validated

through an assessment of the expression profiles of fatty acid metabolism related gene

namely lipoxygenase across brinjal fruit developmental stages. Lipoxygenases (LOXs)

are monomeric, non-heme and non-sulfur but iron-containing dioxygenases widely

expressed in animals, plants and fungi (Liavonchanka and Feussner 2006).

Lipoxygenases (LOXs) catalyze the conversion of polyunsaturated fatty acids (lipids)

into conjugated hydroperoxides and this process is called hydroperoxidation of lipids

(Feng et al. 2010). In plants, LOXs are involved in germination, traumatin and jasmonic

acid pathways, biotic and abiotic stresses (Umate 2011). Studies on LOX in rice showed

that it responds to wounding and insect attack (Wang et al. 2008). In Arabidopsis,

LOXs were studied in response to natural and stress-induced senescence, transition to

flowering, regulation of lateral root development and defense responses (Vellosillo et


Chapter III

al. 2007). Brinjal fruit is susceptible to many biotic and abiotic stresses during

development. However, the functions of lipoxygenase family genes in response to fruit

development in brinjal remain unclear. These gene expressions were normalized using

2 different combinations of reference genes; first set consisted of the best reference

genes, SAND and Expressed, while the other set consisted of least stable reference gene

with low ranking Ubiquitin. In brinjal fruit development, 0 dpa is the fruit initiation

stage, 5 to 10 dpa is a fruit elongation stage, 10 to 30 dpa is the fruit maturation stage

and 50 dpa is the fruit breaking or ripening starting stage. In this study, the

lipoxygenase transcripts expressed up to 20 dpa and the expression declined relatively

at 30 and 50 dpa. The changes in lipoxygenase transcript expression at breaker stage of

fruit development and it encodes an enzyme catalyse the dioxygenation of

polyunsaturated fatty acids in lipids containing a cis,cis-1,4- pentadiene structure. It

may be involved in a number of diverse aspects of plant physiology including growth

and development, senescence or responses to wounding. A difference observed in

relative expressions of lipoxygenase normalized by reference genes with different

stabilities indicated that selection of validated stable reference genes is crucial for

normalization of qRT-PCR gene expression data that prevent bias and misinterpretation

of qRT-PCR data. We expect that in future, use of these validated genes for

normalization in qRT-PCR analysis of gene expression data will improve the sensitivity

and reproducibility of the results in brinjal.

3.5 CONCLUSION

Using two different software applications - geNorm and NormFinder, we have

assessed 21 candidate reference genes and their expression stability in different fruit

developmental stages and leaf tissue of brinjal (Solanum melongena L.). Between two

algorithms, regardless of small incongruences, both indicated the stability of two brinjal

genes (SAND and Expressed). To provide accurate normalization, the combination of

SAND and Expressed is sufficient according to geNorm, however, NormFinder

suggested Expressed gene and TBP as reference genes. In addition, the expression of

lipoxygenase emphasized the significance of validating reference genes in order to

achieve accurate and reliable qRT-PCR gene expression results. In summary, validation

of new brinjal reference genes will provide a foundation guideline for the selection of

suitable reference genes for accurate gene expression studies.


http://en.wikipedia.org/wiki/Dioxygenation

http://en.wikipedia.org/wiki/Polyunsaturated

http://en.wikipedia.org/wiki/Fatty_acids

http://en.wikipedia.org/wiki/Lipid

http://en.wikipedia.org/wiki/Pentadiene

Chapter IV

Characterization of antioxidant genes during fruit development and ripening in Brinjal (Solanum melongena L.)

4.1 INTRODUCTION

Biochemical reactions produce many reactive oxygen species (ROS) such as

hydrogen peroxide, superoxide and hydroxyl radicals which are considered to be the

main cause of oxidative damage (Jimenez et al. 2003). Susceptibility of plants to

oxidative stress may depend on the balance between ROS generated, activity and

availability of cellular antioxidants (Foyer et al. 1994). Activities of various antioxidant

enzymes are known to increase in defence responses (Anand et al. 2009) and salinity

(Hernandez et al. 2000). Reactions involving ROS are an inherent feature of the

senescence and fruit ripening (Jimenez et al. 2003). Since ROS levels and their harmful

products are known to increase during senescence in many plants, it is possible that

these changes are due to a decline in the activity of certain antioxidant enzymes.

Increased levels of ROS have been reported during pepper and tomato ripening

(Rogiers et al. 1998).

Brinjal or eggplant (Solanum melongena L.) is the third most important

Solanaceous crop species. Brinjal fruit is primarily consumed as a cooked vegetable in

various ways. It is low in fats, contains protein, fibre and carbohydrates. It is a good

source of minerals and vitamins and is rich in total water soluble sugars, free reducing

sugars, amide proteins. (Gopalan et al. 2007). The brinjal varieties display a wide

variation in fruit shapes and colours like long, egg-shaped and from green, white, black

through degrees of purple pigmentation. Brinjal have many unique traits, including

extra-large fruit size, high temperature and water-stress tolerance and Verticillium and

bacterial wilt resistance (Saito et al. 2009). Attractive characteristics of the brinjal fruit

are not only colour, size, aroma and texture, but also its chemical composition (contents

of minerals, vitamins and antioxidants). Brinjal fruit contains many compounds with

antioxidant activity such as anthocyanins, flavonoids, phenolic acids. There is no

information about the activities of significant antioxidant enzymes in brinjal fruits at


Chapter IV

different development and ripening stages. The aim of the present research was to study

the activities of important antioxidant enzymes during fruit development and ripening

in brinjal.


4.2.1 Sample collection

Brinjal (Solanum melongena L.) cvs. Pusa purple long (PPL) and Killikulam-1

(KKM-1) were grown in glasshouse under control conditions. PPL is a variety with

long purple coloured fruits, while KKM-1 bears round white fruits. Flowers were hand-

pollinated at anthesis and fruit samples were collected at 0, 5, 10, 20 and 50 days post

anthesis ( dpa). For the 0 and 5 dpa sample buds were stripped of sepals, petals and

style. For samples taken at 10, 20 and 50 dpa whole fruit was sampled with only the

sepals removed. Fruits were vertically divided into three equal parts and middle part

was used for total RNA isolation. All samples were frozen in liquid nitrogen at the time

of harvest and then stored at -70 0C.

4.2.2 RNA isolation and cDNA synthesis

Total RNA was isolated using SpectrumTM Plant Total RNA kit (Sigma, USA)

according to the manufacturer’s protocol. The quality and quantity of RNA was

measured by NanoDrop 1000 Spectrophotometer (Thermo Scientific, USA). The total

RNA was used for RT-cDNA synthesis from 1 µg of total RNA using AffinityScript

qPCR cDNA synthesis kit (Stratagene, Agilent Technologies, USA). Resulting cDNA

template was diluted five-fold in molecular grade water (Promega, Madisson, WI).

Gene specific qRT-PCR primers were designed using PrimerQuest software

(http://eu.idtdna.com). The primers were used in this study are listed in Table 4.1.

4.2.3 Real-time PCR

Real-time assays were conducted for all the genes by using the Stratagene

MX3005P (Agilent Technologies, USA) detection system and 18S rRNA gene was

used as the housekeeping gene to normalize the amount of template cDNA added in

each reaction. The qRT-PCR was performed under the following programme, 5 min at

95 0C, followed by 40 cycles of amplification with 30s of denaturation at 95 0C, 30s of

annealing at 60 0C and 30s of extension at 72 0C.


Chapter IV

Table 4.1: List of antioxidant primers used in this study.

Gene Name Primer Sequence (5’-3’)

Superoxide dismutase F: TTGACCGGTCCAGACTCAGTTGTT

R : AGTCAAACCAACCACACCACATGC

Catalase 1 F : GCCTTTGATGCCAGTTGGTCGATT

R : TTTGGCCCAATACGGTGTCTCTGA

Catalase 2 F : ATGGGTCTGGTGTCCACACATTCA

R: TCCTGAGTAGCGTGGCTGTGATTT

Ascorbate peroxidase F: ATGGATGTGTCTGGACCTGAGCAA

R: AGACATCACGCAAATGAGCAGCAG

Peroxidase F : TCGGGTGCCCATACATTTGGAAGA

R: AAGTACCACCATTGCCACCTTGTG

Glutathione reductase F: TGGTGGTGTTAGGGCTTCTCGTTT

R: TCTTGGGTACACATCCACGAAGCA

Potassium Uptake 1 F : AGATGGGCTTCTTACTCCAGCCAT

R: TTGATGGTGTTCCCGAGACATGGA

Plasma membrane ATPase F: GCCCAATTGGTTGCTACAGTGCTT

R: TAGACCCAGATGATTGCTGCCCAT

18S rRNA F: CCGCGGAAGTTTGAGGCAATAACA

R: CGGCAAGGCTATAAGCTCGTTGAA


Chapter IV

Three biological replicates were used. Amplicons were subjected to the melt

curve analysis to check the specificity of the amplified products (Figure 4.1 and Figure

4.2). The relative expression level of each gene was calculated by 2-ddCt. A fold change

of ≥1.5 was considered as significant change in gene expression.

4.3 RESULTS AND DISCUSSION

In the present study expression analysis of eight antioxidant genes were carried

out during fruit development and ripening stages in two brinjal cvs. PPL and KKM-1.

Data presented here (Figure 4.3 and Figure 4.4) showed differential expression of

antioxidant genes during fruit development and ripening. In PPL, Peroxidase (PO) was

up-regulated at all the stages and the highest expression was observed at ripening stage

(50 dpa). However expression of PO was not significantly altered in KKM-1 compared

to control (0 dpa). Expression of Catalase 1 (CAT 1) was up-regulated at all the stages

in PPL with the highest expression at ripening stage (50 dpa), while in KKM-1 the

expression of CAT 1 was the highest at 10 dpa. Catalase 2 (CAT 2) was up-regulated at

early stages (5 and 10 dpa) of fruit development and its expression was similar in both

the cultivars of brinjal. In PPL superoxide dismutase (SOD) was up-regulated at 5 and

10 dpa. However, its expression was not significantly altered in KKM-1 during fruit

development and ripening. Expression of Ascorbate peroxidase (AP) was up-regulated

at early stages and ripening of fruit development in both the cultivars. Glutathione

reductase (GR) was up-regulated at 5 dpa in PPL while in KKM-1 expression of GR

was not significantly altered in KKM-1 compared to control (0 dpa). Plasma membrane

ATPase (PMATPase) was up-regulated at all the stages except 50 dpa in PPL while in

KKM-1 its expression was unchanged. There is no changes of potassium uptake 1

(KUP1) expression level in both cultivars of brinjal as compared to control (0 dpa).


Chapter IV

Figure 4.1: Amplification plots for 8 antioxidant genes


Chapter IV

Figure 4.2: Real-Time amplification specificity. Melt curves with single peak

generated for each of the 8 antioxidant genes


Chapter IV

Figure 4.3: Expression analysis of antioxidant genes during fruit development

stages (5, 10, 20 and 50 dpa) in Brinjal (Solanum melongena L.) cv. PPL compared with 0 dpa. Y-axis represents the fold change.


Chapter IV

Figure 4.4: Expression analysis of Antioxidant genes during fruit development

stages (5, 10, 20 and 50 dpa) in Brinjal (Solanum melongena L.) cv. KKM-1 compared with 0 dpa. Y-axis represents the fold change.


Chapter IV

4.4 DISCUSSION

Fruit development and ripening is a complex process and it undergoes many

physiological and biochemical changes. Fruit ripening has been described as a

controlled oxidative process whereby ROS accumulation is balanced by the activity of

cellular antioxidant systems (Jimenez et al. 2002). These free radicals disturb normal

metabolism by peroxidizing membrane lipids and denaturing proteins and nucleic

acids. Plants have an endogenous mechanism to protect cellular and subcellular

systems from the cytotoxic effects of ROS. These include up-regulation of antioxidant

enzymes such as GR, PO, SOD, CAT and PMATPase. Peroxidase (PO) participates in

hormone catabolism, phenol oxidation, polysaccharides and cell wall proteins

intercrossing, lignin polymerization, fruit ripening and defense against pathogens.

During fruit ripening, peroxidase activity is increased along with the polygalacturonase

and cellulase enzymes (Robinson 1991). In the present study PO was up-regulated in

PPL at all the stages and the highest expression was observed at ripening stage.

Activity of PO increases during fruit development and maturation in muskmelon (Biles

et al. 2000) and strawberry (Lopez et al. 2010). However in KKM-1, PO expression did

not significantly changed. These disparities may be derived from the differences in

shape and size of brinjal cultivar. Catalase is responsible for the dismutation of

hydrogen peroxide into oxygen and water in the peroxisomes, protecting the cell from

the deleterious effects of hydrogen peroxide accumulation. In this study, we observed

that both CAT 1 and CAT 2 were up-regulated at early stages of fruit development in

both the cultivars of brinjal which suggests its important role in detoxification of H2O2

during early stages of fruit development. However, the expression of CAT 1 was very

high in PPL at ripening stage (50 dpa) which suggests its role during brinjal fruit

ripening. In strawberry, catalase activity was maximum in early fruit development and

ripening stages (Lopez et al. 2010). SOD catalyzes the dismutation of superoxide

radicals in a broad range of organisms, including plants. The dismutation of superoxide

into hydrogen peroxide and oxygen constitutes the first line of cellular defense to

prevent undesirable biological oxidation by oxygen radical generated during cellular

metabolism. In the present study SOD was up-regulated at 5 and 10 dpa in PPL that

suggests it's very important role in preventing cell cycle arrest by detoxifying

superoxide into H2O2 and oxygen. Up-regulation of SOD is reported during fruit


Chapter IV

development in tomato (Rocco et al. 2006) and strawberry (Lopez et al. 2010).

However, SOD expression does not significantly change in KKM-1 throughout fruit

development and ripening.

Ascorbate peroxidase (AP) is one of the key enzymes in the ascorbate-

glutathione cycle. It uses two molecules of ascorbate to reduce H2O2 to water, with the

concomitant generation of two molecules of monodehydroascorbate. It plays an

important role in scavenging and protecting cells against the toxic effects of H2O2 in

higher plants (Asada 1999). In this study AP was up-regulated at early and ripe stages

of fruit development in both the cultivars. In strawberry AP expression was the lowest

at the small green stage, gradually increased at the full red stage (Xia et al. 2009). AP

increases in tomato during fruit ripening (Faurobert et al. 2007; Loannidi et al. 2009).

Catalase and AP are highly expressed in green tissues than in ripening grapes (Giribaldi

et al. 2007). Hydrogen peroxide can also be converted into water by ascorbate-

glutathione cycle which involves successive oxidations and reductions of ascorbate,

glutathione and NADPH. Glutathione reductase (GR) plays a very important role in this

cycle and converts oxidized glutathione to glutathione by utilizing NADPH. In this

study expression of GR was significantly altered only at 5 dpa in PPL. Plasma

membrane H+ATPase (PMATPase) is involved in broad range of physiological

responses that play a central role in the growth and development of plants (Serrano

1984). It maintains extracellular and intracellular pH of cell and affect auxin-induced

growth by acidification of the cell wall, causing loosening of the wall, which allows

turgor-driven expansion of the cell (Cleland 1987). In the present study PMATPase

was up-regulated at all stages of fruit development except 50 dpa in PPL which

specifies its role in cell enlargement. Up-regulation of PMATPase creates

electrochemical gradient of protons across the membrane and causes uptake of water

into cell. Electrochemical gradient and uptake of water are considered to be very

important in the expansion of cells that leads to fruit enlargement. PMATPase

expression does not significantly alter in white round cultivar suggests PMATPase are

more important for cell elongation in long cultivar than round one. KUP family are

involved in potassium transport and localized at different membranes. KUP 2 is

predominantly expressed in rapidly growing tissues and plays a role in cell expansion


Chapter IV

(Elumalai et al. 2002). In growing tissues it is involved in maintaining cytoplasmic

potassium levels and/or turgor regulation.

4.5 CONCLUSION

The present study has shown differential expression of antioxidant genes during

fruit development and ripening in brinjal. PO and SOD were up-regulated in PPL while

in KKM-1 their expression was not significantly altered. AP was up-regulated at early

and ripe stages of fruit development while GR was up-regulated at 5 dpa. PMATPase

was up-regulated at all the stages except 50 dpa in PPL while expression of KUP 1 was

similar to that at 0 dpa in both cultivars of brinjal. Disparities in expression of

Peroxidase, Superoxide dismutase and Plasma membrane ATPase may be derived from

the differences in shape and size of brinjal fruits. Stress may arise in the fruits during

ripening as a result of changes in osmotic potential due to the accumulation and the

storage of osmotically active compounds or from abiotic or biotic factors (Aharoni et

al. 2002). Another source of ROS production might be electron flow in mitochondria

(Leprince et al. 2000). There is an association between ripening-related gene

expression and oxidative stress response in strawberry (Aharoni et al. 2002). Our

results also support this idea and it is proposed that CAT 1, PO and AP could play an

important role in the regulation of ripening processes in brinjal.


Chapter V

Isolation and characterization of fruit specific genes in Brinjal (Solanum melonjena L.)

5.1 INTRODUCTION

Vegetables play an important role in human health and nutrition by providing

minerals, micronutrients, vitamins, antioxidants, phytosterols and dietary fiber

(Guimaraes et al. 2000; Giovannoni 2001; Kwon et al. 2008). Vegetable cultivation is a

significant part of the agricultural economy of nations, especially in the developing

world. In countries like India where the population is predominantly vegetarian,

vegetables form a vital constituent of the diet.

Brinjal is the only vegetable crop whose fruits show so many variations. If the

genes responsible for these variations in brinjal fruit shape, color and size can be

identified, they can be used to alter the characteristics of the fruits of other vegetable

crops also.

With the continuous increase in the world population and decrease in the area

available for cultivation of vegetable and fruit crops, there is a demand to increase the

production of crops per unit area. This is the major problem in countries like India,

where the population is predominantly vegetarian. Total production could be greatly

improved if losses due to biotic and abiotic stresses, and lack of proper storage and

processing facilities could be overcome. Therefore, over the last two decades various

important traits such as biotic stress resistance, improvement in product quality and

storage life have been successfully engineered into vegetable and fruit crops (Klug and

Cummings 1997; Ortiz 1998).

Besides engineering crops with these traits, the production can still be increased

if these crops can be engineered to produce fruits of bigger size (Griffiths et al. 2000;

Guillet et al. 2002; Hochheimer and Tjian 2003). This can be done by identifying and

isolating the genes responsible for fruit shape and size, and then using them to produce

transgenic crops in which the genes responsible for fruit elongation and enlargement

are expressed at high levels (Meyer et al. 1996).


Chapter V

Thus, it can be said that fruit specific genes are of immense agronomic and

health importance (Chen et al. 2004; Karaaslan and Hrazdina 2010). In the present

study, in order to isolate and characterize the fruit specific genes of brinjal, two

varieties of brinjal [var. Pusa Purple Long (PPL) and Killikulam-1 (KKM-1)] differing

in fruit shape, size and colour, one with purple and long fruits and the other with white

and round fruits were taken. The total RNA was isolated at different stages of fruit

development from both varieties of brinjal. Isolated total RNA was used for

Suppression Subtractive Hybridization (SSH) analysis to identify the genes that were

differently expressed in these varieties. The fruit specificity of these genes was

confirmed using Microarray analysis, proteomics analysis and Quantitative Real-Time

PCR analysis. Thereby, two genes were found to be fruit specific and used for further

analysis and characterization. Based on sequence analysis it was found that both the

EST sequences have start codon and the full length genes were amplified using simple

PCR. Amplified product of genes were cloned in pGEMT-Easy vector and sequenced.

Once, the sequence was confirmed, they were cloned into suitable binary vectors for

plant transformation to validate the fruit specificity of the respective gene (Komori et

al. 2007).


5.2.1 Plant material

The genomic DNA and total RNA was isolated from both varieties of brinjal,

such as PPL with purple and elongated fruits and KKM-1 with white and round fruits,

were used for the various experiments related to the isolation and cloning of fruit

specific genes of brinjal. The cDNA libraries were prepared from the total RNA which

was isolated at the various stages of fruit development from both varieties was also

used in various experiments.

5.2.2 Preparation of media

5.2.2.1 LB Broth and Agar

LB medium is a rich medium that is commonly used to culture members of the

Enterobacteriaceae as well as for coliphage plaque assays. To prepare LB broth, the

following components were dissolved in respective amount of double distilled water


Chapter V

and autoclaved at 121ºC at 15 psi for 20 minutes. LB agar was prepared by adding

1.5% agar to LB broth (Table 5.1).

5.2.3 Polymerase Chain Reaction (PCR)

PCR amplification of genes or DNA fragments was done using Thermo

Scientific Taq DNA Polymerase enzyme. However, Clontech Advantage 2 Polymerase

enzyme was used for the amplification of genes to be cloned as it has DNA

proofreading activity with high fidelity and processivity as compared to Taq DNA

polymerase lacking proof reading activity.

5.2.3.1 Colony PCR

Colony PCR is a variant of PCR used to screen for plasmid inserts directly from

bacterial colonies. Colonies are picked with a sterile micropipette tip and added to the

PCR mix. The initial heating of 5 min at 95ºC causes cell lysis and release of the

plasmid DNA from the cell, so it can serve as template for the amplification

reaction. Either inserts specific primers or the primers targeting vector DNA flanking

the insert can be used to determine presence of the insert. Colony PCR analysis was

done using Thermo Scientific Taq DNA Polymerase enzyme.

5.2.3.2 Protocol

The PCR reaction mix was prepared in PCR tubes and the PCR tubes were

placed in the thermal cycler and the program was set as per the conditions required for

the amplification of the gene of interest (Table 5.2).

5.2.3.3 Analysis of PCR product

The presence or absence of a PCR amplicon and size of the product were

determined by electrophoresis along with a suitable DNA ladder on an agarose/EtBr

gel.

5.2.4 Gel extraction of PCR product

Gel extraction of PCR product has used to isolate a desired fragment of intact

DNA from a gel following electrophoresis and to purify it prior to ligation, as usually

both the insert and vector DNA fragments are derived from restriction digestion or PCR

and thus, are mixed with enzymes, salts and possibly other DNA fragments that may

inhibit the ligation reaction. Gel extraction of PCR products was carried out using

Qiagen DNA Gel Extraction Kit as per manufacture instructions.


Chapter V

Table 5.1: Composition of Luria Bertini (LB) medium

S. No Ingredients Grams/Litre

1 Tryptone 10.0

2 Yeast extract 5.0

3 Sodium chloride 10.0

4 Final pH 7.5±0.2

Table 5.2: Reaction mixture for PCR using Taq polymerase

S. No Reaction component Per PCR tube

1 Nuclease free water 40.625 μl

2 Taq buffer (10X) 5.0 μl

3 dNTP mixture (10 mM) 1.0 μl

4 Forward primer 1.0 μl

5 Reverse primer 1.0 μl

6 DNA template 1.0 μl

7 Taq polymerase (5 units/μl) 0.375 μl

8 Total volume 50.0 μl


Chapter V

5.2.4.1 Protocol

The DNA fragment was excised from the agarose gel with a clean, sharp

scalpel. The size of the gel slice was minimized by removing extra agarose.

The gel slice was taken in a 2 ml eppendorf tube and 3 volumes of solubilisation

buffer were added to 1 volume of gel (100 mg or approximately 100 µl).

The eppendorf tube was incubated at 50°C for 10 min (or until the gel slice has

completely dissolved). The tube was inverted every 2 to 3 minutes during the

incubation.

After the gel slice had dissolved completely 1 gel volume of isopropanol was

added to the sample and mixed by inverting the tube several times.

The mixture was transferred to a microspin cup seated in a 2 ml receptacle tube.

It was centrifuged at 13000 rpm for 1 min.

The filtrate was discarded as the cDNA is retained in the fibre matrix of the

microspin cup.

750 µl of wash buffer was added to the microspin cup seated in a 2 ml

receptacle tube. It was centrifuged at 13000 rpm for 1 min and the filtrate was

discarded.

The microspin cup seated in a 2 ml receptacle tube was centrifuged at 13000

rpm for 2 minutes for drying.

The microspin cup was transferred to a fresh 1.5 ml eppendorf tube and 20 μl of

nuclease free water was added onto the top of the fiber matrix at the bottom of

the cup. It was incubated at room temperature for 5 minutes.

It was then centrifuged at 13000 rpm for 1 min. The filtrate containing the DNA

was labelled as 1st elution and stored at -20ºC.

The microspin cup was transferred to a fresh 1.5 ml eppendorf tube and 15 μl of

nuclease free water was added onto the top of the fiber matrix at the bottom of

the cup. It was incubated at room temperature for 5 minutes.

It was then centrifuged at 13000 rpm for 1 min. The filtrate containing the DNA

was labelled as 2nd elution and stored at -20ºC.

1 μl of each elution was analysed on a 1.2 % agarose/EtBr gel along with 1 kb

DNA ladder.


Chapter V

5.2.5 TA cloning using pGEMT-Easy vector

TA cloning is a simple and efficient means of directly cloning PCR products

that avoids the use of restriction enzymes. The procedure exploits the terminal

transferase activity of certain Thermophilic DNA polymerases including Taq

polymerase (Zhou and Gomez-Sanchez 2000), which adds a single 3'-A to the ends of

PCR products.

Linearized “T-vector” which has a 3'-T overhang at each end (Holton and

Graham 1991, Marchuk et al. 1991, Mead et al. 1991) can be use to directly clone PCR

products having 3'-A overhangs. It is a convenient and labour-saving alternative to

traditional, restriction endonuclease mediated cloning strategies. Promega’s pGEMT-

Easy Vector ligation kit was used for TA cloning.

5.2.5.1 Protocol

The amount of insert required in the ligation reaction was calculated using the

following equation:

ng of vector x kb size of insert x insertkb size of vector

×vector molar ratio = ng of insert

The ligation reaction was kept in PCR tubes as described below.

The components were mixed by pipetting (Table 5.3).

The tubes were spin shortly to settle the components at the bottom of the PCR

tubes.

The tubes were then incubated for overnight at 4°C.

Longer incubation times will increase the number of transformants. Generally,

incubation overnight at 4°C will produce the maximum number of

transformants.

5.2.6 Preparation of competent E. coli cells

This natural ability of bacteria to take up naked DNA from its surroundings is

known as competence (Dale and Schantz 2002). Since E. coli is not naturally

competent, competency must be induced by chemical methods. E.coli DH5α competent

cells were prepared using CaCl2 method. The addition of CaCl2 serves to neutralize the

unfavourable interactions between the DNA and the polyanions present on the outer

membrane of bacteria.


Chapter V

Table 5.3: Ligation reaction mixture for ligation in pGEMT-Easy vector

S. No Reaction component Volume (μl)

1 2X Rapid ligation buffer 5 μl

2 PGEM-T Easy vector(50 ng) 1 μl

3 Insert Depending on insert concentration

4 T4 DNA ligase(3U/ μl) 1 μl

5 Nuclease free water to a volume of 10 μl

Table 5.4: Reaction mixture for restriction digestion.

S. No. Reagent Volume (μl)

1 Fast digestion buffer (10X) 3 μl

2 Plasmid/DNA fragment Depending upon its concentration

3 Enzyme 1 1 μl

4 Enzyme 2 1 μl

5 Nuclease free water Volume made up to 30


Chapter V

5.2.6.1 Protocol

E.coli strain DH5α was streaked directly from glycerol stock stored at -80oC

onto LB-agar plate.

A single colony was picked from the plate and inoculated into 5 ml LB broth

(containing 10 mg/l of Nalidixic acid antibiotic). It was incubated at overnight

37ºC at 220 rpm.

100 ml of LB broth was inoculated with 200 µl-1 ml of the bacterial culture

obtained and incubated at 37oC with shaking till OD becomes 0.8.

After incubation, the culture was aseptically transferred to 50 ml centrifuge

tubes under the laminar hood.

The centrifuge tubes were centrifuged at 6000 rpm for 7 minutes at 4oC.

The supernatant was decanted under laminar hood and the pellet was

resuspended in 20 ml of ice cold 100 mM CaCl2 such that no cell clumps were

left. It was incubated on ice for ½ hour.

The tubes were again centrifuged at 5000 rpm for 7 minutes at 4oC.

The supernatant was decanted under laminar hood and the pellet was again

resuspended in 20 ml of ice cold 100 mM CaCl2 such that no cell clumps were

left. It was incubated on ice for 1½ hours.

The tubes were again centrifuged at 5000 rpm for 7 minutes at 4oC.

The supernatant was decanted under laminar hood and the pellet was

resuspended in1.8 ml 100 mM CaCl2 by tapping gently. It was incubated

overnight at 4ºC.

1.2 ml of 100% glycerol was added after incubation and mixed properly to form

a suspension.

100 µl of the suspension of competent cells was aseptically transferred to sterile

1.5 ml eppendorf tubes under laminar hood.

The tubes were immediately freezed by immersing the tightly closed tubes in

liquid nitrogen. The tubes were then stored at -80oC for future use.


Chapter V

5.2.7 Transformation of E. coli cells

Transformation of competent E.coli DH5α cells was done using heat shock

method.

5.2.7.1 Protocol

100 µl of competent cells were taken in an eppendorf tube and thawed on ice for

5 minutes.

10 µl of the ligation product or DNA to be transformed was added to the

competent cells.

The contents were mixed by tapping the tubes gently. The tubes were then

incubated on ice for 45-60 minutes.

The tubes were then transferred to a water bath set at 42oC for 90 seconds, to

give heat shock to the cells.

The tubes were then instantly transferred into ice and incubated on ice for 15

minutes.

900 µl of LB was aseptically added to the tubes under laminar hood. The

contents were mixed by tapping gently.

The tubes were incubated at 37oC for 1to 1 ½ hours with shaking at 220 rpm.

The tubes were then centrifuged at 5000 rpm for 5 minutes to pellet down the

cells.

The supernatant was discarded under laminar hood and the cells were

resuspended in 100 µl of LB.

The suspended cells were then spread on LB-agar plates containing IPTG,

X-Gal and Ampicillin till whole of the cell suspension was completely

absorbed.

The plates were then inverted and incubated overnight at 37oC.

5.2.7.2 Screening of transformants

The transformed colonies can be identified on the basis of blue-white selection

principle. The white colonies obtained are transformed, whereas the blue colonies are

non-transformed. The transformed white colonies obtained were restreaked on a new

LB agar plate containing ampicillin (1mg/l), X-gal (0.4mg/l) and IPTG (10mM/l). The

plate was incubated overnight at 37oC.


Chapter V

5.2.8 Plasmid isolation

Plasmid isolation was done from bacterial cells using alkaline lysis method.

5.2.8.1 Protocol

A 2 ml eppendorf tube (or 50 ml centrifuge tube) was taken and the overnight

grown culture was transferred to it. The tube was centrifuged at 7000 rpm for 5

minutes to pellet down the cells.

The supernatant was discarded and the remaining culture was added, which was

again centrifuged to pellet down the cells.

The supernatant was discarded and the tube was inverted briefly on paper

napkin to remove the supernatant completely.

300 µl (or 2 ml) resuspension buffer was added to cell pellet and the cells were

resuspended by vortexing.

3 µl of RNase A was added and mixed by inverting 4-5 times gently.

300 µl (or 2 ml) lysis buffer was added and mixed by inverting 4-5 times gently.

The tubes were then incubated at room temperature for 5 minutes.

300 µl (or 3 ml) neutralization buffer was added and mixed by inverting 4-5

times gently. The tubes were then incubated on ice for 15 minutes.

The tubes were centrifuged at 9000 rpm for 20 minutes.

The supernatant was transferred to fresh eppendorf tubes (or centrifuge tubes)

avoiding any white pellet.

0.7 volume of ice cold isopropanol was added to the supernatant and it was

centrifuged at 9400 rpm for 20 minutes.

A milky pellet should be at the bottom of the tube. The supernatant is discarded

without disturbing the pellet. The tube was inverted on paper napkin to remove

the supernatant completely.

500 µl of ice-cold 70% ethanol was added and the tubes were centrifuged at

9400 rpm for 5 minutes. The supernatant was discarded and the tube was

inverted on paper napkin to remove the supernatant completely.

The tubes were left for air drying at room temperature or at 37ºC.

20 µl (50 µl) of nuclease free water was added and the tubes were tapped gently

to dissolve the pellet. The tubes were then incubated overnight at 4ºC for

dissolving the plasmid completely.


Chapter V

1 μl of the isolated plasmid was checked on a 1.2% agarose/EtBr gel, along with

1 kb DNA ladder.

5.2.9 Restriction digestion analysis

The restriction digestion was done using Thermos Scientific fast digestion

enzymes and fast digest buffer.

5.2.9.1 Protocol

The plasmid or DNA fragment to be restricted was analyzed on agarose/EtBr

gel to check its concentration.

The restriction digestion reaction was set as below in 0.5 ml eppendorf tubes:

(Table 5.4)

The components were mixed by pipetting.

The tubes were then spinned shortly to settle the components at the bottom of

the PCR tubes.

The tubes were then incubated for at 37°C for 1 ½ hours.

The restricted products were the analyzed on 1.2% agarose/EtBr gel.

5.2.10 DNA sequencing and sequence analysis

The positive transformed colonies obtained were outsourced for DNA

sequencing and the sequences obtained were compared with the original sequence

using sequence analysis tools such as analysis was done using BLASTN, TBLASTX,

CLUSTALW, and LaserGene softwares.

5.2.11 Real-Time PCR

Real-Time PCR, first introduced in 1992 by Higuchi and co-workers has the

ability to monitor the progress of the PCR as it occurs i.e., in real time (Higuchi et al.

1992). It does not require post-amplification manipulation and is far more sensitive

than traditional PCR. It provides a unique, multidimensional perspective of a gene’s

presence, its function and even its regulation in a concrete and quantifiable manner.

This is achieved using different reporter molecules that relate PCR product

concentration to fluorescence intensity (Higuchi et al. 1993). The fluorescence emitted

by the reporter molecule increases with the accumulation of the PCR product.


http://onlinelibrary.wiley.com/doi/10.1002/9780470089941.et1003s00/full%23et1003-bib-0016

http://onlinelibrary.wiley.com/doi/10.1002/9780470089941.et1003s00/full%23et1003-bib-0016

Chapter V

SYBR Green I is the most commonly used DNA-binding dye for Real-Time

PCR. It emits fluorescence when bound to dsDNA, while have virtually no

fluorescence when free in solution. For Real-Time PCR, TaKaRa Premix Ex Taq II

(Tli RNaseH Plus) kit was used.

5.2.11.1 Protocol

Autoclaved PCR tubes were taken and labeled appropriately.

A 1.5 ml eppendorf tube was taken and master mix was prepared according to

the following table as per the requirement (Table 5.5).

Each 25 µl reaction was divided into triplicates in the PCR reaction plates well

to prepare technical replicates of 8 µl each.

After completion of the PCR plate, it was sealed tightly with the seal provide

with it.

The plate was then spinned shortly to settle the components at the bottom.

The PCR plate was placed in the thermal cycler and the program was set as per

the conditions required for the amplification and analysis of the gene of interest.

(Table 5.6).

After the reaction was complete, the amplification and dissociation curves were

checked.

5.2.12 Ligation in a binary vector

Ligation in binary vectors was done using Fermentas (Thermo scientific) T4

DNA ligase enzyme with rapid ligation buffer.

5.2.12.1 Protocol

The amount of insert required in the ligation reaction was calculated using the

following equation:

ng of vector x kb size of insert x insertkb size of vector

×vector molar ratio = ng of insert

The ligation reaction was kept in PCR tubes as described in Table 5.7.

The components were mixed by pipetting.

The tubes were spin shortly to settle the components at the bottom of the PCR

tubes.

The tubes were then incubated for 2 hours at 22°C.


Chapter V

Table 5.5: Reaction mixture for Real-Time PCR

S. No. Reagent Volume(μl)

1 Nuclease free water 10.325 μl

2 2X SYBR® Premix Ex Taq II 12.5 μl

3 1X ROX 0.375 μl

4 Forward primer (10 µM) 0.4 μl

5 Reverse primer (10 µM) 0.4 μl

6 cDNA 1.0 μl

Total 25 μl

Table 5.6: Reaction conditions for Real-Time PCR

S. No. Temperature Duration

1 50°C 3 minutes

2 95°C 10 minutes

3 95°C 15 seconds

4 Depending on Tm of primers 1 minute

Repeated steps 3 and 4 for 45 cycles

5 95°C 1 minute

6 55°C 30 seconds

Table 5.7: Ligation reaction mixture for ligation in a binary vector

S. No Reaction component Volume (μl)

1 5X Rapid ligation buffer 2 μl

2 Binary vector (50 ng) Depending on vector concentration

3 Insert Depending on insert concentration

4 T4 DNA ligase(3U/ μl) 1 μl

5 Nuclease free water to a volume of 10 μl


Chapter V

5.2.13 Genomic DNA isolation

Genomic DNA isolation was done from brinjal leaves samples using silica

matrix method.

5.2.13.1 Protocol

Approximately 100 mg of frozen plant material (in liquid nitrogen) was taken.

Liquid nitrogen was added to it and the tissue was grinded using a mortar and

pestle.

Approximately 10 mg of ground tissue was taken in a 1.5 ml eppendorf tube.

700 µl of DNA Extraction Buffer was added and the sample was mixed

properly by inverting the tube a few times.

The tube was incubated at 60ºC for 15-20 minutes.

5 µl RNase A solution was added to the tubes and mixed by inverting.

The tube was incubated at 60ºC for 10 minutes.

700 µl of chloroform: isoamyl alcohol 24:1 v/v solution was added and the

mixture was mixed properly by inverting the tube a few times.

The tubes were then centrifuged at 12000 rpm at 4ºC for 10 minutes.

The aqueous upper phase was transferred to a fresh eppendorf tube.

700 µl of 6M NaI solution was added and it was mixed well by inverting the

tube several times.

50 µl of silica matrix was added and the contents were mixed by tapping. The

tube was kept at room temperature for 2 minutes.

The matrix was pelleted by centrifugation at 10000 rpm for 30 seconds and the

supernatant was removed by pipetting.

The matrix was washed by resuspending with 1 ml 70% ethanol solution and by

vigorous vortexing.

The matrix was again pelleted by centrifugation at 10000 rpm for 30 seconds

and the supernatant was removed by pipetting.

It was again centrifuged at 10000 rpm for 30 seconds and the residual liquid

was removed carefully by pipetting.

50 µl of TE buffer was added and the pellet was resuspended completely by

vortexing.

The tube was incubated at 65ºC for 10 minutes.


Chapter V

The tube was then centrifuged at 12000 rpm for 5 minutes and the supernatant

containing the genomic DNA was transferred to a fresh eppendorf tube.

5.3 RESULTS

The present work was done to isolate and characterize the fruit specific genes of

brinjal. To achieve this aim, two varieties of brinjal (PPL and KKM-1) differing in fruit

shape, size and colour were taken and the total RNA was isolated at different stages of

fruit development from the fruit tissues. Isolated total RNA was used for performing

the Suppression Substractive Hybridization (SSH) analysis to identify the genes that

were differently expressed in these varieties.

The fruit specificity of these genes was confirmed using Microarray analysis,

proteomics analysis and Quantitative Real-Time PCR analysis. Few genes were found

to be fruit specific, out of that two genes were found to be full length gene sequences

(Lipoxygenase and p40like protein). Gene specific primers were designed to amplify

SmLipoxygenase and Smp40 like protein using PCR (Frohman et al. 1988).

5.3.1 Amplification of Lipoxygenase gene

Lipoxygenase gene was amplified from cDNA of 10 dpa fruit tissue and

genomic DNA using gene specific primers by Taq polymerase enzyme to check the

working of primers and identify the length of the gene and presence of any introns. The

amplification products were checked along with 1 kb DNA ladder on 0.8% agarose gel

by electrophoresis. Lipoxygenase gene was found to be around 2.5 kb without introns

which amplificated from cDNA and more than 10 kb with introns while amplified

from genomic DNA (Figure 5.1).

5.3.2 Amplification of p40 like protein

Gene p40 like protein was amplified from cDNA of 10 dpa fruit tissue and

genomic DNA using gene specific primers through PCR by Taq DNA polymerase

enzyme to check the primers efficiency and identify the length of the gene and presence

of any introns. The amplification products were analyzed along with 1 kb DNA ladder

on 0.8% agarose gel by electrophoresis. Gene p40 like protein was found to be around

1.0 kb without introns while amplified from cDNA and around 2.5 kb with introns

while amplified from genomic DNA (Figure 5.2).


Chapter V

Figure 5.1: Amplification of Lipoxygenase gene from gDNA and cDNA.

Figure 5.2: Amplification of p40 like protein gene from gDNA and cDNA.


Chapter V

5.3.3 Gel elution of Lipoxygenase and p40 like protein genes Lipoxygenase and p40 like protein genes were re-amplified using brinjal cDNA

of 0 dpa fruit tissue by using the same PCR conditions, but the enzyme from Clontech

Advantage DNA polymerase as it has high fidelity and also it adds an 3’A at ends of

the amplified DNA fragments useful in TA cloning. The amplified products were

eluted from the agarose gel after gel electrophoresis (Figure 5.3; Figure 5.4).

5.3.4 Ligation of Lipoxygenase, p40 like protein genes in pGEMT-Easy vector

and transformation of E.coli DH5α cells using the ligation product After gel elution, the genes were checked on agarose gel and their concentration

determined from the band intensity by visual. According to the concentration of the

eluted products, the ligation reaction was prepared. E.coli DH5α cells were used for

transformation of the ligation products. The transformed positive clones were selected

using blue-white screening.

5.3.5 Colony PCR analysis

The positive colonies were re-streaked and checked for the presence of insert by

colony PCR with SP6 and T7 primers as the pGEMT-Easy vector contains T7 and SP6

promoters to which these primers can bind and amplify the insert ligated in between

them. The amplification products were analysed along with 1kb DNA ladder on 0.8%

agarose gel by electrophoresis (Figure 5.5; Figure 5.6).

5.3.6 Plasmid isolation and restriction digestion analysis Plasmid DNA was isolated from positive clones and analyzed the Plasmid DNA

on 0.8% agarose gel by electrophoresis along with 1 kb DNA ladder. Based on plasmid

concentration, restriction digestion reactions were kept with EcoRI. The restriction

digestion product was checked on 1.2% agarose gel and observed the presence of gene

of interest in the respective transformed clones.

5.3.6.1 SmLipoxygenase gene Four bands were observed upon EcoRI restriction digestion of plasmid DNA

isolated from Lipoxygenase gene (2.5 kb) colonies (#1 and #7). The observed 3.0 kb

fragment from pGEMT-Easy vector and the other 3 bands from Lipoxygenase gene,

which was cleaved internally due to the presence of two internal EcoRI sites. Thus,

colonies #1 and #7 of SmLipoxygenase gene were confirmed to be positive (Figure 5.7;

Figure 5.8).


Chapter V

Figure 5.3: Gel elution of Lipoxygenase gene

Figure 5.4: Gel elution of p40 like protein gene


Chapter V

Figure 5.5: Colony PCR analysis of Lipoxygenase gene

Figure 5.6: Colony PCR analysis of p40 like protein gene.


Chapter V

5.3.6.2 Smp40 like protein gene

Two bands were observed upon EcoRI restriction digestion of plasmid DNA

isolated from p40 like protein gene (1 kb) colonies #1, 5, 7, 8, 12 and 14. 3.0 kb

fragment was observed from the pGEMT-Easy vector and one more 1.0 kb fragment

from p40 like protein gene. Thus, all these colonies of p40 like protein gene were

confirmed to be positive (Figure 5.9; Figure 5.10).

5.3.7 Sequence analysis for Lipoxygenase and p40 like protein genes

The positive colonies obtained for each gene were outsourced for DNA

sequencing to confirm the presence of the gene of interest and its sequence. The

sequences obtained were matched with the original sequence for confirmation. For

Lipoxygenase gene, complete sequence could not be obtained as the size of the gene

was large (2.6 kb). The sequence of both the ends of the cloned gene fragment matched

with the original sequence but since the middle of the DNA could not the sequenced,

full length gene sequence could not be confirmed. Thus, new internal primers were

designed to sequence the middle part of the gene and the colonies were again send for

sequencing along with these new primers, the complete sequence was obtained and

matched 100% with the original gene sequence (Figure 5.11; Table 5.8). For p40 like

protein gene, the complete sequence of the clone matched 100% with the original gene

sequence. The clones from two genes was confirmed and used for further analysis

(Figure 5.12; Table 5.9).

5.3.8 Expression analysis of Lipoxygenase and p40 like protein genes by

Quantitative Real-Time PCR

Real-Time PCR was performed to check the expression level of Lipoxygenase

and p40 like protein genes at various stages of fruit development in both PPL and

KKM-1 varieties of brinjal using cDNA samples prepared from fruit tissue. SmAPRT

gene was used as the normaliser gene. The amplification plots obtained show low Ct

value for PPL variety as compared to KKM-1 variety, which infers that there is higher

amplification of p40 like protein in PPL variety. The dissociation curves obtained for

both the varieties show single peak and thus specific amplification. This shows that the

primers were working properly and did not observe any primer dimmers.


Chapter V

Table 5.8: Primers used for full length lipoxygenase gene isolation.

S. No

Gene Name Accession No.

Primer Sequence (F/R) Primer length (bp)

Tm (0C)

1 Lipoxygenase-F1 TC7446 5'-ggatccCCCTTATATTCATATCATCATG-3' 28 55

2 Lipoxygenase-R1 TC7446 5'-gagctcCTCCAGTGTCGACGATCTTCTTC-3' 29 62

3 Lipoxygenase-F2 TC7446 5’-GGAGGTTCTGCTGACTACCCGTATCCT-3’ 27 60

4 Lipoxygenase-R2 TC7446 5’-AACTCTCGTCTTCAACTGCTACTCCCC-3’ 27 59

Table 5.9: Primers used for full length p40 like protein gene isolation

S. No.

Gene Name

Accession No.

Primer Sequence (F/R) Primer length (bp)

Tm (0C)

1 P40 like protein-F1

TC9609 5’-ggatccGGGGAAGAAACAGAGTGCAACC-3’ 28 62

2 P40 like protein-R1

TC9609 5’-gagctcTGAAGAGCTTAAGGGAACAAGG-3’

28 61


Chapter V

Figure 5.7: Plasmid DNA isolated from pGEMT-Easy vector carrying

lipoxygenase.

Figure 5.8: Restriction digestion analysis of pGEM T-Easy vector carrying plasmid

isolated from lipoxygenase gene with EcoRI.


Chapter V

Figure 5.9: Plasmid DNA isolated from pGEM T-Easy vector carrying p40 like

protein gene

Figure 5.10: Restriction digestion analysis of pGEM T-Easy vector carrying p40 like

protein with EcoRI.


Chapter V

Figure 5.11: Full length lipoxygenase (TC7446) gene sequence.

>5’- ATGTTTGGTTCTATTATAGGGGGACTTACTGGTCATAATGACTCAAAAAAAG TAAAAGGAACTGTGGTGATGATGAAGAAAAATGCTTTAGATTTTACTGATCTTGCCGGTTCTTTAACTGATAAAATTTTTGAGGCTCTTGGACAAAAGGTCTCTTTTCAATTAATCAGTTCTGTTCAAGGTGATCCTGCAAATGGTTTACAAGGAAAACGTAGCAATCCAGCCTACTTGGAGAACTTCCTCTTTACTCTAACTCCATTAGCAGCAGGTGAATCAGCCTTTGGTGTCTCATTTGATTGGAATGAAGAATTTGGAGTTCCAGGAGCATTTATCATAAAAAATTCTCACATCAATGAATTCTTCCTCAAGTCACTCACTCTTGAAGATGTGCCTAATCATGGCAAGGTCCATTTTGTTTGCAATTCTTGGGTTTATCCTGCTTTTAGATACAAGACAGACAGAATTTTCTTTGCAAATCAGCCATATCTCCCAAGTGAAACACCAGAAACTTTGCGCAAATACAGAGAAAGTGAATTGCAAACTTTAAGAGGAGACGGAACAGGAAAGCGCGAGGAATGGGATAGGATTTATGACTATGATGTCTACAATGACTTGGGCAATCCAGATCAAGGTGCAGACCAAGTTAGAACTACCTTAGGAGGTTCTGCTGACTACCCGTATCCTCGTAGAGGAAGGACTGGTAGACCACCAACACGAAAAGATCCTAAAAGTGAAAGCAGGATTCCACTTATTCTGAGCTTAGACATCTATGTACCGAGAGACGAGCGCTTTGGTCACTTGAAGATGTCAGACTTCCTAACATATGCTTTGAAATCCATTGTTCAATTCATCCTCCCTGAATTACATGCCCTGTTTGACGGCACACCTAATGAGTTCGATAGTTTCGAGGATGTACTTAGACTATATGAAGGAGGGATCAAACTTCCTCAAGGTCCTTTATTCAAAGCTCTCACTGATGCTCTTCCTCTGGAGATGATAAGAGAACTCCTTCGAACAGACGGTGAAGGAATATTGAGGTTTCCAACTCCTCTCGTGATTAAAGATAGTAAAACCGCGTGGAGGACTGATGAAGAATTCGCAAGAGAAATGCTAGCTGGAGTCGATCCTGTCATAATAAGTAGACTCCAAGAATTTCCTCCAAAAAGCAAGCTAGATCCCCAAGCATATGGAAATCAAAACAGTACAATTACCGCGCAACACATAGAGGATAAGTTGGATGGACTATCGATTGATGAGGCGATCAACAATAATAAGATTTTCATATTGAACCATCATGACGTTCTAATACCATATTTGAGGAGGATAAACACTACAAACACAAAAACCTATGCCTCGAGAACTTTGCTCTTCCTGCAAGATAATGGATCTTTGAAGCCACTAGCGATTGAATTGAGTTTGCCACATCCAGATGGAGATCAATTTGGTGTTATTAGCAAAGTGTATACTCCAAGTGAACAAGGCGTTGAGGGCTCCATCTGGCAATTGGCCAAAGCTTATGTTGCAGTGAATGACTCTGGTGTTCATCAACTAATTAGTCATTGGCTGAATACACATGCGGTGATTGAGCCATTTGTGATTGCAACAAACAGGCAACTAAGTGTGCTTCACCCTATTCATAAACTTCTATATCCTCATTTCCGAGACACAATGAACATAAACGCTTTGGCAAGACAGATCCTAATCAATGCCGGTGGAGTTCTTGAGAGTACAGTCTTTCCATCCAAATATGCGATGGAAATGTCAGCTGTCATTTACAAAGACTGGGTTTTCCCTGATCAAGCCCTTCCGGCTGATCTTGTGAAAAGGGGAGTAGCAGTTGAAGACGAGAGTTCTCCTCATGGCGTTCGTTTACTGATAGAGGACTATCCATACGCTGTTGATGGCTTAGAAATCTGGTCTGCAATCAAAAGTTGGGTGACAGACTACTGCAATGTCTACTATGGATCGGACGAAGAGATTCTGAAAGACAATGAACTCCAAGCCTGGTGGAAGGAAATCCGAGAAGTAGGACATGGTGACAAGAAAGATGAGCCCTGGTGGCCTGAAATGGAAACGCCTCAAGAGCTAATCGATTCATGTACCACCATCATATGGATAGCTTCTGCACTTCATGCAGCAGTTAATTTTGGGCAGTATCCTTATGCAGGTTACCTCCCAAATCGCCCCACAGTAAGTCGAAGATTTATGCCAGAGCCAGGAACTCCTGAATATGAAGAACTAAAGAAGAATCCGGATAAGGCGTTCTTGAAAACAATCACTGCTCAGCTGCAAACATTGCTTGGTGTTTCACTCATAGAGATATTGTCAAGGCATACAACAGATGAGATTTACCTCGGACAAAGGGAATCCGCGGAATGGACAAAGGACAAAGAACCCCTTGCTGCTTTTGAAAGATTTGGAAAGAAGTTGACTGAGATTGAAAATCAGATTATACAGAGGAATGGTGACCAAATACTGAAAAACAGAACAGGTCCTGTTAATGCTGCATATACATTGCTTTTTCCGACAAGCGAAGGAGGACTTACAGGCAAAGGAATTCCCAACAGTGTGTCAATAT-3’


Chapter V

Figure 12: Full length p40 like protein (TC9609) gene sequence. >5' – ATGGCGACGCAGGATGTAAGGACTCTTTCGACTAAAGAAGCTGATATCCA

GATGATGTTGGCTGCTGAAGTCCATCTCGGCACTAAGAATTGTGATTTCCAAAT

GGAGCGTTACACTTTCAAGCGCCGAGACGATGGTATCTACATCATCAACCTTG

GAAAGACATGGGAGAAGCTTCAAATGGCCGCTAGGGTGATTGTTGCTATTGAG

AATGCTCAGGACATCATTGTCCAATCTGCCAGGCCATATGGACAGAGAGCTGT

CTTGAAGTTTGCACAATACACTGGTGCACATGCTATTGCTGGACGTCATACCCC

TGGTACTTTTACCAACCAGCTTCAGACCTCATACAGTGAGCCACGGCTCTTGAT

TCTCACTGATCCAAGAACTGACCATCAGCCAATTAAGGAAGCTGCACTTGGGA

ATATCCCAACTATTGCTTTCTGTGACACTGATTCTCCAATGCGCTATGTTGACA

TTGGCATCCCTGCCAATAACAAAGGAAAGCACAGCATCGGTGTTCTTTTCTGG

ATCTTAGCAAGGATGGTACTCCAAATGCGTGGGGCCATTAATCCAGGACATAA

ATGGGATGTCATGGTGGATCTCTTCTTTTACAGAGAGCCTGAAGAGGCAAAGG

AGCAAGAAGAGGAAGTAGTGCCTCCGATCGCAGATTTTCTAGCAGACTACCCT

GCTAGTGCTGCCCTTGGTGGTGACTGGTCTAGTAGCCAAATCCCTGAGGCGCA

ATGGACCGCTGATGCTGCTGCACCAGTTCCAGTAGGTGGTGGTTGGGCCGGAG

ATGGAGCTGATGGCGGATGGGACTCAGCAGCTGCTCCACCAGTTCCTCTACCA

ATTCCAGATGCCCCTACTTCTGGTGCCACAGGTGCCACAGGCTGGGAATGAG-3'


Chapter V

Upon the analysis of Ct values for each fruit deveopmental stage in both the

varieties, it was observed that the expression of Lipoxygenase and p40 like protein was

upregulated in PPL variety and downregulated in KKM-1 variety as compared to its

expression in their respective leaf samples (Figure 5.13; Figure 5.14).

5.3.9 Isolation of pBI121 binary vector

Plasmid DNA from pBI121 binary vector was isolated by alkaline lysis method

and checked the plasmid DNA along with 1 kb DNA ladder on 0.8% agarose gel by

electrophoresis. It was observed to be more than 10 kb (Figure 5.15).

5.3.10 Restriction digestion of pBI121 binary vector and p40 like protein gene

insert out from pGEMT-Easy vector

Plasmid DNAs from pBI121 binary vector and the pGEMT-Easy vector

carrying p40 like protein gene were isolated and digested with BamHI and SacI. While

digestion, 2.0 kb GUS gene fragment was released from pBI121 binary vector and

upper fragment (~12 kb) was gel eluted and purified. Whereas, digestion of the

pGEMT-Easy carrying p40 like protein gene plasmid isolated from colony #5 released

the p40 like protein (1 kb) gene. The restriction digestion products were checked along

with 1 kb DNA ladder on 0.8% agarose gel by electrophoresis (Figure 5.16).

5.3.11 Gel elution of restriction digested pBI121 binary vector and p40 like protein

gene

The restriction digested pBI121 binary vector and p40 like protein gene were

eluted from agarose gel after gel electrophoresis analysis. The eluted products were

checked along with 1 kb DNA ladder on 0.8% agarose gel by electrophoresis (Figure

5.17).


Chapter V

Figure 5.13: Expression analysis of lipoxygenase gene in different fruit

developmental stages of PPL and KKM-1 varieties of Brinjal compared with their expression of leaf tissue.

Figure 5.14: Expression analysis of p40- like protein gene in different fruit

developmental stages of PPL and KKM-1 varieties of Brinjal compared with their expression of leaf tissue.


Chapter V

Figure 5.15: Plasmid DNA isolated from pBI121 binary vector (14.7 kb).

Figure 5.16: Restriction digestion analysis of pGEM T-Easy vector carrying p40 like

protein gene and binary vector pBI121 with double digestion of BamHI and SacI.


Chapter V

Figure 5.17: Agarose gel electrophoresis analysis of gel eluted and purified product

of p40 like protein gene and pBI121 binary vector.


Chapter V

5.3.12 Ligation of p40 like protein gene in pBI121 binary vector and

transformation

The concentration of the eluted pBI121 binary vector and p40 like protein

product gene was determined from the gel by respective band intensity after agarose gel

electrophoresis analysis. Based on the concentration of the vector and the gene of

insert, the ligation reaction was kept and the ligation product was transformed to E. coli

DH5α competent cells by heat shock method. The transformed cells were selected on

LB agar plates containing kanamycin (50mg/l) (Figure 5.18).

5.3.13 Colony PCR analysis of pBI121 binary vector carrying p40 like protein

gene

The obtained positive colonies were re-streaked on LB plate containing

Kanamycin antibiotic and confirmed gene of insert in binary vector by colony PCR

using with gene specific primers. The amplification products were checked along with

1kb DNA ladder on 0.8% agarose gel by electrophoresis (Figure 5.19).

5.4 DISCUSSION

In the present work, two varieties of brinjal, differing in fruit shape, size and

colour, which are PPL having long and purple fruits and KKM-1 having round and

white fruits, were used to compare the expression of the genes in their fruit tissue at

various stages of fruit development to identify the fruit specific genes of brinjal.

Two genes, Lipoxygenase and p40 like protein were identified to be fruit

specific and found to be 2.5 and 1.0 kb, respectively. Yang et al. (2012) found that

Lipoxygenase genes are expressed in tissue specific manner and p40 like protein gene is

a uncharacterized gene. The full length genes was isolated by PCR amplification and

cloned into pGEMT-Easy vector transformed in to E. coli DH5α host cells. The

positive clones were obtained by blue- white screening and the presence of the insert

was confirmed using colony PCR, followed by plasmid isolation and restriction

digestion analysis.

The confirmed positive clones were sequenced and the sequence analysis was

done by various in silico tools. The sequence of the clones showed 100% match with

both the original sequence and the brinjal genomic sequence.


Chapter V

Figure 5.18a: Linear map of pBI121 binary vector carrying p40 like protein gene from

Brinjal.

Figure 5.18b: Circular map of pBI121 binary vector carrying p40 like protein gene

from Brinjal.


Chapter V

Figure 5.19: Agarose gel electrophoresis analysis shows colony PCR confirmation of

pBI121 binary vector carrying p40-like gene.


Chapter V

Quantitative real-time analysis was done for checking and comparing the

expression of Lipoxygenase and p40 like protein genes in both the varieties of brinjal at

different fruit developmental stages using the cDNA of fruit tissue of those stages.

Real-Time analysis showed up-regulation of genes in PPL variety, whereas it was

down-regulated in KKM-1 variety as compared to the expression in their respective

leaf samples. The Lipoxygenase gene was expressed in initial stages, where as the p40

like protein was expressed in later stages. This indicates that the expression of these

genes increases during fruit development in PPL variety whereas decrease in KKM-1

variety, as PPL has elongated fruit compared to round fruits of KKM-1, Lipoxygenase

and p40 like protein genes may have a role in fruit elongation.

The p40 like protein gene were insert out from pGEMT-Easy vector and ligated

to pBI121 binary vector at BamHI and SacI restriction sites. The constructed binary

vector were confirmed by multiple restriction digestion and colony PCR analysis and

purified binary vector DNA was mobilized in to Agrobacterium tumefaciens strain

EHA105 and confirmed the Agrobacterium strain harboring binary vector by colony

PCR analysis, which can then be used to generate transgenics by Agrobacterium-

mediated genetic transformation.

5.5 CONCLUSION

From the quantitative real-time analysis of the expression of Lipoxygenase and

p40 like protein genes in both the varieties of brinjal at different stages of fruit

developmental stages, as increase in the expression of Lipoxygenase and p40 like

protein genes was observed at all stages of fruit development in PPL variety of brinjal,

whereas a decrease in the expression of Lipoxygenase and p40 like protein genes was

observed in KKM-1 variety at all stages of fruit development. Since PPL variety has

elongated purple fruits and KKM-1 has round white fruits, it can be inferred that the

Lipoxygenase and p40 like protein genes may be involved in the elongation of fruits.

Therefore due to increase in expression of Lipoxygenase and p40 like protein genes in

PPL during fruit development the fruits become elongated, whereas due to decrease in

its expression in KKM-1 the fruits remain round and small. The Agrobacterium strain

harboring the binary vector carrying p40 like protein gene can be used to generate

transgenic plants to validate the fruit specificity and the role of this


Summary and Conclusion

6.1 Introduction

Brinjal (Solanum melongena L.) is the third most important solanaceous crop

species after potato and tomato. Unripe brinjal fruit is primarily consumed as cooked

vegetable in various ways. It is low in fats, contains mostly water, some protein,

carbohydrates and fibre. It is a good source of minerals and vitamins and is rich in total

water soluble sugars, free reducing sugars, amide proteins among other nutrients.

Despite the economic importance of brinjal as a crop, little research has been done to

understand the molecular basis of brinjal fruit development. Fruit development and

ripening is a complex phenomenon which is unique to plant species and involves a

series of physiological, biochemical and organoleptic changes that alter the fruit colour,

size, aroma, shape and nutritional values. These changes are a combination of events,

which are under strict genetic control and influenced by several environmental

conditions. To gain detailed insights into molecular mechanism of brinjal fruit

development and ripening, 10 reciprocal Suppression Substractive Hybridization (SSH)

libraries from five stages were prepared from Pusa Purple Long (PPL) and Killikulam-

1 (KKM-1) varieties of brinjal, which are distinct from each other in fruit shape, size

and colour. In this study, 2122 ESTs (JZ715513-JZ717572 and JZ722901-JZ722962)

from five fruit developmental stages were generated from both varieties, to identify the

tissue and variety specific genes. The results obtained in this study have been

summarized in the following objectives.

6.2 Generation, sequencing and annotation of EST libraries from different

fruit developmental stages of two contrasting Brinjal varieties (PPL VS.

KKM-1) by Suppression Subtractive Hybridization (SSH) method.

A large number of the identified genes varied in their level of expression during

the course of fruit development and ripening in varieties studied. This reflects the

occurrence of a massive genetic re-programming in studied varieties of brinjal. These

genes expressed in a stage-specific manner, which implicates their involvement in

physiological process which takes place only at specific developmental stages. This



study extended our understanding of the global and dynamic changes during brinjal

fruit development and ripening.

Differences present at initial floral tissue and organ development are

responsible for final size and shapes of the fruits. Flowers are produced in the plants

through floral meristem activity and this is different from vegetative meristem. MADS

box C-, D-, and E-type proteins are responsible for flower determinacy within the floral

meristem to control the stem cell population. In present data, mini zinc finger protein 2-

like was expressed in 10 dpa PPL and KKM-1, this gene may involve in ovule

development. To control the number of carpels during the floral development, IMA

inhibits cell proliferation during floral termination and act as a repressor of the

meristem organizing centre gene WUSCHEL. MADS-box genes are ubiquitous among

eukaryotes and play fundamental roles in floral determination and fruit development. In

this data, we found MADS-box encoded gene, MADS-box transcription factor 6-like in

0 dpa of KKM-1, Agamous-like MADS-box protein AGL9 homolog in 10 dpa of

KKM-1, MADS-box protein present in 20 dpa of KKM-1 and SEPALLATA1-like

MADS-box gene in 50 dpa of PPL. Differential expression of these MADS-box genes

suggest their role in fruit bulging in KKM-1. Plant reproductive development is

affected by zinc finger motif containing nucleic acid binding proteins. In this data, zinc

finger CCCH domain-containing protein 29-like gene is expressed at 0 dpa in KKM-1

and 30 dpa of PPL, zinc finger protein 2 is expressed at 20 dpa in KKM-1, zinc finger

hit domain-containing protein 2 is expressed at 30 dpa in KKM-1 and b-box type zinc

finger family protein is expressed at 0 dpa in PPL and it may be involved in stamen and

carpel formation. WRKY zinc-finger transcription factors also have been shown to be

involved in trichome and seed coat development. In this experiment probable, WRKY

transcription factor 40 expressed in 30 dpa of KKM-1 and WRKY transcription factor

was expressed at 50 dpa in PPL.

Phytohormones such as auxin and gibberellic acid play a major role in fruit

development and for the co-ordination of cell division and expansion during the early

stages of this process. However, fruit set is regulated by not only positive growth

factors, but also by negative regulators. Auxin response factors (ARFs) are

transcriptional activators and repressors which bind to the specific site TGTCTC



present in promoters of primary or early auxin response genes. In parthenocarpic

transgenic lines, auxin-regulated cell division phase was bypassed and fruit growth

mainly depended on cell expansion. Ethylene and ABA also plays an important role in

regulation of fruit set and development through a complex network. In this study,

Auxin responsive factor 5 was expressed in 0 dpa of PPL variety, it may be involved in

fruit set of brinjal where as auxin-induced protein 15a-like and auxin-responsive

protein IAA16 was expressed at 30 dpa in KKM-1, which may be involved in further

growth of brinjal fruit.

Both, early enlargement of the brinjal fruit driven by cell expansion and latter

ripening process requires the presence of expansins to loosen the cell walls. Expansins

induce the plant cell wall extension by disrupting non covalent interactions between

hemicellulose and cellulose micro fibrils. Several genes encoding expansins were

detected in the present study and their expression was higher at the latter stages of fruit

development and ripening. Expansin partial and expansin 2 genes present in 30 dpa of

PPL may contribute for its elongated shape of PPL fruit variety.

A major group of the differentially expressed genes during brinjal fruit

development and ripening are involved in cell wall modification, as major textural

changes associated with the softening of fruit are due to enzyme-mediated alterations in

the structure and composition of the cell wall. Changes in the activity of several cell

wall-related genes were known to result in the abnormal development of fruit sac.

Pectins and hemicelluloses typically undergo solubilisation and depolymerisation

during the fruit softening, which contribute to cell wall loosening and disassembly.

During the green stages, solid synthesis of methyl-esterified pectin and the increase in

cell number and volume underline the presence of high pectin methylesterase activity at

early stages in fruit. In fruit softening, pectin methylesterase plays an important role

due to the hydrolysis of methyl ester groups in cell wall pectins. In this data, cell wall-

related genes like pectin methylesterase, probable pectinesterase 53, probable

pectinesterase inhibitor 34 and probable pectinesterase inhibitor 12 were observed.

Pectin methyl esterase was expressed only in 0 dpa of PPL where as in 10, and 30 dpa

of both PPL and KKM-1, probable pectinesterase 53 was expressed in 20 dpa of PPL,

probable pectinesterase inhibitor 34 expressed in 30 dpa of PPL, probable



pectinesterase inhibitor 12 expressed in 30 dpa of KKM-1. Here as brinjal is non-

climacteric, expression of the gene encoding the pectin esterase genes expressed up to

30 dpa and down-regulated during the ripening (50 dpa) in both PPL and KKM-1

varieties of brinjal. The hemicellulose xyloglucan is a common component of the cell

wall, and is hydrolysed and transglycosylated by xyloglucan endotransglycosylase

hydrolase in growing tissues and ripening fruits. Here xyloglucan endotransglucosylase

hydrolase protein 9 was expressed in 10 dpa of PPL and KKM-1 where as xyloglucan

endotransglycosylase was expressed at 50 dpa in PPL. Likewise, probable xyloglucan

endotransglucosylase hydrolase protein 8-like was expressed in 30 dpa of KKM-1 and

xyloglucan:xyloglucosyl transferase, putative and xyloglucan endotransglucosylase-

hydrolase XTH7 were expressed at 30 dpa in PPL variety. It was suggested that

polygalacturonase, a cell wall degrading enzyme, mRNA of which is developmentally

regulated during tomato fruit ripening. In this data, probably polygalacturonase-like

gene was expressed in 30 dpa of KKM-1, exactly after which colour of KKM-1 fruit

turn yellow from egg white and fruit get little soften. Expression of cell wall related

enzymes in fruit development and ripening indicate it’s probable role in cell wall

degradation during fruit maturation and ripening related changes.

Aquaporins or major intrinsic proteins have a central role in metabolism in fruit

cells and determining fruit size through water transport into fruit cells and vacuoles.

The aquaporin family is mainly classified into four subfamilies: plasma membrane

intrinsic protein (PIP), tonoplast intrinsic protein (TIP), NOD26-like intrinsic protein

(NIP) and small basic intrinsic protein (SIP). In this data, plasma membrane intrinsic

protein 1b was present at 30 dpa of PPL; major intrinsic protein 2 was present in 10, 20

and 30 dpa of KKM-1. Recent studies suggested the role of aquaporins in

transportation of other molecules than water like CO2, H2O2, glycerol, ammonia and

boron. Aquaporin related genes like probable aquaporin tip1-1 present in 10 dpa of

KKM-1, 20 dpa of KKM-1and 50 dpa of PPL, probable aquaporin PIP-TYPE PTOM75

was present in 10, 20 and 30 dpa of PPL and 20 dpa of KKM-1, aquaporin PIP2-1-like

was present in 30 dpa of KKM-1 and aquaporin PIP2-4-like gene is present in 50 dpa

of PPL. This shows delayed expression of these genes in PPL as compared with KKM-

1. Over ally, water channel proteins are highly expressed in KKM-1 which may be a

cause of bulged and round shape of KKM-1. In this study, ABC transporter F family



member 1-like was expressed in 0 and 50 dpa of PPL and 30 dpa of KKM-1 variety.

ABC transporters of multidrug resistance-associated protein (MRP) subfamily along

with glutathione transferases are anthocyanin transporters and these might be

implicated in fruit pigmentation in PPL.

For fruit quality, the vacuole is important organelle because of its large size and

the compounds stored in vacuole at high concentrations are responsible for taste and

flavour such as sugars, organic acids and secondary metabolites. Secondary metabolites

such as phenolics, main flavonoids, terpenoids and alkaloids are the main compounds

responsible for flavours and tastes of fruits. Secondary metabolites responsible for

flavours are often unique to particular fruit but sugars and organic acids are common in

many fruits. This material is to be transported into the vacuole by specific transporters

such as proton pumps, aquaporins, sugars, organic acid and secondary metabolite

transporters. Fruit specific vacuolar H+-ATPase (V-ATPase) has unique properties that

increases in fruit size and contributes to fruit enlargement and accumulation of sugar

and organic acids. In this data V-type proton ATPase subunit E1-like, V-type proton

ATPase 16 kDa proteolipid subunit is present in 20 dpa of KKM-1 and V-type proton

ATPase 16 kDa proteolipid subunit C1 present in 50 dpa of PPL. This differential

expression of V-ATPases may contribute to differential fruit sugar and/or organic acid

accumulation. In fruit, alcohol dehydrogenases involved in aroma volatiles biosynthetic

pathway by inter converting aldehydes to alcohols and to form the esters for substrates

and expressed in developmental tissues particularly during fruit ripening. In both

climacteric and non-climacteric fruit, ethylene is regulated by the same alcohol

dehydrogenases. In this experiment quinone oxidoreductase-like protein 2 homolog

was expressed in 50 dpa of PPL and this gene may be involved in aroma production

during fruit ripening.

Ripening physiology has been classically defined as either ‘climacteric’ or

‘non-climacteric’. Climacteric fruits show a sudden increase in respiration at the onset

of ripening, usually in concert with increased production of the gaseous hormone

ethylene. Whereas, non-climacteric fruits do not increase respiration at ripening, and

often have no requirement for ethylene to complete maturation. The responsiveness of

some non-climacteric fruits to ethylene, particularly in the area of colour development,



is well documented. In this data we observed ethylene synthesis related genes like 1-

aminocyclopropane-1-carboxylate oxidase 1 in 30 dpa of KKM-1 and 50 dpa of PPL,

S-adenosylmethionine partial, S-adenosyl-l-methionine: salicylic acid carboxyl

methyltransferase and ethylene-responsive transcription factor RAP2-4-like in 50 dpa

of PPL and ethylene-responsive transcription factor 5-like in 30 dpa of KKM-1. Based

on these observations, ethylene may be playing some role in brinjal, a non-climacteric

fruit at least some aspects of ripening and also differentially in these two varieties.

Simple Sequence Repeats (SSRs) also identified from obtained EST data.

Microsatellites (SSRs) are short tandem repeats of simple (1–6nt) motifs, and their

value for genetic analysis lies in their multi-allelism, codominant inheritance, relative

abundance, genome coverage and suitability for high-throughput PCR-based platforms.

Earlier it was long believed that SSRs were associated only with non-coding DNA, but

now it is clear that they are also present in the coding region of the genome. These

SSRs are commonly referred to as "genic SSRs" or "EST-SSRs" and are present in 1 to

5% of the expressed plant DNA sequence. They provide a powerful means to link the

genetic maps of related species, and since many of them are located within genes of

known or at least putative function, any allelic variation present can be exploited to

generate perfect markers. Very few reports have been available to determine the genetic

diversity in brinjal at the cDNA level. As for the other Solanaceae crop species (potato,

tomato and pepper), the level of intra-specific polymorphism appears to be rather

limited, and so it is important that an effort is made to develop more informative cDNA

markers to make progress in understanding the genetics of brinjal and to advance its

breeding. In this study, the abundance of SSRs in two varieties PPL and KKM-1 shows

the motifs AC/CT/TG, and AAG/AGA/CTT/CAC/ATT were the predominant di-, and

tri-nucleotide SSRs, respectively. The majority of di- and tri-nucleotide SSRs contained

6–10 repeats. The comprehensive SSR survey data presented here demonstrates the

potential of in silico mining of ESTs for rapid development of SSR markers for genetic

analysis and applications in solanaceae crops.



6.3 Evaluation of suitable reference genes for normalization of qRT-PCR gene

expression during fruit development stages in Brinjal

(Solanum melongena L.)

For rapid and reliable quantification of gene expression, the quantitative real-

time RT-PCR (qRT-PCR) is currently one of the most sensitive tools that contributes to

substantial improvement in the understanding of gene functions. The accuracy and

reliability of the quantitative gene expression analysis is mainly affected by one of the

key factor called normalization. To normalize the gene expression data, endogenous

reference genes are used to achieve reliable results. The selection of stable reference

genes may vary among different species, different varieties, experimental conditions

and tissues tested. Prior to gene expression study, there is a need to validate reference

genes in targeted tissues.

This study describes a comprehensive analysis on the validation of brinjal

candidate reference genes for normalization of gene expression data during fruit

developmental stages. This analysis was based on geNorm and NormFinder algorithm

for determination of the expression stability. Analysis by both geNorm and

NormFinder showed some differences, especially in the stability ranking of stable

reference genes. This divergence is probably due to the differences in the statistical

algorithms for each program. The geNorm determines the reference gene stability in

specific experimental set of tissues by pair-wise comparison of expression ratio

variation among reference genes and also provides information on the optimal number

of genes in a given experimental dataset. The sensitivity to co-regulation is the main

limitation in geNorm and similar expression patterns of co-regulated genes might not

stably express in different tissues but these genes may have similar M values in the

pair-wise approach. The genes selected from different cellular function and many of

these genes are yet to be fully characterized, keeping open the possibility that some of

the selected genes may be co-regulated. With this in mind, for complement the analysis

of reference gene stability another method such as NormFinder was used. NormFinder,

measures the overall expression variation and variation across sample in order to

reduce sensitivity towards co-regulation. However, NormFinder also has some

limitations. Many studies reported that it does not account for systematic errors during

sample preparation. The stability of candidate reference genes was determined in order



to overcome different limitations of each software program, based on the consensus

ranking from all different computation programs for gene expression normalization

under different fruit developmental stages tested in brinjal.

Interestingly, across different stages of the fruit development of brinjal (fruit

initiation to ripening), 2 genes namely SAND and Expressed were selected as ideal for

normalization of the gene expression. Ubiquitin expression was found to be less stable

with ranking of 21 from the consensus rankings in the brinjal fruit developmental

tissues arrangement. For normalization, these observations further strengthen the

necessity to analyze the stability of candidate reference genes as suitable references, as

the best normalizer gene varied depending on experimental conditions. Besides that,

18S rRNA, APRT and Cyclophilin have been previously reported as the most stable

normalization factors in brinjal vegetative tissues (Leaf, shoot, root, bud and flower)

using geNorm, NormFinder and BestKeeper. Our study indicated that 18S rRNA, APRT

and Cyclophilin were not the most stable genes in the brinjal fruit development tissues

tested. This experiment also demonstrated that the tissues of the plants also affect

selection of reliable reference genes as normalization factors.

Among the top reference genes, SAND was determined as the most stable

reference gene followed by Expressed gene and TBP. The SAND gene expressed in all

of the brinjal growth and developmental stages (Leaf, pollen, flower, petal, sepal, root,

shoot and seed). The SAND domain protein ULTRAPETALA1 acts as a trithorax group

factor to regulate cell fate in plants. This gene is commonly used as a reference gene in

plants due to its high expression in active tissues. Another stable candidate reference

gene, Expressed is an uncharacterized gene and previous studies proofed that this gene

is a suitable reference gene for tomato and buckwheat gene expression study. TBP, a 3rd

ranked stable candidate reference gene is a transcription factor, which is shown to be a

suitable reference gene for papaya in different experimental conditions.

The expression stability of commonly used housekeeping genes including

Ubiquitin, elongation factor, GAPDH, Actin, 18S rRNA and Tubulin were also tested in

this study. The results showed that, the above-mentioned genes are unsuitable reference

genes across all fruit developmental stages in brinjal. The expression stability of



Ubiquitin was ranked the late in geNorm and NormFinder in different fruit

developmental stages, while the elongation factor, GAPDH and Actin was ranked in the

middle. Earlier studies used that Ubiquitin as a best normalizer gene for gene

expression study in cotton plants under drought stress, bud, flower, fruit, fibre

development and somatic embryogenesis and also showed expression stability in

pepper under abiotic and hormonal stress treatments. However, a report in soybean

showed that Ubiquitin gene was not a good normalizer gene for gene expression

analysis. Earlier studies proved that in tobacco, during development and abiotic stress

conditions Elongation factor was the suitable normalizer gene. Likewise, GAPDH has

been reported as a stable reference gene in coffee, Brassica juncea and strawberry

plants under different experimental conditions. However, tomato, soybean and peach

studies have reported that GAPDH is not recommended for normalization of gene

expression.

Finally, the suitability of reference genes was identified in this study were

validated through an assessment of the expression profiles of fatty acid metabolism

related gene namely lipoxygenase across brinjal fruit developmental stages. Brinjal fruit

is susceptible to many biotic and abiotic stresses during development. However, the

functions of lipoxygenase family genes in response to fruit development in brinjal

remain unclear. These gene expressions were normalized using 2 different

combinations of reference genes; first set consisted of best reference genes, SAND and

Expressed, while the other set consisted of least stable reference gene with low ranking

Ubiquitin. In this study, the lipoxygenase transcripts expressed up to 20 dpa and the

expression declined relatively at 30 and 50 dpa. The changes in lipoxygenase transcript

expression at breaker stage of fruit development and it encodes an enzyme catalyse the

dioxygenation of polyunsaturated fatty acids in lipids containing a cis,cis-1,4-

pentadiene structure. It may be involved in a number of diverse aspects of plant

physiology including growth and development, senescence or responses to wounding.

A difference observed in relative expressions of lipoxygenase normalized by reference

genes with different stabilities indicated that selection of validated stable reference

genes is crucial for normalization of qRT-PCR gene expression data that prevent bias

and misinterpretation of qRT-PCR data. The present study demonstrated that use of


http://en.wikipedia.org/wiki/Dioxygenation

http://en.wikipedia.org/wiki/Polyunsaturated

http://en.wikipedia.org/wiki/Fatty_acids

http://en.wikipedia.org/wiki/Lipid

http://en.wikipedia.org/wiki/Pentadiene


these validated genes for normalization in qRT-PCR analysis of gene expression data

will improve the sensitivity and reproducibility of the results in brinjal in near feature.

6.4 Characterization of antioxidant genes during fruit development and

ripening in Brinjal (Solanum melongena L.)

Fruit development and ripening is a complex process as in which many

physiological and biochemical changes occur. Fruit ripening has been described as a

controlled oxidative process whereby ROS accumulation is balanced by the activity of

cellular antioxidant systems. These free radicals disturb normal metabolism by

peroxidizing membrane lipids and denaturing proteins and nucleic acids. Plants have an

endogenous mechanism to protect cellular and subcellular systems from the cytotoxic

effects of ROS. These include up-regulation of antioxidant enzymes such as

Glutathione reductase(GR), Peroxidase (PO), Superoxide dismutase (SOD), Catalase

(CAT), Ascorbate peroxidase (AP), Potassium uptake(KUP) and Plasma membrane

H+ATPase (PMATPase). Peroxidase participates in hormone catabolism, phenol

oxidation, polysaccharides and cell wall proteins intercrossing, lignin polymerization,

fruit ripening and defense against pathogens. During fruit ripening, peroxidase activity

is increased along with the polygalacturonase and cellulase enzymes. In this study,

Peroxidase was up-regulated at all the stages of PPL and highest expression was

observed at ripening stage. However in KKM-1, expression of Peroxidase did not

change significantly. These disparities may be derived from the differences in shape

and size of brinjal cultivar. Catalase is responsible for the dismutation of hydrogen

peroxide into oxygen and water in the peroxisomes, protecting the cell from the

deleterious effects of hydrogen peroxide accumulation. In this study, we observed that

both CAT 1 and CAT 2 were up-regulated at early stages of fruit development in both

cultivars of brinjal which suggests its important role in detoxification of H2O2 during

early stages of fruit development. However, the expression of CAT 1 was very high in

PPL at ripening stage (50 dpa) which suggests its role during brinjal fruit ripening.

Superoxide dismutase catalyzes the dismutation of superoxide radicals in a broad range

of organisms, including plants. The dismutation of superoxide into hydrogen peroxide

and oxygen constitutes the first line of cellular defense to prevent undesirable

biological oxidation by oxygen radical generated during cellular metabolism. In this

study, Superoxide dismutase was up-regulated at 5 and 10 dpa in PPL that suggests its



very important role in preventing cell cycle arrest by detoxifying superoxide into H2O2

and oxygen. However, Superoxide dismutase expression did not change significantly in

KKM-1 throughout the fruit development and ripening.

Ascorbate peroxidase is one of the key enzymes in the ascorbate-glutathione

cycle. It uses two molecules of ascorbate to reduce H2O2 to water, with the concomitant

generation of two molecules of monodehydroascorbate. It plays an important role in

scavenging and protecting cells against the toxic effects of H2O2 in higher plants. In

this study, Ascorbate peroxidase was up-regulated at early and ripe stages of fruit

development in both cultivars. Hydrogen peroxide can also be converted into water by

ascorbate-glutathione cycle which involves successive oxidations and reductions of

ascorbate, glutathione and NADPH. Glutathione reductase plays a very important role

in this cycle and converts oxidized glutathione to glutathione by utilizing NADPH. This

study showed that the expression of Glutathione reductase was significantly altered

only at 5 dpa in PPL. Plasma membrane H+ATPase is involved in broad range of

physiological responses that play a central role in the growth and development of

plants. It maintains extracellular and intracellular pH of cell and affect auxin-induced

growth by acidification of the cell wall, causing loosening of the wall, which allows

turgor-driven expansion of the cell. In this study, PMATPase was up-regulated at all

stages of fruit development except 50 dpa in PPL which specifies its role in cell

enlargement. Up-regulation of PMATPase creates electrochemical gradient of protons

across the membrane and causes uptake of water into cell. Electrochemical gradient and

uptake of water are considered to be very important in the expansion of cells that leads

to fruit enlargement. PMATPase expression does not significantly alter in white round

cultivar suggests that PMATPase are more important for cell elongation in long cultivar

than round one. KUP family is involved in potassium transport and localized at

different membranes. KUP 2 is predominantly expressed in rapidly growing tissues and

plays a role in cell expansion. In growing tissues, it is involved in maintaining

cytoplasmic potassium levels and/or turgor regulation.



6.5 Isolation and characterization of fruit specific genes in Brinjal

In this study, two varieties of brinjal PPL and KKM-1, which are differing in

fruit shape, size and colour, were used to compare the expression of the genes in their

fruit tissue at various stages of fruit development to identify the fruit specific genes of

brinjal. Few genes were identified to be fruit specific. Out of which, Lipoxygenase and

p40 like protein genes were found to be 2.5 and 1kb in length, respectively. Full length

genes were isolated by PCR amplification and cloned into pGEM T-Easy vector of E.

coli DH5α host cells. The positive clones were obtained by blue- white screening and

the presence of gene of insert was confirmed using colony PCR followed by plasmid

isolation and restriction digestion analysis.

The confirmed positive clones were sequenced and the sequence analysis was

done by various in silico tools. The sequence of the clones showed 100% match with

both the original and the brinjal genomic sequence. Quantitative real-time PCR analysis

was done for checking and comparing the expression of Lipoxygenase and p40 like

protein genes in both the varieties of brinjal at different fruit developmental stages

using cDNA samples of fruit tissue of those stages. Real-time analysis showed up-

regulation of genes in PPL variety, whereas down-regulation in KKM-1 variety as

compared to the expression in their respective leaf samples. This indicates that the

expression of Lipoxygenase and p40like protein genes were increased during fruit

development in PPL whereas decrease in KKM-1 variety, as PPL has elongated fruit

compared to round fruits of KKM-1, Lipoxygenase and p40 like protein genes may

have a role in fruit elongation and these both genes were inserted out from pGEM T-

Easy vectors, restricted with BamHI/SacI and cloned into corresponding sites of

pBI121 binary vector. The binary plasmid DNA carrying both genes was individually

mobilized into Agrobacterium tumefaciens strain EHA105 and confirmed the

Agrobacterium strain harboring the binary vectors by colony PCR analysis. Both

strains can be used for Agrobacterium-mediated genetic transformation of brinjal to

manipulate the fruit structure.


References

Acciarri N, Restaino F, Vitelli G, Perrone D and Zottini M (2002) Genetically modified parthenocarpic eggplants: improved fruit productivity under both greenhouse and open field cultivation. BMC Biotechnology 4: 1472-6750.

Acciarrin N, Donzella G, Restaino F, Vitelli G, Perrone D, Spena A, Zottini M and Rotino GL (2001) Transgenic parthenocarpic eggplant, an overview on greenhouse and open field trails. Proceedings of the 11th Eucarpia meeting on Genetics on Breeding of Capsicum and Eggplant 112-116.

Aharoni A, Keizer LCP, Van den Broeck HC, Blanco- Portales R, Munoz-Blanco J, Bois G, Smit P, De Vos R and O´Connell AP (2002) Novel insight into vascular, stress, and auxin-dependent and -independent gene expression programs in strawberry, a non climacteric fruit. Plant Physiology 129: 1019-1031.

Amemiya T, Kanayama Y, Yamaki S, Yamada K and Shiratake K (2006) Fruit specific V-ATPase suppression in antisense transgenic tomato reduced fruit development and its seed formation. Planta 223: 1272-1280.

Amil-Ruiz F, Garrido-Gala J, Blanco-Portales R, Folta KM, Munoz-Blanco J and Caballero JL (2013) Identification and validation of reference genes for transcript normalization in strawberry (Fragaria ananassa) defense responses. PLoS ONE 8(8): e70603.

Anand T, Ghaskaran R, Raguchander T, Samiyappan R, Prakasan V and Gopalakrishnan C (2009) Defence responses of chilli fruits to Colletotrichum capsici and Alternaria alternata. Plant Biology 53: 553-559.

Andersen CL, Jensen JL and Orntoft TF (2004) Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Research 64: 5245-5250.

Andersen JR and Lubberstedt T (2003) Functional markers in plants. Trends in Plant Science 8: 554-560.

Arpaia S, Mennella G, Onofaro V, Perri E and Sunseri F (1997) Production of transgenic eggplant (Solanum melongena L.) resistant to Colorado potato beetle (Leptinotarsa decemlineata Say). Theoretical Applied Genetics. 95: 329-334.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. i

References

Artico S, Nardeli SM, Brilhante O, Grossi-de-Sa MF and Alves-Ferreira M (2010) Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data. BMC Plant Biology 10: 49.

Artsaenko O, Kettig B, Fiedler U, Conrad U and During K (1998) Potato tubers as a bio factory for recombinant antibodies. Molecular Breeding 4: 313–319.

Arumuganathan K and Earle E (1991) Nuclear DNA content of some important plant species. Plant Molecular Biology Reporter 3: 208-218.

Asada K (1999) The water-water cycle in chloroplasts: scavenging of active oxygens and dissipation of excess photons. Annual Review of Plant Physiology and Plant Molecular Biology 50: 601-639.

Aubert S, Daunay MC and Pochard E (1989) Saponosides steroidiques de l'aubergine (Solanum melongena). I. Interet alimentaire, methodologie d'analyze, localisation dans le fruit.Agronomie 9:641–651.

Barchi L, Lanteri S, Portis E, Acquadro A, Vale G, Toppino L and Rotino GL (2011) Identification of SNP and SSR markers in eggplant using RAD tag sequencing. BMC Genomics 304: 1471-2164.

Barsalobres-Cavallari C, Severino FE, Maluf MP and Maia IG (2009) Identification of suitable internal control genes for expression studies in Coffea arabica under different experimental conditions. BMC Molecular Biology 10: 1.

Bewley JD and Black M (1994) Seeds: Physiology of development and germination. New York: Plenum Publishing Corporation.

Biles LC, Bruton DB, Zhang XJ and Russo V (2000) Characterization of muskmelon fruit peroxidases at different developmental stages. Biologia plantarum 43: 373-379.

Bird RE, Hardmann KD, Jacobson JW, Johnson S, Kaufman BM, Lee S, Lee T, Pope SH, Riordan GS and Whitlow M (1988) Single-chain antigen-binding proteins. Science 242:423-426.

Blanc G and Wolfe KH (2004) Functional Divergence of Duplicated Genes Formed by Polyploidy during Arabidopsis Evolution. The Plant Cell, 16: 1679-1691.

Bluthgen N, Brand K, Cajavec B, Swat M and Herzel H (2005) Biological profiling of gene groups utilizing gene ontology. Genome Informatics 16: 106-115.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. ii

References

Borek C (1991) Antioxidants and cancer, science and medicine. The baby-boomer’s guide New Canaan connecticus keats publishing, 4: 51-61.

Brummell DA, Dal Cin V, Crisosto CH and Labavitch JM (2004) Cell wall metabolism during maturation, ripening and senescence of peach fruit. Journal of Experimental. Botany. 55: 2029-2039.

Brummell DA, Harpster MH, Civello PM, Palys JM and Bennett AB (1999) Modification of expansion protein abundance in tomato fruit alters softening and cell wall polymer metabolism during ripening. The Plant Cell. 11: 2203-2216.

Bustin SA (2002) Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. Journal of Molecular Endocrinology, 29: 23-39.

Cacao SM, Leite TF, Budzinski IG, dos Santos TB and Scholz MB (2012) Gene expression and enzymatic activity of pectin methylesterase during fruit development and ripening in Coffea arabica L. Genetics and Molecular Research. 11(3): 3186-97.

Carles CC and Fletcher JC (2009) The SAND domain protein ULTRAPETALA1 acts as a trithorax group factor to regulate cell fate in plants. Genes and Development 23: 2723-2728.

Cassan-Wang H, Soler M, Yu H, Camargo EL O, Carocha V and Ladouce N (2012) Reference genes for high-throughput quantitative reverse transcription–PCR analysis of gene expression in organs and tissues of Eucalyptus grown in various environmental conditions. Plant Cell Physiology 53(12): 2101-2116.

Catala C, Rose JKC, York WS, Albersheim P and Darvill AG (2001) Characterization of a tomato xyloglucan endotransglycosylase gene that is down-regulated by auxin in etiolated hypocotyls. Plant Physiology 127: 1180-1192.

Chandna R, Augustine R and Bisht NC (2012) Evaluation of candidate reference genes for gene expression normalization in Brassica juncea using Real Time Quantitative RT-PCR. PLoS ONE 7(5): e36918.

Chen JC, Jiang CZ, Gookin TE, Hunter DA, Clark DG and Reid MS (2004) Chalcone synthase as a reporter in virus-induced gene silencing studies of flower senescence. Plant Molecular Biology 55: 521-530.

Choudhary B (1976) Vegetables (4th edition). New Delhi: National Book Trust 50-58.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. iii

http://www.ncbi.nlm.nih.gov/pubmed?term=Ca%C3%A7%C3%A3o%20SM%5BAuthor%5D&cauthor=true&cauthor_uid=23007997

http://www.ncbi.nlm.nih.gov/pubmed?term=Leite%20TF%5BAuthor%5D&cauthor=true&cauthor_uid=23007997

http://www.ncbi.nlm.nih.gov/pubmed?term=Budzinski%20IG%5BAuthor%5D&cauthor=true&cauthor_uid=23007997

http://www.ncbi.nlm.nih.gov/pubmed?term=dos%20Santos%20TB%5BAuthor%5D&cauthor=true&cauthor_uid=23007997

http://www.ncbi.nlm.nih.gov/pubmed?term=Scholz%20MB%5BAuthor%5D&cauthor=true&cauthor_uid=23007997

http://www.ncbi.nlm.nih.gov/pubmed/23007997


References

Cleland RE (1987) Auxin and cell elongation. In PJ D,wies, ed, Plant Hormones and Their Role in Plant Growth and Development. Martinus Nijhoff, Dordrecht, The Netherlands, pp. 132-148.

Collonnier C, Fock I, Kashyap V, Rotino GL, Daunay MC, Lian Y, Mariska IK, Rajam MV, Servaes A, Ducreux G and Sihachakr D (2001) Applications of biotechnology in eggplant. Plant Cell Tissue and Organ Culture 65: 91–107.

Conesa A, Gotz S, García-Gomez JM, Terol J and Talon M (2005) Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics applications note 21: 3674-3676.

D’Arcy WG (1991) The Solanaceae since 1976 with a review of biogeography. In: Hawkes JG, Lester RN, Nee M and Estrada-Ramos N (Eds) Solanaceae III: Taxonomy, chemistry, evolution. Kew, UK: Royal Botanic Gardens 75–138.

Dale JW and Schantz MV (2002) From Genes to Genomes: Concepts and Applications of DNA Technology. John Wiley & Sons, Ltd.

Daunay MC (2008) Eggplant. Prohens J, Nuez F (Eds.) Handbook of Plant Breeding. Vegetables II, Springer, New York, USA pp: 163–220.

Demidenko NV, Logacheva MD and Penin AA (2011) Selection and Validation of Reference Genes for Quantitative Real-Time PCR in Buckwheat (Fagopyrum esculentum) Based on Transcriptome Sequence Data. PLoS ONE 6(5): e19434.

Dheda K, Huggett JF, Chang JS, Kima LU, Bustinc SA, Johnson MA and (2005) The implications of using an inappropriate reference gene for real-time reverse transcription PCR data normalization. Analytical Biochemistry 344: 141-143.

Doganlar S, Frary A, Daunay M-C, Lester RN and Tanksley SD (2002a) Conservation of Gene Function in the Solanaceae as Revealed by Comparative Mapping of Domestication Traits in Eggplant. Genetics 161: 1713-1726.

Doganlar S, Frary A, Daunay MC, Lester RN and Tanksley SD (2002b) A Comparative Genetic Linkage Map of Eggplant (Solanum melongena) and Its Implications for Genome Evolution in the Solanaceae. Genetics 161: 1697-1711.

Draye M and Van Cutsem P (2008) Pectin methylesterases induce an abrupt increase of acidic pectin during strawberry fruit ripening. Journal of Plant Physiology 165: 1152-1160.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. iv

References

Echeverria G, Graell J, Lopez ML and Lara I (2004) Volatile production, quality, and aroma-related enzyme activities during maturation of ‘‘Fuji’’ apples. Postharvest Biology and Technology 31:217-227.

El-Kereamy A, Chervin C, Roustan JP, Cheynier V and Souquet JM (2003) Exogenous ethylene stimulates the longterm expression of genes related to anthocyanin biosynthesis in grape berries. Physiologia Plantarum. 119: 175-182.

Elumalai RP, Nagpal P and Reed JW (2002) A mutation in the Arabidopsis KT2/KUP2 potassium transporter gene affects shoot cell expansion. The Plant Cell 14: 119–131.

Esau K (1977) Anatomy of seed plants 2nd Edition. 2nd edition. Santa Barbara , John Wiley & Sons, Inc.

Eulgem T, Rushton PJ, Robatzek S and Somssich IE (2000) The WRKY superfamily of plant transcription factors. Trends Plant Science 5: 199-206.

Exposito-Rodriguez M, Borges AA, Borges-Perez A and Perez JA (2008) Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process. BMC Plant Biology 8: 131.

Faurobert M, Mihr C, Bertin N, Pawlowski T, Negroni L, Sommerer N and Mathilde C (2007) Major Proteome Variations Associated with Cherry Tomato Pericarp Development and Ripening. Plant Physiology 143:1327–1346.

Feng B, Dong Z, Xu Z, An X, Qin H and Wu N (2010) Molecular analysis of lipoxygenase (LOX) genes in common wheat and phylogenetic investigation of LOX proteins from model and crop plants. Journal of Cereal Science 52: 387-394.

Ferguson BS, Nam H, Hopkins RG and Morrison RF (2010) Impact of reference gene selection for target gene normalization on experimental outcome using Real-time qRT-PCR in adipocytes. PLoS ONE 5(12): e15208.

Fessele S, Maier H, Zischek C, Nelson PJ and Werner T (2002) Regulatory context is a crucial part of gene function. Trends in Genetics 18: 60–63.

Foyer CH, Descourvieres P and Kunert KJ (1994) Protection against oxygen radicals: an important defence mechanism studied in transgenic plants. Plant Cell & Environment 17: 507-523.

Frodin D (2004) History and concepts of big plant genera. Taxon 53: 753–776.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. v

References

Frohman MA, Dush MK and Martin GR (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proceedings of the National Academy of Sciences USA 85: 8998.

Fukuoka H, Yamaguchi H, Nunome T, Negoro S and Miyatake K (2010) Accumulation, functional annotation, and comparative analysis of expressed sequence tags in eggplant (Solanum melongena L.), the third pole of the genus Solanum species after tomato and potato. Gene 450: 76-84.

Gachon C, Mingam A and Charrier B (2004) Real-time PCR: what relevance to plant studies. Journal of Experimental Botany 55 (402): 1445-1454.

Gangopadhyay KK, Mahajan RK, Kumar G, Yadav SK, Meena BL, Pandey C, Bisht IS, Mishra SK, Sivaraj N, Gambhir R, Sharma SK and Dhillon BS (2010). Development of a Core Set in Brinjal (Solanum melongena L.). Crop Science 50:755-762.

Gantasala NP, Papolu PK, Thakur PK, Kamaraju D, Sreevathsa R and Rao U (2013) Selection and validation of reference genes for quantitative gene expression studies by real-time PCR in eggplant (Solanum melongena L.). BMC Research Notes 6: 312.

Gillaspy G, Ben-David H and Gruissem W (1993) Fruits: a developmental perspective. The Plant Cell 5: 1439-1451.

Giovannoni J (2001) Molecular biology of fruit maturation and ripening. Annual Review of Plant Physiology and Plant Molecular Biology 52:725-749.

Giovannoni JJ (2004) Genetic Regulation of Fruit Development and Ripening. The Plant Cell 16: S170-S180.

Giribaldi M, Perugini I, Sauvage FX and Schubert A (2007) Analysis of protein changes during grape berry ripening by 2-DE and MALDI-TOF. Proteomics 7: 3154–3170.

Gleddie S, Keller W and Setterfield G (1986) Eggplant. In: Evans DA and Sharp WR (Eds) Handbook of Plant Cell Culture (Vol 3): Techniques for Propagation and Breeding. NY, USA: MacMillan 500–511.

Gopalan C, Ramasastri BV and Balasubramanian S (2007) Nutritive value of Indian foods, published by National Institute of Nutrition (NIN), ICMR.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. vi

References

Griffiths AJF, Suzuki DT, Lewontin RC and Gelbart WM (2000) Regulation of gene transcription. Modern Genetic Analysis (3rd edition). New York, USA: WH Freeman and Company.

Guenin S, Mauriat M, Pelloux J, Wuytswinkel OV, Bellini C and Gutierrez L (2009) Normalization of qRT-PCR data: the necessity of adopting a systematic, experimental conditions-specific, validation of references. Journal of Experimental Botany 60(2) 487-493.

Guilfoyle TJ and Hagen G (2001) Auxin response factors. Journal of Plant Growth Regulation. 10: 281-291.

Guillet C, Just D, Bénard N, Destrac-Irvine A , Baldet P, Hernould M, Causse M, Raymond P and Rothan C (2002) A fruit-specific phosphoenolpyruvate carboxylase is related to rapid growth of tomato fruit. Planta 214(5): 717-726.

Guillet C, Aboul-Soud MAM, Le Menn A, Viron N, Pribat A, Germain V, Just D, Baldet P, Rousselle P, Lemaire-Chamley M and Rothan C (2012) Regulation of the fruit-specific PEP Carboxylase SlPPC2 promoter at early stages of tomato fruit development. PLoS ONE 7(5): e36795.

Guimaraes PR, Galvao AMP, Batista CM, Azevedo GS, Oliveira RD, Lamounier RP, Freire N, Barros AMD, Sakurai E, Oliveira JP, Vieira EC and Alvarez-Leite JI (2000) Eggplant (Solanum melongena) infusion has a modest and transitory effect on hypercholesterolemic subjects. Brazilian Journal of Medical and Biological Research 33(9): 1027-1036.

Guo S, Liu J, Zheng Y, Huang M and Zhang H (2011) Characterization of transcriptome dynamics during watermelon fruit development: sequencing, assembly, annotation and gene expression profiles. BMC Genomics 454: 1471-2164.

Gupta AB and Sankararamakrishnan R (2009) Genome-wide analysis of major intrinsic proteins in the tree plant Populus trichocarpa: Characterization of XIP subfamily of aquaporins from evolutionary perspective. BMC Plant Biology 9:134.

Gutierrez L, Mauriat M, Guenin S, Pelloux J, Lefebvre JF, Louvet R, et al (2008) The lack of a systematic validation of reference genes: a serious pitfall undervalued in reverse transcription polymerase chain reaction (RT-PCR) analysis in plants. Plant Biotechnology Journal 6: 609-618.

Haldrup A, Petersen SG and Okkels FT (1998) Plant Mol. Biol 37:287-296.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. vii

References

Hellemans J, Mortier G, Paepe AD, Speleman F and Vandesompele J (2007) qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biology 8(2): R19.

Hernandez JA, Jimenez A, Mullineaux P, Sevilla F (2000) Tolerance of pea (Pisum sativum) to long term salt stress is associated with induction of antioxidant defences. Plant Cell & Environment 23: 853-862.

Higuchi R, Dollinger G, Walsh PS and Griffith R (1992) Simultaneous amplification and detection of specific DNA sequences. Biotechnology 10:413-417.

Higuchi R, Fockler C, Dollinger G and Watson R (1993) Kinetic PCR: Real time monitoring of DNA amplification reactions. Biotechnology 11:1026-1030.

Hochheimer A and Tjian R (2003) Diversified transcription initiation complexes expand promoter selectivity and tissue-specific gene expression. Genes and Development 17: 1309-1320.

Hoeven RVd, Ronning C, Giovannoni J, Matin G and Tanksley S (2002) Deductions about the number, organization and evolution of genes in the tomato genome based on analysis of a large expressed sequence tag collection and selective genomic sequencing. Plant Cell 14:1441–1456.

Holton TA and Graham MW (1991) A simple and efficient method for direct cloning of PCR products using ddT-tailed vectors. Nucleic Acids Research 19: 1156.

Hu W, Ma H (2006) Characterization of a novel putative zinc finger gene MIF1: involvement in multiple hormonal regulation of Arabidopsis development. The Plant Journal. 45:399-422.

Imai T, Ubi BE, Saito T and Moriguchi T (2014) Evaluation of reference genes for accurate normalization of gene expression for Real time quantitative PCR in Pyrus pyrifolia using different tissue samples and seasonal conditions. PLoSONE 9 (1): e86492.

Ioannidi E, Kalamaki MS, Engineer C, Pateraki I, Alexandrou D, Mellidou I, Giovannonni J and Kanellis AK (2009) Expression profiling of ascorbic acid-related genes during tomato fruit development and ripening and in response to stress conditions. Journal of Experimental Botany 1-16.

Jelenkovic G, Billings S, Chen Q, Lashomb J, Hamilton G et al. (1998) Transformation of eggplant with synthetic cryIIIA gene produces a high level of resistance to the Colorado potato beetle. Journal of the American Society for Horticultural Science 123:19-25.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. viii

References

Jian B, Liu B, Bi Y, Hou W, Wu C and Han T (2008) Validation of internal control for gene expression study in soybean by quantitative real-time PCR. BMC Molecular Biology 9: 59.

Jimenez A, Creissen G, Kular B, Firmin J, Robinson S, Verhoeyen M and Mullineaux P (2002) Changes in oxidative processes and components of the antioxidant system during tomato fruit ripening. Planta 214: 751-758.

Jimenez A, Romojaro F, Gomez JM, Llanos MR and Sevilla F (2003) Antioxidant systems and their relationship with the response of pepper fruits to storage at 20 0C. Journal of Agricultural and Food Chemistry 51: 6293-6299.

Joersbo M, Donaldson I, Kreiberg J, Petersen SG, Brunstedt J, Okkels FT (1998) Analysis of mannose selection used for transformation of sugar beet. Molecular Breeding 4:111-117.

Johanson U, Karlsson M, Johansson I, Gustavsson S and Sjovall S (2001) The complete set of genes encoding major intrinsic proteins in Arabidopsis provides a framework for a new nomenclature for major intrinsic proteins in plants. Plant Physiology 2001, 126: 1358-1369.

Johnson CS, Kolevski B and Smyth DR (2002) TRANSPARENT TESTA GLABRA2, a trichome and seed coat development gene of Arabidopsis, encodes a WRKY transcription factor. Plant Cell 14: 1359-1375.

Jong MD, Wolters-Arts M, Garcı´a-Martı´nez JL, Celestina Mariani C and Vriezen WH (2011) The Solanum lycopersicum AUXIN RESPONSE FACTOR 7 (SlARF7) mediates cross-talk between auxin and gibberellin signalling during tomato fruit set and development. Journal of Experimental Botany 62: 617-626.

Kalloo G (1993) Eggplant (Solanum melongena L.). In: Kalloo G (Ed) Genetic Improvement of Vegetable Crops. Oxford, UK: Pergamon Press 587–604.

Karaaslan M and Hrazdina G (2010) Characterization of an expansin gene and its ripening-specific promoter fragments from sour cherry (Prunus cerasus L.) cultivars. Acta Physiologia Plantarum 32: 1073-1084.

Karp A, Seberg O and Buiatti M (1996) Molecular Techniques in the Assessment of Botanical Diversity. Annals of Botany 1996, 78: 143-149.

Klug WS and Cummings MR (1997) Concepts of Genetics. New Jersey: Prentice-Hall.

Komori T, Imayama T, Kato N, Ishida Y, Ueki J and Komari T (2007) Current Status of Binary Vectors and Superbinary Vectors. Plant Physiology 145: 1155–1160.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. ix

References

Kong Q, Yuan J, Gao L, Zhao S, Jiang W and Huang Y (2014) Identification of suitable reference genes for gene expression normalization in qRT-PCR analysis in watermelon. PLoS ONE 9(2): e90612.

Kouadjo KE, Nishida Y, Cadrin-Girard JF, Yoshioka M and St-Amand J (2007) Housekeeping and tissue-specific genes in mouse tissues. BMC Genomics 8: 127.

Kubista M, Andrade JM, Bengtsson M, Forootan A, Jonak EJ and Lind K (2006) The real-time polymerase chain reaction. Molecular Aspects of Medicine 27: 95-125.

Kumar G, Meena BL, Kar R, Tiwari SK, Gangopadhyay KK, and Bisht IS (2008) Morphological diversity in brinjal (Solanum melongena L.) germplasm accessions. Characterization and utilization. Plant Genetic Resources: Characterization and Utilization, 6 (3): 232-236.

Kumar PA, Mandaokar A, Sreenivasu K, Chakrabarti SK, Bisaria S, Sharma SR, Kaur S and Sharma RP (1998) Insect-resistant transgenic brinjal plants. Molecular Breeding 4: 33-37.

Kwon YI, Apostolidis E and Shetty K (2008) In vitro studies of eggplant (Solanum melongena) phenolics as inhibitors of key enzymes relevant for type 2 diabetes and hypertension. Bioresource Technology 99(8): 2981-2988.

Le DT, Aldrich DL, Valliyodan B, Watanabe Y, Ha CV and Nishiyama R (2012) Evaluation of candidate reference genes for normalization of quantitative RT-PCR in soybean tissues under various abiotic stress conditions. PLoS ONE 7(9): e46487.

Leprince O, Hoekstra FA and Harren FJM (2000) Unravelling the responses of metabolism to dehydration points to a role for cytoplasmic viscosity in desiccation tolerance. In: Black M, Bradford KJ, Vasques-Ramos J (ed.): Seed Biology: Advances and Applications pp. 57-66. CABI Publishing, Wallingford.

Li J, Jia D and Chen X (2001) HUA1, a Regulator of Stamen and Carpel Identities in Arabidopsis, Codes for a Nuclear RNA Binding Protein. The Plant Cell 13: 2269-2281.

Liavonchanka and Feussner I (2006) Lipoxygenases: occurrence, functions and catalysis. Journal of Plant Physiology 163: 348-357.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. x

References

LiLi T, XianLong Z, DiQiu L, ShuangXia J, JingLin C and LongFu Z (2007) Suitable internal control genes for qRT-PCR normalization in cotton fiber development and somatic embryogenesis. Chinese Science Bulletin 52(22): 3110-3117.

Lopez PA, Gochicoa NTM and Franco RA (2010) Activities of antioxidant enzymes during strawberry fruit development and ripening. Biologia plantarum 54 : 349-352.

Mace ES, Lester RN and Gebhardt CG (1999) AFLP analysis of genetic relationships among the cultivated eggplant, Solanum melongena L. and wild relatives (Solanaceae). Theoretical Applied Genetics 99: 626-633.

Mafra V, Kubo KS, Alves-Ferreira M, Ribeiro-Alves M, Stuart RM and Boava LP (2012) Reference Genes for accurate transcript normalization in Citrus genotypes under different experimental conditions. PLoS ONE 7(2): e31263.

Marchuk D, Drumm M, Saulino A and Collins FS (1991) Construction of T- vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Research 19: 1154.

Marti C, Orzaez D, Ellul P, Moreno V and Carbonell J (2007) Silencing of DELLA induces facultative parthenocarpy in tomato fruits. The Plant Journal 52: 865-876.

Martins WS, Lucas DCS, Neves KFDS and Bertioli DJ (2009) WebSat ‐ A web software for microsatellite marker development. Bioinformation 3(6): 282-283.

Mead DA, Pey NK, Herrnstadt C, Marcil RA and Smith LM (1991) A universal method for the direct cloning of PCR amplified nucleic acid. Bio Technology 9: 657-663.

Meyer B, Houlné C, Pozueta-Romero J, Schantz ML and Schantz R (1996) Fruit-Specific Expression of a defensin-type gene family in bell pepper upregulation during ripening and upon wounding. Plant Physiology 112: 61 5-622.

Morgante M, Hanafey M and Powell W (2002) Microsatellites are preferentially associated with nonrepetitive DNA in plant genomes. Nature Genetics 30: 194-200.

Moyano E, Encinas-Villarejo S, Lopez-Raez JA, Redondo-Nevado J and Blanco-Portales R (2004) Comparative study between two strawberry pyruvate decarboxylase genes along fruit development and ripening, post-harvest and stress conditions. Plant Science 166: 835-845.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. xi

http://www.ncbi.nlm.nih.gov/pubmed/?term=Martins%20WS%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Soares%20Lucas%20DC%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=de%20Souza%20Neves%20KF%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Bertioli%20DJ%5Bauth%5D

References

Muller ML, Irkens-Kiesecker U, Kramer D and Taiz L (1997) Purification and reconstitution of the vacuolar H+-ATPases from lemon fruits and epicotyls. Journal of Biological Chemistry 272:12762-12770.

Muller ML, Irkens-Kiesecker U, Rubinstein B, Taiz L (1996) On the mechanism of hyperacidification in lemon: Comparison of the vacuolar H+-ATPase activities of fruits and epicotyls. Journal of Biological Chemistry 271: 1916-1924.

Mutalik S, Paridhavi K, Mallikarjuna Rao C and Udupa N (2003) Antipyretic and analgesic effect of leaves of Solanum melongena Linn in rodents. Indian Journal of Pharmacology 35: 312-315.

Nakano T, Fujisawa M, Shima Y and Ito Y (2014) The AP2/ERF transcription factor SlERF52 functions in flower pedicel abscission in tomato. Journal of Experimental Botany 65(12): 3111-9.

Nolan T, Hands RE and Bustin SA (2006) Quantification of mRNA using real-time RT-PCR. Nature Protocols 1(3): 1559-1582.

Nunome T, Ishiguro K, Yoshida T and Hirai M (2001) Mapping of fruit shape and color development traits in eggplant (Solanum melongena L.) based on RAPD and AFLP markers. Breeding science 51(1):19-26.

Nunome T, Negoro S, Kono I, Kanamori H and Miyatake K (2009) Development of SSR markers derived from SSR-enriched genomic library of eggplant (Solanum melongena L.). Theoretical Applied Genetics 119: 1143-1153.

Okuda S, Yamada T, Hamajima M, Itoh M and Katayama T (2008) KEGG Atlas mapping for global analysis of metabolic pathways. Nucleic Acids Research. 36: 423-426.

Ortiz R (1998) Critical role of plant biotechnology for the genetic improvement of food crops: perspectives for the next millennium. Electronic Journal of Biotechnology 1: 1–7.

Padmalatha KV, Dhandapani G, Kanakachari M, Kumar S, Dass A and Patil DP (2012) Genome-wide transcriptomic analysis of cotton under drought stress reveal significant down-regulation of genes and pathways involved in fibre elongation and up-regulation of defense responsive genes. Plant Molecular Biology 78: 223-246.

Paolacci AR, Tanzarella OA, Porceddu E and Ciaffi M (2009) Identification and validation of reference genes for quantitative RT-PCR normalization in wheat. BMC Molecular Biology 10: 11.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. xii

http://www.ncbi.nlm.nih.gov/pubmed?term=Okuda%20S%5BAuthor%5D&cauthor=true&cauthor_uid=18477636

http://www.ncbi.nlm.nih.gov/pubmed?term=Yamada%20T%5BAuthor%5D&cauthor=true&cauthor_uid=18477636

http://www.ncbi.nlm.nih.gov/pubmed?term=Hamajima%20M%5BAuthor%5D&cauthor=true&cauthor_uid=18477636

http://www.ncbi.nlm.nih.gov/pubmed?term=Itoh%20M%5BAuthor%5D&cauthor=true&cauthor_uid=18477636

http://www.ncbi.nlm.nih.gov/pubmed?term=Katayama%20T%5BAuthor%5D&cauthor=true&cauthor_uid=18477636


References

Pascual L, Blanca JM, Canizares J and Nuez F (2009) Transcriptomic analysis of tomato carpel development reveals alterations in ethylene and gibberellin synthesis during pat3/pat4 parthenocarpic fruit set. BMC Plant Biology 9: 67.

Paull RE, Gross K and Qiu YX (1999) Changes in papaya cell walls during fruit ripening. Postharvest Biology and Technology. 16: 79-89.

Penna D, Alexander DC and Bennett AB (1986) Molecular cloning of tomato fruit polygalacturonase: Analysis of polygalacturonase mRNA levels during ripening. Proceedings of the National Academy of Sciences U S A. 83(17): 6420-6424.

Polignano G, Uggenti P, Bisignano V and Gatta CD (2010) Genetic divergence analysis in eggplant (Solanum melongena L.) and allied species. Genetic Resources and Crop Evolution 57: 171-181.

Porta and Rocha-Sosa (2002) Plant lipoxygenases: physiological and molecular features. Journal of Plant Physiology 130: 15-21.

Powell W, Morgante M, Andre C, Hanafey M and Vogel J (1996) The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Molecular Breeding 2: 225-238.

Raigon MD, Prohens J, Munoz-Falcon JE and Nuez F (2008) Comparison of eggplant landraces and commercial varieties for fruit content of phenolics, minerals, dry matter and protein. Journal of Food Composition and Analysis 21(5): 370-376.

Reddy DS, Bhatnagar-Mathur P, Cindhuri KS and Sharma KK (2013) Evaluation and validation of reference genes for normalization of quantitative real-time PCR based gene expression studies in Peanut. PLoS ONE 8(10).

Redgwell RJ, Melton LD and Brasch DJ (1990) Cell wall changes in Kiwifruit following post harvest ethylene treatment. Phytochemistry 29: 399-407.

Rensink WA, Lee Y, Liu J, Iobst S, Ouyang S and Buell CR (2005) Comparative analyses of six solanaceous transcriptomes reveal a high degree of sequence conservation and species-specific transcripts. BMC Genomics 6:124.

Repaka V and Fischerova I (1996) Distribution of stress related anionic peroxidase in different cucumber organs. Plant Biology 38: 571-583.

Rieu and Powers (2009) Real-Time Quantitative RT-PCR: Design, Calculations and Statistics. The Plant Cell 21: 1031-1033.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. xiii

References

Robinson DS (1991) in: Oxydative enzymes in foods, peroxidases and catalases in foods. Elsevier Science Publishers LTD, England, 1-9.

Rocco M, D’Ambrosio C, Arena S, Faurobert M, Scaloni A and Marra M (2006) Proteomic analysis of tomato fruits from two ecotypes during ripening. Proteomics 6: 3781-3791.

Rodriguez SC, Lopez B and Chaves AR (1999) Changes in polyamines and ethylene during the development and ripening of eggplant fruits (Solanum melongena). Journal of Agricultural and Food Chemistry.47(4): 1431-1434.

Rodriguez-Amaya D (2003) Food carotenoids: Analysis, composition and alterations during storage and processing of foods. Forum of Nutrition 56: 35–7.

Rogiers SY, Kumar MGN and Knowles NR (1998) Maturation and ripening of fruit Amelanchier alnifolia Nutt. are accompanied by increasing oxidative stress. Annals of Botany 81: 203-211.

Rongwen J, Akkaya MS, Bhagwat AA, Lavi U and Cregan PB (1995) The use of microsatellite DNA markers for soyabean genotype identification. Theoretical Applied Genetics 90: 43-48.

Ronning CM, Stegalkina SS, Ascenzi RA, Bougri O, Hart AL, Utterbach TR, Vanaken SE, Riedmuller SB, White JA, Cho J, Pertea GM, Lee Y, Karamycheva S, Sultana R, Tsai J, Quackenbush J, Griffiths HM, Restrepo S, Smart CD, Fry WE, Hoeven RV, Tanksley S, Zhang P, Jin H, Yamamoto ML, Baker BJ and Buell CR (2003) Comparative analyses of potato expressed sequence tag libraries. Plant Physiology 131:419–429.

Rotino GL, Perri E, Zottini M, Sammer H and Spena A (1997) Genetic engineering of partenocarpic plants. Nature Biotechnology 15(13): 1398-1401.

Rozen S and Skaletsky H (2000) Primer3 on the WWW for general users and for biologist programmers. Methods in Molecular Biology 132: 365-386.

Saito T, Yoshida T, Monma S, Matsunaga H and Sato T (2009) Development of the parthenocarpic eggplant cultivar ‘Anominori’. Japan Agricultural Research Quarterly 43: 123–127.

Sakata Y, Monma S, Narikawa T and Komochi S (1996) Evaluation of resistance to bacterial wilt and Verticillium wilt in eggplants (Solanum melongena L.) collected in Malaysia. Journal of the Japanese Society for Horticultural Science 65: 81–88.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. xiv

References

Schmidt and Delaney (2010) Stable internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana tabacum) during development and abiotic stress. Molecular Genetics and Genomics 283: 233-241.

Serrano R (1984) Plasma membrane ATPase of fungi and plants as a novel type of proton pump. Current Topics in Cellular Regulation l23: 87-126.

Seymour GB, Ostergaard L, Chapman NH, Knapp S and Martin C (2013) Fruit Development and Ripening. Annual Review of Plant Biology. 64: 219-41.

Shabana MM, Salama MM, Ezzat SM and Ismail LR (2013) In Vitro and In Vivo Anticancer activity of the fruit peels of Solanum melongena L. against hepatocellular carcinoma. Journal of Carcinogenesis Mutagenesis 4: 149.

Shiratake K and Martinoia E (2007) Transporters in fruit vacuoles. Plant Biotechnology 24: 127-133.

Shore P and Sharrocks AD (1995) The MADS-box family of transcription factors. European Journal of Biochemistry 229: 1-13.

Shukla V and Naik LB (1993) Agro-techniques of solanaceous vegetables. In Chadha KL and Kalloo G (Eds) Advances in Horticulture (Vol 5): Vegetable Crops Part 1. New Delhi: Malhotra Pub House 365.

Sicard A, Petit J, Mouras A, Chevalier C and Hernould M (2008) Meristem activity during flower and ovule development is controlled by the mini zinc finger gene inhibitor of meristem activity in tomato. The Plant Journal. 55: 415-427.

Sies H (1997) Oxidative stress: oxidants and antioxidants. Experimental Physiology 82(2): 291-295.

Sihachakr D, Daunay MC, Serraf I, Chaput MH, Mussio I, Haicour R, Rossignol L and Ducreux G (1994) Somatic Hybridization of Eggplant (Solanum melongena L.) with its Close and Wild Relatives. Y. P. S. Bajaj (cd.), Somatic Hybridization in Crop Improvement I.

Silver N, Best S, Jiang J and Thein SL (2006) Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Molecular Biology 7: 33.

Sindhu CU, Padmanabhan JV, Thakidiyil TM, Rintu TV and Eppurathumana VS (2012) Molecular cloning and characterization of fruit specific promoter from Cucumis sativus L. American Journal of Molecular Biology 2: 132-139.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. xv

http://www.researchgate.net/journal/0070-2137_Current_topics_in_cellular_regulation

References

Speirs J, Correll R and Cain P (2002) Relationship between ADH activity, ripeness and softness in six tomato cultivars. Scientia Horticulturae 93:137-142.

Speirs J, Lee E, Holt K, Kim YD and Scott NS (1998) Genetic manipulation of alcohol deshydrogenase levels in ripening tomato fruit affects the balance of some flavour aldehydes and alcohols. Plant Physiology 117:1047-1058.

Srivastava A and Sanjay (2011) Analgesic Activity of Root Extract of Solanum melongena Linn Root. International Journal of Research in ayurveda and Pharmacy 2(5): 1615-1617.

Swarup V (1995) Genetic resources and breeding of aubergine (Solanum melongena L.). Acta Horticulturae 412: 71-79.

Takatsuji H (1998) Zinc-finger transcription factors in plants. CHLS Cellular and Molecular Life Sciences. 54: 582-596.

Tanksley SD, Bernatzky R, Lapitan NL and Prince JP (1988) Conservation of gene repertoire but not gene order in pepper and tomato (chromosome evolution/Capsicum spp. /Lycopersicon escudentum). Proceedings of the National Academy of Sciences 85: 6419-6423.

Tautz D (1989) Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucleic Acids Research 17: 6463-6471.

Tesniere C, Pradal M, El-Kereamy A, Torregrosa L and Chatelet P (2004) Involvement of ethylene signalling in a non-climacteric fruit: new elements regarding the regulation of ADH expression in grapevine. Journal of Experimental Botany 55: 2235-2240.

Tesniere C and Verries C (2000) Molecular cloning and expression of cDNAs encoding alcohol dehydrogenases from Vitis vinifera L. during berry development. Plant Science 157: 77-88.

Tong Z, Gao Z, Wang F, Zhou J and Zhang Z (2009) Selection of reliable reference genes for gene expression studies in peach using real-time PCR. BMC Molecular Biology 10: 71.

Toth G, Gaspari Z and Jurka J (2000) Microsatellites in Different Eukaryotic Genomes: Survey and Analysis. Genome Research 10(7): 967-981.

Tyerman SD, Niemietz CM, Bramley H (2002) Plant aquaporins: Multifunctional water and solute channels with expanding roles. Plant Cell and Environment 25: 173-194.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. xvi

http://www.ncbi.nlm.nih.gov/pubmed/?term=T%26%23x000f3%3Bth%20G%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=G%26%23x000e1%3Bsp%26%23x000e1%3Bri%20Z%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Jurka%20J%5Bauth%5D

References

Umate P (2011) Genome-wide analysis of lipoxygenase gene family in Arabidopsis and rice. Plant Signaling and Behavior 6 (3): 335-338.

Vandesompele J, De Preter K, Pattyn F, Poppe B, Roy NV and De Paepe A (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology 3(7): 0034.1-0034.11.

Vaquero C, Sack M, Chandler J, Drossard J, Schuster F, Monecke M, Schillberg S and Fischer R (1999) Transient expression of a tumor-specific single-chain fragment and a chimeric antibody in tobacco leaves. Proceedings of the National Academy of Sciences. USA 96: 11128–11133.

Vellosillo T, Martinez M, Lopez MA, Vicente J, Cascon T and Dolan L (2007) Oxylipins produced by the 9-lipoxygenase pathway in Arabidopsis regulate lateral root development and defense responses through a specific signaling cascade. Plant Cell 19: 831-846.

Vivian-Smith A, Luo M, Chaudhury A and Koltunow AM (2001) Fruit development is actively restricted in the absence of fertilization in Arabidopsis. Development 128: 2321-2331.

Vriezen WH, Feron R, Maretto F, Keijman J, Mariani C (2008) Changes in tomato ovary transcriptome demonstrate complex hormonal regulation of fruit set. New Phytologist 177: 60-76.

Wakabayashi K (2000) Changes in cell wall polysaccharides during fruit ripening. Journal of Plant Research 113(3): 231-237.

Wakabayashi K, Chun JP and Huber DJ (2000) Extensive solubilization and depolymerization of cell wall polysaccharides during avocado (Persea americana) ripening involves concerted action of polygalacturonase and pectinmethylesterase. Physiologia Plantarum 108: 345-352.

Wan H, Yuan W, Ruan M, Ye Q, Wang R and Li Z (2011) Identification of reference genes for reverse transcription quantitative real-time PCR normalization in pepper (Capsicum annuum L.). Biochemical and Biophysical Research Communications 416: 24–30.

Wang H, Schauer N, Usadel B, Frasse P and Zouine M (2009) Regulatory Features Underlying Pollination dependent and independent tomato fruit set revealed by transcript and primary metabolite profiling. The Plant Cell 21: 1428-1452.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. xvii

References

Wang R, Shen W, Liu L, Jiang L, Liu Y and Su N (2008) A novel lipoxygenase gene from developing rice seeds confers dual position specificity and responds to wounding and insect attack. Plant Molecular Biology 66 (4): 401-414.

Wang Y, Dieh A, Wu F, Vrebalov J and Giovannoni J (2008) Sequencing and Comparative Analysis of a Conserved Syntenic Segment in the Solanaceae. Genetics 180: 391-408.

Warrington JA, Nair A, Mahadevappa M, Tsyganskaya M (2000) Comparison of human adult and fetal expression and identification of 535 housekeeping/maintenance genes. Physiological Genomics 2: 143-147.

Watson JD, Hopkins NH, Roberts JW, Steitz JA and Weiner AM (1965) The functioning of higher eukaryotic genes. Molecular Biology of the Gene 1 (21): 704.

Weese TL and Bhos L (2010) Eggplant origins: Out of Africa, into the Orient. Taxon 59 (1): 49-56.

Wu F, Eannetta NT, Xu Y, Durrett R, Mazourek M et al. (2009b) A COSII genetic map of the pepper genome provides a detailed picture of synteny with tomato and new insights into recent chromosome evolution in the genus Capsicum. Theoretical Applied Genetics. 118: 1279-1293.

Wu F, Eannetta NT, Xu Y, Plieske J and Ganal M (2010) COSII genetic maps of two diploid Nicotiana species provide a detailed picture of synteny with tomato and insights into chromosome evolution in tetraploid N. tabacum. Theoretical Applied Genetics 120: 809-827.

Wu F, Eannetta NT, Xu Y and Tanksley SD (2009a) A detailed synteny map of the eggplant genome based on conserved ortholog set II (COSII) markers. Theoretical Applied Genetics 118: 927-935.

Xia YH, Ru HT, Yong Z, Ya L, Qing C (2009) Cloning and expression analysis of ascorbate peroxidase gene during fruit development and ripening in Fragaria × ananassa cv. Toyonaka. World Journal of Agricultural Sciences 5: 675-679.

Xianquan S, Shi J, Kakuda Y, Yueming J (2005) Stability of lycopene during food processing and storage. Journal of Medicinal Food 8 (4): 413–22.

Xiao H, Radovich C, Welty N, Hsu J and Li D (2009) Integration of tomato reproductive developmental landmarks and expression profiles, and the effect of SUN on fruit shape. BMC Plant Biology 9 (49):1471-2229.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. xviii

References

Yang X, Cheng YF, Deng C, Ma Y and Wang ZW (2014) Comparative transcriptome analysis of eggplant (Solanum melongena L.) and turkey berry (Solanum torvum Sw.): phylogenomics and disease resistance analysis. BMC Genomics 15 (412): 1471-2164.

Yao JL, Dong YH, Kvarnheden A and Morris B (1999) Seven MADS-box genes in apple are expressed in different parts of the fruit. Journal of the American Society for Horticultural Science. 124:8-13.

Yeap W-C, Loo JM, Wong YC and Kulaveerasingam H (2014) Evaluation of suitable reference genes for qRT-PCR gene expression normalization in reproductive, vegetative tissues and during fruit development in oil palm. Plant Cell Tissue and Organ Culture 116: 55-66.

Yu K, Xu Q, Da X, Guo F and Ding Y (2012) Transcriptome changes during fruit development and ripening of sweet orange (Citrus sinensis). BMC Genomics 13: 1471-2164.

Zeitlin L, Olmsted SS, Moench TR, Co MS, Martinell BJ and Paradkar VM (1998) A humanized monoclonal antibody produced in transgenic plants for immunoprotection of the vagina against genital herpes. Nature Biotechnology. 16(13): 1361-1364.

Zhou MY and Gomez-Sanchez CE (2000) Universal TA Cloning. Current Issues in Molecular Biology 2(1): 1-7.

Zhu X, Li X, Chen W, Chen J, Lu W and Chen L (2012) Evaluation of new reference

genes in Papaya for accurate transcript normalization under different

experimental conditions. PLoS ONE 7(8): e44405.

M. Kanakachari, Ph.D. Thesis, Department of Plant Science, BDU, 2015. xix

29 Int.J.Curr.Biotechnol. Volume 2; Issue 12; December, 2014

International Journal of CurrentBiotechnology

Journal Homepage : http://ijcb.mainspringer.com

Mogilicherla Kanakachari, Ishar Ahmad, Amolkumar U. Solanke, Narayanasamy Jayabalan and Polumetla Anandakumar, Characterization of Antioxi-dant genes during Fruit Development and Ripening in Brinjal (Solanum melongena L.), Int.J.Curr.Biotechnol., 2014, 2(12):29-34.

Characterization of Antioxidant genes during Fruit Development and Ripening in Brinjal(Solanum melongena L.)

Mogilicherla Kanakachari1,2, Ishar Ahmad1,4, Amolkumar U. Solanke1, Narayanasamy Jayabalan2 andPolumetla Anandakumar1,3*

1National Research Centre on Plant Biotechnology, Pusa Campus, New Delhi-110012, India.

2Department of Plant Science, Bharathidasan University, Tiruchirapalli-620024, Tamil Nadu, India.

3Present Address: Institute of Biotechnology, Acharya N.G. Ranga Agricultural University, Hyderabad -500030,India.

4Present Address: Division of Crop Improvement and Biotechnology, Central Institute for Subtropical Horticulture(CISH), Lucknow-227107, Uttar Pradesh, India.

A R T I C L E I N F O A B S T R A C T

Article History:Received 25 November 2014Received in revised form 05 December 2014Accepted 10 December 2014Available online 15 December 2014

Key words:Brinjal, days post anthesis, fruit ripening,reactive oxygen species.

Expression analysis of eight antioxidant genes was carried out to in two varieties of brinjalviz., Pusa Purple Long (PPL) and Killikulam-1 (KKM-1) to determine the role of these genesduring brinjal fruit development and ripening. All the antioxidant genes displayed differentialexpression pattern throughout various stages of fruit development and ripening. Peroxidase(PO) and Superoxide dismutase (SOD) were up-regulated in PPL in-contrast to that in KKM-1 while their expression was not significantly altered during fruit development and ripening.Ascorbate peroxidase (AP) was up-regulated at early and ripe stages of fruit development inboth the cultivars. Glutathione reductase (GR) was up-regulated at 5 dpa in PPL while itsexpression was not significantly altered in KKM-1 during development and ripening. Plasmamembrane ATPase (PMATPase) was up-regulated at all the stages except 50 dpa in PPLwhile in KKM-1 its expression was similar to that at 0 dpa. There is an association betweenripening-related gene expression and oxidative stress response in tomato and strawberry. Theresults support the idea that catalase 1 (CAT 1), peroxidase and ascorbate peroxidase couldplay an important role in the regulation of ripening processes in brinjal.

*Corresponding author.Email address: [email protected]

IntroductionBiochemical reactions produce many reactive oxygenspecies (ROS) such as hydrogen peroxide, superoxideand hydroxyl radicals which are considered to be themain cause of oxidative damage (Jimenez et al., 2003).Susceptibility of plants to oxidative stress may dependon the balance between ROS generated, activity andavailability of cellular antioxidants (Foyer et al., 1994).Activities of various antioxidant enzymes are known toincrease in defence responses (Anand et al., 2009) andsalinity (Hernandez et al., 2000). Reactions involving ROSare an inherent feature of the senescence and fruitripening (Jimenez et al., 2003). Since ROS levels and theirharmful products are known to increase duringsenescence in many plants, it is possible that thesechanges are due to a decline in the activity of certainantioxidant enzymes. Increased levels of ROS have beenreported during pepper and tomato ripening (Rogiers etal., 1998).

ISSN: 2321 - 8371

Brinjal or eggplant (Solanum melongena L.) is the thirdmost important Solanaceous crop species. Brinjal fruit isprimarily consumed as a cooked vegetable in variousways. It is low in fats, contains protein, fibre andcarbohydrates. It is a good source of minerals and vitaminsand is rich in total water soluble sugars, free reducingsugars, amide proteins. (Gopalan et al., 2007). The brinjalvarieties display a wide variation in fruit shapes andcolours like long, egg-shaped and from green, white, blackthrough degrees of purple pigmentation. Brinjal havemany unique traits, including extra-large fruit size, hightemperature and water-stress tolerance and Verticilliumand bacterial wilt resistance (Saito et al., 2009). Attractivecharacteristics of the brinjal fruit are not only colour,size, aroma and texture, but also its chemical composition(contents of minerals, vitamins and antioxidants). Brinjalfruit contains many compounds with antioxidant activitysuch as anthocyanins, flavonoids, phenolic acids. Thereis no information about the activities of significantantioxidant enzymes in brinjal fruits at differentdevelopment and ripening stages. The aim of the presentresearch was to study the activities of important

Volume 2; Issue 12; December, 2014 Int.J.Curr.Biotechnol. 30

antioxidant enzymes during fruit development andripening in brinjal.

Materials and MethodsBrinjal (Solanum melongena L.) cvs. Pusa purple long(PPL) and Killikulam-1 (KKM-1) were grown inglasshouse under control conditions. PPL is a varietywith long purple coloured fruits, while KKM-1 bearsround white fruits. Flowers were hand-pollinated atanthesis and fruit samples were collected at 0, 5, 10, 20and 50 days post anthesis (dpa). For the 0 and 5 dpasample buds were stripped of sepals, petals and style.For samples taken at 10, 20 and 50 dpa whole fruit wassampled with only the sepals removed. Fruits werevertically divided into three equal parts and middle partwas used for total RNA isolation. All samples were frozenin liquid nitrogen at the time of harvest and then storedat -70ºC.

Total RNA was isolated using SpectrumTM Plant TotalRNA kit (Sigma, USA) according to the manufacturer’sprotocol. The quality and quantity of RNA was measuredby NanoDrop 1000 Spectrophotometer (ThermoScientific, USA). The total RNA was used for RT-cDNAsynthesis from 1 µg of total RNA using AffinityScriptqPCR cDNA synthesis kit (Stratagene, AgilentTechnologies, USA). Resulting cDNA template wasdiluted five-fold in molecular grade water (Promega,Madisson, WI). Gene specific qRT-PCR primers weredesigned using PrimerQuest software (http://eu.idtdna.com). The primers were used in this study arelisted in Table-1. Real-time assays were conducted for allthe genes by using the Stratagene MX3005P (AgilentTechnologies, USA) detection system and 18S rRNAgene was used as the housekeeping gene to normalizethe amount of template cDNA added in each reaction.The qRT-PCR was performed under the followingprogramme, 5 min at 95 ºC, followed by 40 cycles ofamplification with 30s of denaturation at 95ºC, 30s ofannealing at 60ºC and 30s of extension at 72ºC. Threebiological replicates were used. Amplicons were subjectedto the melt curve analysis to check the specificity of theamplified products. The relative expression level of eachgene was calculated by 2-ddCt. A fold change of e”1.5 wasconsidered as significant change in gene expression.

Results and DiscussionIn the present study expression analysis of eightantioxidant genes were carried out during fruitdevelopment and ripening stages in two brinjal cvs. PPLand KKM-1. Data presented here (Figure-1 and Figure-2)showed differential expression of antioxidant genesduring fruit development and ripening. In PPL, Peroxidase(PO) was up-regulated at all the stages and highestexpression was observed at ripening stage (50 dpa).However expression of PO was not significantly alteredin KKM-1 compared to control (0 dpa). Expression ofCatalase 1 (CAT 1) was up-regulated at all the stages inPPL with highest expression at ripening stage (50 dpa),while in KKM-1 the expression of CAT 1 was highest at10 dpa. Catalase 2 (CAT 2) was up-regulated at earlystages (5 and 10 dpa) of fruit development and itsexpression was similar in both the cultivars of brinjal. InPPL superoxide dismutase (SOD) was up-regulated at 5and 10 dpa. However, its expression was not significantlyaltered in KKM-1 during fruit development and ripening.Expression of Ascorbate peroxidase (AP) was up-regulated at early stages and r ipening of fruitdevelopment in both the cultivars. Glutathione reductase(GR) was up-regulated at 5 dpa in PPL while in KKM-1expression of GR was not significantly altered in KKM-1

compared to control (0 dpa). Plasma membrane ATPase(PMATPase) was up-regulated at all the stages except50 dpa in PPL while in KKM-1 its expression wasunchanged. There is no changes of potassium uptake 1(KUP1) expression level in both cultivars of brinjal ascompared to control (0 dpa).

Fruit development and ripening is a complex process andit undergoes many physiological and biochemicalchanges. Fruit ripening has been described as acontrolled oxidative process whereby ROS accumulationis balanced by the activity of cellular antioxidant systems(Jimenez et al., 2002). These free radicals disturb normalmetabolism by peroxidizing membrane lipids anddenaturing proteins and nucleic acids. Plants have anendogenous mechanism to protect cellular andsubcellular systems from the cytotoxic effects of ROS.These include up-regulation of antioxidant enzymes suchas GR, PO, SOD, CAT and PMATPase. Peroxidase (PO)participates in hormone catabolism, phenol oxidation,polysaccharides and cell wall proteins intercrossing,lignin polymerization, fruit ripening and defense againstpathogens. During fruit ripening, peroxidase activity isincreased along with the polygalacturonase and cellulaseenzymes (Robinson, 1991). In the present study PO wasup-regulated in PPL at all the stages and highestexpression was observed at ripening stage. Activity ofPO increases during fruit development and maturation inmuskmelon (Biles et al., 2000) and strawberry (Lopez etal., 2010). However in KKM-1, PO expression did notsignificantly change. These disparities may be derivedfrom the differences in shape and size of brinjal cultivar.Catalase is responsible for the dismutation of hydrogenperoxide into oxygen and water in the peroxisomes,protecting the cell from the deleterious effects ofhydrogen peroxide accumulation. In this study, weobserved that both CAT 1 and CAT 2 were up-regulatedat early stages of fruit development in both the cultivarsof brinjal which suggests its important role indetoxification of H2O2 during early stages of fruitdevelopment. However, the expression of CAT 1 was veryhigh in PPL at ripening stage (50 dpa) which suggests itsrole during brinjal fruit ripening. In strawberry, catalaseactivity was maximum in early fruit development andripening stages (Lopez et al., 2010). SOD catalyzes thedismutation of superoxide radicals in a broad range oforganisms, including plants. The dismutation ofsuperoxide into hydrogen peroxide and oxygenconstitutes the first line of cellular defense to preventundesirable biological oxidation by oxygen radicalgenerated during cellular metabolism. In the present studySOD was up-regulated at 5 and 10 dpa in PPL thatsuggests it’s very important role in preventing cell cyclearrest by detoxifying superoxide into H2O2 and oxygen.Up-regulation of SOD is reported during fruitdevelopment in tomato (Rocco et al., 2006) and strawberry(Lopez et al., 2010). However, SOD expression does notsignificantly change in KKM-1 throughout fruitdevelopment and ripening.

Ascorbate peroxidase (AP) is one of the key enzymes inthe ascorbate-glutathione cycle. It uses two moleculesof ascorbate to reduce H2O2 to water, with the concomitantgeneration of two molecules of monodehydroascorbate.It plays an important role in scavenging and protectingcells against the toxic effects of H2O2 in higher plants(Asada, 1999). In this study AP was up-regulated at earlyand ripe stages of fruit development in both the cultivars.In strawberry AP expression was lowest at the small greenstage, gradually increased at the full red stage (Xia et al.,2009). AP increases in tomato during fruit ripening


Figure-1: Expression analysis of Antioxidant genes during fruit development stages (5, 10, 20 and 50 dpa) in brinjal(Solanum melongena L.) cv. PPL compared with 0 dpa. Y-axis represents the fold change.


Gene Name Primer Sequence (5’-3’)

Superoxide dismutase F: TTGACCGGTCCAGACTCAGTTGTT R : AGTCAAACCAACCACACCACATGC

Catalase 1 F : GCCTTTGATGCCAGTTGGTCGATT R : TTTGGCCCAATACGGTGTCTCTGA

Catalase 2 F : ATGGGTCTGGTGTCCACACATTCA R: TCCTGAGTAGCGTGGCTGTGATTT

Ascorbate peroxidase F: ATGGATGTGTCTGGACCTGAGCAA R: AGACATCACGCAAATGAGCAGCAG

Peroxidase F : TCGGGTGCCCATACATTTGGAAGA R: AAGTACCACCATTGCCACCTTGTG

Glutathione reductase F: TGGTGGTGTTAGGGCTTCTCGTTT R: TCTTGGGTACACATCCACGAAGCA

Potassium Uptake 1 F : AGATGGGCTTCTTACTCCAGCCAT R: TTGATGGTGTTCCCGAGACATGGA

Plasma membrane ATPase F: GCCCAATTGGTTGCTACAGTGCTT R: TAGACCCAGATGATTGCTGCCCAT

18S rRNA F: CCGCGGAAGTTTGAGGCAATAACA R: CGGCAAGGCTATAAGCTCGTTGAA

Figure-2: Expression analysis of Antioxidant genes during fruit development stages (5, 10, 20 and 50 dpa)in brinjal (Solanum melongena L.) cv. KKM-1 compared with 0 dpa. Y-axis represents the fold change.

Table-1: List of antioxidant primers used in this study.


(Faurobert et al., 2007; Loannidi et al., 2009). Catalaseand AP are highly expressed in green tissues than inripening grapes (Giribaldi et al., 2007). Hydrogen peroxidecan also be converted into water by ascorbate-glutathione cycle which involves successive oxidationsand reductions of ascorbate, glutathione and NADPH.Glutathione reductase (GR) plays a very important rolein this cycle and converts oxidized glutathione toglutathione by utilizing NADPH. In this study expressionof GR was significantly altered only at 5dpa in PPL.Plasma membrane H+ATPase (PMATPase) is involved inbroad range of physiological responses that play a centralrole in the growth and development of plants (Serrano,1984). It maintains extracellular and intracellular pH ofcell and affect auxin-induced growth by acidification ofthe cell wall, causing loosening of the wall, which allowsturgor-driven expansion of the cell (Cleland, 1987). In thepresent study PMATPase was up-regulated at all stagesof fruit development except 50 dpa in PPL which specifiesits role in cell enlargement. Up-regulation of PMATPasecreates electrochemical gradient of protons across themembrane and causes uptake of water into cell.Electrochemical gradient and uptake of water areconsidered to be very important in the expansion of cellsthat leads to fruit enlargement. PMATPase expressiondoes not significantly alter in white round cultivarsuggests PMATPase are more important for cellelongation in long cultivar than round one. KUP familyare involved in potassium transport and localized atdifferent membranes. KUP 2 is predominantly expressedin rapidly growing tissues and plays a role in cellexpansion (Elumalai et al., 2002). In growing tissues it isinvolved in maintaining cytoplasmic potassium levelsand/or turgor regulation.

ConclusionThe present study has shown differential expression ofantioxidant genes during fruit development and ripeningin brinjal. PO and SOD were up-regulated in PPL while inKKM-1 their expression was not significantly altered.AP was up-regulated at early and ripe stages of fruitdevelopment while GR was up-regulated at 5 dpa.PMATPase was up-regulated at all the stages except 50dpa in PPL while expression of KUP 1 was similar to thatat 0 DPA in both cultivars of brinjal. Disparities inexpression of Peroxidase, Superoxide dismutase andPlasma membrane ATPase may be derived from thedifferences in shape and size of brinjal fruits. Stress mayarise in the fruits during ripening as a result of changesin osmotic potential due to the accumulation and thestorage of osmotically active compounds or from abioticor biotic factors (Aharoni et al., 2002). Another source ofROS production might be electron flow in mitochondria(Leprince et al., 2000). There is an association betweenripening-related gene expression and oxidative stressresponse in strawberry (Aharoni et al., 2002). Our resultsalso support this idea and it is proposed that CAT 1, POand AP could play an important role in the regulation ofripening processes in brinjal.

AcknowledgementThis work was supported by funds from the IndianCouncil of Agricultural Research (ICAR) New Delhi, India.We are thankful to Dr T. R. Sharma, Project Director, NRCon Plant Biotechnology, IARI Campus, New Delhi for hissuggestion for preparation of this manuscript.

ReferencesAharoni A., Keizer L.C.P., Van den Broeck H.C., Blanco-Portales R., Munoz-Blanco J., Bois G., Smit P., De Vos R.and O´Connell A.P., 2002. Novel insight into vascular,stress, and auxin-dependent and -independent geneexpression programs in strawberry, a non climacteric fruit.Plant Physiology. 129: 1019-1031.

Anand T., Ghaskaran R., Raguchander T., SamiyappanR., Prakasan V. and Gopalakrishnan C., 2009. Defenceresponses of chilli fruits to Colletotrichum capsici andAlternaria alternata. Plant Biology. 53: 553-559.

Asada K., 1999. The water-water cycle in chloroplasts:scavenging of active oxygens and dissipation of excessphotons. Annual Review of Plant Physiology and PlantMolecular Biology. 50: 601-639.

Biles L.C., Bruton D. B., Zhang X. J. and Russo V., 2000.Characterization of muskmelon fruit peroxidases atdifferent developmental stages. Biologia plantarum. 43:373-379.

Cleland R.E., 1987. Auxin and cell elongation. In PJ D,wies,ed, Plant Hormones and Their Role in Plant Growth andDevelopment. Martinus Nijhoff. Dordrecht. TheNetherlands. pp. 132-148.

Elumalai R.P., Nagpal P. and Reed J.W., 2002. A mutationin the Arabidopsis KT2/KUP2 potassium transportergene affects shoot cell expansion. The Plant Cell. 14: 119–131.

Foyer C.H., Descourvieres P. and Kunert K.J., 1994.Protection against oxygen radicals: an important defencemechanism studied in transgenic plants. Plant Cell &Environment. 17: 507-523.

Faurobert M., Mihr C., Bertin N., Pawlowski T., NegroniL., Sommerer N. and Mathilde C., 2007. Major ProteomeVariations Associated with Cherry Tomato PericarpDevelopment and Ripening. Plant Physiology. 143:1327–1346.

Giribaldi M., Perugini I., Sauvage F.X. and Schubert A.,2007. Analysis of protein changes during grape berryripening by 2-DE and MALDI-TOF. Proteomics. 7: 3154–3170.

Gopalan C., Ramasastri B.V. and Balasubramanian S., 2007.Nutritive Value of Indian Foods. published by NationalInstitute of Nutrition (NIN). ICMR.

Hernandez J.A., Jimenez A., Mullineaux P. and Sevilla F.,2000. Tolerance of pea (Pisum sativum) to long term saltstress is associated with induction of antioxidantdefences. Plant Cell & Environment. 23: 853-862.

Jimenez A., Creissen G., Kular B., Firmin J., Robinson S.,Verhoeyen M. and Mullineaux P., 2002. Changes inoxidative processes and components of the antioxidantsystem during tomato fruit ripening. Planta. 214: 751–758.

Jimenez A., Romojaro F., Gomez J.M., Llanos M.R. andSevilla F., 2003. Antioxidant systems and their relationshipwith the response of pepper fruits to storage at 20 0C.Journal of Agriculture Food Chemistry. 51: 6293-6299.


Leprince O., Hoekstra F.A. and Harren F.J.M., 2000.Unravelling the responses of metabolism to dehydrationpoints to a role for cytoplasmic viscosity in desiccationtolerance. In: Black, M, Bradford, K.J., Vasques-Ramos,J. (ed.): Seed Biology: Advances and Applications. pp.57-66. CABI Publishing, Wallingford.

Ioannidi E., Kalamaki M. S., Engineer C., Pateraki I.,Alexandrou D., Mellidou I., Giovannonni J. and KanellisA. K. 2009. Expression profiling of ascorbic acid-relatedgenes during tomato fruit development and ripening andin response to stress conditions. Journal of ExperimentalBotany. pp. 1-16. doi:10.1093/jxb/ern322.

Lopez P. A., Gochicoa N. T. M. and Franco R. A. 2010.Activities of antioxidant enzymes during strawberry fruitdevelopment and ripening. Biologia plantarum 54 : 349-352.

Repaka V. and Fischerova I., 1996. Distribution of stressrelated anionic Peroxidase in different cucumber organs.Plant Biology. 38: 571-583.

Robinson D. S., 1991. in: Oxydative enzymes in foods,Peroxidases and catalases in foods. Elsevier SciencePublishers LTD. England. 1-9.

Rocco M., D’Ambrosio C., Arena S., Faurobert M., ScaloniA. and Marra M., 2006. Proteomic analysis of tomatofruits from two ecotypes during ripening. Proteomics. 6:3781–3791.

Rogiers S. Y., Kumar M. G. N. and Knowles N. R. 1998.Maturation and ripening of fruit Amelanchier alnifoliaNutt. Are accompanied by increasing oxidative stress.Annals of Botany. 81: 203-211.

Saito T., 2009. Development of the parthenocarpiceggplant cultivar ‘Anominori’.JARQ, Japan agriculturalresearch quarterly. 43: 123–127.

Serrano R., 1984. Plasma membrane ATPase of fungi andplants as a novel type of proton pump. Current topics incellular regulation. l23: 87-126.

Xia Y. H., Ru H. T., Yong Z., Ya L. and Qing C., 2009.Cloning and expression analysis of ascorbate peroxidasegene during fruit development and ripening in Fragaria× ananassa cv. Toyonaka. World Journal of AgriculturalSciences. 5: 675-679.

ww

w.In

dia

nJo

urn

als.

com

Mem

ber

s C

op

y, N

ot

for

Co

mm

erci

al S

ale

Do

wn

load

ed F

rom

IP -

125

.18.

242.

18 o

n d

ated

20-

Ap

r-20

14

49

Indian J. Hort. 71(1), March 2014: 49-54

INTRODUCTIONBrinjal (Solanum melongena L.) commonly known

as eggplant is an agronomically important crop, grown primarily for its fruits. This is the third important Solanaceae vegetable after potato and tomato. It is native to India and probably introduced to Europe by Arabian traders and then taken to North America by early European settlers. Most of the commercially important varieties of brinjal have been selected from the long established types of the tropical India and China. Brinjal has many unique traits, including large fruit size, high temperature and water-stress tolerance, Verticillium and bacterial wilt resistance etc. (Saito et al., 12). Fleshy fruits are divided into two groups, climacteric and non-climacteric, based upon the presence or absence of steep increase in respiratory rate and ethylene evolution, brinjal is a non-climacteric fruit. It does not have an autocatalytic ethylene burst during ripening and exogenous application of ethylene does not rapidly accelerate fruit ripening. It is interesting to study the behavior of Ethylene Responsive Factor (ERF) genes in this species to understand difference between climacteric and non- climacteric fruit ripening.

The ERF family is a large gene family of transcription factors and is a part of AP2/ERF superfamily (Riechmann et al., 11). The AP2/ERF superfamily is defined by the AP2/ERF domain,

which consists of about 60 to 70 amino acids and is involved in DNA binding. AP2/ERF proteins have important functions in the transcriptional regulation of a variety of biological processes related to growth and development, as well as various responses to environmental stimuli. Apetala 2 family genes have been shown to participate in the regulation of flower and embryo development (Boutilier et al., 2). Many proteins of ERF family were identified and implicated in many diverse functions in cellular processes, such as response to biotic (Gu et al., 6) and abiotic stresses (Dubouzet et al., 4), regulation of metabolism (Aharoni et al., 1; Zhang et al., 15) and in developmental processes (Chuck et al., 3). The objective of this study was to isolate and characterize the expression of selected members of brinjal ERF gene family under stress conditions and during fruit development and ripening stages.

MATERIALS AND METHODSAll the six genes encoding Ethylene Response

Factor (ERF) were identified by homology search using ERF genes from tomato (Sharma et al., 13). Brinjal ERF gene ESTs were searched using BLAST, at eggplant gene index project database (http://compbio.dfci.harvard.edu/tgi/cgi-bin/tgi/gimain.pl?gudb=eggplant), taking tomato ERF ESTs as the reference. Primers were designed to amplify selected genes from brinjal cDNA isolated from the seedling tissues (Table 1). For gene amplification, polymerase chain reaction (PCR) was performed in a final volume

Isolation and characterization of Ethylene Responsive Factor (ERF) genes from brinjal

Israr Ahmad1, A.U. Solanke1, D.P. Deshmukh, M. Kanakachari, R. Sreevathsa, D. Pattanayak, T.R. Sharma and P.A. Kumar*

National Research Centre on Plant Biotechnology, Pusa Campus, New Delhi 110012

ABSTRACTEthylene Responsive Factor (ERF) family of genes encode transcriptional regulators with a variety of

functions involved in the developmental and physiological processes in plants. In this study, six SmERF genes were isolated from brinjal and expression analysis was carried out to determine their role in response to salt, drought and mechanical wounding and during fruit development and ripening stages. All the six SmERFs displayed differential expression pattern and levels throughout various stages of fruit development and ripening. Six genes namely SmERF7, SmERF20, SmERF52, SmERF70, SmERF80 and SmERF83 were up-regulated in response to salt, drought and mechanical wounding suggesting a crosstalk between stress signaling pathways. Up-regulation of SmERF7, SmERF52, SmERF70 and SmERF83 play important role at early stages of fruit development. Key words: Ethylene Responsive Factor, brinjal, fruit ripening, stress response.

*Corresponding author's present address: Institute of Biotechnology, Acharya N.G. Ranga Agricultural University, Hyderabad 500 030; E-mail: [email protected] equally

ww

w.In

dia

nJo

urn

als.

com

Mem

ber

s C

op

y, N

ot

for

Co

mm

erci

al S

ale

Do

wn

load

ed F

rom

IP -

125

.18.

242.

18 o

n d

ated

20-

Ap

r-20

14

50

Indian Journal of Horticulture, March 2014

of 25 μl containing 10 × buffer, 2.5 mM dNTPs, 1 unit of Taq DNA polymerase, 10 pmols/reaction primer and 50 ng of cDNA. The PCR was performed by initial denaturation at 94°C for 5 min. followed by 35 cycles of denaturation at 94°C for one min., annealing at 62°C for 45 s, extension at 72°C for two min. and final elongation at 72°C for 7 min. Amplified products were confirmed by Sanger sequencing from both the sides using forward and reverse primers. Confirmed six gene sequences of SmERF7, SmERF20, SmERF52, SmERF70, SmERF80 and SmERF83 were submitted to NCBI.

Seeds of brinjal (Solanum melongena L.) cultivar Pusa Uttam were germinated on Murashige and Skoog (MS) medium and 15-17 day-old seedlings were subjected to three different stresses, i.e. mechanical wounding, salt and drought stresses. For salt and drought stresses seedlings were removed from the solid MS medium without disturbing roots and transferred to liquid MS medium containing 200 mM NaCl and 200 mM mannitol, respectively. For mechanical wounding, each leaf and cotyledon of the plant was punctured three times with a needle and squeezed twice with forceps. All the stressed samples were collected after 8 h of stress. For different fruit developmental stages, brinjal plants were grown under controlled conditions in the glasshouse. Fruit samples were collected at 0, 5, 10, 20 and 50 days post anthesis (dpa). All the samples were frozen in liquid nitrogen just after collection and stored at -70°C.

Total RNA was isolated using SpectrumTM Plant Total RNA kit (Sigma, USA) according to the manufacturer ’s protocol. The quality and quantity of RNA was measured by NanoDrop 1000

spectrophotometer (Thermo Scientific, USA) and gel electrophoresis. First strand cDNA was synthesized from 1 µg of total RNA using AffinityScript qPCR cDNA synthesis kit (Stratagene, Agilent Technologies, USA). Gene specific qRT-PCR primers were designed using PrimerQuest software (http://eu.idtdna.com). The primer sequences are given in Table 2. qRT-PCR was performed using the Brilliant-II SYBR Green qPCR master mix in Stratagene MX3005P (Agilent Technologies, USA) detection system. The qRT-PCR was performed using following PCR conditions: DNA denaturation for 5 min. at 95°C, followed by 40 cycles of amplification consisting of 30 s of denaturation at 95°C, 30 s of annealing at 60°C and 30 s of extension at 72°C. Three biological replicates were used in this experiment. Amplicons were subjected to the meltcurve analysis to check the specificity of the amplified products. The relative expression level of each gene was calculated by 2-ddCt and 18S rRNA gene was used as housekeeping gene to normalize the amount of template cDNA added in each reaction.

RESULTS AND DISCUSSIONIn the present study six ERF genes from brinjal

(SmERF7, SmERF20, SmERF52, SmERF70, SmERF80, SmERF83) were isolated and amplified from cDNA (Fig. 1). PCR products were further sequenced from both the sides and submitted to NCBI (Accession No. KF547974- KF547979). The expression analysis was carried out for these SmERFs after 8 h of salt, drought and mechanical wounding stresses and during fruit development (5, 10, 20 dpa) and ripening

Table 1. List of the primers used to amplify SmERF genes from brinjal.

Primer code

Sequence

ERF 7 F: CGAGGAGTGAGACAACGCCATTGGGR: GCAGGAACA AGATTGGAGAGTGACC

ERF 20 F: CCGCGATAGCAGCAAGCATCCTGR: CTCCATCTTCCGGATATAGCCAGGC

ERF 52 F: CGTGGCGTCCGTCAGCGACATTGGR: CTGTTGTGTACTCTCTGCTTG ACC

ERF 70 F: CCACCGATGAACTTTCCGGGAGAR: CCGACGAGCTAGTAGCCA GTTCAG G

ERF 80 F: GGGCAGCTAGAGTATGGCTCGGR: CCC TCA GCT TTC TCA GGC CCC CAC

ERF 83 F: GGGCAGCAGAAATAAGGGATCCACGR: ATATCTGCCCAATAGTCTCTCGCC

Table 2. List of SmERF primers used in qRT-PCR analysis.

Primer code

Sequence

SmERF7 F: GCCAAAGCTTGGCCAATCCCAAATR: AGCTGAACCTGAATCCACTGAAGC

SmERF20 F: GCAGCAGCAATGGACAAGTTCGATR: CGATGTTGCTAAGTCTATCGCGGA

SmERF52 F: TCGACGAAGTATCTCTCTGCTGCTR: CTTGCAATTTCGTCGTTCCAGGTC

SmERF70 F: CGGATTGGTTTGAATGAACCGGAACCR: CAACGTCACATTTCCGAACGGCTT

SmERF80 F: CCACAATGCTTCGTCTTCTTCACCR: TGTCCGATGCCATCAATTCATCC

SmERF83 F: GCATCTCCGCAATTCATAGCTCCAR: GTGAGTATTCCCAATAGTCTCTCGCC

18S rRNA F: CCGCGGAAGTTTGAGGCAATAACAR: CGGCAAGGCTATAAGCTCGTTGAA

ww

w.In

dia

nJo

urn

als.

com

Mem

ber

s C

op

y, N

ot

for

Co

mm

erci

al S

ale

Do

wn

load

ed F

rom

IP -

125

.18.

242.

18 o

n d

ated

20-

Ap

r-20

14

51

Isolation and Characterization of Ethylene Responsive Factor Genes from Brinjal

(50 dpa) stages. All the analyzed genes exhibited differential accumulation in response to three given stress treatments (Fig. 2). For SmERF7, SmERF70, SmERF80 and SmERF83 genes magnitude of the fold change under salt stress was more compared

to drought and wound stress, while expression of SmERF20 and SmERF52 was more during salt stress. In wounding stress, all SmERF were up-regulated with fold change varying from 8.1 (SmERF83) to 47 fold (SmERF80) except in SmERF7, where no

Fig. 1. PCR amplification of partial SmERF genes from brinjal seedling cDNA. L: 1kb DNA ladder.

Fig. 2. Validation of SmERF family genes under mannitol, salinity and wounding treatments using qRT-PCR. Y-axis represents the fold change values at various stress conditions.

ww

w.In

dia

nJo

urn

als.

com

Mem

ber

s C

op

y, N

ot

for

Co

mm

erci

al S

ale

Do

wn

load

ed F

rom

IP -

125

.18.

242.

18 o

n d

ated

20-

Ap

r-20

14

52


differential expression observed. Data presented in Fig. 3 showed differential expression of SmERFs during fruit development and ripening. SmERF80 is the only gene which is highly up-regulated at 20 dpa and ripening stage (50 dpa). Expression of SmERF52 and SmERF83 was high at 5dpa but further down-regulated till ri pening. Expression of SmERF7, SmERF70 and SmERF80 was found to be high at ripening stage (50 dpa) where as the other three genes expression was equal to 0 dpa. SmERF20 was found to be up-regulated at all the fruit developmental stages except 50 dpa.

In order to adapt to a large number of biotic and abiotic stresses, plants respond at physiological as well as biochemical levels. Many transcription factor families have been shown to exhibit stress-responsive gene expressions with significant overlap in response to various stress treatments, suggesting that signaling pathways involved in biotic and abiotic stresses are interconnected (Kunkel and Brooks, 8; Singh et al., 14; Fujita et al., 5). Present study is in accordance to the observations made by Sharma et al. (13) that SlERF52 and SlERF80 were up-regulated during

various stresses. SlERF70 was up-regulated 17 fold during salt and oxidation stress, whereas, SlERF7 (DREB gene) was up-regulated in response to salt and drought stress. We have observed the induction of SmERF genes in response to all the three stresses suggesting a crosstalk between different stress signaling pathways. Over-expression of ERF family genes in Arabidopsis, tobacco and tomato has been shown to confer increased resistance to biotic as well as abiotic stresses (He et al., 7; Park et al., 10).

Ethylene plays a major role in the ripening of fleshy fruits. Understanding the key genes involved in ethylene biosynthesis and stress response is crucial to manipulate their expression for preventing losses due to over-ripening. ERFs regulate the expression of target genes in ethylene signal transduction pathway by binding to the GCC box in their promoter regions. These target genes in turn regulate the firmness, aroma, taste, colour and shelf Life of the fruits (Nath et al., 9). In tomato, SlERF7 and SlERF80 exhibited high-level accumulation in immature green stage and gradually declined during fruit development (Sharma et al., 13). In-contrast homologs of these genes

Fig. 3. Expression analysis of SmERF family genes under different fruit development stages (5, 10, 20 and 50 dpa) compared with 0 dpa. Y-axis represents the fold change.

ww

w.In

dia

nJo

urn

als.

com

Mem

ber

s C

op

y, N

ot

for

Co

mm

erci

al S

ale

Do

wn

load

ed F

rom

IP -

125

.18.

242.

18 o

n d

ated

20-

Ap

r-20

14

53

Isolation and Characterization of Ethylene Responsive Factor Genes from Brinjal

i.e. SmERF7 and SlERF80 showed up-regulation at ripening stage in brinjal. Brinjal being a non-climacteric fruit, there is absence of sudden ethylene production at ripening stage. Probably up-regulation of these genes has some role in non-climacteric fruit ripening. The expression of two genes, i.e., SmERF52 and SmERF83 decreases during fruit development and ripening stage, which suggests that these ERFs solely require high ethylene level for their expression. Slight up-regulation of SmERF7, SmERF20, SmERF52, SmERF70 and SmERF83 at very early stage of development suggests its role in early stage of fruit development. In tomato, SlERF83 was found to express only in red ripe stage of fruit development. SlERF52 exhibited maximum expression specifically at immature green stage of fruit development with negligible expression in breaker and red ripe fruit stages. This shows the change in its role during evolution in tomato and brinjal. Expression of SlERF70 was up-regulated from immature green to red ripe stages. Specific accumulation of their transcripts in different stages of fruit development indicates their involvement in stage-specific developmental activities (Sharma et al., 13).

In conclusion, present study has shown differential expression and involvement of SmERF7, SmERF20, SmERF52, SmERF70, SmERF80 and SmERF83 under salt and drought stresses, and in response to mechanical wounding. SmERF7, SmERF20, SmERF52, SmERF70 and SmERF83 genes play important role at early stage of fruit development, whereas, SmERF7, SmERF70 and SmERF80 are probably involved in the non-climacteric ripening of brinjal fruit. This study opens the window of investigation of an important ERF transcription factor family of genes and its role in brinjal fruit development and stress responses.

ACKNOWLEDGEMENTThis work was supported by funds from the Indian

Council of Agricultural Research, New Delhi.

REFERENCESAharoni, A., Dixit, S., Jetter, R., Thoenes, E., van 1. Arkel, G. and Pereira, A. 2004. The SHINE clade of AP2 domain transcription factors activates wax biosynthesis, alters cuticle properties, and confers drought tolerance when over-expressed in Arabidopsis. Plant Cell, 16: 2463-80.

Boutilier, K., Offringa, R., Sharma, V.K., Kieft, 2. H., Ouellet, T., Zhang, L., Hattori, J., Liu, C.M., Vanlammeren, A.A., Miki, B.L., Custers, J.B.M. and Lookeren Campagne, M.M.V. 2002. Ectopic

expression of BABY BOOM triggers a conversion from vegetative to embryonic growth. Plant Cell, 14: 1737-49.

Chuck, G., Muszynski, M., Kellogg, E., Hake, S. 3. and Schmidt, R.J. 2002. The control of spikelet meristem identity by the branched silkless1 gene in maize. Science, 298: 1238-41.

Dubouzet, J.G., Sakuma, Y., Ito, Y., Kasuga, M., 4. Dubouzet, E.G., Miura, S., Seki, M., Shinozaki, K. and Yamaguchi-Shinozaki, K. 2003. OsDREB genes in rice, Oryza sativa L., encode transcription activators that function in drought-, high-salt- and cold-responsive gene expression. Plant J. 33: 751-63.

Fujita, M., Fujita, Y., Noutoshi, Y., Takahashi, 5. F., Narusaka, Y., Yamaguchi-Shinozaki, K. and Shinozaki, K. 2006. Crosstalk between abiotic and biotic stress responses: A current view from the points of convergence in the stress signaling networks. Curr. Opin. Plant. Biol. 9: 436-42.

Gu, Y.Q., Yang, C., Thara, V.K., Zhou, J. and 6. Martin, G.B. 2000. Pti4 is induced by ethylene and salicylic acid and its product is phosphorylated by the Pto kinase. Plant Cell, 12: 771-86.

He, P., Warren, R.F., Zhao, T., Shan, L., Zhu, L., 7. Tang, X. and Zhou, J.M. 2001. Overexpression of Pti5 in tomato potentiates pathogen-induced defense gene expression and enhances disease resistance to Pseudomonas syringae pv. tomato. Mol. Plant Microbe Interact. 14: 1453-57.

Kunkel, B.N. and Brooks, D.M. 2002. Cross talk 8. between signaling pathways in pathogen defense. Curr. Opin. Plant Biol. 5: 325-31.

Nath, P., Trivedi, P.K., Sane, V.A. and Sane, 9. A.P. 2006. Role of ethylene in fruit ripening. In: Ethylene Action in Plants, Khan, A.N. (Ed.), Springer, Berlin, pp. 151-76.

Park, J.M., Park, C.J., Lee, S.B., Ham, B.K., 10. Shin, R. and Paek, K.H. 2001. Overexpression of the tobacco Tsi1 gene encoding an EREBP/ AP2-type transcription factor enhances resistance against pathogen attack and osmotic stress in tobacco. Plant Cell, 13: 1035-46.

Riechmann, J.L., Heard, J., Martin, G., Reuber, 11. L., Jiang, C., Keddie, J., Adam, L., Pineda, O., Ratcliffe, O.J., Samaha, R.R., Creelman, R.,

ww

w.In

dia

nJo

urn

als.

com

Mem

ber

s C

op

y, N

ot

for

Co

mm

erci

al S

ale

Do

wn

load

ed F

rom

IP -

125

.18.

242.

18 o

n d

ated

20-

Ap

r-20

14

54


Pilgrim, M., Broun, P., Zhang, J.Z., Ghandehari, D., Sherman, B.K. and Yu, G. 2000 Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. Science, 290: 2105-10.

Saito, T12. ., Yoshida, T., Monma, S., Matsunaga, H., Sato, T., Saito, A. and Yamada, T. 2009. Development of the parthenocarpic eggplant cultivar ‘Anominori’. Japnanese Agric. Res. 43: 123-27.

Sharma, M.K., Kumar, R., Solanke, A.U., 13. Sharma, R., Tyagi, A.K. and Sharma, A.K. 2010. Identification, phylogeny, and transcript profiling of ERF family genes during development and

abiotic stress treatments in tomato. Mol. Genet. Genomics, 284: 455-75.

Singh, K., Foley, R.C. and Onate-Sanchez, L. 14. 2002. Transcription factors in plant defense and stress responses. Curr. Opin. Plant Biol. 5: 430-36.

Zhang, J.Y., Broeckling, C.D., Blancaflor, E.B., 15. Sledge, M.K., Sumner, L.W. and Wang, Z.Y. 2005. Overexpression of WXP1, a putative Medicago truncatula AP2 domain-containing transcription factor gene, increases cuticular wax accumulation and enhances drought tolerance in transgenic alfalfa (Medicago sativa). Plant J. 42: 689-707.

Received: June, 2013; Revised: November, 2013; Accepted: January, 2014

ORIGINAL RESEARCH PAPER

GhDRIN1, a novel drought-induced gene of upland cotton(Gossypium hirsutum L.) confers abiotic and biotic stresstolerance in transgenic tobacco

Gurusamy Dhandapani • Azhagiyamanavalan Lakshmi Prabha •

Mogilicherla Kanakachari • Mullapudi Lakshmi Venkata Phanindra •

Narayanasamy Prabhakaran • Sellamuthu Gothandapani •

Kethireddy Venkata Padmalatha • Amolkumar U. Solanke •

Polumetla Ananda Kumar

Received: 2 July 2014 / Accepted: 11 November 2014

� Springer Science+Business Media Dordrecht 2014

Abstract A novel stress tolerance cDNA fragment

encoding GhDRIN1 protein was identified and its

regulation was studied in cotton boll tissues and

seedlings subjected to various biotic and abiotic

stresses. Phylogenetic and conserved domain predic-

tion indicated that GhDRIN1 was annotated with a

hypothetical protein of unknown function. Subcellular

localization showed that GhDRIN1 is localized in the

chloroplasts. The promoter sequence was isolated and

subjected to in silico study. Various cis-acting ele-

ments responsive to biotic and abiotic stresses and

hormones were found. Transgenic tobacco seedlings

exhibited better growth on amended MS medium and

showed minimal leaf damage in insect bioassays

carried out with Helicoverpa armigera larvae. Trans-

genic tobacco showed better tolerance to water-deficit

and fast recovered upon rewatering. Present work

demonstrated that GhDRIN1, a novel stress tolerance

gene of cotton, positively regulates the response to

biotic and abiotic stresses in transgenic tobacco.

Keywords Drought-induced � Fungal pathogens �Gossypium hirsutum � Helicoverpa armigera � Salt

stress � Transgenic tobacco �Water-deficit stress

Introduction

Abiotic stresses such as drought and salinity are the

major constraints in modern agriculture. These

stresses lead to a series of morphological, physiolog-

ical, biochemical and molecular changes in plants that

negatively affect plant growth and productivity (Wang

et al. 2001). Water-deficit and salinity affects more

than 10 % of arable land on our planet which results in

a yield reduction of more than 50 % on average for

most of the major crop plants (Bartels and Sunkar

2005). Cotton (Gossypium spp.) is the leading fiber

crop worldwide and is an important source of oil and

protein meal. Gossypium hirsutum L. is the most

widely cultivated cotton species, dominating global

cotton commerce with a share of more than 95 % of

the world production. As with the other major fiber

Electronic supplementary material The online version ofthis article (doi:10.1007/s10529-014-1733-9) contains supple-mentary material, which is available to authorized users.

G. Dhandapani � M. Kanakachari �M. L. V. Phanindra � N. Prabhakaran � S. Gothandapani �K. V. Padmalatha � A. U. Solanke � P. A. Kumar (&)

National Research Centre on Plant Biotechnology, LBS

Building, Pusa Campus, New Delhi 110012, India

e-mail: [email protected]

G. Dhandapani � A. Lakshmi Prabha �M. Kanakachari � N. Prabhakaran

Department of Plant Science, Bharathidasan University,

Tiruchirappalli 620024, Tamil Nadu, India

Present Address:

P. A. Kumar

Institute of Biotechnology, Acharya N. G. Ranga

Agricultural University, Rajendranagar,

Hyderabad 500030, Telangana, India

123

Biotechnol Lett

DOI 10.1007/s10529-014-1733-9

Genome-wide transcriptome and proteome analyses of tobaccopsaA and psbA deletion mutants

Sadhu Leelavathi • Amit Bhardwaj • Saravanan Kumar • Abhishek Dass •

Ranjana Pathak • Shiv S. Pandey • Baishnab C. Tripathy • K. V. Padmalatha •

Gurusamy Dhandapani • Mogilicherla Kanakachari • Polumetla Ananda Kumar •

Rino Cella • V. Siva Reddy

Received: 11 September 2010 / Accepted: 4 January 2011

� Springer Science+Business Media B.V. 2011

Abstract Photosynthesis in higher land plants is a com-

plex process involving several proteins encoded by both

nuclear and chloroplast genomes that require a highly

coordinated gene expression. Significant changes in plastid

differentiation and biochemical processes are associated

with the deletion of chloroplast genes. In this study we

report the genome-wide responses caused by the deletion of

tobacco psaA and psbA genes coding core components of

photosystem I (PSI) and photosystem II (PSII), respec-

tively, generated through a chloroplast genetic engineering

approach. Transcriptomic and quantitative proteomic anal-

ysis showed the down regulation of specific groups of

nuclear and chloroplast genes involved in photosynthesis,

energy metabolism and chloroplast biogenesis. Moreover,

our data show simultaneous activation of several defense

and stress responsive genes including those involved in

reactive oxygen species (ROS) scavenging mechanisms. A

major finding is the differential transcription of the plas-

tome of deletion mutants: genes known to be transcribed by

the plastid encoded polymerase (PEP) were generally down

regulated while those transcribed by the nuclear encoded

polymerase (NEP) were up regulated, indicating simulta-

neous activation of multiple signaling pathways in response

to disruption of PSI and PSII complexes. The genome wide

transcriptomic and proteomic analysis of the DpsaA and

DpsbA deletion mutants revealed a simultaneous up and

down regulation of the specific groups of genes located in

nucleus and chloroplasts suggesting a complex circuitry

involving both retrograde and anterograde signaling

mechanisms responsible for the coordinated expression of

nuclear and chloroplast genomes.

Keywords Photosystem I and II (PSI and PSII) �Plastome transformation � Transcriptomic and proteomic

analysis � Retrograde and anterograde signals � NEP and

PEP RNA polymerases � ROS scavenging mechanisms

Introduction

It is widely accepted that chloroplasts have originated

from a free living photosynthetic prokaryote that estab-

lished an endosymbiotic relationship with an early

eukaryotic progenitor (Goksoyr 1967; Martin and Muller

1998). During the course of evolution, the great majority

of the chloroplast genes moved to the nucleus, leaving

behind a small but functional genome encoding some key

components involved in photosynthesis, transcription and

Electronic supplementary material The online version of thisarticle (doi:10.1007/s11103-011-9731-y) contains supplementarymaterial, which is available to authorized users.

S. Leelavathi � A. Bhardwaj � S. Kumar � A. Dass �R. Pathak � V. Siva Reddy (&)

Plant Transformation Group, International Center for Genetic

Engineering and Biotechnology, Aruna Asaf Ali Marg,

New Delhi 110067, India


S. S. Pandey � B. C. Tripathy

School of Life Sciences, Jawaharlal Nehru University,


K. V. Padmalatha � G. Dhandapani �M. Kanakachari � P. A. Kumar

National Research Centre on Plant Biotechnology, Indian

Agricultural Research Institute, PUSA campus,


R. Cella

Dipartimento di Genetica e Microbiologia, Universita di Pavia,

Via Ferrata 1, 27100 Pavia, Italy

123

Plant Mol Biol

DOI 10.1007/s11103-011-9731-y

http://dx.doi.org/10.1007/s11103-011-9731-y

Genome-wide transcriptomic analysis of cotton under droughtstress reveal significant down-regulation of genes and pathwaysinvolved in fibre elongation and up-regulation of defenseresponsive genes

Kethireddy Venkata Padmalatha • Gurusamy Dhandapani • Mogilicherla Kanakachari •

Saravanan Kumar • Abhishek Dass • Deepak Prabhakar Patil • Vijayalakshmi Rajamani •

Krishan Kumar • Ranjana Pathak • Bhupendra Rawat • Sadhu Leelavathi •

Palakolanu Sudhakar Reddy • Neha Jain • Kasu N. Powar • Vamadevaiah Hiremath •

Ishwarappa S. Katageri • Malireddy K. Reddy • Amolkumar U. Solanke •

Vanga Siva Reddy • Polumetla Ananda Kumar

Received: 14 July 2011 / Accepted: 8 November 2011 / Published online: 7 December 2011

� Springer Science+Business Media B.V. 2011

Abstract Cotton is an important source of natural fibre

used in the textile industry and the productivity of the crop is

adversely affected by drought stress. High throughput tran-

scriptomic analyses were used to identify genes involved in

fibre development. However, not much information is

available on cotton genome response in developing fibres

under drought stress. In the present study a genome wide

transcriptome analysis was carried out to identify differen-

tially expressed genes at various stages of fibre growth under

drought stress. Our study identified a number of genes dif-

ferentially expressed during fibre elongation as compared to

other stages. High level up-regulation of genes encoding for

enzymes involved in pectin modification and cytoskeleton

proteins was observed at fibre initiation stage. While a large

number of genes encoding transcription factors (AP2-

EREBP, WRKY, NAC and C2H2), osmoprotectants, ion

transporters and heat shock proteins and pathways involved

in hormone (ABA, ethylene and JA) biosynthesis and signal

transduction were up-regulated and genes involved in

phenylpropanoid and flavonoid biosynthesis, pentose and

glucuronate interconversions and starch and sucrose

metabolism pathways were down-regulated during fibre

elongation. This study showed that drought has relatively

less impact on fibre initiation but has profound effect on fibre

elongation by down-regulating important genes involved in

cell wall loosening and expansion process. The compre-

hensive transcriptome analysis under drought stress has

provided valuable information on differentially expressed

genes and pathways during fibre development that will be

useful in developing drought tolerant cotton cultivars with-

out compromising fibre quality.

Keywords Cotton � Drought stress � Cell wall-modifying

genes � Fibre development � Microarrays

Introduction

Cotton is the major source of natural fibres used in the textile

industry and is cultivated across the globe (Smith and Co-

thren 1999). Among the four cultivated species, Gossypium

arboreum and G. herbaceum are diploids with A genome

and G. hirsutum and G. barbadense are allotetraploid spe-

cies with AD genome. G. hirsutum represents over 95% of

the cultivated cotton worldwide (Smith and Cothren 1999).

Electronic supplementary material The online version of thisarticle (doi:10.1007/s11103-011-9857-y) contains supplementarymaterial, which is available to authorized users.

K. V. Padmalatha � G. Dhandapani � M. Kanakachari �N. Jain � A. U. Solanke � P. A. Kumar

National Research Centre on Plant Biotechnology,

New Delhi, India

S. Kumar � A. Dass � D. P. Patil � V. Rajamani � K. Kumar �R. Pathak � B. Rawat � S. Leelavathi � P. S. Reddy �M. K. Reddy � V. S. Reddy (&)

Plant Transformation Group, International Center for Genetic

Engineering and Biotechnology, Aruna Asaf Ali Marg,



K. N. Powar � V. Hiremath � I. S. Katageri

University of Agricultural Sciences, Dharwad, India

123

Plant Mol Biol (2012) 78:223–246

DOI 10.1007/s11103-011-9857-y

http://dx.doi.org/10.1007/s11103-011-9857-y

Padmalatha et al. BMC Genomics 2012, 13:624http://www.biomedcentral.com/1471-2164/13/624

RESEARCH ARTICLE Open Access

Functional genomics of fuzzless-lintless mutant ofGossypium hirsutum L. cv. MCU5 reveal key genesand pathways involved in cotton fibre initiationand elongationKethireddy Venkata Padmalatha1, Deepak P Patil2, Krishan Kumar2, Gurusamy Dhandapani1,Mogilicherla Kanakachari1, Mullapudi LV Phanindra1, Saravanan Kumar2, T C Mohan3, Neha Jain1,Arkalgud H Prakash4, Hiremath Vamadevaiah3, Ishwarappa S Katageri3, Sadhu Leelavathi2, Malireddy K Reddy2,Polumetla Ananda Kumar1 and Vanga Siva Reddy2*

Abstract

Background: Fuzzless-lintless cotton mutants are considered to be the ideal material to understand the molecularmechanisms involved in fibre cell development. Although there are few reports on transcriptome and proteomeanalyses in cotton at fibre initiation and elongation stages, there is no comprehensive comparative transcriptomeanalysis of fibre-bearing and fuzzless-lintless cotton ovules covering fibre initiation to secondary cell wall (SCW)synthesis stages. In the present study, a comparative transcriptome analysis was carried out using G. hirsutumL. cv. MCU5 wild-type (WT) and it’s near isogenic fuzzless-lintless (fl) mutant at fibre initiation (0 dpa/days postanthesis), elongation (5, 10 and 15 dpa) and SCW synthesis (20 dpa) stages.

Results: Scanning electron microscopy study revealed the delay in the initiation of fibre cells and lack of anyfurther development after 2 dpa in the fl mutant. Transcriptome analysis showed major down regulation oftranscripts (90%) at fibre initiation and early elongation (5 dpa) stages in the fl mutant. Majority of the downregulated transcripts at fibre initiation stage in the fl mutant represent calcium and phytohormone mediated signaltransduction pathways, biosynthesis of auxin and ethylene and stress responsive transcription factors (TFs). Further,transcripts involved in carbohydrate and lipid metabolisms, mitochondrial electron transport system (mETS) and cellwall loosening and elongation were highly down-regulated at fibre elongation stage (5–15 dpa) in the fl mutant. Inaddition, cellulose synthases and sucrose synthase C were down-regulated at SCW biosynthesis stage (15–20 dpa).Interestingly, some of the transcripts (~50%) involved in phytohormone signalling and stress responsivetranscription factors that were up-regulated at fibre initiation stage in the WT were found to be up-regulated atmuch later stage (15 dpa) in fl mutant.

Conclusions: Comparative transcriptome analysis of WT and its near isogenic fl mutant revealed key genes andpathways involved at various stages of fibre development. Our data implicated the significant role of mitochondriamediated energy metabolism during fibre elongation process. The delayed expression of genes involved inphytohormone signalling and stress responsive TFs in the fl mutant suggests the need for a coordinated expressionof regulatory mechanisms in fibre cell initiation and differentiation.

* Correspondence: [email protected] Transformation Group, International Center for Genetic Engineeringand Biotechnology, Aruna Asaf Ali Marg, New Delhi 110067, IndiaFull list of author information is available at the end of the article

© 2012 Padmalatha et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of theCreative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use,distribution, and reproduction in any medium, provided the original work is properly cited.

mailto:[email protected]

http://creativecommons.org/licenses/by/2.0

Padmalatha et al. BMC Genomics 2012, 13:624 Page 2 of 15http://www.biomedcentral.com/1471-2164/13/624

BackgroundCotton is a commercially important fibre crop and isused as a major source of natural textile fibre and cot-tonseed oil. Among the four cultivated species, Gossy-pium hirsutum represents over 95% of the cultivatedcotton worldwide whereas the other three species, G.barbadense, G. arboreum and G. herbaceum togetherrepresent the remaining 5%. Cotton fibres are single-celled seed trichomes that develop from the ovule epi-dermal cells. About 30% of the seed epidermal cellsdifferentiate into spinnable fibres [1,2]. Cotton fibredevelopment includes four distinct, but overlappingstages: initiation, elongation/primary cell wall (PCW)synthesis, secondary cell wall (SCW) synthesis andmaturation. The fibre cell initiation usually occursfrom 2–3 days before anthesis to 2–3 days post anthe-sis (dpa) and fibre cell elongation occurs up to 20 dpa.However, fast elongation of fibre cell occurs between 5to 15 dpa. Secondary cell wall synthesis starts at about20 dpa and continues up to 45 dpa. During this periodlarge amount of cellulose (>90%) deposition takes placeand the fibre cell wall becomes thick. In the final mat-uration stage (45–50 dpa) fibres undergo dehydrationand produce mature cotton lint [1-3].Cotton fibre is considered as an excellent single-celled

model system for studying the molecular mechanismscontrolling the plant cell initiation, elongation and sec-ondary cell wall biosynthesis. In recent years, functionalgenomics-based approaches have been widely used to in-vestigate the genes involved in cotton fibre development[2-8]. Phytohormones such as ethylene [9], auxins[10,11] and brassinosteroids (BR) [12,13] and transcrip-tion factors such as MYB25 [14] and MYB25-like [15,16]were shown to be involved in fibre development. Cottonfibre elongates by diffusion growth mechanism and theturgor driven force is required for unidirectional elong-ation [17,18]. Therefore, osmotically active solutes (sol-uble sugars, potassium and malate) and ion-transporters(H+-ATPases and K+-transporter) play an important rolein maintaining the osmotic potential of the elongatingfibre cell [18]. It is reported that the closure of plasmo-desmata (PD) and the coordinated up-regulation of po-tassium (K+) and sugar transporters during fibreelongation stage maintains the turgor pressure requiredfor the fibre cell elongation and the duration of PD clos-ure correlates positively with the fibre length [19]. Inaddition, it has been reported that ROS (reactive oxygenspecies) homeostasis is the central regulatory mechan-ism for cotton fibre initiation and differentiation [8].Carbohydrate and energy metabolisms play an importantrole in the fibre development by providing the carbonskeletons for the synthesis of cell wall polysaccharidesand fatty acids [5,7,20,21]. Several studies have shownthe role of xyloglucan and pectin modifying enzymes

[22], arabinogalactans [23] and expansins [24] in cellwall loosening and expansion during fibre elongationstage. Further actin cytoskeleton plays an important roleduring fibre elongation stage and reorientation of cyto-skeleton microtubules is required for the onset of sec-ondary cell wall synthesis [25-27]. Despite extensiveresearch on cotton fibre biology over the last few dec-ades, the mechanisms controlling fibre development re-main largely unknown.The fuzzless-lintless (fl) ovules of cotton mutant are

ideal material for identifying genes involved in the fibredevelopment through comparative approaches. A fewcomparative transcriptome and proteome studies werecarried out to understand the genes involved in fibre ini-tiation and differentiation using the ovules of fuzzless-lintless mutant and its wild-type [4,8,28]. Similarly, acomparative proteome study was carried out usingovules of fl mutant and its wild-type to identify the dif-ferentially expressed proteins at elongation stage [7].However, comprehensive transcriptome studies employ-ing fuzzless-lintless mutants involving all the importantstages (initiation, elongation and secondary cell wall syn-thesis) of fibre development are not yet reported.In the present study, comparative transcriptome ana-

lysis of fl mutant with its wild-type (WT), G. hirsutumL. cv. MCU5 at fibre initiation (0 dpa), elongation (5, 10and 15 dpa) and SCW synthesis stage (20 dpa) was car-ried out using Affymetrix cotton GeneChip genomearray. Data from this study suggests that stress respon-sive transcription factors and the genes involved in cal-cium (Ca2+) and phytohormone-mediated signallingpathways play a crucial regulatory role in fibre cell initi-ation and differentiation. Our study also revealed thedown-regulation of several genes involved in intercon-version of sugar molecules and mitochondrial electrontransport system (mETS) that are required for the syn-thesis of cell wall polysaccharides and fatty acids andmaintenance of redox-homeostasis during fibre elong-ation. The comprehensive transcriptome analysis identi-fied several stage specific genes and pathways operatingduring the fibre development that might be useful forthe improvement of cotton fibre.

Results and discussionMorphology of fuzzless-lintless mutantThe near isogenic fl mutant employed in this study is aspontaneous mutant of G. hirsutum L. cv. MCU5 firstidentified in 1984 [29] and maintained as a purefuzzless-lintless line in the germplasm collections at theCotton Breeding Station, Tamil Nadu Agricultural Uni-versity, Coimbatore [29,30]. Morphological and growthparameters of the fl mutant including plant height, leafsize, flower colour, number of bolls per plant, number ofseeds per boll, etc. are very similar to that of WT.


Scanning electron microscopy (SEM) study was carriedout to identify the differences in early stages of fibre de-velopment by comparing the ovule of fl mutant with thatof WT (Figure 1A). SEM analysis revealed the presenceof fibre cell initials in the fl mutant, though very less innumbers as compared to WT. Fibre initials could beseen two days before anthesis (−2 dpa) in the WT andwere more prominent at 0 dpa. Similarly, the fibre initi-als were also observed on the fl mutant, though not veryprominent at −2 dpa, but were more visible at 0 dpa(Figure 1A). This suggests the probable delay of fibre ini-tiation in the fl mutant. However, further growth of fibreinitials were not observed in the fl mutant leading to itsfuzzless-lintless status (Figure 1A and B).

Comparative transcriptome analysisComparative transcriptome analysis was carried out atfibre initiation (0 dpa), elongation (5, 10 and 15 dpa)and SCW synthesis (20 dpa) stages using ovules of flmutant and fibre-bearing ovules of WT to decipher mo-lecular mechanisms involved in fibre cell development.Affymetrix cotton GeneChip genome arrays were usedfor transcriptome analysis. Transcripts with false discov-ery rate (FDR) adjusted p value ≤ 0.01 and fold changeof ≥ 3.0 were considered as differentially expressedtranscripts (DETs) in the fl mutant as compared to theirrespective stages in WT (Figure 1C, Additional file 1).The number of down-regulated transcripts was more ascompared to up-regulated transcripts in various stagesanalysed. Further, the percentage of down-regulatedtranscripts was very high at fibre initiation (0 dpa,90.0%) and early elongation (5 dpa, 91.5%) stages ascompared to the later stages (Figure 1C). Data analysisrevealed that majority of the DETs showed stage spe-cific expression pattern with minor overlap among thestages (Figure 1D).

Annotation and functional classification of DETsThe DETs were annotated based on TAIR proteomedatabase (http://www.arabidopsis.org). Out of 3,898DETs, 2,968 (76.14%) were matched with Arabidopsisgene models with E value ≤ e-10 (Additional file 1). Fur-ther, the DETs were classified into different functionalcategories according to their putative functions based onMIPS functional catalogue (http://mips.gsf.de/projects/funcat). In categories such as “protein with binding func-tion or cofactor requirement”, “response to biotic andabiotic stresses”, “transcription”, “cellular transport,transport facilities and transport routes” and “biogenesisof cellular components” the transcripts were mostlydown-regulated at fibre initiation and early elongationstages (Additional file 2). Further, DETs related to vari-ous transcription factor (TF) families and phytohor-mone biosynthesis and signal transduction pathways

were identified using Arabidopsis transcription factor(http://plntfdb.bio.uni-potsdam.de) and hormone (http://ahd.cbi.pku.edu.cn) databases, respectively (Figure 2;Additional file 3 and Additional file 4). In addition,DETs involved in carbohydrate and energy metabolisms,fatty acid metabolism, cell wall loosening and extensionand SCW synthesis were identified and discussed below(Figures 3, 4; Additional file 5 and Additional file 6).

Validation of microarray dataTo validate the microarray data, quantitative real-timepolymerase chain reaction (qRT-PCR) analysis was per-formed on 28 DETs, belonging to various functional cat-egories, during fibre development stages (0, 5, 10, 15and 20 dpa). The qRT-PCR analysis and microarray datashowed similar gene expression pattern for all the genesstudied (Figure 5, Additional file 7).

Differentially expressed transcription factorsDETs encoding transcription factors (TFs) belongingto various families were identified in the fl mutant inall stages of ovule development as compared to WT(Figure 2; Additional file 3). TFs belonging to theAP2-EREBP, C2H2, NAC and WRKY were highlydown-regulated at fibre initiation (0 dpa) and earlyelongation stages (5 dpa) in the fl mutant. Similarly, TFsbelonging to the heat shock transcription factor (HSF)family were down-regulated at 10 and 20 dpa in the flmutant (Figure 2). Further, several transcripts encodingMYB family TFs were differentially expressed at 0 and10 dpa. In addition, transcripts encoding integrase-typeDNA-binding superfamily proteins involved in defencemechanism were highly down-regulated at 0 and 10 dpasuggests their involvement in fibre development(Figure 5A1). Transcripts encoding AP2-EREBP familyTFs such as ethylene responsive element binding factors(ERFs), redox responsive transcription factor 1 (RRTF1,Figure 5A2) and DREB1-like (DREBP1L) were highlydown-regulated at fibre initiation (0 dpa) and elong-ation (5 dpa) stages in the fl mutant. In addition, tran-scripts encoding salt tolerance zinc finger (STZ) TFsbelonging to C2H2-type zinc finger family and heatshock transcription factor 2 (HSFA2) were down-regulated at fibre initiation and elongation stages, re-spectively (Figure 5A3).Transcripts encoding R2R3-MYB transcription factors

such as GhMYB25/AtMYB16 (Figure 5A4), AtMYB106and AtMYB73 were down-regulated at fibre initiationand elongation stages. It has been shown that GhMYB25[14] and GhMYB25-like [16] are highly expressed duringfibre initiation stage and have a role in regulation offibre cell elongation and trichome development.AtMYB60 has been shown to be involved in root growthof Arabidopsis under drought stress [31]. Further,

http://www.arabidopsis.org

http://mips.gsf.de/projects/funcat


http://plntfdb.bio.uni-potsdam.de

http://ahd.cbi.pku.edu.cn


37 40

1168

362462

333433

1561

456588

0

200

400

600

800

1000

1200

1400

1600

1800Up-regulated

Down-regulated

0

20

40

60

80

100

0dpa

5dpa

10dpa

15dpa

20dpa

% o

f tr

ansc

rip

ts

Nu

mb

er o

f tr

ansc

rip

ts

C

5 dpa20 dpa

10 dpa15 dpa

0 dpa

Up-regulated transcripts in the fl mutant

1

25

0 2

1

01 0

1 3

2

26

0 2213

24

1120263

54

390

5 dpa20 dpa

10 dpa15 dpa

0 dpa

Down-regulated transcripts in the fl mutant

0

222

8 71

0

43

15

10

326

14

750

126

195

54

4520

0

2

1337

D

A

10 dpa

B

Wild-type fl mutant

-2 dpa

-1 dpa

0 dpa

2 dpa

EHT = 15.00 KVWD = 17 nnMag = 1.00 K X

10 µm

0 dpamutant vs WT

5 dpamutant vs WT

15 dpamutant vs WT

10 dpamutant vs WT

20 dpamutant vs WT

E F

5 dp

a

0 dp

a

15 d

pa

10 d

pa

20 d

pa

5 dp

a

0 dp

a

15 d

pa

10 d

pa

20 d

pa

Figure 1 (See legend on next page.)


(See figure on previous page.)Figure 1 Scanning electron microscopy (SEM) and transcriptome analyses during fibre development stages in G. hirsutum L. cv. MCU5wild-type and its near isogenic fuzzless-lintless (fl) mutant. (A) SEM images (bar is 10 μM) of epidermal layer of −2 to 2 dpa ovules from theWT and fl mutant. (B) Fibre-bearing ovules of WT and fuzzless-lintless ovule of mutant at 10 dpa. (C) Number of differentially expressed transcripts(DETs) during fibre development stages in the fl mutant as compared to their respective stages in WT and inset represents the percentage ofup- and down-regulated transcripts in the fl mutant (D) Venn diagrams showing the commonly up- and down-regulated transcripts among thefibre development stages in the fl mutant. Cluster analysis showing the down-regulation of transcripts related to transcription factors (E) andphytohormones (F) at 0 dpa and up-regulation of about 50% of those transcripts at 15 dpa. DETs with p value≤ 0.01 and fold change≥ 3 wereincluded and presented in Additional file 1.


transcripts encoding NAC family TFs were down-regulated at 0 dpa (NAC047) and early elongation(NAC047, NAC072/RD26 and NAC074) stages. Anotherstress responsive gene, multiprotein bridging factor 1C(MBF1c) was down-regulated at 10 and 20 dpa. It hasbeen reported that MBF1c is involved in biotic and abi-otic stress tolerance by activating ethylene-responsivesignal transduction pathway [32]. In addition to stressresponsive TFs, transcripts encoding the homeodomainproteins such as (HOX3)/glabrous 11 and knotted1-likehomeobox gene 3 (KNAT3) involved in Arabidopsistrichome and root development, respectively weredown-regulated at 10 dpa.The developing fibre cell during initiation and elong-

ation stages accumulate a large amount of solutes inorder to maintain the required turgor pressure. Expres-sion of stress responsive factors during initiation andelongation stages suggests stress-like condition beinggenerated due to turgor pressure. The stage specifictranscriptome analysis showed the down-regulation of

-30

-25

-20

-15

-10

-5

0

5

10

15

20

25

1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1

AP2-EREBP

AUX/IAA bHLH bZIP C2C2 C2H2

Up-regulated Do

Nu

mb

er o

f tr

ansc

rip

ts

Figure 2 Differentially expressed transcripts (DETs) encoding the transtages in the fl mutant as compared to their respective stages in WT.factors at each stage are presented in the Additional file 3.

several stress responsive TFs in the fl mutant during theinitiation and elongation stages as compared to WT.This could be due to the fact that these TFs may nothave any role in the fl mutant as there is no further de-velopment of the fibre initials after 2 dpa. In contrast,our data showed the up-regulation of about 50% of thesame TFs at much later stage (15 dpa) in the fl mutant(Figure 1E). The down-regulation of stress responsiveTFs in the initiation stage and up-regulation of the samefactors at 15 dpa in the fl mutant as opposed to WT sug-gests the loss of coordination among the regulatorymechanisms and the factors involved in the stress re-sponse in the mutant.

Calcium and phytohormones-mediated signallingCalcium mediated signalling plays an important role incell division and differentiation including root hairelongation [33]. Preferential expression of genes encod-ing calcium binding proteins involved in Ca2+-mediatedsignalling pathways during fibre initiation and elongation

2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5

C3H GRAS HB HSF MYB NAC WRKY

wn-regulated

scription factors of various families during fibre development1–5 represents the 0, 5, 10, 15 and 20 dpa. Putative transcription

Figure 3 (See legend on next page.)


(See figure on previous page.)Figure 3 Differentially expressed transcripts (DETs) involved in mitochondrial electron transport system (mETS) and fatty acidmetabolism in the fl mutant as compared to WT at 10 dpa. (A) MapMan-based visualization of the DETs involved in mETS in the fl mutant.Small blue and red colour squares represents up- and down-regulated transcripts, respectively. (B) Over view of DETs involved in fatty acidmetabolism in the fl mutant. ABC: ATPase transporter, ACBP: acyl-CoA binding protein, ACY: acyltransferase-like protein, CER: eceriferum/fatty acidhydroxylase, CK: choline kinase, CT-BMY: chloroplast beta-amylase, DAG: diacylglycerol, DGDG: digalactosyldiacylglycerol, FAD: fatty aciddesaturase, FAE: Long chain fatty acid elongation enzyme, FDH: Fiddlehead-like protein, Glc-6-P: glucose 6-phosphate, Gly-3-P: Glycerol-3-phosphate, KCS: beta-ketoacyl-CoA synthase, KCR: beta-ketoacyl reductase, LTP: lipid transfer protein, LTPG1: glycosylphosphatidylinositol-anchored lipid protein transfer1, PA: phosphatidic acid, PC: phosphatidylcholine, PEP: phosphoenol pyruvate, PG: phosphatidylglycerol, 3-PGA:phosphoglyceric acid, PM: plasma membrane, PPT2: phosphoenolpyruvate (PEP)/phosphate translocator 2, TAG: triacylglycerol, TPT: glucose-6-phosphate/phosphate translocator-related and VLCFA: very long chain fatty acids. DETs related to mETS and fatty acid metabolism are presentedin the Additional file 6.


stages have been reported in cotton [33,34]. In thisstudy, several transcripts coding for calcium-binding EF-hand family proteins were highly down-regulated at 0and 10 dpa in the fl mutant as compared to WT(Additional file 1; Figure 5B1, 5B2, 5B3). In addition,transcripts encoding Ca2+-dependent protein kinase 6(CDPK6) and glutamate decarboxylase (GAD) weredown-regulated at 0 and 10 dpa, respectively. Further,transcripts encoding Ca2+-ATPase that was shown toplay a role in maintaining the calcium homeostasis inthe cell [35] (Figure 5B4) and C2 calcium-dependentmembrane targeting protein were highly down-regulatedat 0 and 10 dpa in the fl mutant. These results are inagreement with the earlier reports that suggested a role

-50

-40

-30

-20

-10

0

10

20

1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4

Xyloglucan modifying enzymes

Pectin modifying enzymes

Expansins Arabinogalacta

Nu

mb

er o

f tr

ansc

rip

ts

Figure 4 Differentially expressed transcripts (DETs) involved in primaheat shock proteins (HSPs) during fibre development stages in the flCytoskeleton related genes include ACT, TUB, ADF and actin binding proteXyloglucan modifying enzymes include XTHs, XETs, β-xylosidases and α-xyl5, 10, 15 and 20 dpa. DETs related to cell wall biosynthesis and HSPs are pr

for Ca2+-mediated signal transduction and Ca2+-homeo-stasis in the fibre cell initiation and elongation [33,34].Phytohormones play an important regulatory role in

various plant growth and developmental processesthrough intracellular signalling events leading to well-defined changes in the gene expression. In the presentstudy, DETs involved in phytohormone biosynthesis andsignal transduction pathways were identified at differentstages in the fl mutant as compared to their respectivestages in WT (Additional file 4). Ethylene [9], auxin [11]and brassinosteroids (BR) [12] were shown to play a rolein fibre cell initiation and elongation. In this study genesinvolved in the phytohormone signal transductionpathways and the biosynthesis of auxin, BR, ethylene,

5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5

ns Cellulose synthases

Proline-rich proteins

Cytoskeleton related

Heat shock proteins

Down-regulated Up-regulated

ry and secondary cell wall biosynthesis and DETs encoding themutant as compared to their respective stages in WT.ins; Pectin modifying enzymes include PGs, PLs, PMEs and PMEIs;osidases; Expansins include EXPA, EXLA and EXLB. 1–5 represents the 0,esented in the Additional file 6.

-8

-6

-4

-2

0

2

Galactinol synthase 1/GolS1 (Ghi.10579.1.S1_at)

-7

-6

-5

-4

-3

-2

-1

0

Arabinogalactan protein 2/GhAGP2 (Ghi.5750.1.S1_s_at)

-7

-6

-5

-4

-3

-2

-1

0

Beta-ketoacyl-CoA synthase 2/KCS2 (Ghi.5184.1.A1_s_at)-10

-8

-6

-4

-2

0

Acyltransferase-like protein/ACY (Ghi.207.1.S1_s_at)

-6

-5

-4

-3

-2

-1

0

Lipid transfer protein 1/LTP1 (GbaAffx.190.1.S1_x_at)

-5

-4

-3

-2

-1

0

Acyl-CoA binding protein 4/ACBP4 (Ghi.7158.1.S1_s_at)

-10

-8

-6

-4

-2

0

2

4

Fasciclin-like arabinogalactan protein 6/FLA6 (Ghi.4418.2.S1_s_at)

-10

-8

-6

-4

-2

0

Fiber protein/GLP1 (Ghi.789.1.S1_at)

-10

-5

0

5

-12

-7

-2

3

8

Integrase-type DNA-binding protein (Ghi.10443.1.S1_at)

-15

-10

-5

0

5

10

15

Redox responsive transcription factor 1/RRTF1 (Ghi.9720.1.S1_at)

GhMYB25(Ghi.10360.1.S1_a_at)

-8

-6

-4

-2

0

-5

-4

-3

-2

-1

0

1

2

-4

-2

0

2

4

Sucrose synthase isoforms C/SusC (Ghi.2039.2.S1_s_at)

UDP-D-glucuronate 4-epimerase1/GAE1 (Ghi.10438.1.S1_s_at)

Endo-1,3-β-glucanase (Ghi.1004.1.A1_at) -15

-10

-5

0

Beta-globulin (Ghi.8040.1.S1_s_at)

-15

-10

-5

0

5

-10

-8

-6

-4

-2

0

2

4

HSP18.2 (Ghi.9308.1.S1_at)

HSFA2 (Ghi.10292.1.S1_s_at)

-5

-4

-3

-2

-1

0

RD22-like protein/RDL (Ghi.5529.1.S1_x_at)

-10

-5

0

5

10

Ca2+ ATPase (Ghi.3763.1.A1_s_at)

A2A1 A4

D1 D2

D3 E3

G4

E2E1

E4

G6G5 H1

F3

B4

F1 F2

A3

-10

-5

0

5

Calcium-binding EF hand family protein(GhiAffx.24550.1.S1_at) -8

-6

-4

-2

0

2

TOUCH2/TCH2(GhiAffx.5986.1.S1_at)

-6

-5

-4

-3

-2

-1

0

Calmodulin 1/CAM1(GhiAffx.25338.1.A1_at)

-10

-5

0

5

10

Short hypocotyl 2/SHY2 (GhiAffx.15164.1.A1_s_at)

B1 B2 B3

C1

-12

-7

-2

3

8

Phosphate-responsive protein/EXO (Ghi.9415.1.A1_at)

C2

-12

-10

-8

-6

-4

-2

0

2

CYP87A2 (Ghi.1119.1.S1_s_at)

F4

-2.5

-2

-1.5

-1

-0.5

0

Irregular xylem 3/IRX3 (Ghi.5191.1.A1_at)-10

-5

0

5

10

TCH4/XTH22 (Ghi.1127.2.A1_x_at)-10

-8

-6

-4

-2

0

Alpha-expansin 1 (Ghi.2039.1.S1_x_at)

G1 G2 G3

Figure 5 Validation of microarray data using qRT-PCR during fibre development stages (0, 5, 10, 15 and 20 dpa) in the fl mutant. Y-axisrepresents the log2 fold change values at various stages in the fl mutant as compared to their respective stages in WT.



gibberellic acid (GA), were found to be down-regulatedat fibre initiation and elongation stages in the fl mutant(Additional file 4).While the transcripts encoding cytochrome P450 83B1

(CYP83B1) were down-regulated at 0 and 5 dpa, thetranscript encoding CYP79B2 was highly down-regulated at 10 dpa. CYP79B2 catalyzes the conversionof tryptophan to Indole-3-acetaldoxime and CYP83B1/RNT1/SUR2 catalyzes the first step in the biosynthesisof indole glucosinolates from indole-3-acetaldoxime andregulates the level of IAA. In addition, a transcript en-coding the P-glycoprotein 19 (PGP19) involved in auxintransport was down-regulated at 10 dpa in the fl mutant[36]. Furthermore, transcripts encoding the auxin re-sponsive gene hypocotyls 2 (SHY2/AUX2-11/IAA4)(Figure 5C1) were highly down-regulated at 0 and 10dpa. Also, auxin-induced in root cultures 1 (AIR1) werehighly down-regulated at 15 and 20 dpa. Transcripts en-coding ACC oxidases (ACOs), involved in ethylene bio-synthesis were down-regulated at 0 dpa (ACO2 andACO4) and 5 dpa (ACO1, ACO2, ACO3 and ACO4/EFE) in the fl mutant. Along with ACC oxidases, a tran-script encoding ACC synthase 6 (ACS6) which is a ratelimiting enzyme in ethylene biosynthesis was also down-regulated at 0 dpa. These results suggest the down-regulation of auxin and ethylene biosynthesis at fibre ini-tiation and early elongation stages in the fl mutant.Transcripts encoding the enzymes involved in BR bio-

synthesis such as 3-oxo-5-α-steroid 4-dehydrogenasefamily protein (DET2) [13] and sterol methyltransferase2 (SMT2) were down-regulated at 10 dpa in the fl mu-tant. In addition, a number of genes (eg. BRI1, BRH1and P450-like protein/CYP734A1/BAS1) involved in BRsignalling pathway [37] was also differentially expressedat various stages in the fl mutant as compared to WT(Additional file 4). Down-regulation of several genesinvolved in ethylene, auxin and BR biosynthesis and sig-nal transduction pathways during fibre initiation andelongation stages suggested their regulatory role in fibrecell initiation and elongation. In the present study wehave identified a number of genes involved in the phyto-hormone biosynthesis and signal transduction pathwaysthat were down regulated at fibre initiation stage (0 dpa)in fl mutant as compared to WT. Interestingly, ~50% ofthese genes were found to be up-regulated at late elong-ation stage (15 dpa) in the fl mutant (Figure 1F), sug-gesting the delay in the phytohormone stimulation andsignalling in the mutant.

Carbohydrate and energy metabolismSugars are the basic source of energy and carbon skele-tons for all biomolecules and they are required for theregulation of cell homeostasis and synthesis of cell wallprecursors. UDP-D-glucose (UDP-Glc) is a central

metabolite in carbohydrate metabolism and is the com-mon precursor for synthesis of cell wall polysaccharidessuch as pectin, hemicellulose and cellulose. In thepresent study, transcripts encoding the enzymes, involvedin synthesis of cell wall precursors, such as UDP-glucosepyrophosphorylases (UGP1 and UGP2), UDP-glucose 6-dehydrogenase (UGD), UDP-D-glucuronate 4-epimerase1 (GAE1), UDP-XYL synthase 5 (UXS5) were down-regulated during fibre elongation stage in the fl mutant.UGP and UGD catalyse the formation of UDP-D-glucose and UDP-D-glucuronic acid, respectivelywhereas GAE1 (Figure 5D1) and UXS5 catalyse theformation of UDP-D-galacturonic acid (precursor forpectin) and UDP-D-xylose (precursor for hemicellu-lose) from UDP-D-glucuronic acid, respectively(Additional file 5 and Additional file 6). The UDP-glucose formed from the sucrose by sucrose synthase(Sus) is used directly as a substrate by the cellulosesynthase complex. The Sus isoform C (SusC) involvedin cellulose synthesis was highly down-regulated at 15dpa in the fl mutant (Figure 5D2, Additional file 5and Additional file 6) [38]. Carbohydrates such as raf-finose family oligosaccharides (RFOs) are the mainstorage forms of carbohydrates in the seeds, whichconfer desiccation tolerance. In the present study,transcripts encoding galactinol synthase (GolS) thatcatalyse the first committed step in the biosynthesisof RFOs (GolS1 and GolS2) were highly down-regulated at 10 dpa in the fl mutant (Figure 5D3;Additional file 5 and Additional file 6). Further, raffi-nose synthase (RS/SIP1), stachyose synthase (STS)were also down-regulated. Trehalose is another stor-age carbohydrate that was shown to be involved indesiccation tolerance [39]. Transcripts encoding theenzymes involved in trehalose biosynthesis such astrehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP) were down-regulated atfibre elongation stage. Previously we have shown that,both GolS and TPS were highly up-regulated underdrought stress at fibre elongation stage suggesting therole of these genes in fibre development [40].In the present study, transcripts encoding the enzymes

involved in Calvin cycle such as ribulose bisphosphatecarboxylase, glyceraldehyde 3-phosphate dehydrogenase,transketolase and fructose-bisphosphate aldolase (FBPA)were down-regulated at 10 and 15 dpa thus indicatingthe reduction of sugar pool in the fl mutant ovules(Additional file 6). Mitochondrial electron transport sys-tem (mETS) is the main pathway for the generation ofATP by oxidative phosphorylation. Recently it has beenshown that the ATP synthase δ1 subunit (GhATPδ1) isrequired for mitochondrial ATP synthesis and to main-tain higher ATP⁄ADP ratio which facilitates faster fibrecell elongation [21]. Several transcripts encoding the


enzymes involved in mETS were down-regulated in thefl mutant which in turn decreases the NAD+/NAD(P)Hratio and efficiency of mitochondrial ATP production(Figure 3A; Additional file 6). The ATP/ADP andNAD+/NAD(P)H ratios are very critical for maintainingredox-homeostasis and functioning of several enzymesinvolved in synthesis of cell wall precursors and fattyacids [41]. These data suggest the importance of inter-conversion of sugars and the role of mETS during fibreelongation process.

Fatty acid metabolismFatty acid biosynthesis is another important biochemicalpathway involved in fibre cell development [5,42,43]. Inthe present study, transcripts encoding the enzymesinvolved in the biosynthesis of very long chain fattyacids (VLCFAs), cuticular wax and phospholipids weredown-regulated at fibre elongation stage in the fl mu-tant as compared to WT. Calvin cycle and sugarsexported from the cytosol are main source of sugarpool for synthesis of fatty acids in plastids of non-photosynthetic tissue. Fatty acids synthesized within theplastids are exported as acyl-CoA esters (C16:0 CoAand C18:1 CoA) to the endoplasmic reticulum (ER) forsynthesis of VLCFA that are precursors for synthesis ofphospholipids, sphingolipids, wax and cuticular matrix(Figure 3B; Additional file 6). Transcripts encoding thesugar transporters such as triose phosphate/phosphatetranslocator (TPT) and phosphoenolpyruvate (PEP)/phosphate translocator (PPT) and acyl-CoA bindingprotein 4 (ACBP4, Figure 5E1) were down-regulated at10 dpa in the fl mutant. Glucose-6-phosphate/phos-phate translocator (GTP), TPT and PPT are required forimport of cytosolic Glc-6-P, 3-PGA and PEP respect-ively, from cytosol into the plastid for synthesis of acyl-CoA [44]. Cytosolic ACBP4 and ACBP5 were shown tobind long-chain acyl-CoAs and involved in the traffick-ing of oleoyl-CoA from the plastids to ER for synthesisof VLCFAs [45].Phospholipids are major structural components of

plasma membrane (PM) and involved in lipid signallingpathway. PM plays a crucial role during fibre cell elong-ation. Phosphatidic acid (PA) is the key component inphospholipid biosynthesis. The transcripts encodingacyltransferase-like protein (ACY) involved in synthesisof PA in ER (Figure 5E2) and AGC (cAMP-dependent,cGMP-dependent and protein kinase C) kinase familyproteins (AGC2-1 and AGC2-2) were highly down-regulated at 10 dpa in the fl mutant. Further, transcriptsencoding fatty acid desaturases (FADs) such as FAD8(plasticidal) and FAD3 (ER) and delta-8 sphingolipiddesaturase were down-regulated. In lipid-signalling path-way PA specifically binds to AtPDK1 (3-phosphoinosi-tide-dependent protein kinase 1) and stimulates AGC2-1

and it has been shown that agc2-1 knockout mutantsresulted in reduced root hair length suggesting its rolein cell elongation [46]. Down-regulation of genesinvolved in phospholipid biosynthesis and lipid signallingsuggested their role in fibre development.Transcripts encoding beta-keto acyl-CoA synthases

(KCS2, KCS6/CER6/CUT1, KCS10/FDH, KCS11, KCS12and KCS19) and beta-keto acyl reductase (KCR1/YBR159), catalyzing the first two committed steps inVLCFA synthesis, were highly down-regulated at fibreelongation stage in the fl mutant (Figures 3B, 5E3). Inaddition, a transcript encoding a long chain fatty acidelongation enzyme (ELo2/SUR4) was highly down-regulated at 5, 10 and 20 dpa. A transcript encoding ep-oxide hydrolase involved in cutin layer biosynthesis washighly down-regulated at 10 dpa [47].Lipid transfer proteins (LTPs) are involved in transport

of lipids from ER to PM and the subsequent transport oflipids from PM to the cell exterior appears to be carriedout by PM localized transporters such as ATP-bindingcassette (ABC) transporters [48,49]. In the present study,several transcripts encoding LTPs (Figure 5E4), ABCtransporters such as white/brown complex proteins(WBC1 and WBC12/CER5) were down-regulated atfibre elongation stage in the fl mutant. Further, a tran-script encoding glycosylphosphatidylinositol-anchoredlipid protein transfer 1 (LTPG1) was down-regulated.High level expression of WBC1 during fibre elongationand plasma membrane localization was reported in up-land cotton [50]. In A. thaliana WBC12/CER5 andWBC11 have been shown to be involved in cuticularlipid transport [51] and the localization of LTPG in PMand its role in lipid deposition has been demonstrated[52]. Down-regulation of genes involved in fatty acidmetabolism in the fl mutant particularly at elongationstage suggests the importance of these genes in fibre celldevelopment.

Transcripts involved in regulation of osmotic potential,ion-homeostasis and protein stabilizationCotton fibre elongates through diffuse growth mechan-ism and turgor-driven pressure is a significant drivingforce for cell enlargement [17,18,53,54]. The turgor-driven pressure largely depends on accumulation ofosmolytes and ion-homeostasis [17,18]. Further, genesinvolved in ROS homeostasis and protein stabilizationplay a crucial role during fibre development [6,8]. In thepresent study several transcripts involved in these pro-cesses were differentially expressed at various fibre de-velopment stages in the fl mutant as compared to WT.Transcripts encoding the ion and sugar transporters(NRT1.5, VIT and STP1) and membrane intrinsic pro-teins (PIP2;2 and γ-TIP1;3) were highly down-regulatedduring fibre elongation stage in the fl mutant (Table 1,

Table 1 Some of the differentially expressed stress responsive transcripts at various fibre development stages in the flmutant as compared to their respective stages in WT

Probe set ID 0 dpa 5 dpa 10 dpa 15 dpa 20 dpa Annotation

Ghi.10292.1.S1_s_at −108.2 −6.7 Heat shock transcription factor A2 (HSFA2)Ghi.9308.1.S1_at 4.2 −142.5 −6.5 Heat shock protein HSP18.2GhiAffx.3815.1.A1_s_at −62.9 −10.9 HSP90Ghi.8378.2.S1_s_at −36.1 −5.8 HSP70GhiAffx.10920.2.S1_at −11.9 Plasma membrane intrinsic protein 2;2 (PIP2;2)Ghi.4613.1.S1_at −36.5 −6.7 Gamma-tonoplast intrinsic protein 1;3 (γ-TIP1;3)Ghi.3135.1.S1_at −62.5 Nitrate transporter 1.5 (NRT1.5)Ghi.6855.1.A1_s_at −6.5 Proline transporter 2 (PROT2)Ghi.9885.1.A1_at −4.6 Sugar transporter 1 (STP1)GhiAffx.17156.1.S1_at −22.7 Vacuolar iron transporter (VIT)Ghi.10646.1.S1_s_at −5.2 178.7 102.2 Osmotin 34GarAffx.24961.2.S1_s_at −3.3 −22.3 −8 Responsive to desiccation 22 (RD22)Gra.2810.2.A1_s_at −3.2 −21.8 −8.2 RD22Ghi.5529.1.S1_x_at −3 −35 −8.2 −4.4 RD22-like protein (RDL)Ghi.779.1.S1_at −20.5 Glutathione S-transferase 30 (GST30)Ghi.7950.1.S1_at −14 Peroxidase 2 (PA2)Ghi.10450.1.S1_s_at −4.8 −13.3 7 Thioredoxin family protein (GRX480)Gra.2231.1.S1_s_at −13.2 −26.2 27.4 Asparagine synthase 1 (ASN1)Ghi.789.1.S1_at −147.1 −21.3 −10.5 Germin-like protein (GLP1)/Fibre proteinGhi.6103.1.S1_at −28.8 −9.4 −3.2 Chalcone synthase (CHS)Gra.432.1.S1_s_at −19.8 −5.1 −4.6 17.7 CHSGhi.3763.1.A1_s_at −52.9 −16.5 28.4 3.7 Ca2+-ATPaseGhiAffx.3680.3.A1_at −34.4 Suppressor of K+ transport growth defect-like protein (SKD1)


Figure 5F1-5F4). A transcript encoding SKD1 (suppres-sor of K+ transport growth defect 1) which is an AAA-type ATPase family protein was highly down-regulatedat 10 dpa in the fl mutant. The expression of mcSKD1(homologous to AtSKD1) in elongating root tips and itsrole in endoplasmic reticulum-Golgi mediated proteinsorting machinery and K+ uptake has been demonstrated[55]. Further, transcripts encoding heat shock proteins(sHSPs, HSP70 and HSP90) were highly down-regulatedat 10 and 20 dpa in the fl mutant.

Primary and secondary cell wall biosynthesisSeveral transcripts involved in the primary and second-ary cell wall biosynthesis were differentially expressed atvarious stages of fibre development in the fl mutant ascompared to their respective stages in WT (Figure 4;Additional file 6). A large number of genes involved inprimary cell wall biosynthesis and elongation such asthose coding for xyloglucanases, pectinases, expansinsand arabinogalactans were down-regulated at 15 dpa.The role of xyloglucan modifying enzymes such as xylo-glucan endotransglycosylases (XETs) and xyloglucanendotransglucosylase/hydrolases (XTHs) has been wellestablished in fibre cell development [3,22]. In thepresent study, transcripts encoding TOUCH 4 (TCH4)/XTH22 (Figure 5G1) and XTH23/XTR6 were highlydown-regulated at initiation and elongation stages in thefl mutant. Further, transcripts encoding endo-xyloglucantransferase/AtXTH7 involved in fibre elongation werehighly down-regulated at 10 and 15 dpa. These data sug-gested their role in primary cell wall synthesis and fibredevelopment. Pectins are major components of the

primary cell wall and in cotton pectins constitute about25% of the cell wall of cotton fibre. Thus, pectin modify-ing enzymes play a major role in the fibre cell wall de-velopment [56]. Several transcripts encoding pectinmodifying enzymes such as poly galacturonases (PGs),pectate lyases (PLs), pectin methyl esterases (PMEs) andpectin methyl esterase inhibitors (PMEIs) were differen-tially expressed during fibre elongation stage in the flmutant as compared to WT (Figure 4; Additional file 6).Further, large number of transcripts encoding glycosylhydrolases and transferases were down-regulated at 10and 15 dpa. Particularly, transcripts encoding β-galactosidase 13 (BGAL13) and UDP-glucosyl transfer-ase 74B1 (UGT74B1) were highly down-regulated at 10dpa in the fl mutant. Among the glycosyl hydrolases,galactosidases (GALs) catalyzes the removal of non-reducing β-D-galactosyl residues from β-D-galactosides.It is therefore thought that GALs may be one of themain enzymes responsible for the metabolism of galact-ose rich polymers such as galactan and arabinogalactanand galactose containing side chains of cell wall polysac-charides [3,5].Expansins are highly expressed in cotton fibre tissue

and play an important role in cell wall loosening duringfibre elongation stage [3,24]. A transcript (Ghi.2039.1.S1_x_at/AY189969.1) encoding α-expansin 1 (EXPA1)was highly down-regulated at 10, 15 and 20 dpa in the flmutant (Figure 5G2; Additional file 6). Further, tran-scripts encoding expansin-like B1 (EXLB1) were highlydown-regulated at 0 and 5 dpa and expansin-like α(EXLA) were down-regulated at 10 dpa. These data sug-gest that both expansins and expansin-like genes play


crucial role in fibre cell development. The transcriptsencoding cellulose synthases were down-regulated at 15dpa at which PCW synthesis ceases and cellulose synthe-sis begins (Figure 5G3; Additional file 6). Further, a tran-script encoding endo-1,3-β-glucanase was highly down-regulated at 20 dpa in the fl mutant (Figure 5F4). It wasreported that the expression of endo-1,3-β-glucanase,which is very low at the fibre elongation stage (5–12dpa) and increases gradually during secondary cell wallformation in G. hirsutum (15–20 dpa), is involved in thedegradation of callose and opening of the plasmodes-mata during cellulose deposition [5,19]. Interestingly, atranscript encoding trichome birefringence (TBR) like 38(TBL38) gene was highly down-regulated at 5 dpa and15 dpa. Recently, it has been shown that TBL genes areinvolved in secondary cell wall synthesis by influencingthe esterification state of pectic polymers and increasingthe crystalline cellulose in Arabidopsis [57]. Along withthe cell wall modifying enzymes, several transcripts en-coding structural proteins such as AGPs (GhAGP2),FLAs (GhFLA6/AtFLA11 and GhFLA3/AtFLA7) andproline-rich proteins (PRPs; PRP3 and PRP5) weredown-regulated at fibre elongation and SCW synthesisstages in the fl mutant (Figures 4, 5G5, 5G6; Additionalfile 6).Actin cytoskeleton plays an important role in fibre

elongation and onset of secondary cell wall deposition[6,26,27]. Tubulins (TUBs) are major components of cyto-skeleton microtubules and play a vital role in cell expan-sion by controlling the orientation of cellulose microfibrils[25]. In the present study, transcripts encoding actins(ACTs), profilin, ATP binding microtubule motor familyproteins, actin depolymerizing factor (ADF) and Xu-142beta-tubulin1 were down-regulated at 10 dpa in the fl mu-tant (Figure 4, Additional file 6). The down-regulation ofseveral genes involved in cell wall loosening and elong-ation, structural reinforcement and cytoskeleton dynamicssuggests their role in fibre development.

ConclusionsSEM study indicated a delay in the initiation process offibre cells on the epidermal layer of ovules in the fl mu-tant and elongation of these initials was completelystopped at about 2 dpa. Transcriptome analysis revealedthe differentially expressed transcripts at various fibredevelopmental stages (0, 5, 10, 15 and 20 dpa) in the flmutant as compared to their respective stages in thewild-type. The down-regulation of stress responsive TFs(representing 19.6% of total down-regulated transcripts)and transcripts involved in the Ca2+-mediated signaltransduction and phytohormone (ethylene, auxin andBR) biosynthesis and signalling pathways at fibre initi-ation stage suggested their regulatory role in fibre cellinitiation and differentiation. Further, down-regulation

of transcripts involved in the Calvin cycle, synthesis ofRFOs (GolS1, GolS2), trehalose (TPS and TPP) and cellwall precursors and mitochondrial electron transportsystem at fibre elongation stage in the fl mutant sug-gested the reduction of overall sugar pool and signifi-cance of mitochondrial energy supply required for thesynthesis of cell wall polysaccharides and to maintainredox-homeostasis. Similarly, down-regulation of tran-scripts involved in the synthesis of VLCFAs and phos-pholipids and lipid transport suggests the reduced fattyacid metabolism in the fl mutant. This study also sup-ports the earlier findings on the role of pectin andxyloglucan modifying enzymes, expansins and arabino-galactans and cytoskeleton dynamics in the cell wallloosening and elongation process. Also the delayed ex-pression of genes involved in phytohormone signallingand stress responsive TFs identified in the present studysuggests the lack of coordinated expression of regulatorymechanisms involved in fibre cell initiation and differen-tiation in fl mutant. On the whole, the comprehensivetranscriptome analysis of Gossypium hirsutum L. cv.MCU5 and its near isogenic fuzzless-lintless mutantrevealed the stage specific involvement of several genesand pathways during fibre development.

MethodsPlant materialThe Gossypium hirsutum L. cv. MCU5 (wild-type) andits near isogenic fuzzless-lintless mutant were grown inthe field following normal agronomic practices. Flowerswere tagged on the day of anthesis and considered as 0dpa (days post anthesis). Cotton bolls were collected atfibre initiation (−2, -1, 0, 1 and 2 dpa), elongation (5, 10and 15 dpa) and secondary cell wall synthesis (20 dpa)stages. The −2 and −1 dpa represent the days before an-thesis. Harvested cotton bolls were immediately frozen inliquid nitrogen and stored at −70°C until used for totalRNA extraction.

Scanning electron microscopy analysisScanning electron microscopy (SEM) was performed atfibre initiation stage (−2 to 2 dpa) to observe the develop-ment of fibre initials on epidermal layer of ovules asdescribed by Mir and Channa [58]. SEM was carried outwith LEO 435 VP scanning electron microscope (LEOElectron Microscopy Ltd., Cambridge, England) at All IndiaInstitute of Medical Sciences (AIIMS), New Delhi, India.

RNA isolationTotal RNA was isolated from fibre-bearing ovules ofwild-type (WT) and fuzzless-lintless (fl) mutant collectedat various stages of fibre development (0, 5, 10, 15 and 20dpa). RNA was isolated using SpectrumTM Plant TotalRNA kit (Sigma, USA) according to the manufacturer’s


protocol. During RNA purification on-column DNasetreatment was given for removing trace amount of DNA.The quality and quantity of total RNA was assessed byAgilent Bioanalyzer 2100 (Agilent Technologies, USA).

Microarray experiments and data analysisAffymetrix cotton GeneChip genome array (Affymetrix,USA) having 23,977 probe sets representing 21,854cotton transcripts was used for transcriptome analysis.Three biological replicates were used to test the repro-ducibility and quality of the chip hybridization. TheOne-Cycle Target Labeling and Control Reagent kitwas used to prepare biotinylated complementary RNA(cRNA) for microarray hybridization. Array hybri-dization, staining and washing procedures were carriedout as described in the Affymetrix protocols. Thearrays were scanned with a GeneChip scanner 3000.DAT, CEL, CHP, XML and JPEG image files were gen-

erated for each array using GeneChip Operating Soft-ware (GCOS) platform. CEL files having estimated probeintensity values were analyzed with GeneSpring GX-11.5software (Agilent Technologies, USA) to get differen-tially expressed transcripts. The Robust Multiarray Aver-age (RMA) algorithm was used for the backgroundcorrection, quantile normalization and median polishedprobe set summarization to generate single expressionvalue for each probe set. Normalized expression valueswere log2-transformed and differential expression ana-lysis was performed using unpaired t-test. The p valueswere corrected by applying the false discovery rate (FDR)correction [59]. Differentially expressed transcripts withFDR corrected p value ≤ 0.01 and fold change ≥ 3 wereincluded for further data analysis. The DETs were anno-tated based on NetAffx annotation data for cotton Gene-Chip (http://www.affymetrix.com). To obtain functionalannotation of transcripts, the consensus sequences ofprobe sets present in the cotton GeneChip genome arraywere mapped to the Arabidopsis TAIR protein databaseversion 10 (http://www.arabidopsis.org) by BLASTX withE value cut off ≤ e-10. Further, the DETs were groupedinto various functional categories by using their corre-sponding Arabidopsis protein IDs in MIPS functionalcatalogue (http://mips.gsf.de/projects/funcat). To identifythe putative transcription factors and transcripts relatedto phytohormone biosynthesis and signal transductionpathways, the consensus sequences of all probe sets pre-sented in cotton GeneChip genome array were searchedagainst the Arabidopsis transcription factor database(http://plntfdb.bio.uni-potsdam.de, version 3.0) and Ara-bidopsis hormone database (http://ahd.cbi.pku.edu.cn,version 2.0) respectively, by BLASTX with E value cut-off ≤ e-10. Further, MapMan software version 3.5.0 wasused to visualize the expression of differentially regulatedcotton transcripts onto metabolic pathways (http://gabi.

rzpd.de/projects/MapMan/). The microarray data is de-posited in the Gene Expression Omnibus database (GEO,http://www.ncbi.nlm.nih.gov/geo) at the NCBI under theSeries Accession numbers GSE38490. The hierarchical clus-tering was performed based on centroid linkage with Eu-clidean distance using log fold change data with Cluster3.0 to display the expression pattern and tree diagram ofdifferentially expressed transcripts [60].

The quantitative real-time PCR (qRT-PCR) analysisFirst strand cDNA was synthesized using 1 μg of totalRNA using AffinityScript QPCR cDNA Synthesis Kit (Stra-tagene, Agilent Technologies, USA) according to the man-ufacturer’s instructions. Gene specific qRT-PCR primerswere designed using PrimerQuest software (http://eu.idtdna.com) and the list of primers are presented inAdditional file 7. The qRT-PCR was performed in tripli-cates using the Brilliant-III Ultra Fast SYBR Green QPCRmaster mix in Stratagene MX 3005P (Agilent Technolo-gies, USA) detection system. The GhPP2A1 gene (Acces-sion No: DT545658) from G. hirsutum was used asreference gene to normalize the expression values [61]. Thelog2 fold change value was calculated based on 2–(ΔΔCt)

method.

Additional files

Additional file 1: List of differentially expressed transcripts (DETs)at 0, 5, 10, 15 and 20 dpa in the fl mutant as compared to theirrespective stages in WT. Excel file containing the DETs with p value≤0.01 and fold change ≥ 3.

Additional file 2: Functional classification of DETs at 0, 5, 10, 15and 20 dpa in the fl mutant as compared to their respective stagesin WT. PPT file containing the DETs grouped into various functionalcategories based on MIPS data base.

Additional file 3: List of DETs encoding putative transcriptionfactors (TFs) belonging to various families at 0, 5, 10 and 20 dpa inthe fl mutant as compared to their respective stages in WT. Excel filecontaining the differentially expressed putative transcription factorsbased on Arabidopsis transcription factor database (E-value cutoff ≤ e-10).

Additional file 4: List of DETs involved in phytohormonebiosynthesis and signalling pathways at 0, 5, 10, 15 and 20 dpa inthe fl mutant as compared to their respective stages in WT. Excel filecontaining the DETs involved in phytohormone biosynthesis andsignalling pathways were identified based on Arabidopsis hormonedatabase (E value cutoff ≤ e-10).

Additional file 5: Differentially expressed transcripts (DETs)involved in carbohydrate metabolism at 0, 5, 10, 15 and 20 dpa inthe fl mutant as compared to their respective stages in WT. PPT filecontaining the DETs involved in biosynthesis of RFO, trehalose and cellwall precursors.

Additional file 6: List of DETs related to fatty acid metabolism,carbohydrate and energy metabolism, cell wall loosening andelongation 0, 5, 10, 15 and 20 dpa in the fl mutant as compared totheir respective stages in WT. Excel file containing the differentiallyexpressed transcripts related to different functional categories based onMIPS and MapMan databases.

Additional file 7: List of primers used for qRT-PCR analysis. Excel filecontaining the primer sequences used for qRT-PCR to validate microarraydata.

http://www.affymetrix.com

http://www.arabidopsis.org


http://plntfdb.bio.uni-potsdam.de


http://gabi.rzpd.de/projects/MapMan/

http://gabi.rzpd.de/projects/MapMan/

http://www.ncbi.nlm.nih.gov/geo

http://eu.idtdna.com

http://eu.idtdna.com

http://www.biomedcentral.com/content/supplementary/1471-2164-13-624-S1.xls

http://www.biomedcentral.com/content/supplementary/1471-2164-13-624-S2.ppt



http://www.biomedcentral.com/content/supplementary/1471-2164-13-624-S5.ppt




Competing interestsThe authors declare that they have no competing interests.

Authors’ contributionKVP carried out microarray experiments, analyzed the transcriptome data anddrafted the manuscript. KK carried out designing of primers, qRT-PCR analysisand revise the manuscript. GD, MK and MLVP and NJ conducted microarrayexperiments. SK and DPP involved in the SEM studies. AHP was involved inthe SEM and manuscript preparation. TCM, HV and ISK planned andexecuted experiments to develop stage specific materials and collectedstage specific samples for the transcriptome analysis and contributed in themanuscript preparation. VSR, PAK, SL and MKR involved in the designing ofthe experiments, data analysis, manuscript preparation and discussion. Allauthors read and approved the manuscript.

AcknowledgmentsThis work was supported by funds from the Indian Council of AgriculturalResearch (ICAR) under the National Agricultural Innovation Project (NAIP),Component-4. Funds from the Department of Biotechnology (DBT),Government of India, International Centre for Genetic Engineering andBiotechnology, New Delhi, India are gratefully acknowledged. KK and DPPacknowledge the DBT and CSIR for the research fellowship, respectively. Wethank Dr. B. M. Khadi and Dr N. Gopalakrishnan for providing MCU5 and itsnear isogenic fuzzless-lintless mutant materials during the initial studies andfor their helpful discussions. We also thank Dr. N. K. Singh for the Microarrayfacility used in the study.

Author details1National Research Centre on Plant Biotechnology, Pusa Campus, New Delhi110 012, India. 2Plant Transformation Group, International Center for GeneticEngineering and Biotechnology, Aruna Asaf Ali Marg, New Delhi 110067,India. 3Agricultural Research Station, Dharwad Farm, University of AgriculturalSciences, Dharwad, India. 4Central Institute for Cotton Research, RegionalStation, Coimbatore, Tamil Nadu, India.

Received: 9 July 2012 Accepted: 7 November 2012Published: 14 November 2012

References1. Wilkins TA, Arpat AB: The cotton fiber transcriptome. Physiol Plant 2005,

124(3):295–300.2. Arpat AB, Waugh M, Sullivan JP, Gonzales M, Frisch D, Main D,

Wood T, Leslie A, Wing RA, Wilkins TA: Functional genomics of cellelongation in developing cotton fibers. Plant Mol Biol 2004,54(6):911–929.

3. Ji SJ, Lu YC, Feng JX, Wei G, Li J, Shi YH, Fu Q, Liu D, Luo JC, Zhu YX:Isolation and analyses of genes preferentially expressed during earlycotton fiber development by subtractive PCR and cDNA array. NucleicAcids Res 2003, 31(10):2534–2543.

4. Wu Y, Machado AC, White RG, Llewellyn DJ, Dennis ES: Expression profilingidentifies genes expressed early during lint fibre initiation in cotton.Plant Cell Physiol 2006, 47(1):107–127.

5. Gou JY, Wang LJ, Chen SP, Hu WL, Chen XY: Gene expression andmetabolite profiles of cotton fiber during cell elongation and secondarycell wall synthesis. Cell Res 2007, 17(5):422–434.

6. Zhao PM, Wang LL, Han LB, Wang J, Yao Y, Wang HY, Du XM, Luo YM, XiaGX: Proteomic identification of differentially expressed proteins in theLigon lintless mutant of upland cotton (Gossypium hirsutum L.).J Proteome Res 2009, 9(2):1076–1087.

7. Pang CY, Wang H, Pang Y, Xu C, Jiao Y, Qin YM, Western TL, Yu SX, Zhu YX:Comparative proteomics indicates that biosynthesis of pectic precursorsis important for cotton fiber and Arabidopsis root hair elongation. MolCell Proteomics 2010, 9(9):2019–2033.

8. Liu K, Han M, Zhang C, Yao L, Sun J, Zhang T: Comparative proteomicanalysis reveals the mechanisms governing cotton fiber differentiationand initiation. J Proteomics 2012, 75(3):845–856.

9. Shi YH, Zhu SW, Mao XZ, Feng JX, Qin YM, Zhang L, Cheng J, Wei LP, WangZY, Zhu YX: Transcriptome profiling, molecular biological, andphysiological studies reveal a major role for ethylene in cotton fiber cellelongation. Plant Cell 2006, 18(3):651–664.

10. Yang SS, Cheung F, Lee JJ, Ha M, Wei NE, Sze SH, Stelly DM, Thaxton P,Triplett B, Town CD, Chen ZJ: Accumulation of genome-specifictranscripts, transcription factors and phytohormonal regulators duringearly stages of fiber cell development in allotetraploid cotton. Plant J2006, 47(5):761–775.

11. Zhang M, Zheng X, Song S, Zeng Q, Hou L, Li D, Zhao J, Wei Y, Li X, Luo M,Xiao Y, Luo X, Zhang J, Xiang C, Pei Y: Spatiotemporal manipulation ofauxin biosynthesis in cotton ovule epidermal cells enhances fiber yieldand quality. Nat Biotechnol 2011, 29(5):453–458.

12. Sun Y, Veerabomma S, Abdel-Mageed HA, Fokar M, Asami T, Yoshida S,Allen RD: Brassinosteroid regulates fiber development on cultured cottonovules. Plant Cell Physiol 2005, 46(8):1384–1391.

13. Luo M, Xiao Y, Li X, Lu X, Deng W, Li D, Hou L, Hu M, Li Y, Pei Y: GhDET2, asteroid 5α-reductase, plays an important role in cotton fiber cellinitiation and elongation. Plant J 2007, 51(3):419–430.

14. Machado A, Wu Y, Yang Y, Llewellyn DJ, Dennis ES: The MYB transcriptionfactor GhMYB25 regulates early fibre and trichome development. Plant J2009, 59(1):52–62.

15. Guan X, Lee JJ, Pang M, Shi X, Stelly DM, Chen ZJ: Activation of Arabidopsisseed hair development by cotton fiber-related genes. PLoS One 2011,6(7):e21301.

16. Walford SA, Wu Y, Llewellyn DJ, Dennis ES: GhMYB25-like: a key factor inearly cotton fibre development. Plant J 2011, 65(5):785–797.

17. Ruan YL, Llewellyn DJ, Furbank RT: Suppression of sucrose synthase geneexpression represses cotton fiber cell initiation, elongation, and seeddevelopment. Plant Cell 2003, 15(4):952–964.

18. Wang L, Ruan YL: Unraveling mechanisms of cell expansion linking solutetransport, metabolism, plasmodesmtal gating and cell wall dynamics.Plant Signal Behav 2010, 5(12):1561–1564.

19. Ruan YL, Xu SM, White R, Furbank RT: Genotypic and developmentalevidence for the role of plasmodesmatal regulation in cotton fiberelongation mediated by callose turnover. Plant Physiol 2004,136(4):4104–4113.

20. Yang YW, Bian SM, Yao Y, Liu JY: Comparative proteomic analysis providesnew insights into the fiber elongating process in cotton. J Proteome Res2008, 7(11):4623–4637.

21. Pang Y, Wang H, Song WQ, Zhu YX: The cotton ATP synthase δ1 subunitis required to maintain a higher ATP⁄ADP ratio that facilitates rapid fibrecell elongation. Plant Biol 2010, 12(6):903–909.

22. Lee J, Burns TH, Light G, Sun Y, Fokar M, Kasukabe Y, Fujisawa K, MaekawaY, Allen RD: Xyloglucan endotransglycosylase/hydrolase genes in cottonand their role in fiber elongation. Planta 2010, 232(5):1191–1205.

23. Liu D, Tu L, Li Y, Wang L, Zhu L, Zhang X: Genes encoding fasciclin-likearabinogalactan proteins are specifically expressed during cotton fiberdevelopment. Plant Mol Biol Rep 2008, 26(2):98–113.

24. Harmer SE, Orford SJ, Timmis JN: Characterisation of six alpha-expansingenes in Gossypium hirsutum (upland cotton). Mol Genet Genomics 2002,268(1):1–9.

25. Li XB, Cai L, Cheng NH, Liu JW: Molecular characterization of the cottonGhTUB1 gene that is preferentially expressed in fiber. Plant Physiol 2002,130(2):666–674.

26. Li XB, Fan XP, Wang XL, Cai L, Yang WC: The cotton ACTIN1 gene isfunctionally expressed in fibers and participates in fiber elongation. PlantCell 2005, 17(3):859–875.

27. Wang J, Wang HY, Zhao PM, Han LB, Jiao GL, Zheng YY, Huang SJ, Xia GX:Overexpression of a profilin (GhPFN2) promotes the progression ofdevelopmental phases in cotton fibers. Plant Cell Physiol 2010,51(8):1276–1290.

28. Wang QQ, Liu F, Chen XS, Ma XJ, Zeng HQ, Yang ZM: Transcriptomeprofiling of early developing cotton fiber by deep-sequencing revealssignificantly differential expression of genes in a fuzzless/lintless mutant.Genomics 2010, 96(6):369–376.

29. Peter SD, Muralidharan V, Bhat MV: Fuzzless-lintless mutant of MCU 5cotton. Cotton Dev 1984, 14:43.

30. Nadarajan N, Rangagasamy SRS: Breeding value of a fuzzless-lintlessmutant in Gossypium hirsutum L. Indian J Genet 1997, 57(3):233–237.

31. Oh JE, Kwon Y, Kim JH, Noh H, Hong SW, Lee H: A dual role for MYB60 instomatal regulation and root growth of Arabidopsis thaliana underdrought stress. Plant Mol Biol 2011, 77(1–2):91–103.

32. Suzuki N, Rizhsky L, Liang H, Shuman J, Shulaev V, Mittler R: Enhancedtolerance to environmental stress in transgenic plants expressing the


transcriptional coactivator multiprotein bridging factor 1c. Plant Physiol2005, 139(3):1313–1322.

33. Gao P, Zhao PM, Wang J, Wang HY, Wu XM, Xia GX: Identification of genespreferentially expressed in cotton fibers: A possible role of calciumsignaling in cotton fiber elongation. Plant Sci 2007, 173(1):61–69.

34. Huang QS, Wang HY, Gao P, Wang GY, Xia GX: Cloning andcharacterization of a calcium dependent protein kinase geneassociated with cotton fiber development. Plant Cell Rep 2008,27(12):1869–1875.

35. George L, Romanowsky SM, Harper JF, Sharrock RA: The ACA10Ca2+-ATPase regulates adult vegetative development and inflorescencearchitecture in Arabidopsis. Plant Physiol 2008, 146(2):716–728.

36. Blakeslee JJ, Bandyopadhyay A, Lee OR, Mravec J, Titapiwatanakun B, SauerM, Makam SN, Cheng Y, Bouchard R, Adamec J, Geisler M, Nagashima A,Sakai T, Martinoia E, Friml J, Peer WA, Murphy AS: Interactions amongPIN-FORMED and P-Glycoprotein Auxin Transporters in Arabidopsis. PlantCell 2007, 19(1):131–147.

37. Molnar G, Bancos S, Nagy F, Szekeres M: Characterisation of BRH1, abrassinosteroid-responsive RING-H2 gene from Arabidopsis thaliana.Planta 2002, 215(1):127–133.

38. Brill E, van Thournout M, White RG, Llewellyn D, Campbell PM, Engelen S,Ruan YL, Arioli T, Furbank RT: A novel isoform of sucrose synthase istargeted to the cell wall during secondary cell wall synthesis in cottonfiber. Plant Physiol 2011, 157(1):40–54.

39. Yeo ET, Kwon HB, Han SE, Lee JT, Ryu JC, Byu MO: Genetic engineering ofdrought resistant potato plants by introduction of the trehalose-6-phosphate synthase (TPS1) gene from Saccharomyces cerevisiae. Mol Cells2000, 10(3):263–268.

40. Padmalatha KV, Dhandapani G, Kanakachari M, Kumar S, Dass A, Patil DP,Rajamani V, Kumar K, Pathak R, Rawat B, Leelavathi S, Reddy PS, Jain N,Powar KN, Hiremath V, Katageri IS, Reddy MK, Solanke AU, Reddy VS, KumarPA: Genome-wide transcriptomic analysis of cotton under drought stressreveal significant down-regulation of genes and pathways involved infibre elongation and up-regulation of defense responsive genes.Plant Mol Biol 2012, 78(3):223–246.

41. Juszczuk IM, Szal B, Rychter AM: Oxidation-reduction and reactive oxygenspecies homeostasis in mutant plants with respiratory chain complex Idysfunction. Plant Cell Environ 2012, 35(2):296–307.

42. Qin YM, Pujol FM, Shi YH, Feng JX, Liu YM, Kastaniotis AJ, Hiltunen JK, ZhuYX: Cloning and functional characterization of two cDNAs encodingNADPH-dependent 3-ketoacyl-CoA reductased from developing cottonfibers. Cell Res 2005, 15(6):465–473.

43. Qin YM, Pujol FM, Hu CY, Feng JX, Kastaniotis AJ, Hiltunen JK, Zhu YX:Genetic and biochemical studies in yeast reveal that the cotton fibre-specific GhCER6 gene functions in fatty acid elongation. J Exp Bot 2007,58(3):473–481.

44. Flugge UI, Hausler RE, Ludewig F, Gierth M: The role of transporters insupplying energy to plant plastids. J Exp Bot 2011, 62(7):2381–2392.

45. Leung KC, Li HY, Mishra G, Chye ML: ACBP4 and ACBP5, novel Arabidopsisacyl-CoA-binding proteins with kelch motifs that bind oleoyl-CoA. PlantMol Biol 2004, 55(2):297–309.

46. Anthony RG, Henriques R, Helfer A, Meszaros T, Rios G, Testerink C, MunnikT, Deak M, Koncz C, Bogre L: A protein kinase target of a PDK1 signallingpathway is involved in root hair growth in Arabidopsis. EMBO J 2004,23(3):572–581.

47. Bellevik S, Zhang J, Meijer J: Brassica napus soluble epoxide hydrolase(BNSEH1). Eur J Biochem 2002, 269(21):5295–5302.

48. Bird DA: The role of ABC transporters in cuticular lipid secretion. Plant Sci2008, 174(6):563–569.

49. Yeats TH, Rose JKC: The biochemistry and biology of extracellular plantlipid-transfer proteins (LTPs). Protein Sci 2008, 17(2):191–198.

50. Zhu YQ, Xu KX, Luo B, Wang JW, Chen XY: An ATP-binding cassettetransporter GhWBC1 from elongating cotton fibers. Plant Physiol 2003,133(2):580–588.

51. Luo B, Xue XY, Hu WL, Wang LJ, Chen XY: An ABC transporter gene ofArabidopsis thaliana, AtWBC11, is involved in cuticle development andprevention of organ fusion. Plant Cell Physiol 2007, 48(12):1790–1802.

52. DeBono A, Yeats TH, Rose JKC, Bird D, Jetter R, Kunst L, Samuels L:Arabidopsis LTPG is a glycosylphosphatidylinositol-anchored lipidtransfer protein required for export of lipids to the plant surface.Plant Cell 2009, 21(4):1230–1238.

53. Liu D, Tu L, Wang L, Li Y, Zhu L, Zhang X: Characterization and expressionof plasma and tonoplast membrane aquaporins in elongating cottonfibers. Plant Cell Rep 2008, 27(8):1385–1394.

54. Park W, Scheffler BE, Bauer PJ, Campbell BT: Identification of the family ofaquaporin genes and their expression in upland cotton (Gossypiumhirsutum L.). BMC Plant Biol 2010, 10:142.

55. Jou Y, Chiang CP, Jauh GY, Yen HE: Functional characterization of iceplant SKD1, an AAA-type ATPase associated with the endoplasmicreticulum-Golgi network, and its role in adaptation to salt stress. PlantPhysiol 2006, 141(1):135–146.

56. Wang H, Guo Y, Lv F, Zhu H, Wu S, Jiang Y, Li F, Zhou B, Guo W, Zhang T:The essential role of GhPEL gene, encoding a pectate lyase, in cell wallloosening by depolymerization of the de-esterified pectin during fiberelongation in cotton. Plant Mol Biol 2010, 72(4–5):397–406.

57. Bischoff V, Nita S, Neumetzler L, Schindelasch D, Urbain A, Eshed R, PerssonS, Delmer D, Scheible WR: TRICHOME BIREFRINGENCE and its homologAT5G01360 encode plant-specific DUF231 proteins required for cellulosebiosynthesis in Arabidopsis. Plant Physiol 2010, 153(2):590–602.

58. Mir IH, Channa A: A Scanning Electron Microscopic Examination of theIntestinal Tract of the Snow Trout, Schizothorax curvifrons Heckel. J FishAquat Sci 2010, 5(5):386–393.

59. Benjamini Y, Hochberg Y: On the adaptive control of the false discoveryrate in multiple testing with independent statistics. J Educ Behav Stat2000, 25(1):60–83.

60. Eisen MB, Spellman PT, Brown PO, Botstein D: Cluster analysis anddisplay of genome-wide expression patterns. Proc Natl Acad Sci 1998,95:14863–14868.

61. Artico S, Nardeli SM, Brilhante O, Grossi-de-Sa MF, Alves-Ferreira M:Identification and evaluation of new reference genes in Gossypiumhirsutum for accurate normalization of real-time quantitative RT-PCRdata. BMC Plant Biol 2010, 10:49.

doi:10.1186/1471-2164-13-624Cite this article as: Padmalatha et al.: Functional genomics of fuzzless-lintless mutant of Gossypium hirsutum L. cv. MCU5 reveal key genes andpathways involved in cotton fibre initiation and elongation. BMCGenomics 2012 13:624.

Submit your next manuscript to BioMed Centraland take full advantage of:

• Convenient online submission

• Thorough peer review

• No space constraints or color figure charges

• Immediate publication on acceptance

• Inclusion in PubMed, CAS, Scopus and Google Scholar

• Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit

Glycoproteome of Elongating Cotton FiberCells*□S

Saravanan Kumar‡, Krishan Kumar‡, Pankaj Pandey‡, Vijayalakshmi Rajamani‡,Kethireddy Venkata Padmalatha§, Gurusamy Dhandapani§, Mogilicherla Kanakachari§,Sadhu Leelavathi‡, Polumetla Ananda Kumar§, and Vanga Siva Reddy‡¶

Cotton ovule epidermal cell differentiation into long fibersprimarily depends on wall-oriented processes such asloosening, elongation, remodeling, and maturation. Suchprocesses are governed by cell wall bound structural pro-teins and interacting carbohydrate active enzymes. Gly-cosylation plays a major role in the structural, functional,and localization aspects of the cell wall and extracellulardestined proteins. Elucidating the glycoproteome of fibercells would reflect its wall composition as well as com-partmental requirement, which must be system specific.Following complementary proteomic approaches, wehave identified 334 unique proteins comprising structuraland regulatory families. Glycopeptide-based enrichmentfollowed by deglycosylation with PNGase F and A re-vealed 92 unique peptides containing 106 formerly N-linked glycosylated sites from 67 unique proteins. Ourresults showed that structural proteins like arabinogalac-tans and carbohydrate active enzymes were relativelymore abundant and showed stage- and isoform-specificexpression patterns in the differentiating fiber cell. Fur-thermore, our data also revealed the presence of hetero-geneous and novel forms of structural and regulatoryglycoproteins. Comparative analysis with other plant gly-coproteomes highlighted the unique composition of thefiber glycoproteome. The present study provides the firstinsight into the identity, abundance, diversity, and compo-sition of the glycoproteome within single celled cotton fi-bers. The elucidated composition also indirectly providesclues about unicellular compartmental requirements under-lying single cell differentiation. Molecular & Cellular Pro-teomics 12: 10.1074/mcp.M113.030726, 3677–3689, 2013.

Cotton fibers are single-cell epidermal seed trichomes thatundergo major developmental changes involving overlappingstages of growth including initiation, elongation, and matura-tion (1, 2). Matured fibers contain �95% cellulose and 1.8%protein (3), whereas elongating fibers contain 22% protein in

its primary cell wall (4). The relatively increased protein con-tent and its consistency throughout the elongation phasecorrelates with its stage-specific compartmental requirement(5). Elongation is the most active and vigorous phase, duringwhich the cell extends between 2 to 6 cm in length at a rate of�2 mm/day (1, 2). Increase in length involve the expansivedeformation of the cell wall, including loosening, expansion,and remodeling. These processes collectively determine thecell wall’s yielding properties and are governed by the cellu-lose microfibril-matrix network and associated factors, suchas wall bound structural proteins and interacting enzymes (6).These proteins play crucial roles in the elongation and matu-ration of numerous fiber cells on the ovule surface in a syn-chronized fashion (7).

Earlier efforts to understand fiber cell differentiation showedthe stage-specific expression of genes encoding cell wallenzymes (8), implicating their probable role in cell elongationand post elongation events (9). Furthermore, experimentaldata from other plant systems highlight the roles of carbohy-drate active enzymes (CAZymes)1, such as xyloglucan endo-transglycosylases/hydrolases (XETs/XTHs) (10, 11), glucan-ases (10, 12), glycosyl transferases (GTs) (13, 14), and pectinmethyl esterases (PMEs) (15, 16), in the wall modificationoccurring during cell development. Most of the earlier men-tioned functions were suggested based on transcriptase, mo-lecular biology or biochemical tools. Transcript level informa-tion does not reflect the structure, function or abundance oftheir gene products. In addition to CAZymes, genes encodingstructural proteins, such as arabinogalactans (AGPs) and fas-ciclin-like arabinogalactans (FLAs), have been shown to playcrucial roles in fiber development (17). AGPs are also knownto act as signaling molecules, modulators of cell wall mechan-ics, pectin plasticizers (18), and stimulators of XET activity (19)and are also involved in pattern formation (20). Despite theirdiverse roles (21), experimental evidence concerning the het-

From the ‡Plant Transformation Group, International Centre forGenetic Engineering and Biotechnology (ICGEB), New Delhi, India;§National Research Centre on Plant Biotechnology (NRCPB), IARI,New Delhi, India

Author’s Choice—Final version full access.Received May 5, 2013, and in revised form, September 4, 2013Published, MCP Papers in Press, September 9, 2013, DOI

10.1074/mcp.M113.030726

1 The abbreviations used are: CAZymes, Carbohydrate active en-zymes; Con A, Concanavalin A; LAC, Lectin affinity chromatography;AGPs, Arabinogalactan proteins; FLA,- Fasciclin-like arabinogalactanproteins; GPAs, Glycosylphosphatidylinositol anchored proteins;XETs/XTHs, Xyloglucan endotransglycosylases/hydrolases; PNGase,Peptide N-glycoamidase; MWCO, Molecular weight cut off, FASP,Filter aided sample preparation; SpC, Spectral counts.

Research

Author’s Choice © 2013 by The American Society for Biochemistry and Molecular Biology, Inc.This paper is available on line at http://www.mcponline.org

Molecular & Cellular Proteomics 12.12 3677

generation and analysis of expressed sequence tag's (est's)

Documents

Transcript of generation and analysis of expressed sequence tag's (est's)