◊

INTRODUCTION

Management of gastrointestinal parasites is a sig-

nificant concern for sheep producers (National Animal Health Monitoring System, 1996), especially in hot, humid areas where sheep are continuously exposed to infection. The blood-feeding nematode Haemonchus contortus is 1 of the most detrimental parasites of sheep in tropical, subtropical, and warm temperate regions. The prevalence of drug-resistant worms has increased worldwide, with some parasite strains re-sistant to all classes of anthelmintics (Kaplan, 2004). Treatment options have correspondingly become more limited, and more holistic parasite control strategies

Gene expression profiles of hair and wool sheep reveal importance of Th2 immune mechanisms for increased resistance to Haemonchus contortus

K. M. MacKinnon,*1 S. A. Bowdridge,*2 I. Kanevsky-Mullarky,† A. M. Zajac,‡ and D. R. Notter*3

*Department of Animal and Poultry Sciences, Virginia Tech, Blacksburg 24061; †Department of Dairy Science, Virginia Tech, Blacksburg 24061; and ‡Department of Biomedical

Sciences and Pathobiology, Virginia-Maryland Regional College of Veterinary Medicine, Blacksburg, VA 24061

ABSTRACT: Management of gastrointestinal para-sites is a critical issue for sheep producers worldwide. Increases in the prevalence of drug-resistant worms have complicated parasite control and increased economic losses. Therefore, other methods of para-site control need to be assessed, including the use of genetically resistant animals in breeding programs. Hair sheep breeds such as the St. Croix have greater parasite resistance than conventional wool breeds. However, the immune mechanisms that control para-site resistance in hair or wool breeds have not yet been fully determined, and information on cytokine expres-sion profiles for both wool sheep selected for increased resistance and hair sheep is limited. Our objective was to investigate gene expression differences in 24 parasite-resistant hair and 24 susceptible wool sheep to identify immune effectors associated with resistance to Haemonchus contortus. One-half of the lambs were infected and sacrificed at 3 or 27 d after infection. Remaining lambs were not infected. Breed differences in expression of genes associated with Th1 and Th2 immune responses in lymph nodes and abomasal tis-

sue were determined. Th2-associated genes included IL-4, IL-13, IL-5, IgE, the α chain of the IL-4 recep-tor, and the α chain of the high-affinity IgE receptor (FcεRI). Th1-associated genes included interferon gamma (IFN-γ), the p35 subunit of IL-12 (IL-12 p35), and the β1 and β2 chains of the IL-12 receptor (IL-12 Rβ1 and IL-12 Rβ2, respectively). In both hair and wool sheep, infection with H. contortus resulted in greater expression of IgE, IL-13, IL-5, and IL-12 p35 and somewhat reduced expression of IFNγ in lymph nodes. In abomasal tissue, parasite infection resulted in greater IgE, IL-13, FcεRI, and IL-12 p35 expression in infected lambs compared with control lambs. Between breeds, hair sheep had a stronger Th2 response after infection than wool sheep, with increased expression of IgE and IL-13 and decreased expression of IFNγ in lymph nodes and increased expression of IL-13 and decreased expression of IL-12 p35 in abomasal tis-sue. Expression of IL-4 in lymph nodes did not differ between hair and wool lambs, and IL-4, IL-5, IL-12 Rβ1, and IL-12 Rβ2 expression was too low to mea-sure at the times sampled in abomasal tissue.

Key words: cytokines, gene expression, Haemonchus contortus, immune response, sheep

© 2015 American Society of Animal Science. All rights reserved. J. Anim. Sci. 2015.93 doi:10.2527/jas2014-8652

1Present address: WorldWide Life Sciences, 8810 Westgate Park Drive, Suite 108, Raleigh, NC 27617.

2Present address: Division of Animal and Nutritional Sciences, West Virginia University, Morgantown 26506.

3Corresponding author: drnotter@vt.eduReceived October 24, 2014.Accepted February 24, 2015.

MacKinnon et al.◊

will be required, including incorporation of genetically resistant animals into breeding populations. Selection to reduce fecal egg counts (FEC) in temperate sheep breeds has been effective (Woolaston, 1992; Bisset et al., 1996). However, selection to meaningfully enhance parasite resistance in susceptible breeds can take many years (Eady et al., 1997). Important differences in re-sistance to internal parasites exist among sheep breeds. In particular, Caribbean hair sheep breeds develop re-sistance more quickly and at a higher level than wool sheep maintained under the same conditions (Gamble and Zajac, 1992; Vanimisetti et al., 2004).

Infection with nematode parasites primarily elicits a Th2 immune response, characterized by antibody pro-duction, eosinophilia, mastocytosis, and production of cytokines IL-4, IL-5, and IL-13 (Kooyman et al., 2000; Pernthaner et al., 2005a; Balic et al., 2006; Lacroux et al., 2006). Differences in immune response between re-sistant and susceptible lines of wool sheep have been explored (Pernthaner et al., 1996, 2005a; Diez-Tascon et al., 2005; Keane et al., 2006), but few studies have evaluated gene expression in Caribbean hair sheep. Our objective was thus to assess breed differences in expres-sion of Th1 and Th2 immune genes and their receptors in abomasum and lymph node tissues of Caribbean hair and temperate wool sheep infected with H. contortus.

MATERIALS AND METHODS

Animals, Tissue Collection, and RNA ExtractionAll experimental procedures were evaluated and

approved by the Virginia Tech Animal Care and Use Committee. Twenty-four St. Croix hair and 24 wool lambs were used for the study. Wool lambs were from a composite line of 50% Dorset, 25% Rambouillet, and 25% Finnsheep breeding established in 1988 (Notter and Cockett, 2005). Lambs were born in April at the

Virginia Tech Sheep Center in Blacksburg and were maintained as contemporaries on pastures known to be infected with H. contortus. Standard deworming proto-cols were followed until lambs were approximately 4 mo of age. At this time, lambs were artificially infected with 3,000 L3 larvae of H. contortus per week for 4 consecutive weeks to further standardize parasite expo-sure. Lambs were dewormed using levamisole (8 mg/kg BW) and fenbendazole (10 mg/kg BW) 1 wk after the last infection, were moved to a drylot to preclude ad-ditional nematode infection, and were dewormed again 3 d later. Twelve hair and 12 wool lambs were chosen at random for experimental infection with H. contor-tus and were moved to raised indoor pens following the second deworming. Fecal egg counts were deter-mined as described below for these lambs and revealed evidence of residual infection in a few lambs, so the 24 lambs were dewormed again 5 d later. Trichostrongylid FEC were zero in all lambs following this deworming.

Three days after the last deworming (d 0; Fig. 1), experimental lambs were orally infected with 10,000 H. contortus L3 larvae and remained in indoor pens for the duration of the study. Six infected lambs of each breed were sacrificed at 3 and 27 d postinfection (PI) to assess responses to larvae (d 3) and to adult worms (d 27). Twelve hair and 12 wool lambs served as con-trols. Because of space limitations, control lambs re-mained in drylot for an additional 2 wk and were moved to indoor pens on d 7 relative to infected lambs. Control lambs were dewormed on d 8 relative to infected lambs, received 10,000 L3 larvae of H. contortus on d 11, and were dewormed on d 12 and 14, thereby allowing brief initial exposure to L3 larvae and to antigen from killed larvae, but without establishment of infection. All control lambs had FEC of zero following deworming on d 14. Four control lambs of each breed type were sacrificed on d 17, 27, and 38 (i.e., 3, 13, and 24 d after final deworm-ing) to provide a profile of responses in control lambs.

Figure 1. Infection, deworming, and sample collection for infected and control lambs of hair and wool breeds. Days are relative to the final dosing of infected lambs with 10,000 Haemonchus contortus larvae (Hc). An arrow indicates that lambs were dewormed. An asterisk indicates that lambs were sacrificed and tissue samples were collected. Cross-hatched lines indicate infection. Control lambs were dosed with 10,000 Haemonchus contortus larvae on d 11 but were subsequently dewormed on d 12 and 14 to prevent establishment of infection.

Immune effectors in hair and wool sheep ◊

Lambs were killed by captive-bolt pistol, followed by exsanguination. The gastrointestinal tract was re-moved, and the abomasum was tied off at both ends and separated from the digestive tract. The abomasum was then cut along the greater curvature and washed with room-temperature PBS, and a 2.5 cm2 section of tissue, including the full thickness and 1 fold of the abomasum, was removed from the fundic region. Lymph nodes lining the lesser curvature of the aboma-sum were removed from surrounding adipose tissue and rinsed in PBS. Lymph node and abomasal tissues were homogenized separately on ice-cold metal trays, and 0.1-g samples were immediately frozen in liquid nitrogen and stored at −80°C

Total RNA was extracted from abomasal tissue using TRIzol reagent (Invitrogen Inc., Carlsbad, CA) and from lymph node tissues using RNeasy Miniprep kit (Qiagen,Hilden, Germany) according to manufac-turers’ protocols. The RNA was examined at 260- and 280-nm wavelengths using a UV spectrophotometer to confirm sufficient concentration and purity (i.e., lack of protein contamination) for use in real-time reverse transcriptase (RT) PCR.

Parasitological Techniques

Eggs collected from adult H. contortus were used to produce a monospecific larval culture (MacKinnon et al., 2009). Larvae were collected using the Baermann technique (Zajac and Conboy, 2012), were stored in deionized water at 4°C, and were used within 1 mo to infect experimental animals. Experimental infections at d 0 and 11 in Fig. 1 used larvae from a single culture. Fecal egg counts were determined at 16, 21, and 27 d PI using the McMaster technique (Whitlock, 1948).

Primer Design and Validation

Target genes (Table 1) were selected on the ba-sis of cDNA microarray analysis (MacKinnon et al., 2009) and previous literature. Oligonucleotide se-quences for IL-4, interferon gamma (IFNγ), and IL-5 were obtained from Coussens et al. (2004), and Primer Express software (Applied Biosystems, Waltham, MA) was used to design primers for the heavy chain of IgE, IL-13, tumor necrosis factor alpha (TNFα), the p35 subunit of IL-12 (IL-12 p35), the α chain of the high-affinity IgE receptor (FcεRI), the α chain of the IL-4 receptor (IL-4 Rα), and the β1 and β2 chains of the IL-12 receptor (IL-12 Rβ1 and IL-12 Rβ2, respectively) on the basis of known bovine and ovine sequences. Primer pairs were selected to have 1 of the 2 primers spanning an exon-intron junction, where applicable, to limit DNA amplification. Candidate housekeeping (HK) genes were glyceraldehyde-3-phosphate dehy-drogenase (GAPDH), β-actin, and ribosomal protein L19. Primer sequences for HK genes were obtained from the Michigan State University Center for Animal Functional Genomics (http://www.ans.msu.edu/re-search1/functional_genomics_and_bioinfomatics). Primer sequences, presence or absence of DNA ampli-fication, and melting temperatures of the correspond-ing amplicons are listed in Table 1.

Primer pairs were evaluated for ovine and bovine cDNA and DNA amplification and contamination by including a blank (negative) control. Amplification ef-ficiency for primer pairs was assessed to ensure similar HK and target gene amplification. To determine am-plification efficiency, 1, 3.16, 10, 31.6, and 100 ng of cDNA were used as described below, and the slope of cycle threshold (Ct) values for log10 cDNA concentra-tions was obtained. A slope of −3.33 indicated 100%

Table 1. Forward and reverse primer sequences for real-time reverse transcriptase PCR melting temperature (Tm) of the amplicons and presence or absence of ovine DNA amplification (DNA)Gene1 Forward sequence Reverse sequence Tm, °C DNAIL-4 GCCACACGTGCTTGAACAAA TGCTTGCCAAGCTGTTGAGA 78.9 NoIL-4 Rα CCAAGCTCCTGCCCTGTTTA CCATTTCTAGCAGCCTTAGAGAAGTC 78.0 YesIL-5 TGGTGGCAGAGACCTTGACA GAATCATCAAGTTCCCATCACCTA 78.8 NoIL-13 AAGCCCTCAGCTAAGCAGGTT TGGGCCACTTCAATTTTGGT 79.2 NoIgE GCGAGACCTACTACTGCAAAGTGA CACGCTTGCCAACATCCTT 81.2 NoFceRI TGCCGAATCAAAGGATTTGC GATCAACCAGTCACTGATGACGTT 76.5 NoIFN-γ TGGAGGACTTCAAAAAGCTGATT TTTATGGCTTTGCGCTGGAT 77.1 NoIL-12 p35 GCTGCAGAAGGCCAGACAA ATATCTTCATGATCAATCTCCTCAGAAG 74.3 YesIL-12 Rb1 CTTTGGGTACCTCGGCTTGA CCTCAGTTTCCCCATCTTGAAA 75.9 NoIL-12 Rb2 CCTGGGCACAACCCTGTTT AACAACCCCGACGGAGATC 80.1 Yesβ-actin CGCCATGGATGATGATATTGC AAGCCGGCCTTGCACAT 82.5 YesRPL19 GCTCCTCAGCCAAGCACATAC GCCATGGTAATCCTGCTCAGTAC 79.2 YesGAPDH GCATCGTGGAGGGACTTATGA GGGCCATCCACAGTCTTCTG 81.7 Yes

1IL-4 Rα = α chain of the IL-4 receptor; FcεRI = α chain of the high-affinity IgE receptor; IFNγ = interferon gamma; IL-12 p35 = p35 subunit of IL-12; IL-12 Rβ1 and IL-12 Rβ2 = β1 and β2 chains, respectively, of the IL-12 receptor; RPL 19 = ribosomal protein 19 and GAPDH = glyceraldehyde-3-phosphate dehydrogenase.

MacKinnon et al.◊

amplification efficiency. Multiple primer pairs for TNFα were evaluated, but none met the above criteria, and TNFα was excluded from our analysis. Multiple HK genes were tested for amplification in abomasal and lymph node tissue of infected and control lambs. Glyceraldehyde-3-phosphate dehydrogenase had con-sistent expression (Ct ± SE = 19.34 ± 0.36) and was used for the analyses.

cDNA synthesis and Real-Time RT-PCR

First-strand cDNA was reverse transcribed from 2.2 μg total RNA using a High Capacity cDNA Archive Kit (Applied Biosystems) according to the manufacturer’s protocol. Reverse-transcribed samples were diluted to a concentration of 10 ng/μL using RNase-free diethylpyro-carbonate-treated (DEPC) water and stored at −20°C. Each RT-PCR reaction was performed in a total volume of 25 μL using 2 μL (10 ng/μL) of reverse-transcribed RNA, 12.5 μL SYBR Green PCR master mix (Applied Biosystems), 1.5 μL (5 μM concentration) forward and reverse primers, and 7.5 μL DEPC water. Samples were loaded into optical 96-well plates (Applied Biosystems) in duplicate, and RT-PCR was performed on an ABI PRISM 7300 sequence detection system (Applied Biosystems) under the following conditions: 50°C for 2 min, 95°C for 10 min, and 40 cycles of 95°C for 15 s and 60°C for 1 min. A melting curve was obtained at the end of each run to ensure amplification of only 1 product. If variation in Ct values between duplicates exceeded 0.125 or multiple products were found, the sample was rerun until acceptable values were obtained. Mean Ct values for sample duplicates were used for all analyses.

Statistical Methods

Differences in Ct values between GAPDH and tar-get genes (ΔCt) for each lamb were analyzed for each gene using a general linear model (SAS Inst. Inc., Cary, NC). The initial model included effects of breed (hair or wool), group (infection status by day of sacrifice), and breed by group interaction. However, no system-atic changes in expression levels across sampling times were observed in control lambs, and observations for control lambs were subsequently averaged across col-lection days. Linear contrasts among the resulting 6 means for control lambs and infected lambs at 3 and 27 d PI for each breed type were used to test effects of breed type and experimental infection. Two-tailed t tests were used to test breed differences within each treatment group, and Dunnett’s test was used to com-pare averages for control lambs to those for infected lambs at 3 and 27 d PI. Effects of breed type were test-

ed separately for control lambs and for infected lambs at 3 and 27 d PI. Breed comparisons were orthogonal to one another and to the contrasts used to compare in-fected and control lambs and were therefore tested with 2-tailed t tests. Differences were considered significant at P < 0.05 unless stated otherwise. Tests were based on ΔCt means. However, for presentation purposes, ΔΔCt values were calculated as differences between least squares means of control wool sheep and least squares means for other groups of lambs, and 2-∆∆ct values were used to show fold changes in gene expres-sion for infected and control hair and wool sheep on each day of sacrifice relative to control wool lambs.

RESULTS

ParasitologyNematode infection, as assessed by FEC, was

not observed in control lambs, but lambs infected with H. contortus all had measurable FEC by 16 d PI (MacKinnon et al., 2010). The mean FEC for wool sheep was similar to that of hair sheep at 16 d PI but was 2.8-fold higher at 21 d PI (n = 3,647 ± 770 and 1,280 ± 867, respectively) and 2.5-fold higher at 27 d PI (n = 3,136 ± 1,599 and 1,267 ± 837, respectively; P = 0.12 for average FEC at 21 and 27 d). Worm numbers in the abomasum at 27 d PI were 1.8-fold higher in wool compared with hair lambs (n = 4,535 ± 690 and 2,491 ± 753, respectively; P = 0.07; MacKinnon et al., 2010). Differences in worm counts and FEC were based on only 6 lambs of each type, but significant differences in FEC between these hair and wool sheep types were pre-viously reported by Notter et al. (2003) and Vanimisetti et al. (2004), with lower FEC in hair lambs.

Gene Expression in Abomasal and Lymph Node Tissue

Cytokine, IgE, and associated receptor genes evaluated in this study (Table 1) all had quantifiable expression in lymph node tissue, but expression of IL-4, IL-5, IL-12 Rβ1, and IL-12 Rβ2 was too low to measure at the times sampled in abomasal tissue. Compared with wool sheep, control hair sheep had greater expression of IgE in lymph nodes (P < 0.001) and lower expression of FcεRI in both lymph nodes and abomasal tissue (P < 0.05; Fig. 2 and 3).

Infection with H. contortus was associated with large changes in gene expression in abomasal tissue and lymph nodes of both breeds. At 3 d PI, lymph nodes of infected lambs had higher expression of IL-13 (6.0-fold; P < 0.001), IL-5 (1.9-fold; P < 0.01), IL-12 p35 (2.0-fold; P < 0.05), and IgE (3.4-fold; P < 0.01) com-pared with control lambs but lower expression of IFNγ

Immune effectors in hair and wool sheep ◊

(P < 0.10; Fig. 2). In abomasal tissue, infected lambs had higher expression compared with control lambs for IL-13 (7.7-fold; P < 0.01), FcεRI (2.1-fold; P < 0.01), and IgE (2.4-fold; P < 0.10) at 3 d PI but had somewhat lower expression of IFNγ (P < 0.10; Fig. 3).

Differences between breeds in gene expression were observed in infected lambs at 3 d PI. An increase in IgE expression was observed in both breeds at 3 d after in-fection, but hair sheep had a much greater increase in expression of IgE in lymph nodes compared with wool sheep (Fig. 2). Hair sheep also tended to have lower ex-pression (P < 0.10) of FcεRI in lymph nodes at 3 d PI compared with wool sheep, but expression levels in ab-omasal tissue were somewhat greater (P < 0.20) for hair sheep. Expression of IL-12 p35, a cytokine subunit asso-

ciated with Th1 immune responses (Collins et al., 1999), increased relative to control lambs in both lymph nodes and abomasal tissues of wool lambs at 3 d PI but did not change in hair sheep. Increases relative to control lambs in expression of IL-13 in lymph nodes and abomasal tis-sue and of IL-5 in lymph nodes and reduced expression of IFNγ were consistent across breed types at 3 d PI.

At 27 d after infection, IgE expression remained higher in lymph nodes (P < 0.05; Fig. 2) and, to a less-er extent, in abomasal tissue (P < 0.10; Fig. 3) of hair compared with wool lambs. In wool lambs, expression of IL-13 in both lymph nodes and abomasal tissue de-clined precipitously relative to levels observed at 3 d PI. Reductions in IL-13 expression were also observed in lymph nodes and abomasal tissue of hair lambs but

Figure 2. Relative expression of IgE, the α chain of the high-affinity IgE receptor (FcεRI), IL-13, IL-5, the p35 subunit of IL-12 (IL-12 p35), and interferon gamma (IFNγ) genes in lymph nodes of wool and hair sheep. Control lambs were infected and then immediately treated. Values for these lambs are averages of measurements taken 3, 13, and 24 d after final deworming of control lambs (Fig. 1). Breeds with different labels (a, b and x, y) differ (P < 0.05 and P < 0.10, respectively) within infection status and sampling day. Infected lambs differ from controls at †P < 0.10, *P < 0.05, **P < 0.01, or ***P < 0.001. Methods used to derive fold-changes in gene expression are described in the text.

MacKinnon et al.◊

were less precipitous, resulting in significantly greater IL-13 expression in both lymph nodes (P < 0.001) and abomasal tissue (P < 0.05) of hair lambs at 27 d PI. The greater expression of IL-12 p35 observed in wool lambs at 3 d PI was also present at 27 d, although ex-pression levels in both breed types tended to decline from 3 to 27 d PI. Greater expression of IFNγ in both lymph nodes (P < 0.05) and, to a lesser extent, aboma-sal tissue (P < 0.10) of wool lambs provides further evidence for a more strongly polarized Th2 immune response in hair lambs. Declines in expression of FcεRI in both lymph nodes and abomasal tissue and of IL-5 in lymph nodes at 27 d PI relative to 3 d PI were generally consistent across breed types.

DISCUSSION

Wool sheep infected with gastrointestinal nematodes predominantly produce a Th2-type immune response (Meeusen et al., 2005; Pernthaner et al., 2005a; Lacroux et al., 2006). Essential immune mechanisms needed for increased resistance to H. contortus in sheep are mediated by T cells expressing the CD4+ (“cluster of differentia-tion 4”) pattern of cell-surface proteins (Peña et al., 2006), but precise mechanisms of activation and development of protective immunity are unknown. We have shown a difference in gene expression between 2 sheep breeds in infected lambs at 3 and 27 d PI that indicates involvement of specific cytokines, immunoglobulins, and receptors in the immune response of sheep to H. contortus infection.

Figure 3. Relative expression of IgE, the α chain of the high-affinity IgE receptor (FcεRI), IL-13, the p35 subunit of IL-12 (IL-12 p35), and interferon gamma (IFNγ) genes in abomasa of wool and hair sheep. Control lambs were infected and then immediately treated. Values for these lambs are averages of measurements taken 3, 13, and 27 d after final deworming of control lambs (Fig. 1). Breeds with different labels (a, b and x, y) differ (P < 0.05 and P < 0.10, respectively) within infection status and sampling day. Infected lambs differ from controls at †P < 0.10, *P < 0.05, **P < 0.01, or ***P < 0.001. Methods used to derive fold-changes in gene expression are described in the text.

Immune effectors in hair and wool sheep ◊

Infection with H. contortus induced a Th2-type re-sponse by 3 d PI in tissues of both hair and wool sheep, with increased expression of Th2 genes, including IL-13, IL-5, and IgE but not IL-4. Expression of the Th1 cyto-kine IFNγ was reduced in both breeds at 3 d PI. However, expression of the Th1 cytokine IL-12 p35 was increased in wool lambs but not in hair lambs. Evidence for a more persistent Th2 immune response in hair sheep was ob-served at 27 d PI when expression of IL-13 returned to control levels in wool lambs but remained elevated in hair lambs. Higher levels of expression of IFNγ and IL-12 p35 were observed in both tissues in wool lambs at 27 d PI, but levels of these cytokines in hair lambs at 27 d PI did not exceed those observed in control lambs.

Increased expression of IL-13, IL-5, and IL-4, as well as IFNγ, was reported in lymph nodes of Romney sheep infected with Trichostrongylus colubriformis, an intestinal nematode parasite (Pernthaner et al., 2006). In younger sheep of a different breed, Lacroux et al. (2006) also reported increased IL-13, IL-5, and IL-4 in abomasal and lymph tissues of infected lambs but no differences between infected and control lambs in IFNγ, IL-12 p35, IL-10, or TNFα. Differences between studies in expres-sion of IFNγ may be associated with parasite-produced IFNγ homologs that can alter host immune responses to facilitate a more favorable Th1 environment for the parasite (Grencis, 2001). Maizels et al. (2004) identified a multitude of proteins produced by different gastrointes-tinal parasites that appear similar to host cytokines.

Increases in IL-13 and IL-5 in lambs infected with H. contortus were not surprising. Interleukin-13 is produced by Th2 cells and induces IgE-class switch-ing in bovine cells (Trigona et al., 1999), which was consistent with the observed increase in IgE expres-sion. Increased IL-13 causes B cell, but not T cell, ac-tivation and proliferation (Trigona et al., 1999), acti-vates mast cells (Kaur et al., 2006), regulates IFNγ, and drives Th2 responses (Webb et al., 2007). Mast cells and Th2 cells produce IL-5, which has been asso-ciated with eosinophil recruitment and activation and larval damage (Rainbird et al., 1998), and eosinophil viability can be increased through synergistic effects of IL-13 and IL-5 (Luttmann et al., 1999). Production of IL-5 in abdominal lymph nodes and abomasal tis-sue indicates a Th2 response, recruitment of eosino-phils to the abomasum (MacKinnon et al., 2010), and increased IgE gene expression within 3 d of infection.

Control hair lambs had higher IgE gene expression in lymph nodes than control wool lambs, but differ-ences were much smaller than those observed in lambs with an active parasite infection. Previous attempts to vaccinate lambs against H. contortus using isolated ex-cretory/secretory (ES) products of adult worms led to transient elevations in ES-specific serum IgE following

treatment (Kooyman et al., 2000; Vervelde et al., 2003). An IgE-reactive antigen was also identified on the sur-face of infective larvae of Teladorsagia circumcincta but not H. contortus (Huntley et al., 2001). Immune re-sponses in control lambs thus potentially reflected both background levels of gene expression and responses to antigen from killed L3 larvae. However, no time trends in gene expression were observed in control lambs, sug-gesting that observed differences mainly reflected dif-ferences in background IgE expression. Greater back-ground levels of IgE expression may be associated with larger numbers of IgE-bound mast cells in the gastroin-testinal tract, enabling hair sheep to respond more rap-idly to invading parasites. Increased numbers of mast cells, which bind IgE, were reported in association with parasitism (Lacroux et al., 2006). These cells can be activated and degranulated by binding with worm antigens and direct cascades of immune events. Mast cells can cause increased IgE production and directly produce IL-4 and IL-13 (Henz et al., 2001).

Expression of FcεRI in lymph nodes and abomasal tissues of control lambs was higher for hair sheep than for wool sheep. Expression of FcεRI in lymph nodes of infected lambs at 3 d PI was essentially identical to that observed in control lambs. However, FcεRI ex-pression tended to increase in abomasal tissue of hair lambs at 3 d PI and then declined at 27 d PI relative to levels of expression found at d 3. Gamble and Zajac (1992) provided evidence for a potential role of mast cells in increased resistance of hair sheep, and these cells could be involved in observed changes in FcεRI expression. Mast cells commonly express FcεRI (Galli et al., 2011) and are considered precursors to globule leukocytes (Huntley et al., 1984). Although this cell type did not increase at d 3 (MacKinnon et al., 2010), eosinophils were higher in hair sheep and are known to express FcεRI. Increased expression of FcεRI in hair lambs thus potentially results from accumulation of a variety of innate immune cells in the abomasum of infected hair lambs. Lower FcεRI expression in abomasal tissue of wool sheep at 3 d PI may result from a reduced ability to recruit immune cells to the site of infection. Feedback loops reflecting effects of IgE and FcεRI on FcεRI gene expression are complex, generally involving positive association between IgE and FcεRI expression (Burton and Oettgen, 2011). However, antigen binding and internalization of anti-gen-IgE complexes by mast cells may have negative effects on FcεRI expression (Brenzovich et al., 2009).

Stronger polarization toward a Th2 immune re-sponse in hair sheep is consistent with the results of Pernthaner et al. (2005a, 2006), who reported stronger Th2 responses after infection in resistant, compared with susceptible, lines of Romney sheep infected with

MacKinnon et al.◊

T. colubriformis. When compared with susceptible animals, resistant sheep had increased IL-5, IL-13, and TNFα expression in lymph nodes but did not dif-fer in expression of IL-4 or IFNγ. Resistant lines of Merino and Romney sheep also had greater IgE pro-duction than susceptible lines (Bendixsen et al., 2004; Pernthaner et al., 2005b).

Decreased expression of Th1 cytokines such as IL-12 and IFNγ may result from downregulation by increased Th2 cytokine levels in infected hair sheep (Webb et al., 2007). Recombinant bovine IL-12 directly caused in-creased IFNγ production by T cells (Collins et al., 1999). Therefore, reduced expression of IL-12 p35 at 3 and 27 d PI may have led to the observed decrease in IFNγ at 27 d. Cytokine profiles at d 27 of infection may also reflect the total worm burden, as hair sheep potentially have fewer worms than wool sheep by 27 d PI.

These results support a stronger Th2 response in infected hair sheep, with large breed differences in expression of IL-13 but not IL-4. Large changes in gene expression were observed within 3 d of infection, presumably in response to larval antigens, suggesting that mechanisms driving resistance to gastrointesti-nal nematodes are initiated immediately on entry of parasitic larvae to the gastrointestinal tract and that immune responses in this period may be critical to ex-pression of parasite resistance.

LITERATURE CITEDBalic, A., C. P. Cunningham, and E. N. Meeusen. 2006. Eosinophil

interactions with Haemonchus contortus larvae in the ovine gastrointestinal tract. Parasite Immunol. 28:107–115. doi:10.1111/j.1365-3024.2006.00816.x.

Bendixsen, T., R. G. Windon, J. F. Huntley, A. MacKellar, R. J. Davey, S. J. McClure, and D. L. Emery. 2004. Development of a new monoclonal antibody to ovine chimeric IgE and its detec-tion of systemic and local IgE antibody responses to the intes-tinal nematode Trichostrongylus colubriformis. Vet. Immunol. Immunopathol. 97:11–24. doi:10.1016/j.vetimm.2003.08.009.

Bisset, S. A., A. Vlassoff, P. G. Douch, W. E. Jonas, C. J. West, and R. S. Green. 1996. Nematode burdens and immunologi-cal responses following natural challenge in Romney lambs selectively bred for low or high faecal worm egg count. Vet. Parasitol. 61:249–263. doi:10.1016/0304-4017(95)00836-5.

Brenzovich, J., M. Macey, J. Fernando, H. J. Chong, B. Barnstein, P. Mirmonsef, J. K. Morales, A. Kimura, T. D. Cruz, and J. Ryan. 2009. IgE signaling suppresses FcεRI expression. J. Leukoc. Biol. 86:1351–1358. doi:10.1189/jlb.0409231.

Burton, O. T., and H. C. Oettgen. 2011. Beyond immediate hyper-sensitivity: Evolving roles for IgE antibodies in immune ho-meostasis and allergic diseases. Immunol. Rev. 242:128–143. doi:10.1111/j.1600-065X.2011.01024.x.

Collins, R. A., C. J. Howard, S. E. Duggan, and D. Werling. 1999. Bovine interleukin-12 and modulation of IFNγ production. Vet. Immunol. Immunopathol. 68:193–207. doi:10.1016/S0165-2427(99)00020-3.

Coussens, P. M., N. Verman, M. A. Coussens, M. D. Elftman, and A. M. McNulty. 2004. Cytokine gene expression in peripheral blood mononuclear cells and tissues of cattle infected with Mycobacterium avium subsp. paratuberculosis: Evidence for an inherent proinflammatory gene expression pattern. Infect. Immun. 72:1409–1422. doi:10.1128/IAI.72.3.1409-1422.2004.

Diez-Tascon, C., O. M. Keane, T. Wilson, A. Zadissa, D. L. Hyndman, D. B. Baird, J. C. McEwan, and A. M. Crawford. 2005. Microarray analysis of selection lines from outbred populations to identify genes involved with nematode parasite resistance in sheep. Physiol. Genomics 21:59–69. doi:10.1152/physiolgenomics.00257.2004.

Eady, S. J., R. R. Woolaston, J. L. Ward, G. D. Gray, J. Karsson, and J. Greef. 1997. Nemesis—Systems for incorporating re-sistance to worms in Merino breeding programs. Proc. Assoc. Adv. Anim. Breed. Genet. 12:507–511.

Galli, H. R., N. Borregaard, and T. A. Wynn. 2011. Phenotypic and functional plasticity of cells of innate immunity: Macrophages, mast cells and neutrophils. Nat. Immunol. 12:1035–1044. doi:10.1038/ni.2109.

Gamble, H. R., and A. M. Zajac. 1992. Resistance of St. Croix lambs to Haemonchus contortus in experimentally and naturally acquired infections. Vet. Parasitol. 41:211–225. doi:10.1016/0304-4017(92)90081-J.

Grencis, R. K. 2001. Cytokine regulation of resistance and suscep-tibility to intestinal nematode infection—From host to parasite. Vet. Parasitol. 100:45–50. doi:10.1016/S0304-4017(01)00482-4.

Henz, B. M., M. Maurer, U. Lippert, M. Worm, and M. Babina. 2001. Mast cells as initiators of immunity and host defense. Exp. Dermatol. 10:1–10. doi:10.1034/j.1600-0625.2001.100101.x.

Huntley, J. F., G. Newlands, and H. R. P. Miller. 1984. The isolation and characterization of globule leukocytes: Their derivation from mucosal mast cells in parasitized sheep. Parasite Immunol. 6:371–390. doi:10.1111/j.1365-3024.1984.tb00809.x.

Huntley, J. F., J. Redmond, W. Welfare, G. Brennan, F. Jackson, F. Kooyman, and L. Vervelde. 2001. Studies on the immuno-globulin E responses to Teladorsagia circumcincta in sheep: Purification of a major high molecular weight allergen. Parasite Immunol. 23:227–235. doi:10.1046/j.1365-3024.2001.00377.x.

Kaplan, R. M. 2004. Drug resistance in nematodes of veterinary importance: A status report. Trends Parasitol. 20:477–481. doi:10.1016/j.pt.2004.08.001.

Kaur, D., F. Hollins, L. Woodman, W. Yang, P. Monk, R. May, P. Bradding, and C. E. Brightling. 2006. Mast cells express IL-13R alpha 1: IL-13 promotes human lung mast cell prolif-eration and Fc epsilon RI expression. Allergy 61:1047–1053. doi:10.1111/j.1398-9995.2006.01139.x.

Keane, O. M., A. Zadissa, T. Wilson, D. L. Hyndman, G. J. Greer, D. B. Baird, A. F. McCulloch, A. M. Crawford, and J. C. McEwan. 2006. Gene expression profiling of naive sheep genetically resistant and susceptible to gastrointestinal nema-todes. BMC Genomics 7:42. doi:10.1186/1471-2164-7-42.

Kooyman, F. N., H. D. Schallig, M. A. Van Leeuwen, A. MacKellar, J. F. Huntley, A. W. Cornelissen, and L. Vervelde. 2000. Protection in lambs vaccinated with Haemonchus contortus antigens is age related, and correlates with IgE rather than IgG1 antibody. Parasite Immunol. 22:13–20. doi:10.1046/j.1365-3024.2000.00265.x.

Lacroux, C., T. H. Nguyen, O. Andreoletti, F. Prevot, C. Grisez, J. P. Bergeaud, L. Gruner, J. C. Brunel, D. Francois, P. Dorchies, and P. Jacquiet. 2006. Haemonchus contortus (Nematoda: Trichostrongylidae) infection in lambs elicits an unequivocal Th2 immune response. Vet. Res. 37:607–622. doi:10.1051/vetres:2006022.

Immune effectors in hair and wool sheep ◊

Luttmann, W., T. Matthiesen, H. Matthys, and J. C. Virchow Jr. 1999. Synergistic effects ofinterleukin-4 or interleukin-13 and tumor ne-crosis factor-alpha on eosinophil activation in vitro. Am. J. Respir. Cell Mol. Biol. 20:474–480. doi:10.1165/ajrcmb.20.3.3326.

MacKinnon, K. M., J. L. Burton, A. M. Zajac, and D. R. Notter. 2009. Microarray analysis reveals differences in gene ex-pression profiles of hair and wool sheep infected with Haemonchus contortus. Vet. Immunol. Immunopathol. 130:210–220. doi:10.1016/j.vetimm.2009.02.013.

MacKinnon, K. M., A. M. Zajac, F. N. J. Kooyman, and D. R. Notter. 2010. Differences in immune parameters are associated with resis-tance to Haemonchus contortus in Caribbean hair sheep. Parasite Immunol. 32:484–493. doi:10.1111/j.1365-3024.2010.01211.x.

Maizels, R. M., A. Balic, N. Gomez-Escobar, M. Nair, M. D. Taylor, and J. E. Allen. 2004. Helminth parasites—Masters of regulation. Immunol. Rev. 201:89–116. doi:10.1111/j.0105-2896.2004.00191.x.

Meeusen, E. N., A. Balic, and V. Bowles. 2005. Cells, cytokines and other molecules associated with rejection of gastroin-testinal nematode parasites. Vet. Immunol. Immunopathol. 108:121–125. doi:10.1016/j.vetimm.2005.07.002.

National Animal Health Monitoring System. 1996. U.S. sheep health and management practices. Natl. Anim. Health Monit. Syst., USDA, APHIS, Fort Collins, CO.

Notter, D. R., S. A. Andrew, and A. M. Zajac. 2003. Responses of hair and wool sheep to a single fixed dose of infective larvae of Haemonchus contortus. Small Rumin. Res. 47:221–225. doi:10.1016/S0921-4488(02)00279-1.

Notter, D. R., and N. E. Cockett. 2005. Opportunities for detec-tion and use of QTL influencing seasonal reproduction in sheep: A review. Genet. Sel. Evol. 37(Suppl. 1):S39–S53. doi:10.1186/1297-9686-37-S1-S39.

Peña, M. T., J. E. Miller, and D. W. Horohov. 2006. Effect of CD4+ T lymphocyte depletion on resistance of Gulf Coast Native lambs to Haemonchus contortus infection. Vet. Parasitol. 138:240–246. doi:10.1016/j.vetpar.2005.12.026.

Pernthaner, A., S. A. Cole, L. Morrison, R. Green, R. J. Shaw, and W. R. Hein. 2006. Cytokine and antibody subclass responses in the intestinal lymph of sheep during repeated experimen-tal infections with the nematode parasite Trichostrongylus colubriformis. Vet. Immunol. Immunopathol. 114:135–148. doi:10.1016/j.vetimm.2006.08.004.

Pernthaner, A., S. A. Cole, L. Morrison, and W. R. Hein. 2005a. Increased expression of interleukin-5 (IL-5), IL-13, and tu-mor necrosis factor alpha genes in intestinal lymph cells of sheep selected for enhanced resistance to nematodes during infection with Trichostrongylus colubriformis. Infect. Immun. 73:2175–2183. doi:10.1128/IAI.73.4.2175-2183.2005.

Pernthaner, A., R. J. Shaw, M. M. McNeill, L. Morrison, and W. R. Hein. 2005b. Total and nematode-specific IgE responses in intestinal lymph of genetically resistant and susceptible sheep during infection with Trichostrongylus colubriformis. Vet. Immunol. Immunopathol. 104:69–80. doi:10.1016/j.vetimm.2004.10.008.

Pernthaner, A., M. Stankiewicz, W. Cabaj, A. Pfeffer, R. S. Green, and P. G. Douch. 1996. Immune responsiveness of nematode-resis-tant or susceptible Romney line-bred sheep to continuous infec-tion with Trichostrongylus axei. Vet. Immunol. Immunopathol. 51:137–146. doi:10.1016/0165-2427(95)05498-7.

Rainbird, M. A., D. Macmillan, and E. N. Meeusen. 1998. Eosinophil-mediated killing of Haemonchus contortus lar-vae: Effect of eosinophil activation and role of antibody, complement and interleukin-5. Parasite Immunol. 20:93–103. doi:10.1046/j.1365-3024.1998.00132.x.

Trigona, W. L., W. C. Brown, and D. M. Estes. 1999. Functional implications for signaling via the IL4R/IL13R complex on bovine cells. Vet. Immunol. Immunopathol. 72:73–79. doi:10.1016/S0165-2427(99)00117-8.

Vanimisetti, H. B., S. P. Greiner, A. M. Zajac, and D. R. Notter. 2004. Performance of hair sheep composite breeds: Resistance of lambs to Haemonchus contortus. J. Anim. Sci. 82:595–604.

Vervelde, L., N. Bakker, F. N. J. Kooyman, A. W. C. A. Cornelissen, C. M. C. Bank, A. K. Nyame, R. D. Cummings, and I. van Die. 2003. Vaccination-induced protection of lambs against the parasitic nematode Haemonchus contortus correlates with high IgG antibody responses to the LDNF glycan anti-gen. Glycobiology 13:795–804. doi:10.1093/glycob/cwg107.

Webb, D. C., Y. Cai, K. I. Matthaei, and P. S. Foster. 2007. Comparative roles of IL-4, IL-13, and IL-4Rα in dendritic cell maturation and CD4+ Th2 cell function. J. Immunol. 178:219–227. doi:10.4049/jimmunol.178.1.219.

Whitlock, H. V. 1948. Some modifications of the McMaster hel-minth egg-counting technique apparatus. J. Counc. Sci. Ind. Res. 21:177–180.

Woolaston, R. R. 1992. Selection of Merino sheep for increased and decreased resistance to Haemonchus contortus: Peri-parturient effects on faecal egg counts. Int. J. Parasitol. 22:947–953. doi:10.1016/0020-7519(92)90052-M.

Zajac, A. M., and G. A. Conboy. 2012. Veterinary clinical parasi-tology. 8th ed. Wiley-Blackwell, Hoboken, NJ.