Gamma carbonic anhydrase like complex interact with plantmitochondrial complex I

Mariano Perales1;y, Gustavo Parisi2;y, Mar��a Silvina Fornasari2, Alejandro Colaneri1,Fernando Villarreal1, Nahuel Gonzalez-Schain1, Julian Echave2, Diego Gomez-Casati1,Hans-Peter Braun3, Alejandro Araya4 and Eduardo Zabaleta1;5;*1Instituto de Investigaciones Biotecnologicas, IIB-INTECH (CONICET/UNSAM), C.C. 164, 7130 Chas-com�us, Argentina; 2Centro de Estudios de Investigaciones, Universidad Nacional de Quilmes, Roque SaenzPena 180, B1876BXD Bernal., Argentina; 3Institut fur Angewandte Genetik, Universitat Hannover, Her-renhauser Str. 2, D-30419 Hannover, Germany; 4UMR 5097 R.E.G.E.R., CNRS and Universite VictorSegalen Bordeaux 2, 146 rue Leo Saignat, 33076 Bordeaux, France; 5Instituto de Investigaciones Biologicas.Universidad Nacional de Mar del Plata, Funes 3250, 7600 Mar del Plata, Argentina (*author for corre-spondence; e-mail ezabalet@mdp.edu.ar); yThese authors have contributed equally to the article.

Received 31 July 2004; accepted in revised form 16 November 2004

Key words: Complex I, Gamma carbonic anhydrase, plant mitochondria, respiratory chain

Abstract

We report the identification by two hybrid screens of two novel similar proteins, called Arabidopsis thalianagamma carbonic anhydrase like1 and 2 (AtcCAL1 and AtcCAL2), that interact specifically with putativeArabidopsis thaliana gamma Carbonic Anhydrase (AtcCA) proteins in plant mitochondria. The interactionregion that was located in the N-terminal 150 amino acids of mature AtcCA and AtcCA like proteinsrepresents a new interaction domain. In vitro experiments indicate that these proteins are imported intomitochondria and are associated with mitochondrial complex I as AtcCAs. All plant species analyzedcontain both AtcCA and AtcCAL sequences indicating that these genes were conserved throughout plantevolution. Structural modeling of AtcCAL sequences show a deviation of functionally important active siteresidues with respect to cCAs but could form active interfaces in the interaction with AtcCAs. We postulatea CA complex tightly associated to plant mitochondrial complex.

Introduction

Enzymes containing the left-handed parallel betahelix (LbH) domain display imperfect tandem-re-peated copies of a hexapeptide sequence charac-terized as [LIV]-[GAED]-X2-[STAV]-X and aretermed ‘hexapeptide repeat’ enzymes (Vaara,1992). It is a very diverse group of proteins in-volved in many biological processes, includingcoenzymes, many types of transferases, carrierproteins, and gamma carbonic anhydrase/ferripy-ochelin binding protein family (Parisi et al., 2000).All carbonic anhydrases are divided into threeclasses (a, b, and c) that evolved independently(Hewett-Emmett and Tashian 1996, Hewett-Emmett,

2000). To date, there is only one example fullycharacterized of cCA from Methanosarcina ther-mophila, named CAM (Alber and Ferry, 1994,Kisker et al., 1996). A putative cCA homologue,CcmM, from Synechococcus PCC7942 without CAactivity has been described (Price et al., 1993). Theprotein is a subunit of the carboxysomal complex,a key compartment in the CO2 concentratingmechanism (Badger and Price, 2003). Recently,very similar proteins from E. coli (i.e. CaiE, etc)were described, which are postulated to work incoordination with multienzymatic complexes ascoenzymes (Merlin et al., 2003). A sequence pat-tern characteristic of cCA was recently defined,which is useful to identify this kind of enzyme

Plant Molecular Biology 56: 947–957, 2004.� 2005 Springer. Printed in the Netherlands.

947

among the large LbH protein family (Parisi et al.,2004a). We previously have identified three puta-tive mitochondrial cCA protein homologues inArabidopsis thaliana, the first example for this typeof enzyme in eukaryotes. These putative AtcCAsare imported into mitochondria and presumablyassociated to respiratory chain complex I (Parisiet al., 2004a).

Here, we report on the identification of twonovel nuclear genes from Arabidopsis thalianawhose products interact in vivo with AtcCAs.These two novel proteins, named Arabidopsisthaliana gamma Carbonic Anhydrase Like(AtcCALs) also show high similarity andsequence-structure compatibility with prokaryoticand plant c class carbonic anhydrases (cCAs).Phylogenetic trees indicate that cCALs derive fromcCAs very early in the evolution since both typesof proteins are present in green algae and primitiveplants.

Furthermore, experimental evidence is pre-sented indicating that these gene products possesstheir own mitochondrial transit peptides. TheAtcCAL and AtcCA proteins share the samesuborganelar location and interact specificallybetween themselves suggesting that cCA holoen-zyme are more complex in photosyntheticeukaryotes than in other organisms.

Materials and methods

Yeast two hybrid analyses

Yeast two-hybrid screens and analyses (Gietzet al., 1992) were performed with cHybriZAP 2.1system (Stratagene, CA). The bait construct wasthe complete AtcCA2 sequence in the vectorpBDGal4Cam (Stratagene). Yeast strainYM190::pBDcCA2 was transformed with anArabidopsis flower cDNAs library (1� 106 pfu/lg). Yeast colonies were selected on auxotrophymedia (-leu, -trp, -his dropout, Clontech, CA, PaloAlto) with 40mM 3 Aminotrioazole (3-AT). Y190genotype: MATa; trp1-901; leu 2-3,112;ade2-101;ura 3-52; his 3-200; gal44512; gal804538;URA3::GAL=lacZ; LYS2::GAL(UAS)=HIS2.Positive clones were tested for LacZ activity onfilters. For deletions of AtcCA2 the followingprimers were used: TCCTCGAGTGATGAATGTGTTT for N1, TACTCGAGTCCAAGATAA-

TACG for N2, ACCTCGAGTGGT-TGCTGCTGGT for N3, ACTCTCGAGTCTC-TCAACCTCG for C1, ACTCTCGAGACCTCTCCAGAAG for C2, ACTCTCGAGTGTTACATTGTCC for C3 and GACTCGAGTT-AGAAGTACTGAG as reverse primer. Restriction sites(underlined) were included to facilitate the cloningof fragments into the appropriate vectors(pGBKT7 and pGADT7). The yeast strain usedfor these assays was PJ69-4A (Clontech), geno-type: MATa; trp1-901; leu 2-3,112; ade2-101; ura3-52; his 3-200; gal44512; gal804538;GAL2-2ADE; LYS2::GAL1-HIS3; met2::GAL7-lacZ. Yeast transformation was performed byusing the lithium acetate method (Gietz et al.,1992). Analysis of b-galactosidase activity wereperformed as described (Busi et al., 2003).

Similarity searches

Using the sequence At3g48680 as input we usedthe program BLASTP to search the protein non-redundant database at NCBI and the programTBLASTN to search the six reading frames of theEST database (Viridiplantae). Sequences with anE-value below 1� 10�4 from both databases wereretrieved and combined in one dataset. Sequenceswere aligned using the program CLUSTALW(Thompson et al., 1997). In the case of the ESTs,previous to being aligned, the retrieved sequenceswere filtered and processed as described (Cuffet al., 2000).

Phylogenetic analysis

A maximum parsimony topology was obtainedusing the program PROTPARS from the packagePHYLIP (Felsestein, 1993). Bootstrapping sup-port was assessed using 500 replicates obtainedwith SEQBOOT and analyzed with CONSENSE.Both programs are also from the PHYLIPpackage.

Protein analysis and immunoblots

Protein extracts from mitochondria of Arabidopisthaliana cell culture were performed followingstandard techniques (Eubel et al., 2003). Re-combinant proteins were isolated following pGEX(AmershamPharmaciaBiotech, Piscataway, NJ) orpET24a (Novagen, Madison, WI) protocols. The

948

GST moiety was cleaved off and the cCA moietyfurther purified. Samples were subjected to stan-dard SDS-PAGE or two dimension BN (BlueNative) followed by a SDS-PAGE (Schagger andPfeiffer, 2000) and blotted onto Nitrocellulosemembranes (BioRad, Hercules, CA). Blots wereincubated with anti-cCA2 polyclonal antiserumand revealed following standard techniques(Sambrook and Russell, 2001).

Mitochondria isolation and Import assays

Mitochondria were prepared from potato tubers(Solanum tuberosum) as described (Parisi et al.,2004a). 35[S] Methionine-35[S] Cysteine labeledproteins were synthesized using TnT CoupledReticulocyte Lysate System (Promega, Madison,WI). Protein imports into mitochondria wereperformed as described (Parisi et al., 2004a).

Model building and structural analysis

Tridimensional structures of At3g48680 were builtusing the program MODELLER 6 (Sali andBlundell, 1993) on the TITO server (http : ==bioserv:cbs:cnrs:fr=)(Database size: 9864 struc-tures). The structural template used was thestructure of the Ferripyochelin Binding Proteinfrom Pyrococcus horikoshii (PDB 1v67) whichproduced the best score in threading analysis withthe server 3D-PSSM for fold recognition (Kelleyet al., 2000). The secondary structure ofAt3g48680 and At5g63510 was estimated usingSOPM (Combet et al., 2000) and PSIPRED(McGuffin et al., 2000) programs.

Results

Two LbH proteins interact in vivo with AtcCAs

To investigate the metabolic pathway in whichAtcCAs could be embedded, a two-hybrid screenwas performed using the entire coding region ofAtcCA2 (Parisi et al., 2004a) fused to the Gal4BDas a bait. More than five millions independentclones were screened for his auxotrophy and LacZactivity.

After several rounds of screening, three differ-ent positive clones that interact stably withAtcCA2 were isolated (Figure 1). One of them

corresponds to a gene that encodes an unknownsmall protein we named CA Interacting Protein14 kDa (CIP14) (At4g35320). Two other full-length cDNA clones were selected correspondingto genes At5g63510 and At3g48680 with unknownfunction, but annotated as transferases belongingto the hexapeptide repeat protein family. Thepredicted amino acid sequences from both geneshave a potential N-terminal signal peptide fortargeting to mitochondria. Interestingly, bothproteins show 87% similarity and 61–64% identityto bona fide AtcCAs. They contain the PaaY do-main (COG0663) as found in carbonic anhydrase/acetyltransferase/isoleucine patch superfamily.Proteins belonging to this family fold into a left-handed parallel b-helix (Raetz and Roderick,1995) (LbH) as do CAM (Alber and Ferry, 1994)and AtcCAs (Parisi et al., 2004a), however, bothproteins lack some catalytically important residuesproposed to be essential for CA activity. These twoproteins were accordingly re-named AtcCAL1 andAtcCAL2 (for gamma Carbonic Anhydrase Like).

Figure 1. AtcCA2 interacts with three novel Arabidopsis pro-

teins. The Y190 yeast strain containing the plasmid pBDGal4-

cCA2 fusion was grown on liquid culture lacking tryptophan

and leucine. It was transformed with an Arabidopsis library in

khybridZAP2.1 (Stratagene). Transformants were plated on

selective medium lacking tryptophan, leucine and histidine,

containing 40mM 3-aminotriozole (-HLT 40mM 3-AT) and

b-galactosidase activity was measured on his positive clones. As

negative control yeast cells harbouring the pGal4BD were used

for both assays. Different positive clones of yeast containing

cCA2 and interacting proteins were expressed in yeast cells. The

effect of the different constructs on growth was monitored.

b-galactosidase activity in yeast cells harbouring the same

constructs as above was assayed by a simple filter method.

949

The cCAs and these novel cCALs were previouslyidentified to co-migrate with mitochondrial com-plex I on Blue Native gels by Heazlewood et al.(2003) as plant-specific component of thiscomplex.

AtcCALs are imported into mitochondriaand co-migrate mainly with complex I

Database searches revealed the presence ofAtcCALs in several other plants and green algae.All these proteins are predicted to have mito-chondrial localization when analyzed with thePSORT program. A presequence 40 amino acidsin length was predicted for AtcCALs. This and thefact that they interact with AtcCA2, which isconsidered a mitochondrial protein (Eubel et al.,2003; Heazlewood et al., 2003; Parisi et al., 2004a)prompted us to investigate the subcellular locali-zation of these proteins in more detail. In vitrolabeled AtcCAL proteins were incubated withisolated mitochondria. As shown in the Figure 2,AtcCAL1 and 2 are efficiently imported into po-tato mitochondria resulting in a protein with areduced size of about 5 kDa. This indicates thatAtcCALs are imported into mitochondria by aclassical mechanism that includes the removal of asignal peptide.

The suborganellar localization of these novelLbH proteins was studied by an immunoblot of an2D Blue Native/SDS gel (Kruft et al., 2001;Sch€agger, 2001; Eubel et al., 2003, Heazlewoodet al., 2003) using a polyclonal antibody directedagainst AtcCA2 which recognizes all AtcCA andAtcCAL proteins and an unknown protein ofaround 70 kDa (Figure 3A). All cCA and cCALproteins are localized in the same vertical row asthe subunits forming part of singular complex I ofthe respiratory chain and the complex I containing

supercomplexes I + III2 and I2 + III4. However,these proteins are also detected with weakerintensity in the lower molecular weight region ofthe 2D gels, (Figure 3b and data not shown).These results confirm previous data found bysubunit identification of complex I using massspectrometry (Heazlewood et al., 2003).

The hexapeptide repeat domain is essentialfor interaction

Yeast strain PJ69-4A was tested for survival onselective medium and Lac Z activity in vitro afterco-transformation with plasmids carrying differentdeletions of AtcCA2 fused to Gal4 binding do-main (BD) and AtcCAL2 containing the activa-tion domain (AD) of Gal4 (see M and M).

Deletions spanning amino acid residues 40 to180 of AtcCA2 completely abolished interactionwith AtcCALs indicating that the N-terminal halfof the predicted mature protein containing thehexapeptide repeats is required for stable interac-tion (Figure 4A).

To evaluate the interaction between cCA2 andcCAL proteins, different combination of AD andBD constructs were tested. cCAL proteins werenot able to form homo- or cCAL heterodimers(cCAL1/cCAL2 heterodimers). In contrast, cCAproteins do form homodimers (data not shown).Interestingly, interaction between cCAL2 andcCA2 is stronger than between cCA2 alone or withcCAL1, suggesting certain specificity in theinteraction (Figure 4B).

Divergence of AtcCAs and AtcCALsis an ancient event

Since AtcCALs showed some homology to the baitprotein (AtcCA2), we decided to study the

Figure 2. AtcCALs are imported into plant mitochondria by a classical mechanism. Import of AtcCAL1 and AtycCAL2 into mito-

chondria. In vitro translated AtcCAL1 and AtcCAL2 were incubated with purified potato mitochondria. Lanes 1 and 5 shows the

precursor proteins without incubation. After incubation, samples were loaded onto gel without treatment (lanes 2 and 6) or pretreated

with proteinase K (lanes 3 and 7) or triton X-100 plus proteinase K (lanes 4 and 8).

950

Figure 3. AtcCALs, together with AtcCAs co-migrate mainly with mitochondrial complex I. Isolated mitochondria were treated with

digitonin as described in (Eubel et al., 2003) and protein complexes were subsequently resolved by one or two-dimensional Blue

Native/ SDS PAGE. These gels were transferred to nitrocellulose membrane and incubated with a polyclonal antibody anti-cCA2. The

membrane was subsequently incubated with a secondary anti-antibody conjugated with alkaline phosphatase and revealed with NBT

and BCiP. (A) 12.5% SDS gel of a mitochondrial extract (left) probed with anti-cCA2 (right). Arrows on the left indicate reacting

bands. (B) 1D Blue-Native (top) and 2D Blue-Native/SDS gels (middle) probed with anti-cCA2 (bottom). Designations of the protein

complexes are given above the gels. (C) A blot of a 15% SDS gel separating total protein extract of E. coli BL21 without IPTG (lane1)

or with 10mM IPTG and 3h induction of cCA2 (lane2), cCAL1 (lane 3), cCAL2 (lane 4) and cCA3 (lane 5) subcloned in pET vector.

These result confirm that only proteins with expected molecular weight are recognized by the antiserum. Molecular weight markers are

shown. CB: Coomasie Blue and WB: western blot.

951

evolutionary origin of these proteins to gain insightabout their probable physiological roles. UsingAt3g48680 as starting sequence, similarity searcheswere performed on EST (Viridiplantae) databases.We found 1249 EST sequences, whose deducedamino acid sequences show the hexapeptide-repeatmotif with different degrees of conservation. Thenon-redundant coding sequences retrieved fromEST searches were supplemented with the proteinsequences from protein–protein searches in such away as to produce an overall non-redundantdataset. Seventy-three sequences were found, all ofthem belong to the LbH fold family.

They were aligned with ClustalW and maxi-mum parsimony analysis was performed. In theFigure 5, the phylogenetic tree obtained showsclearly that relatively similar genes cluster in twomain clades (bootstrap 96%), one containingAtcCAs (A in the figure) and other containingAtcCALs (B in the figure). Sequences in the CladeA contain all catalytically important residues pre-dicted for a cCA in plants (Parisi et al., 2004a).This includes three His residues, essential tocoordinate a Zn ion, and residues Arg 86, Asp 88,Gln 101, Asp 102 and Tyr 207 following AtcCA1

annotation, (Parisi et al., 2004a). Sequences in theclade B only one His is fully conserved, other isreplaced by an Ala residue and the last one isreplaced by an Arg residue. The latter could rep-resent a conservative replacement in binding a Znion (see below) (Ferraroni et al., 2002). Interest-ingly, other important residues are properlyarranged into the putative active site that includesArg 103, Asp 105, Gln 118, Glu 119 (conservativereplacement) and Tyr 231 (following cCAL2annotation).

Whereas cCAs are present in all prokaryotesand photosynthetic eukaryotes (Smith et al., 1999,Parisi et al., 2004a), cCALs are not present inprokaryotes. However, in all plant and green algaeanalyzed, there is at least one representative ofeach clade (Figure 5), indicating that duplicationand divergence of these genes might be occurredbefore or when green algae arose.

AtcCALs could form a CA active site onlyinteracting with cCAs

Deduced amino acid sequences of cCALs fromArabidopsis were subjected to protein modeling

Figure 4. N-terminal domain of AtcCAs is essential for interaction with AtcCALs. The PJ69-4A yeast strain containing the plasmids

listed were grown on liquid culture lacking tryptophan and leucine. Serial dilutions of 105–102 cells were plated on non-selective

medium lacking tryptophan and leucine (�LT) or on selective medium lacking tryptophan, leucine and histidine containing 10mM

3-aminotriozole (�HLT 10mM 3-AT) and b-galactosidase activity was measured. As negative control yeast cells harbouring the

pGal4BD were used for both assays. (A) Left panel: Different N and C-terminal deletions of cCA2 and cCAL2 were expressed in yeast

cells. The effect of the different constructs on growth was monitored. Right panel: b-galactosidase activity in yeast cells harbouring the

same constructs as above. (B) Left panel: Different combination of AtcCAs and AtcCALs were expressed in yeast cells. The effect of

the different constructs on growth was monitored. Right panel: b-galactosidase activity in yeast cells harbouring the same constructs as

above was calculated according to Miller (1992). The graphic was generated with Excel software (Microsoft).

952

using the Modeller 6a program (Sali and Blundell,1993). A structural template, the ferripyochelinbinding protein of Pyrococcus horikoshii Ot3(PhFBP, synonym carbonic anhydrase) was foundwith an E-value of 1.09e�05, using threadingsearches with 3DPSSM server. The 1v67 structureco-crystallized with Zn, -HCO3 and Ca (Iversonet al., 2000; Tripp and Ferry, 2000; Tu et al., 2002)represents a homotrimeric protein where eachsubunit adopts the left-handed b helix fold asCAM (Iverson et al., 2000) and AtcCAs (Parisiet al., 2004a). The deduced structure of the cCALsfits perfectly to PhFBP (as do CAM and AtcCAs,data not shown), with an a-helix protruding fromthe left-handed centre to the C-terminus predictedby using the SOPM (Combet et al., 2000) andPSIRED (McGuffin et al., 2000) servers. As with

CAM, PhFBP and AtcCAs, the AtcCALs se-quences contain six coils separated by loops orturns. The calculated root means square deviation(r.m.s.d.) value between the models and the tem-plate structure is 2.3A indicating a significantsimilarity.

It has been previously suggested that LbHproteins could form stable heterooligomers (Parisiet al., 2004b). Models as heterotrimers with cCAswere built. Three different interfaces could beformed using different combinations of the twodistinct subunits (Figure 6A and B). The firstinterface has been previously described (Parisiet al., 2004a). The second interface comprises theHis 130 of cCAs (red in the figure) and the His 124and Arg 152 (conservative replacement) to bind azinc ion. The putative third interface (Figure 6B)

Figure 5. cCAs and cCALs are present in all plants and green algae analyzed. Maximum parsimony tree inferred for cCAs (clade A)

and cCALs (clade B) from plants and green algae using all the proteins found EST database. All the proteins in clade A contain the His

residues important to bind the Zn atom. The proteins in clade B contain only one of the His mentioned above. Cluster A and B

contains paralogous sequences probably originated early in the evolution of plants. All photosynthetic organisms contain represen-

tative of both gene types. Arabidopsis sequences are highlighted. The support for the node separating both clusters is 96 %. Boostrap

values are indicated by black triangles (60–80%) or black circles (80–100%).

953

comprises two His residues of cCAs (His 107 and135) and the Gln 164 of cCALs. The equivalentposition to His 130 in cCAs is 100substituted byAla (Ala 147) in cCALs. The Gln 164 is conservedin all proteins belonging to B cluster (Figure 5). Asin case of Arg 152 mentioned above, Gln was alsodescribed as a conservative replacement of His invarious carbonic anhydrases to coordinate aputative Zn ligand (Lesburg et al., 1997).

Following the predicted reaction mechanism ofCAM (Iverson et al., 2000; Tripp and Ferry, 2000;Tu et al., 2002; Tripp et al., 2004) and PhFBP,Arg 59, Asp 61, Gln 75 and Asp 76 (CAM resi-dues) are important residues. Asp 76 is replaced byGlu 119 in cCALs which is a conservativereplacement. Thus, all these residues are conservedand properly arranged in the active site cavity of

the models. Alternative amino acids that mightserve as proton transfer residues, Tyr 207 (AtcCAsresidues) and Tyr 159 (PhFBP residues) have beenpostulated (Iverson et al. 2000a; Tripp and Ferry,2000; Tu et al., 2002 Parisi et al., 2004a;). It isinteresting to note that these residues are alsoconserved in AtcCALs (Tyr 231). These results,together with two hybrid analyses, suggest thatheteromers cCA/cCAL could be present possiblyforming a CA complex mainly associated tocomplex I in plants.

Discussion

In this report, two genes coding for LbH proteinsimported into mitochondria have been identified

Figure 6. Putative CA active interfaces in heterotrimers cCA–cCAL. Left panel. Diagram of a heterotrimer. Arrows indicate the

interface presented in the corresponding right panel. Two different interfaces and the main residues involved in the enzyme mechanism

are shown. The ball in the center of the figure represents the Zn atom. Residues Arg 152 and Gln 164 coordinating Zn atom are shown.

cCA subunit is shown in red whereas cCAL subunit is shown in blue. Residues Asp 105, Arg 103, Gln 118 and Glu 119.participating in

the mechanism are also shown.

954

by two hybrid analyses. These proteins interactwith AtcCAs, were found to be tightly associatedmainly to mitochondrial complex I and show highsimilarity in sequence and structure with AtcCAs.

Although AtcCALs lack two essential His res-idues to act as carbonic anhydrase, they couldform putative active interfaces only interactingwith AtcCAs. One of these putative active inter-faces requires that Arg 152 that replaces a Hisresidue could coordinate a Zn ion, a situation thathas been described for variants of human carbonicanhydrase I (Ferraroni et al., 2002). Indeed, oneexception is found in the sequence from Vitisaestivalis where the VacCAL has a His residuereplacing Arg 152, suggesting that His/Argreplacement is conservative. A second putativeactive interface contains the Gln 164, a residuethat has been postulated to coordinate Zn ions(Lesburg et al., 1997; McCall and Fierke, 2004). Inmonocotyledoneous plants some cCAs present aGln residue at the position of a conserved His(Parisi et al., 2004a and this work].

Whereas cCA proteins are able to form ho-modimers, interaction between AtcCAL andAtcCA proteins is stronger than between cCAproteins themselves. Two-hybrid screens using thecCA2 protein neither identified complex I subunitsnor cCAs. This could be interpreted in favour of acCA/cCAL complex, which could exist indepen-dently and peripherally associated with complex I,which is supported by some Western Blotting re-sults (Figure 3 and data not shown). Alternatively,interaction of cCA/cCAL could be required priorto association with complex I and thus, none ofcomplex I subunit was detected in the two hybridscreen. The association to other respiratory com-plexes remains unclear. Recently, Millar et al.(2004) using mass spectrometry failed to identifythe proteins described in this report in complex IV.An alternative interpretation is that presence ofcCA/cCAL proteins in regions corresponding tosmaller protein complexes rather reflects artificialaggregation due to digitonin solubilization and/orpartial degradation of complex I into subcom-plexes. Further work is required to solve thispoint. Further evidence, that AtcCA/cCAL do notonly co-migrate with complex I on 2D BN/SDSgels, but indeed could be considered to physicallyinteract with this complex, came from olderinvestigations, which reported chromatographicalpreparations of complex I from other plants and

subunit identification by N-terminal proteinsequencing (Leterme and Boutry, 1993; Herzet al., 1994). Thus, using completely differentprocedures to purify complex I, several proteins,having significant sequence similarity to Arabid-opsis cCA and cCAL, have been identified. Pre-liminary experiments using sucrose gradientseparation of digitonin treated mitochondrialcomplexes and western blotting with anti-cCA2,show very similar results to 2D BN/SDS gels(Perales, M., Eubel, H. and Braun H-P., unpub-lished results). Physiological function of thesenovel proteins associated to complex I is, so far,unclear. Recombinant AtcCAL proteins producedin E. coli showed no carbonic anhydrase activity.This situation was also found for AtcCAs (Parisiet al., 2004a). Thus, it is tempting to postulate thata proper CA activity of these proteins may requireheteromeric organization and/or association withrespiratory complex I.

The presence of homologous ESTs of cCA andcCAL mitochondrial proteins in all plants andgreen algae analyzed so far, indicate that bothprotein types have been conserved throughout theevolution. In consequence, both might be requiredfor proper mitochondrial function during plantgrowth and development. Thus, cCALs may rep-resent an ancient divergence event from the uniqueprokaryotic cCA after eukaryotic green algaearose. In contemporary plants, both kinds ofproteins show strong interactions associated withthe same intramitochondrial complex.

The results obtained in yeast suggest that atleast two cCAs and two novel cCALs may interactto form heterodimers, or even more complexstructures. This is in good agreement with theresults obtained in planta that clearly indicate thatthese proteins have the same suborganellar locali-zation, mainly in the respiratory complex I. Ourresults constitute a strong argument to support theidea that interaction between these proteins couldeffectively occur in vivo.

The fact that cCALs interact with cCAs and allare associated to complex I raised some interestingquestions about their physiological role. Associa-tion of CAs with chloroplastic NAD(P)H dehy-drogenases has been postulated to function aslocal pH regulators (Maeda et al., 2002) necessaryfor proper electron flux between PSI and quinones.Based on this observation, it is tempting to pos-tulate that a complex cCA/cCAL functions, in

955

association with complex I and probably super-complexes, to regulate the differential pH causedby proton efflux. As suggested recently, the actualmetal ligand of cCAs would be Fe2þ instead Zn2þ

(Tripp et al., 2004), thus these carbonic anhydraselike proteins associated with mitochondrial com-plex I could link the respiratory chain functionwith a CA activity. Based on two hybrid results,we postulate that the holoenzyme could be formedin vivo with two or three different monomers. Ifthis is the case, it could imply that plant cCAsmight be more complex than prokaryotic ones. Itis interesting to note that since AtcCA andAtcCAL proteins are able to interact themselvesand they are detected at the migration positions oflower molecular weight complexes in BN 2D gel,the existence of minor amounts of free CA com-plexes, besides a high percentage associated tocomplex I, can not be ruled out. The free formsmay represent the CA multimers precursor to theirassociation with complex I or may play otherphysiological roles in mitochondria.

cCA1 and cCA2 were found associated withcomplex I (Haezlewood et al., 2003, Braun, H-P.unpublished results). The strong signal detected at28–30 kDa region corresponds to more than oneprotein, which could be interpreted as severalisoforms of putative cCAs (Figure 3A, B and datanot shown). Whereas cCALs are constitutivelyexpressed in all tissue analyzed, cCAs show a 10-fold induction in the flowers (Perales et al.,unpublished results). This suggests that subunitcomposition of this putative CA complex associ-ated with complex I may vary between differenttissues. Differences in potato complex IV compo-sition depending on tissue analyzed have beenobserved previously (Eubel et al., 2004).

In conclusion, two novel LbH proteins havebeen identified in Arabidopsis (AtcCALs) thatinteract with AtcCA proteins forming putativeactive interfaces. All of them mainly occur asso-ciated with respiratory complex I. We postulate aCA complex consisting of AtcCA and AtcCALproteins that might be important for complex Iactivity in plants.

Acknowledgments

We would like to thank Dr. Jorg Kudla forhelps in performing two hybrid screens and

Mr. Jose Luis Burgos (CIC, Argentina) for excel-lent technical assistance. This work was supportedin part by ANPCyT (05008, 09538 and 0111265)(Argentina), Fundacion Antorchas-DAAD (Ger-many-Argentina), ECOS-Sud, (A00B01) (France-Argentina), Universidad Nacional de Quilmes,Third World Academy of Sciences, FundacionAntorchas and the DFG (grant BR 1829-7/1). EJ,ZE and GCD are members of the NationalResearch Council (CONICET). PM (ANPCyT,Argentina) and CA (CONICET, Argentina) aredoctoral fellows and this work is part of theirdoctoral theses.

Gene bank accession numbers: AB007649(At5g63510) and AL133315 (At3g48680)

References

Alber, B.E. and Ferry, J.G. 1994. A carbonic anhydrase fromthe archaeon Methanosarcina thermophila. Proc. Natl. Acad.Sci. USA 91: 6909–6913.

Badger, M.R. and Price, G.D. 2003. CO2 concentratingmechanisms in cyanobacteria: molecular components, theirdiversity and evolution. J. Exp. Bot. 54: 609–622.

Busi, M.V., Bustamante, C., D’Angelo, M.C., Hidalgo-Cuevas, M.,Boggio, M., Valle, E. and Zabaleta E. 2003. MADS boxexpressed during tomato seed and fruit development. PlantMol. Biol. 54: 801–815.

Combet, C., Blanchet, C., Geourjon, C. and Deleage, G. 2000.NPS@: network protein sequence analysis.Trends Biochem.Sci. 25: 147–150.

Cuff, J.A., Birney, E., Clamp, M. and Barton, G. 2000.ProtEST: protein multiple sequence alignments fromexpressed sequence tags. Bioinformatics 16: 111–116.

Eubel, H., Jansch, L. and Braun, H.-P. 2003. New Insights intothe respiratory chain of plant mitochondria. Supercomplexesand a unique composition of complex II. Plant Physiol. 133:274–286.

Eubel, H., Heinemeyer, J. and Braun, H.-P. 2004. Identificationand characterization of respirosome in potato mitochondria.Plant Physiol. 134: 1450–1459.

Felsenstein, J. 1993. PHYLIP (Phylogeny Inference Package)version 3.5c. Distributed by the author. Department ofGenetics, Univ. of Washington, Seatle.

Ferraroni, M., Tilli, S., Briganti, F., Chegwidden, W., Supuran,C., Wiebauer, K., Tashian, R. and Scozzafava, A. 2002.Crystal structure of a zinc-activated variant of humancarbonic anhydrase I, CA I Michigan 1: evidence for asecond zinc binding site involving arginine coordination.Biochemistry 41: 6237–6244.

Gietz, D., St Jean, A., Woods, A. and Schiesti, R. 1992.Improved method for high efficiency transformation ofintact yeast cells. Nucl. Acids Res. 20: 1425.

Heazlewood, J.L., Howell, K. and Millar, A.H. 2003. Mito-chondrial complex I from Arabidopsis and rice: orthologs ofmammalian and fungal components coupled with plantspec-ific subunits. Biochim. Biophys. Acta 1604: 159–169.

Herz, U., Schroder, W., Liddell, A., Leaver, C.J., Brennicke, A.and Grohmann, L. 1994. Purification of the NADH:-

956

ubiquinone oxidoreductase (complex I) of the respiratorychain from the inner mitochondrial membrane of Solanumtuberosum. J. Biol. Chem. 269: 2263–2269.

Hewett-Emmett, D. and Tashian, R.E. 1996. Functionaldiversity, conservation, and convergence in the evolution ofthe alpha-, beta-, and gamma-carbonic anhydrase genefamilies. Mol. Phylogenet. Evol. 5: 50–77.

Hewett-Emmett, D. 2000. Evolution and distribution of thecarbonic anhydrase gene families. In:W.R.Chegwidden,N.D.Carter and Y.H. Edwards (Eds.), The Carbonic Anhdyrases.New Horizons, Birkh€auser Verlag, Basel, pp. 29–76.

Iverson, T.M., Alber, B.E., Kisker, C., Ferry, J.G. and Rees,D.C. 2000. A closer look at the active site of gamma-classcarbonic anhydrases: high-resolution crystallographic stud-ies of the carbonic anhydrase from methanosarcina thermo-phila. Biochemistry 39: 9222–9231.

Kelley, L.A., MacCallum, R.M. and Sternberg, M.J. 2000.Enhanced genome annotation using structural profiles in theprogram 3D-PSSM. J. Mol. Biol. 299: 499–520.

Kisker, C., Schindelin, H., Alber, B.E., Ferry, J.G. and Rees,D.C. 1996. A left-hand beta-helix revealed by the crystalstructure of a carbonic anhydrase from the archaeonMethanosarcina thermophila. EMBO J. 15: 2323–2330.

Kruft, V., Eubel, H., Jansch, L., Werhahn, W. and Braun, H-P.2001. Proteomic approach to identify novel mitochondrialproteins in Arabidopsis. Plant Physiol. 127: 1694–1710.

Lesburg, C.A., Huang, C.C., Christianson, D. and Fierke, C.A.1997. Histidine carboxamide ligand substitutions in the zincbinding site of carbonic anhydrase Ii alter metal coordina-tion geometry but retain catalytic activity. Biochemistry 36:15780–15791.

Leterme, S. and Boutry, M. 1993. Purification and preliminarycharacterization of mitochondrial complex I (NADH: ubi-quinone reductase) from broad bean (Vicia faba L.). PlantPhysiol.102: 435–443.

Maeda, S., Badger, M.R. and Price, G.D. 2002. Novel geneproducts associated with NdhD3/D4-containing NDH-1complexes are involved in photosynthetic CO2 hydration inthe cyanobacterium, Synechococcus sp. PCC7942. Mol.Microbiol. 43: 425–435.

Merlin, C., Masters, M., McAteer, S. and Coulson, A. 2003Why is carbonic anhydrase essential to Escherichia coli ?J. Bacteriol. 185: 6415–6424.

Millar, A.H., Eubel, H., Jansch, L., Kruft, V., Heazlewood,J.L. and Braun, H.P. 2004. Mitochondrial cytochrome coxidase and succinate dehydrogenase complexes containplant specific subunits. Plant Mol. Biol. (in press)

McCall, K. and Fierke, C, 2004. Probing determinants of themetal ion selectivity in carbonic anhydrase using mutagen-esis. Biochemistry 43: 3979–3986.

McGuffin, L.J., Bryson, K. and Jones, D.T. 2000. ThePSIPRED protein structure prediction server. Bioinformat-ics 16: 404–405.

Parisi, G., Fornasari, M. and Echave, J. 2000. Evolutionaryanalysis of gamma-carbonic anhydrase structurally relatedproteins. Mol. Phylogene. Evol. 14: 323–334.

Parisi, G., Perales, M., Fornasari, M.S., Colaneri, A.,Gonz�alez-Shain, N., G�omez-Casati, D., Zimmermann, S.,Brennicke, A., Araya, A., Ferry, J.G., Echave, J. andZabaleta, E. 2004a. Gamma Carbonic Anhydrases in PlantMitochondria. Plant Mol. Biol. (In press).

Parisi, G. Fornasari, M.S. and Echave, J. 2004b. Dynactins p25and p27 are predicted to adopt the LbH fold FEBS lett. (Inpress).

Price, G.D., Hewit, S.M., Harrison, K. and Badger, M.R. 1993.Analysis of genomic DNA region from the cyanobacteriaSynechococcus sp strain PCC7942 involved in carboxysomeassembly and function. J. Bacteriol. 175: 2871–2879.

Raetz, C.R. and Roderick, S.L. 1995. A left-handed parallelbeta helix in the structure of UDP-N-acetylglucosamineacyltransferase. Science 270: 997–1000.

Sali, A. and Blundell, T.L. 1993. Comparative protein modelingby satisfaction of spatial restraints. J. Mol. Biol. 234: 779–815.

Sambrook, J. and Russell, D. 2001. Molecular Cloning, aLaboratory Manual. 3rd edn. Cold Spring Harbor Labora-tory Press. New York.

Schagger H 2001. Blue-native gels to isolate protein complexesfrom mitochondria. Meth. Cell Biol. 65: 231–244.

Schagger H, Pfeiffer K 2000. The ratio of oxidative phosphor-ylation complexes I-V in bovine heart mitochondria and thecomposition of respiratory chain supercomplexes EMBO J.19: 1777–1783.

Smith, K., Jakubzick, S.C., Whittam, T.S. and Ferry, J.G. 1999.Carbonic anhydrase is an ancient enzyme widespread inprokaryotes. Proc. Natl. Acad. Sci. USA 96: 15184–15189.

Thompson, J.D., Gibson, T.D., Plewniak, F. Jeanmougin, F.,and Higgins, D.G. 1997. The CLUSTALX windowsinterface: flexible strategies for multiple sequence align-ment aided by quality analysis tools. Nucl. Acids Res. 25:4876–4882.

Tripp, B. C. and Ferry, J.G. 2000. A Structure-Function Studyof a proton transport pathway in the gamma-class carbonicanhydrase from methanosarcina thermophila. Biochemistry39: 9232–9240.

Tripp, B., Bell, C., Cruz, F., Krebs, C. and Ferry, J.G. 2004. Arole for iron in an ancient carbonic anhydrase. J. Biol. Chem.279: 6683–6687.

Tu, C. K., Rowlett, R., Tripp, B.C., Ferry, J.G. and Silverman,D.N. 2002. Chemical rescue of proton transfer in catalysis bycarbonic anhydrases in the beta- and gamma-class. Bio-chemistry 41: 15429–15435.

Vaara, M. 1992. Eight bacterial proteins, including UDP-N-acetylglucosamine acyltransferase (LpxA) and three othertransferases of Escherichia coli, consist of a six-residueperiodicity theme. FEMS Microbiol. Lett. 76: 249–254.

957