Fsr quorum sensing system and cognate Gelatinase orchestrate the expression and processing of...

Fsr quorum sensing system and cognate Gelatinase orchestrate the expression and 1

processing of pro-protein EF1097 into mature antimicrobial peptide enterocin O16 2

Halil Dundara, Dag A. Bredeb, *, Sabina Leanti La Rosab, Ahmed Osama El-Gendyc, Dzung 3

B. Diepb and Ingolf F. Nesb, #. 4

5

Department of Biotechnology, Middle East Technical University, Ankara, Turkeya; 6

Department of Chemistry, Biotechnology and Food Science, Norwegian University of Life 7

Sciences, Ås, Norwayb; Department of Microbiology and Immunology, Faculty of Pharmacy, 8

Beni-Suef University, Egyptc. 9

10

Running title: E. faecalis fsr-regulated bacteriocin Enterocin O16 production 11

12

#Address correspondence to Ingolf F. Nes, [email protected] 13

*Present address: Centre for Environmental Radioactivity, CERAD, Department of 14

Environmental Sciences, Norwegian University of Life Sciences, Ås, Norway. 15

H.D. and D.A.B. contributed equally to this work. 16

17

Key words: E. faecalis, bacteriocin, ef1097, quorum sensing, Fsr regulon 18

JB Accepted Manuscript Posted Online 2 March 2015J. Bacteriol. doi:10.1128/JB.02513-14Copyright © 2015, American Society for Microbiology. All Rights Reserved.

2

Abstract. A novel antimicrobial peptide designated enterocin O16 was purified from 19

Enterococcus faecalis. Mass spectrometry showed a monoisotopic mass of 7231 Da, and N-20

terminal Edman degradation identified a 29-amino-acid sequence corresponding to residues 21

90-119 of the EF1097 protein. Bioinformatics analysis showed that enterocin O16 is 22

comprised of the 68 C-terminal most residues of the EF1097 protein. Introduction of an in-23

frame isogenic deletion in the ef1097 gene abolished production of enterocin O16. Enterocin 24

O16 has a narrow inhibitory spectrum as it inhibits mostly lactobacilli. Apparently E. faecalis 25

are intrinsically resistant to the antimicrobial peptide, as no immunity could be identified 26

connected to production of enterocin O16. ef1097 has previously been identified as one of 27

three loci regulated by the fsr quorum sensing system. Consistently, introduction of a 28

nonsense mutation in fsrB impaired enterocin O16 production, but externally added GBAP 29

(gelatinase biosynthesis-activating pheromone) restored the antimicrobial activity. Functional 30

genetic analysis showed that the EF1097 pro-protein is processed extracellularly into 31

enterocin O16 by the metallo protease GelE. Thus, it is evident that the fsr quorum sensing 32

system constitutes the regulatory unit that controls the expression of the EF1097 precursor 33

protein and the protease GelE, the latter being required for the formation of enterocin O16. 34

Based on these results, this study identifies antibacterial antagonism as a novel aspect related 35

to the function of fsr, and provides a rationale why ef1097 is part of the fsr regulon. 36

37

Importance. The fsr quorum sensing system modulates important physiological functions in 38

E. faecalis via the activity of GelE. The present study presents a new facet of the fsr signaling. 39

The system controls expression of three primary target operons (fsrABCD, gelEsprE and 40

ef1097ab). We demonstrate that the concerted expression of these operons constitutes the 41

elements necessary for production of a bacteriocin type peptide, and that antimicrobial 42

antagonism is an intrinsic function of fsr. The bacteriocin enterocin O16 consists of the 68 C-43

3

terminal most residues of the EF1097 secreted pro-protein. The GelE protease processes the 44

EF1097 pro-protein into enterocin O16. In this manner fsr-signalling enables E. faecalis 45

populations to express antimicrobial activity in a cell-density dependent manner. 46

4

Introduction 47

Enterococci are among the most common commensal lactic acid bacteria (LAB) in the 48

gastrointestinal (GI) tract of humans and animals. Throughout our lives we receive frequent 49

supplies of enterococci, especially from fermented foods (dairy, meat and vegetable based). 50

While some enterococci seem to establish as part of the GI microbiota, most enterococcal 51

strains only transiently inhabit the GI system. Enterococci are also a prominent etiological 52

agent of nosocomial infections (1). The increasing incidence of multiple antibiotics resistant 53

nosocomial isolates makes treatment of infections by E. faecalis and E. faecium particularly 54

challenging. There is therefore an urgent need for novel source of antimicrobial agents to deal 55

with these multi-antibiotic resistant pathogens (2, 3). 56

Antimicrobial peptides are produced by most organisms in all tree domains of life 57

(prokaryotes, archeaea and eukaryotes) and in bacteria they are often referred to as 58

bacteriocins (4). Bacteriocins are found in both gram-positive and gram-negative bacteria and 59

they together constitute a large and diverse group of antimicrobial peptides and proteins. 60

Within the gram-positive bacteria, particularly lactic acid bacteria (LAB), bacteriocins are 61

found abundantly and have been extensively studied with respect to structure, diversity, mode 62

of action, production and target specificity (5). Bacteriocins have been divided into three 63

classes: Class I) the lantibiotics which are small and heavily modified peptides containing 64

lanthionine residues; Class II) the non-modified bacteriocins which are small non-modified 65

peptides or peptides with minor modifications (such as sulphide bridges); and Class III) the 66

lytic and relatively large proteins (6). Enterococci have been shown to produce bacteriocins of 67

all three classes (7, 8). 68

The fsr quorum sensing system, which is an important global regulator of gene expression in 69

E. faecalis, is comprised of 4 genes (fsrABCD) responsible for the extracellular accumulation 70

of the gelatinase biosynthesis-activating pheromone (GBAP), encoded by fsrD (9, 10). The 71

5

precursor FsrD is processed into the mature GBAP by FsrB and released extracellularly. 72

Accumulated GBAP is recognized by the sensor histidine kinase FsrC, which in turn activates 73

the response regulator FsrA by phosphorylation. FsrA acts as transcription factor up-74

regulating the expression of three primary target loci (fsrBCD, gelE-sprE operons and ef1097) 75

(11). The fsr regulatory system thus controls the expression of the GelE and SprE proteases, 76

which are implicated in several aspects of E. faecalis physiology including protein turnover, 77

biofilm formation, and virulence (12-14). The last gene, ef1097, which constitutes part of the 78

E. faecalis core genome, is physically located 800 kb apart from the other fsr-controlled loci, 79

and it is a member of a gene family encoding antimicrobial proteins (15). 80

In the current work we present a functional analysis of the ef1097 gene product of E. faecalis, 81

and elucidate the molecular mechanism showing that the fsr system coordinates both 82

expression and maturation of a novel type of antimicrobial peptide. 83

6

MATERIALS AND METHODS 84

Bacterial strains and growth conditions Bacterial strains and growth conditions used in this 85

study are listed in Table 1. 86

Bacteriocin assay. Bacteriocin activity was evaluated by microtiter plate assay. Two-fold 87

serial dilutions at volumes of 50 μl were added with 150 μl of a dilited indicator strain (over-88

night culture diluted 100 fold in growth medium) and incubated at 30 oC for 12 h. Growth 89

inhibition was measured at 620 nm by a microtiter plate reader reader (Multiscan Ascent; 90

Labsystems, Helsinki, Finland). One bacteriocin unit (BU) was defined as the minimum 91

amount of bacteriocin that inhibits the growth of the indicator strain by 50% in a 200 μl 92

culture. Lactobacillus sakei LMGT 2313 was routinely used as indicator strain. Other strains 93

used for defining inhibition spectrum and their growth conditions are listed in Table 1. Agar 94

overlay bacteriocin and spot on a lawn assays were performed as previous published (16, 17). 95

For storage, all strains were maintained at -80oC in appropriate media containing 25 % (v/v) 96

glycerol and sub-cultured on fresh medium before use. 97

Bacteriocin purification. One liter of de Man-Rogosa-Sharpe (MRS) broth (Merck) was 98

inoculated with an overnight culture of E. faecalis strain O16 (0.1% v/v) and propagated for 99

12 h with an initial pH of 6.5 at 30oC. After centrifugation, culture supernatant was filtered 100

and stored at 4oC. The bacteriocin activity was purified by a three-step purification protocol 101

including Amberlite XAD16 chromatography, reverse-phase chromatography on RPC 1 ml 102

column and two consecutive reverse phase chromatography steps by Sephacil Peptide C8 5 103

µm ST 4.6/250 column. Twenty gram of Amberlite XAD-16 was added to the bacteriocin 104

containing supernatant and this mixture was stirred gently for 60 min. The supernatant was 105

removed and the sedimented gel slurry was loaded on a 2 x 20 cm column. The matrix was 106

washed with 300 ml of distilled water and next with 200 ml of 40% (v/v) ethanol in distilled 107

water. Bacteriocin was eluted with 100 ml of 70% (v/v) 2-propanol in distilled water with 108

7

0.1% TFA (v/v). 25 ml of this bacteriocin preparation was diluted to 250 ml using distilled 109

water with 0.1% TFA (v/v) and applied to Resource 15 RPC 1 ml reverse-phase column 110

equilibrated with 0.1% trifluoracetic acid (TFA) in distilled water. Bacteriocin containing 111

sample was eluted with a 27-column volume (CV) linear gradient of 40 to 60% 2-propanol 112

with 0.1% TFA at a flow rate of 1 ml/min using Äkta purifier and 1 ml fractions were 113

collected. The five fractions with the most activity (fractions 8, 9, 10, 11 and 12) were 114

combined and diluted in distilled water to 50 ml. The reverse-phase chromatography using 115

Resource RPC 1 ml column was applied for the remaining bacteriocin solution (75 ml) eluted 116

from Amberlite XAD-16 matrix with 25 ml sample applied on each run again. 117

The most active fractions from first reverse-phase chromatography (fractions 8, 9,10, 11 and 118

12) were combined and diluted 10 times with distilled water with 0.1% TFA. This combined 119

mixture was applied to Sephacil Peptide C8 5 µm ST 4.6/250 column (Amersham 120

Biosciences). Elution was carried out with a 10 CV linear gradient from 25 to 45% 2-propanol 121

in 0.1% TFA in 1 ml fractions. The most active fractions (fractions 30, 31, 32, 33 and 34) 122

were combined and diluted 10 times with distilled water with 0.1% TFA. The sample was 123

applied on a Sephacil Peptide C8 5 µm ST 4.6/250 column. Elution was carried out with a 10 124

CV linear gradient from 25 to 45% 2-propanol in 0.1% TFA in 1 ml fractions. The most 125

active fraction (fraction 20) coincided with a single peak of absorbance at 280 nm. 126

The purified bacteriocin was stored at -20oC for mass spectrometry and N-terminal amino 127

acid sequencing analysis. 128

Genomic DNA isolation and PCR. Three-five ml of overnight culture of E. faecalis O16 129

was pelleted and resuspended in 250 µl cold Solution I (Omega Bio-Tek, USA). The 130

suspension was transferred to FastPrep tube with 0.5 g glass beads (<106 nm) and lyzed in 131

FastPrep FP120 instrument (20 sec, 4m/s). After spin down of the FastPrep tube, the 132

8

supernatant was transferred to a new Eppendorf tube. The remaining steps are identical to the 133

Miniprep protocol (Omega Bio-Tek, USA). 134

The extracted DNA was dissolved in sterile distilled water. PCR was performed on genomic 135

DNA of Enterococcus faecalis strain O16 to amplify and confirm the presence of the gene 136

coding for the bacteriocin. The PCR mixture (50 µl) included 100-200 ng of template DNA, 137

10 µl (5x Phusion High Fidelity) buffer, 1 µl (10 mM dNTPs), 2.5 µl (10 µM) of each primer 138

and 0.5 µl of Phusion DNA polymerase. The gene encoding the bacteriocin structural gene 139

and flanking regions was amplified from Enterococcus faecalis strain O16 using the primer 140

pair O16-forw/O16-rev (Table 4). 141

The amplification conditions consisted of an initial step at 95°C for 4 min followed by 32 142

cycles where denaturation occurred at 95°C for 15 sec, annealing at 54°C for 30 sec and 143

extension at 72°C for 45 sec, followed by a final extension step of 72°C for 10 min. The 144

product purification and sequencing was carried out by using the BigDye Terminator v3.1 145

Cycle Sequencing Kit. 146

Multi locus sequence typing (MLST). Allelic profile or sequence type (ST) was determined 147

in accordance with E. faecalis MLST database (http://efaecalis.mlst.net/) as described in (18). 148

Clonality of obtained ST amongst all E. faecalis STs included in the MLST database was 149

evaluated using eBurst v3 program (http://efaecalis.mlst.net/eburst/database.asp). 150

Measurement of gelatinase activity. The gelatinase activity was tested by spotting the 151

strains on Todd Hewitt agar supplemented with 3% gelatin as substrate. Todd Hewitt agar 152

plates were incubated at 37oC for 24 h, and left at 4oC for 5 h. Formation of turbid zones 153

around the colonies were examined as the indication of gelatinase activity. 154

Haemolytic activity. The haemolytic activity of E. faecalis strains was determined on Brain 155

Heart Infusion (BHI) agar supplemented with 1% (w/w) glucose, 0.03% (w/w) L-arginine and 156

9

5% (v/v) defibrinated horse blood. Strains were spotted on the agar and incubated at 37oC for 157

24 hours. 158

Construction of isogenic ef1097 deletion mutants, and testing of bacteriocin production 159

and immunity. 160

Isogenic ef1097 deletion mutants in E. faecalis V583 and V583ΔgelE were constructed using 161

the conditional suicide vector pLT06 as described in Thurlow et al. (19). Two 0.8 Kb 162

fragments were amplified from V583 genome using the primer pairs EF1097f1-r1/EF1097bf-r 163

and EF1097f2-r2/EF1098f1-r1, respectively (Table 4). The two resulting 1.6 Kb PCR-SOE 164

fused fragments were cloned into the EcoRI-BamHI site of pLT06. The resulting plasmids 165

pEf1097 and pEf1097b were propagated in E. coli EC1000 at the plasmid permissive 166

temperature of 30°C (20). Vector pEf1097 and pEf1097b were introduced in E. faecalis V583 167

and V583ΔgelE by electroporation. Plasmid chromosomal integration by single cross-over 168

was selected by culturing the transformants in Todd Hewitt broth (THB) supplemented with 169

20 µg/ml of chloramphenicol for 2.5 hours at 30°C followed by additional incubation at 2.5 170

hours at the non-permissive temperature of 42°C. The second recombination event was 171

obtained by sub-culturing for two days in THB with no selection at 30°C. Potential deletion 172

mutants were identified as white colonies on M9YEG plates supplemented with 10 mM p-173

chloro phenylalanine and x-gal. PCR screening and sequencing with primers 174

EF1097f1/EF1098r1 was used to confirm the deletion. Plasmid pEf1097 was also employed 175

to delete the gene ef1097 in the E. faecalis ΔgelE background (21). Antimicrobial peptide 176

production and sensitivity phenotypes were assayed using agar overlay assay as described 177

above. 178

RESULTS 179

Determination of bacteriocin production and inhibitory spectrum by Enterococcus 180

faecalis O16. E. faecalis O16 is a strain isolated from Egyptian food commodity in 2008. We 181

10

found that this strain was a ST116, thus not a member of any clonal complex 182

(http://efaecalis.mlst.net/eburst/database.asp). The strain displayed a gelatinase positive 183

phenotype, but was not hemolytic. Its antimicrobial activity was evaluated against a number 184

of gram-positive bacteria using spot-on-the lawn method (Table 1). The strain produced 185

antimicrobial/inhibitory activity against only a few lactobacilli. In particular, growth of L. 186

sakei LMG 2313 and Lactobacillus plantarum LMG 2003 was strongly inhibited, while none 187

of the tested E. faecalis, E. faecium, Staphylococcus aureus or Listeria monocytogenes strains 188

was affected. 189

Purification and characterization of an antimicrobial peptide from E. faecalis O16. An 190

antimicrobial peptide was purified from the E. faecalis strain O16 as described in the 191

Materials and Methods section. The last step of purification showed that the homogenous 192

peak of antimicrobial activity corresponded to a peak of absorbance at 280 nm (Fig. 1A). 193

The purified bacteriocin was subjected to MS analysis and a compound of 7231.6 Da was 194

identified (Figure 1B). N-terminal Edman degradation identified a sequence of 30 amino acid 195

residues of which only one amino acid residue (position 4) was not identifiable. BLAST 196

analysis of the peptide fragment perfectly matched with part of the EF1097 in E. faecalis 197

V583. EF1097 is annotated as a 191 amino acid residue-peptide. The analysis recognized the 198

unknown amino acid in position 4 (Figure 2) to be a cysteine residue. It is well known that 199

standard Edman peptide sequencing is not able to identify cysteine residues. 200

The theoretical calculated molecular weight (7215.0 Da) of the 68 amino acid residues C-201

terminal fragment of EF1097 (Figure 2B, position 124-191) is consistent with the observed 202

mass (7231.6 Da) of the purified peptide if we assume an oxidized methionine residue in 203

position 139, which is commonly observed in purified peptides (22). The second peak 204

(7175.9) might be a modified form of bacteriocin since no other sequence was obtained from 205

the Edman degradation. 206

11

The bacteriocin activity is hereafter referred to as O16. 207

Antimicrobial activity of purified enterocin O16. In order to confirm that the antimicrobial 208

spectrum of the enterocin O16 was consistent with results from the initial testing presented in 209

Table 1, the antibacterial spectrum of the purified peptide was examined with the same 210

indicators by using the quantitative microtiter plate assay. As expected, lactobacilli were most 211

susceptible to enterocin O16 (see Table 2) while cells of enterococci, staphylococci and 212

listeria were not (data not shown). L. sakei LMG 2313 was by far the most sensitive to 213

enterocin O16 than any of the other lactobacilli tested, but they all gave MIC values in the 214

range of 0.5 to 500 ng/ml. 215

Functional genetic analysis reveals that E. faecalis is intrinsically insensitive to ef1097 216

encoded enterocin O16. In order to investigate the genetic basis of enterocin O16 217

biosynthesis, both bioinformatics and functional genetic analyses were performed. EF1097 is 218

member of a family of antimicrobial proteins (15). The ef1097 locus (Fig. 2A) is conserved in 219

E. faecalis, and is comprised of two genes named ef1097 and ef1097b. The ef1097 of E. 220

faecalis V583 has been annotated to encode a 170 amino acid protein, however, in other 221

automated genome annotations of E. faecalis strains, ef1097 orthologs have been annotated 222

differently with respect to the coding region varying between 155 and 191 amino acid 223

residues. This discrepancy in peptide length is due to the proposal of different starting points 224

of the coding region. DNA sequencing of the ef1097 locus of E. faecalis O16 revealed no 225

major differences in the promoter region or in the putative translated product compared to the 226

ef1097 sequences of other E. faecalis strains (data not shown). Sequence analyses identified 227

two imperfect direct repeats with identity to the sequences found in the fsr regulated 228

promoters (11). Putative -10 and -35 sequences were identified as well as transcription start 229

and ribosomal binding site were identified (Fig 2). 230

12

Next, a functional genetic approach was employed to establish the genetic basis for the 231

antimicrobial activity. We constructed an isogenic ef1097 deletion mutant in V583, which 232

abolished the antimicrobial activity towards L. sakei, thus verifying that this gene is required 233

for production of enterocin O16 (Fig. 3). 234

To search for the genetic determinant involved in self-immunity against enterocin O16, 235

different relevant genes were evaluated. In general, most bacteriocin-associated genetic loci 236

usually contain genes that encode immunity factors conferring producer self-protection. The 237

bacteriocin and its dedicated immunity system are usually genetically organized in one operon 238

structure (23). In the analogous bacteriocin system of Streptococcus dysgalcticus, the dysI 239

gene is co-transcribed with the dysA and confers immunity towards dysgalacticin (24). A 240

TblastN search revealed no similarity of DysI to genes in E. faecalis. However, a small orf 241

(termed orf1097b) is located directly downstream of ef1097 (Fig. 2). This orf 1097b is 242

putatively translationally coupled with ef1097 and is conserved in all E. faecalis, although 243

some sequence variation exists at the amino acid level. In order to investigate the putative 244

immunity role of orf1097b, deletion mutants were devised in V583, and subsequently tested 245

for sensitivity to enterocin O16. The mutant still produced the antimicrobial activity, and no 246

changes in the susceptibility to enterocin O16 were observed. 247

The GelE proteinase has previously been shown to function as an immunity or protective 248

factor for the pediocin-familiy bacteriocin producer MC4-1 (25). We thus constructed an 249

isogenic in frame deletion of gelE in V583. The resulting strain, V583ΔgelE, was insensitive 250

to enterocin O16. 251

In a further attempt to elucidate any other immunity mechanisms, we reasoned that another 252

gene under direct or indirect regulation by fsr could be involved. To test this hypothesis we 253

assessed whether a V583 mutated in fsrB (aka E. faecalis V583fsrB*; Leanti La Rosa, S, 254

Snipen, LG, Murray BE, Willems, RJL, Gilmore, MS, Diep, DB, Nes, IF, Brede, DA, 255

13

submitted), and thus deficient in the fsr regulatory circuit, would be sensitive. No inhibition 256

was observed showing that tolerance to enterocin O16 was not related to the regulatory fsr 257

system. It has previously been reported that a collection of E. faecalis strains were highly 258

sensitive to a EF1097 derived protein of the 12 kDa protein (136 amino acid residues) 259

obtained by heterologous expression in E. coli (26). We therefore tested sensitivity of 22 260

genome sequenced E. faecalis to enterocin O16, but no growth inhibition was seen (Table 1). 261

Enterocin O16 antimicrobial activity of genome sequenced E. faecalis strains is 262

correlated to intact fsr system and gelatinase production. Since the ef1097 gene is part of 263

the core-genome of E. faecalis, 22 genome-sequenced E. faecalis strains were tested for 264

antimicrobial against L. sakei LMG2123 (Table 3). Among the strains tested, 13 did show 265

antimicrobial activity against the indicator strain. Analysis of the ef1097 DNA sequences 266

(including the promoter region) revealed that only Merz96 had one nucleotide substitution 267

that could explain absence of antimicrobial activity; this mutation produces a 5’ truncation of 268

the ef1097 thereby employing an alternate translation initiation. Since the ef1097 gene 269

subjected to the fsr regulatory system (11, 27), the genomes were investigated with respect to 270

integrity of the fsrABCD genes and gelatinase production. It was evident that all bacteriocin 271

positive strains except X98 inherited intact fsr regulatory system and produced gelatinase. 272

X98 is a known producer of the hemolytic toxin, cytolysin, which also is a potent bacteriocin 273

(28, 29). In order to confirm the involvement of the fsr regulatory system in production of 274

enterocin O16, the V583 fsrB* mutant was investigated for the ability to produce enterocin 275

O16 type antimicrobial activity. The fsrB* mutant is defective in GBAP production, but is 276

still able to recognize externally added GBAP, and capable to modulate transcription of fsr 277

controlled genes. As expected the fsrB* mutant showed no antimicrobial activity. Moreover, 278

by addition of externally cell-free culture supernatant from the GBAP producing V583 279

Δef1097ΔgelE double mutant, it was possible to restore antimicrobial activity of the fsrB* 280

14

mutant strain, thus confirming that the fsr signaling pathway controls the production of 281

enterocin O16 (results not shown). 282

The ef1097 encodes a pre-proprotein which is processed into enterocin O16 283

extracellularly by the GelE proteinase. Bioinformatics analysis strongly suggests that the 284

ef1097 encoded protein is sec-dependent, with a cleavage site between Ala56 and Ser57 as 285

seen in Figure 2b. Our N-terminal amino acid sequencing data implied a second proteolytic 286

processing site between residues 123-124 in the ef1097 encoded protein via an unknown 287

mechanism. E. faecalis produces several proteinases involved in secretion and turnover of 288

extracellular proteins, the gelatinase GelE, being the most prominent. In order to investigate if 289

gelatinase might be involved in the production of enterocin O16 (processing of ef1097 290

encoded protein) the presence of the gelatinase gene and the production of gelatinase activity 291

among the 22 antibacterial-tested E. faecalis strains was investigated. While all 22 strains 292

harbored the gelatinase gene, gelatinase activity was recorded only in 13 of bacteriocin 293

producing strains (Table 3). The results implied a potential involvement of gelatinase in 294

processing of the EF1097 pro-protein and could be a prerequisite for this antibacterial activity 295

of E. faecalis. 296

To test the hypothesis whether GelE activity is required for enterocin O16 production a 297

functional genetic analysis was performed. Single deletion mutants of ef1097 and ef1818 298

(gelE) (21) were constructed and the following genotypes were made: E. faecalis 299

Δef1097(gelE+) and E. faecalis (ef1097+)ΔgelE. It was shown that neither of the deletion 300

constructs produced antimicrobial activity directed against L. sakei LMGT 2313, different 301

from the wild type E. faecalis V583 (Figure 3). However, when the two mutants were grown 302

next to each other on a plate, they were able to synthesize complementary gene products that 303

restored the bacteriocin activity (Figure 3). Consistent with these results, a double ef1097 and 304

gelE mutant could not complement antimicrobial activity from either of the single mutants. 305

15

The results thus clearly show that gelatinase is needed to activate the EF1097 proprotein to 306

produce the mature and active enterocin O16. 307

To investigate whether the EF1097 proprotein was secreted or bound to the producer cell 308

surface, cell free supernatants of the E. faecalis Δef1097(gelE+) and E. faecalis 309

(ef1097+)ΔgelE mutants were used in agar diffusion assays. This showed no antimicrobial 310

activity in the supernatant of either mutant. In contrast, mixed supernatants showed potent 311

inhibition, thus confirming that the pro-protein of enterocin O16 is secreted and processed 312

into enterocin O16 extracellularly (Figure 4). 313

In vivo secreted EF1097 (enterocin O16 pro-protein) shows no antimicrobial activity 314

towards E. faecalis. The EF1097 is member of a family of antimicrobial proteins (10), and it 315

has been demonstrated that the 12.8 kDa corresponding to residues EF1097130-170 displays 316

potent antimicrobial activity towards E. faecalis (17). Based on our finding that GelE 317

processed the enterocin O16 pro-protein, we reasoned that in the V583ΔgelE strain the native 318

secreted EF1097 pro-protein should be intact. Using the V583ΔgelE strain as producer, we 319

investigated whether the secreted full length EF1097 protein produced in vivo by E. faecalis 320

V583 could inhibit other E. faecalis isolates. With the exception of JH2-2, which showed a 321

minute halo of inhibition, none of the 24 genome sequenced E. faecalis strains were inhibited 322

by V583ΔgelE (data not shown). In order to test whether any immunity function related to 323

production of enterocin O16 caused this resistance, the Δef1097, Δef1097b, ΔgelE/Δef1097, 324

ΔgelE/Δef1097b and the fsrB mutant version of V583 were investigated for inhibition by 325

V583ΔgelE. Again, no inhibition was observed thus demonstrating that E. faecalis is 326

intrinsically resilient to natively secreted EF1097 as to the enterocin O16 peptide. 327

328

DISCUSSION 329

16

The present study describes the purification, functional genetic analysis of production of a 330

novel type of antimicrobial peptide named enterocin O16 from E. faecalis, whose 331

biosynthesis and activity is governed by the fsr quorum sensing system. 332

The molecular weight of the purified enterocin O16 antimicrobial peptide was determined to 333

7231 Da (Figure 1B) and N-terminal sequencing revealed the first 30 residues of which one 334

(residue 4) was not identifiable. BLAST analysis identified the peptide sequence obtained as 335

part of the translated ef1097 sequence of E. faecalis V583 genome (Figure 2). By extending 336

the peptide sequence to the end of EF1097 a theoretical monoisotopic molecular weight of the 337

bacteriocin was calculated to 7215 Da, which is 16 Da less than the experimentally 338

determined mass of the purified peptide. The most probable explanation to this discrepancy is 339

that an oxidation of the only methionine residue had taken place in the peptide, a phenomenon 340

we have frequently observed with other methionine-containing bacteriocins (23). The DNA 341

sequence of ef1097 in E. faecalis O16 strain did not reveal any nucleotide changes that could 342

lead to differences in the amino acid composition that otherwise could explain this apparent 343

discrepancy in the molecular weight of the peptide (data not presented). 344

By means of functional genetic analysis, enterocin O16 was conclusively shown to be 345

encoded by ef1097 (Figure 3), a gene that is found in the core genome of E. faecalis. ef1097 is 346

highly conserved at the nucleotide level, with the exception of Merz96 showing one 347

nucleotide substitution, which probably causes this strain to use an alternative translational 348

initiation codon and thus leads to reduced production of the pre-proprotein. It should be noted 349

that the ef1097 orthologs among a number of sequenced E. faecalis have erroneously 350

predicted CDS-length due to automated annotations. These results convincingly show that the 351

68 amino acid C-terminal part of EF1097 comprises the enterocin O16 peptide. 352

We investigated 22 genome sequenced E. faecalis, which have the ef1097 gene, but do not 353

display inhibitory activity towards E. faecalis. Eleven of these showed enterocin O16-like 354

17

activity, and had intact fsr regulatory pathway. Consistent with previous reports (11, 27), we 355

show by functional genetic analysis that the ef1097 is regulated by the fsr system, and that, in 356

the absence of intact fsr signaling, production of the EF1097 precursor protein and the factors 357

required for its maturation were compromised. 358

Both sequence analysis and experimental results suggest that the EF1097 is a pre-proprotein, 359

which undergoes a two-step maturation process resulting in the mature enterocin O16. First, 360

the secretion is apparently taking place by a sec-signal dependent process, which removes the 361

55 N-terminal amino acid residues leader peptide. The remaining 136 amino acid residues 362

pro-peptide is further processed extracellularly by gelatinase, which removes the next 65 N-363

terminal residues, resulting in the 68 amino acid residue enterocin O16. The processing of the 364

pro-peptide by gelatinase is supported by two experimental results. We have shown that there 365

is a 100% correlation between the enterocin O16 and presence gelatinase activity (Table 3). In 366

addition by complementing the two enterocin O16 negative Δef1097(gelE+) and 367

(ef1097+)ΔgelE bacteria genotypes, enterocin O16 became activated (Figure 3). 368

In a previous work, the DNA sequence of a 136 amino acid C-terminal fragment of EF1097 369

(pro-sequence of the enterocin O16) was cloned in E. coli (26). From one clone, an 370

antimicrobial peptide was purified and according to the molecular mass analysis the full 371

length peptide (136 amino acids) was produced. The cloned version of EF1097 was not 372

processed as seen in the endogenous version identified in this work. Another peculiarity 373

between the two versions of the EF1097 bacteriocin is the differences in their spectra of 374

bacterial targets. While the cloned version had a relative broad target specificity that included 375

strong antimicrobial activity also against enterococci including E. faecalis, the endogenous 376

version of EF1097 bacteriocin recognized only a few lactobacilli and none of the enterococci 377

tested (Table 1). It is an interesting observation that the enterococcin EF1097 corresponding 378

to 136 residues of the proprotein of EF1097 showed substantially lower MIC (17) compared 379

18

to the mature endogenous peptide enterocin O16. It thus seems likely that enterococcin 380

EF1097 is not produced in high enough amounts to cause inhibition or is rapidly processed 381

into enterocin O16. 382

The enterocin O16 is not a conventional bacteriocin type peptide in several aspects. Most 383

precursor genes encode small peptides. In contrast, the enterocin O16 antimicrobial peptide is 384

translated as a large precursor pre-proprotein. The precursor is secreted via the general 385

secretory pathway, and a 30-residues proprotein is released from the cells. Formation of 386

mature enterocin O16 is facilitated extracellularly by the gelatinase GelE (Figure 4). 387

A resembling phenomenon has been described in Propionibacterium jenseni (30). Most 388

strains of P. jensenii and P. thoenii produce and export the Pro-PAMP protein, which is has 389

no antimicrobial activity (31). However, the antimicrobial activity is produced extracellularly 390

via proteolytic processing of the N-terminus part of the proprotein of PAMP. Biochemical and 391

genetic analysis revealed that PAMP comprised the 64 C-terminal residues of a 225 amino 392

acid putative protein with a 27-residue sec leader peptide. Subsequently, the secreted pro-393

PAMP protein comprising 198 amino acids was purified from culture supernatant not 394

subjected to protease treatment. Moreover, formation of PAMP upon protease treatment of 395

purified pro-PAMP was demonstrated (30). However, hitherto no host-encoded proteinase 396

that enables efficient production of PAMP in vivo has been identified. 397

Another feature distinguishing enterocin O16 from most antimicrobial peptides is the 398

apparent lack of a dedicated immunity function. Bioinformatics search identified a candidate 399

immunity gene translationally coupled to ef1097, but functional genetic analysis showed that 400

this orf did not render E. faecalis insensitive to enterocin O16. 401

The isolated antimicrobial peptide (EF1097) was earlier classified as a bacteriocin belonging 402

to a new family of bacteriocins according to Swe et al (32). But we have not identified any 403

19

immunity-encoding gene in the producer and in addition all E. faecalis strains tested were 404

resistant to enterocin O16. 405

Swe and coauthors were able by heterologous expression in E. coli to produce a wide 406

spectrum antimicrobial protein (32). This protein also inhibited enterococci. Interestingly, 407

enterocin O16 is the native from of this antimicrobial peptide produced by E. faecalis, and 408

displays a totally different activity spectrum. The reasons why there is such a huge difference 409

in activity remain unknown, but based on the fact that enterocin O16 constitutes only the 67 410

residue C-terminal portion of EF1097, it thus seems like certain structural features inherited 411

by the mid-section of the protein dictates inhibition spectrum. It is tempting to speculate that 412

the mid-section could comprise a domain for target cell recognition or docking. It seems 413

likely that the enterocin O16 part of the peptide facilitates the antimicrobial activity also in 414

the heterologous protein produced from E. coli. 415

In a recent study by Teixera et al., it was shown that deletion of the ef1097 locus reduced the 416

virulence of E. faecalis in a Drosophila infection model (33). In addition to the fact that the 417

expression of enterocin O16 is controlled by the major virulence regulator system in E. 418

faecalis a potential role of enterocin O16 in certain infections is conceivable, though we have 419

no experimental results to support this notion. 420

Concluding remarks 421

The fsr quorum sensing system, via the activity of GelE, contributes to several important 422

aspects of E. faecalis physiology, including fratricide, protein cell surface presentation and 423

protein turnover, and as such is important to virulence (13-15-34). 424

It has also been shown that the promoter regions of three operons have binding sites 425

recognized by the phosphorylated FsrA transcription factor (12). For one of these operons, the 426

ef1097a-1097b operon, there was no obvious explanation why this highly conserved locus 427

was part of the fsr regulon. 428

20

The results from the current study unveiled a new aspect of fsr signaling. The characterization 429

of enterocin O16 lead to the identification of a novel molecular mechanism by which fsr 430

controls the expression and maturation of antimicrobial peptide production. Enterocin O16 431

consists of the 68 C-terminal most residues of the EF1097 precursor protein. Functional 432

genetic analysis revealed that the protease GelE is responsible for processing the EF1097 pro-433

protein into enterocin O16. Ultimately, these findings demonstrate that the concerted 434

expression of fsr quorum sensing primary target operons (fsrABCD, gelEsprE and ef1097ab) 435

constitutes the element necessary for production of the enterocin O16 peptide, and that 436

antimicrobial antagonism is an intrinsic function of fsr. 437

ACKNOWLEDGMENTS 438

DAB and SLLR were financially supported by the project number 191452 from the 439

Norwegian Research Council. 440

21

Table 1. Inhibition spectrum of the bacteriocin produced by E. faecalis 016. 441

Indicator organism Medium Growth

Temperature (°C) aSensitivity

L. sakei LMG 2313 MRS 30 +++

L. sakei LMG 3354 MRS 30 +





L. plantarum LMG 2003 MRS 30 +++

L. plantarum 12M MRS 30 +

L. delbrueckii subsp. lactis MRS 30 +

E. faecium W3 MRS 30 +

E. faecium LMG 2384 MRS 30 -




S. aureus LMG 3226 GM17 30 -

S. aureus LMG 3260 GM17 30 -

L. monocytogenes LMG 2650 GM17 30 -

L. monocytogenes LMG 2652 GM17 30 -

L. lactis B100 GM17 30 -

L. lactis 1213 GM17 30 -

E. faecalis V583 MRS 30 -

E. faecalis OG1RF MRS 30 -

E. faecalis EF62 MRS 30 -

E. faecalis JH2-2 MRS 30 -

E. faecalis ARO1/DG MRS 30 -

E. faecalis ATCC4200 MRS 30 -

E. faecalis CH188 MRS 30 -

E. faecalis D6 MRS 30 -

E. faecalis DS5 MRS 30 -

E. faecalis E1Sol MRS 30 -

E. faecalis Fly1 MRS 30 -

E. faecalis HIP11704 MRS 30 -

E. faecalis JH1 MRS 30 -

E. faecalis Merz96 MRS 30 -

22

Indicator organism Medium Growth

Temperature (°C) aSensitivity

E. faecalis T1 MRS 30 -





E. faecalis X98 MRS 30 -

E. faecalis TX0104 MRS 30 -

E. faecalis HH22 MRS 30 -

E. faecalis V19 MRS 30 -

E. faecalis V583ΔgelE MRS 30 - a +, inhibition; -, no inhibition; +/- moderate inhibition; +++, good inhibition 442

443

23

Table 2. MIC values for the most sensitive indicator strains. 444

Indicator Organism MIC value (ng/ml)

L. sakei LMG 2313 0.5

L. sakei LMG 3354 250


L. sakei LMG 3356 62.5


L. plantarum LMG 2003 31

445

446

24

Table 3. Gelatinase activities of Enterococcus faecalis strains used in this study. 447

Strain Bacteriocin O16 activity Gelatinase activity Reference

E. faecalis O16 + + This study

E. faecalis V583 +++ + (35)

E. faecalis OG1RF +++ + (36)

E. faecalis EF62 - - (37)

E. faecalis JH2-2 - - (38)

E. faecalis ARO1/DG +++ + (39)

E. faecalis ATCC4200 - - (40)

E. faecalis CH188 - - (41)

E. faecalis D6 - - (42)

E. faecalis DS5 - - (43)

E. faecalis E1Sol +++ + (44)

E. faecalis Fly1 +++ + (42)

E. faecalis HIP11704 - - (42)

E. faecalis JH1 +++ + (45)

E. faecalis Merz96 - + (46)

E. faecalis T1 +++ + (47)

E. faecalis T2 - - (47)

E. faecalis T3 +++ + (47)

E. faecalis T8 -/+ - (47)

E. faecalis T11 + + (47)

E. faecalis X98 +++ - (28)

E. faecalis TX0104 +++ + (48)

E. faecalis HH22 +++ + (49)

E. faecalis V19 +++ + (50)

E. faecalis V583ΔgelE - - (21)

448

449

25

Table 4. Plasmid and primers used in this study. 450

Name Description Reference

pLT06 Plasmid for mutagenesis; contains CatR (19)

pEf1097 Plasmid for ef1097 deletion, a derivative of pLT06, CatR This study

pEf1097b Plasmid for ef1097b deletion, a derivative of pLT06, CatR This study

Primers

O16-forw GAATTTGTGCGATTTATTCT This study

O16-rev AGATTTAAGTGGCAATATGT This study

EF1097-f1 GGTGGTGAATTCAAACTGGTTATTAGTTGGTG This study

EF1097-r1 GCTTAGCCCACATTGAACGTTTTTAAAGTTATCTTCCGT This study

EF1097b-f1 ACGGAAGATAACTTTAAAAACGTTCAATGTGGGCTAAGC This study

EF1097b-r1 GGTGGTGGATCCTAACAGAGTGTTATCCTA This study

EF1098-f1 ACGGAAGATAACTTTAAAAACATGAAGTGGTTTTAGAAAGA This study

EF1098-r1 GGTGGTGGATCCGTACAGCTATGCAATTATTC This study

EF1097-r2 TCTTTCTAAACCACTTCATGTTTTTAAAGTTATCTTCCGT This study

CatR, chloramphenicol resistant 451

452

453

26

REFERENCES 454

1. Sava IG, Heikens E, Huebner J. 2010. Pathogenesis and immunity in enterococcal 455

infections. Clin Microbiol Infect 16:533-540. 456

2. Arias CA, Murray BE. 2008. Emergence and management of drug-resistant 457

enterococcal infections. Expert Rev Anti Infe 6:637-655. 458

3. Lebreton F, van Schaik W, Manson McGuire A, Godfrey P, Griggs A, 459

Mazumdar V, Corander J, Cheng L, Saif S, Young S, Zeng Q, Wortman J, 460

Birren B, Willems RJ, Earl AM, Gilmore MS. 2013. Emergence of epidemic 461

multidrug-resistant Enterococcus faecium from animal and commensal Strains. MBio 462

4 (4):e00534-13. doi:10.1128/mBio.00534-13. 463

4. Nissen-Meyer J, Nes IF. 1997. Ribosomally synthesized antimicrobial peptides: their 464

function, structure, biogenesis, and mechanism of action. Archiv Microbiol 167:67-77. 465

5. Kjos M, Borrero J, Opsata M, Birri DJ, Holo H, Cintas LM, Snipen L, 466

Hernandez PE, Nes IF, Diep DB. 2011. Target recognition, resistance, immunity and 467

genome mining of class II bacteriocins from Gram-positive bacteria. Microbiology 468

157:3256-3267. 469

6. Cotter PD, Hill C, Ross RP. 2005. Bacteriocins: developing innate immunity for 470

food. Nat Rev Microbiol 3:777-788. 471

7. Nes IF, Diep DB, Holo H. 2007. Bacteriocin diversity in Streptococcus and 472

Enterococcus. J Bacteriol 189:1189-1198. 473

8. Nilsen T, Nes IF, Holo H. 2003. Enterolysin A, a cell wall-degrading bacteriocin 474

from Enterococcus faecalis LMG 2333. Appl Environ Microbiol 69:2975-2984. 475

9. Qin X, Singh KV, Weinstock GM, Murray BE. 2001. Characterization of fsr, a 476

regulator controlling expression of gelatinase and serine protease in Enterococcus 477

faecalis OG1RF. J Bacteriol 183:3372-3382. 478

27

10. Nakayama J, Cao Y, Horii T, Sakuda S, Akkermans AD, de Vos WM, Nagasawa 479

H. 2001. Gelatinase biosynthesis-activating pheromone: a peptide lactone that 480

mediates a quorum sensing in Enterococcus faecalis. Mol Microbiol 41:145-154. 481

11. Del Papa MF, Perego M. 2011. Enterococcus faecalis virulence regulator FsrA 482

binding to target promoters. J Bacteriol 193:1527-1532. 483

12. Shankar J, Walker RG, Ward D, Horsburgh MJ. 2012. The Enterococcus faecalis 484

exoproteome: identification and temporal regulation by Fsr. PLoS One 7:e33450. 485

13. Thomas VC, Thurlow LR, Boyle D, Hancock LE. 2008. Regulation of autolysis-486

dependent extracellular DNA release by Enterococcus faecalis extracellular proteases 487

influences biofilm development. J Bacteriol 190:5690-5698. 488

14. Thurlow LR, Thomas VC, Narayanan S, Olson S, Fleming SD, Hancock LE. 489

2010. Gelatinase contributes to the pathogenesis of endocarditis caused by 490

Enterococcus faecalis. Infect Immun 78:4936-4943. 491

15. Heng NCK, Ragland NL, Swe PM, Baird HJ, Inglis MA, Tagg JR, Jack RW. 492

2006. Dysgalacticin: a novel, plasmid-encoded antimicrobial protein (bacteriocin) 493

produced by Streptococcus dysgalactiae subsp. equisimilis. Microbiology 152:1991-494

2001. 495

16. Gabrielsen C, Brede DA, Hernandez PE, Nes IF, Diep DB. 2012. The maltose 496

ABC transporter in Lactococcus lactis facilitates high-level sensitivity to the circular 497

bacteriocin garvicin ML. Antimicrob Agents Chemother 56:2908-2915. 498

17. Diep DB, Axelsson L, Grefsli C, Nes IF. 2000. The synthesis of the bacteriocin 499

sakacin A is a temperature-sensitive process regulated by a pheromone peptide 500

through a three-component regulatory system. Microbiology 146:2155-2160. 501

18. Ruiz-Garbajosa P, Bonten MJ, Robinson DA, Top J, Nallapareddy SR, Torres C, 502

Coque TM, Canton R, Baquero F, Murray BE, del Campo R, Willems RJ. 2006. 503

28

Multilocus sequence typing scheme for Enterococcus faecalis reveals hospital-adapted 504

genetic complexes in a background of high rates of recombination. J Clin Microbiol 505

44:2220-2228. 506

19. Thurlow LR, Thomas VC, Fleming SD, Hancock LE. 2009. Enterococcus faecalis 507

capsular polysaccharide serotypes C and D and their contributions to host innate 508

immune evasion. Infect Immun 77:5551-5557. 509

20. Leenhouts K, Buist G, Bolhuis A, ten Berge A, Kiel J, Mierau I, Dabrowska M, 510

Venema G, Kok J. 1996. A general system for generating unlabelled gene 511

replacements in bacterial chromosomes. Mol Gen Genet 253:217-224. 512

21. Solheim M, La Rosa SL, Mathisen T, Snipen LG, Nes IF, Brede DA. 2014. 513

Transcriptomic and functional analysis of NaCl-induced stress in Enterococcus 514

faecalis. PLoS One 9:e94571. 515

22. Fimland G, Blingsmo OR, Sletten K, Jung G, Nes IF, Nissen-Meyer J. 1996. New 516

biologically active hybrid bacteriocins constructed by combining regions from various 517

pediocin-like bacteriocins: the C-terminal region is important for determining 518

specificity. Appl Environ Microbiol 62:3313-3318. 519

23. Nes IF, Diep DB, Havarstein LS, Brurberg MB, Eijsink V, Holo H. 1996. 520

Biosynthesis of bacteriocins in lactic acid bacteria. A Van Leeuw 70:113-128. 521

24. Swe PM, Heng NC, Cook GM, Tagg JR, Jack RW. 2010. Identification of DysI, the 522

immunity factor of the streptococcal bacteriocin dysgalacticin. Appl Environ 523

Microbiol 76:7885-7889. 524

25. Sedgley CM, Clewell DB, Flannagan SE. 2009. Plasmid pAMS1-encoded, 525

bacteriocin-related "siblicide" in Enterococcus faecalis. J Bacteriol 191:3183-3188. 526

26. Swe PM, Heng NCK, Ting Y-T, Baird HJ, Carne A, Tauch A, Tagg JR, Jack 527

RW. 2007. ef1097 and ypkK encode enterococcin V583 and corynicin JK, members of 528

29

a new family of antimicrobial proteins (bacteriocins) with modular structure from 529

Gram-positive bacteria. Microbiology 153:3218-3227. 530

27. Bourgogne A, Hilsenbeck SG, Dunny GM, Murray BE. 2006. Comparison of 531

OG1RF and an isogenic fsrB deletion mutant by transcriptional analysis: the Fsr 532

system of Enterococcus faecalis is more than the activator of gelatinase and serine 533

protease. J Bacteriol 188:2875-2884. 534

28. Wheeler SM, Foley GE. 1945. Studies on the streptococci (entercococci) of 535

Lancefield group D; recovery of Lancefield group D streptococci from antemortem 536

and postmortem cultures from infants and young children. Am J Dis Child 70:207-537

213. 538

29. McBride SM, Fischetti VA, Leblanc DJ, Moellering RC, Jr., Gilmore MS. 2007. 539

Genetic diversity among Enterococcus faecalis. PLoS One 2:e582. 540

30. Faye T, Brede DA, Langsrud T, Nes IF, Holo H. 2002. An antimicrobial peptide is 541

produced by extracellular processing of a protein from Propionibacterium jensenii. J 542

Bacteriol 184:3649-3656. 543

31. Faye T, Brede DA, Langsrud T, Nes IF, Holo H. 2004. Prevalence of the genes 544

encoding propionicin T1 and protease-activated antimicrobial peptide and their 545

expression in classical propionibacteria. Appl Environ Microbiol 70:2240-2244. 546

32. Swe PM, Heng NC, Cook GM, Tagg JR, Jack RW. 2010. Identification of DysI, the 547

immunity factor of the streptococcal bacteriocin dysgalacticin. Appl Environ 548

Microbiol 76:7885-7889. 549

33. Teixeira N, Varahan S, Gorman MJ, Palmer KL, Zaidman-Remy A, Yokohata 550

R, Nakayama J, Hancock LE, Jacinto A, Gilmore MS, de Fatima Silva Lopes M. 551

2013. Drosophila host model reveals new Enterococcus faecalis quorum-sensing 552

associated virulence factors. PLoS One 8:e64740. 553

30

34. Pinkston KL, Gao P, Diaz-Garcia D, Sillanpaa J, Nallapareddy SR, Murray BE, 554

Harvey BR. 2011. The Fsr quorum-sensing system of Enterococcus faecalis 555

modulates surface display of the collagen-binding MSCRAMM Ace through 556

regulation of gelE. J Bacteriol 193:4317-4325. 557

35. Sahm DF, Kissinger J, Gilmore MS, Murray PR, Mulder R, Solliday J, Clarke B. 558

1989. In vitro susceptibility studies of vancomycin-resistant Enterococcus faecalis. 559

Antimicrob Agents Chemother 33:1588-1591. 560

36. Bourgogne A, Garsin DA, Qin X, Singh KV, Sillanpaa J, Yerrapragada S, Ding 561

Y, Dugan-Rocha S, Buhay C, Shen H, Chen G, Williams G, Muzny D, Maadani 562

A, Fox KA, Gioia J, Chen L, Shang Y, Arias CA, Nallapareddy SR, Zhao M, 563

Prakash VP, Chowdhury S, Jiang H, Gibbs RA, Murray BE, Highlander SK, 564

Weinstock GM. 2008. Large scale variation in Enterococcus faecalis illustrated by 565

the genome analysis of strain OG1RF. Genome Biol 9:R110. 566

37. Brede DA, Snipen LG, Ussery DW, Nederbragt AJ, Nes IF. 2011. Complete 567

genome sequence of the commensal Enterococcus faecalis 62, isolated from a healthy 568

Norwegian infant. J Bacteriol 193:2377-2378. 569

38. Jacob AE, Hobbs SJ. 1974. Conjugal transfer of plasmid-borne multiple antibiotic 570

resistance in Streptococcus faecalis var. zymogenes. J Bacteriol 117:360-372. 571

39. Manson JM, Keis S, Smith JM, Cook GM. 2003. Characterization of a vancomycin-572

resistant Enterococcus faecalis (VREF) isolate from a dog with mastitis: further 573

evidence of a clonal lineage of VREF in New Zealand. J Clin Microbiol 41:3331-574

3333. 575

40. Birkhaug K. 1927. Bacteriologic studies in acute rheumatic fever with reference to 576

soluble toxin production. Proc Soc Exp Biol Med 24:541–545. 577

31

41. Rice LB, Eliopoulos GM, Wennersten C, Goldmann D, Jacoby GA, Moellering 578

RC, Jr. 1991. Chromosomally mediated beta-lactamase production and gentamicin 579

resistance in Enterococcus faecalis. Antimicrob Agents Chemother 35:272-276. 580

42. Palmer KL, Carniol K, Manson JM, Heiman D, Shea T, Young S, Zeng Q, 581

Gevers D, Feldgarden M, Birren B, Gilmore MS. 2010. High-quality draft genome 582

sequences of 28 Enterococcus sp. isolates. J Bacteriol 192:2469-2470. 583

43. Dunny GM, Clewell DB. 1975. Transmissible toxin (hemolysin) plasmid in 584

Streptococcus faecalis and its mobilization of a noninfectious drug resistance plasmid. 585

J Bacteriol 124:784-790. 586

44. Gardner P, Smith DH, Beer H, Moellering RC, Jr. 1969. Recovery of resistance 587

(R) factors from a drug-free community. Lancet 2:774-776. 588

45. LeBlanc DJ, Lee LN. 1982. Characterization of two tetracycline resistance 589

determinants in Streptococcus faecalis JH1. J Bacteriol 150:835-843. 590

46. Harrington SM, Ross TL, Gebo KA, Merz WG. 2004. Vancomycin resistance, esp, 591

and strain relatedness: a 1-year study of enterococcal bacteremia. J Clin Microbiol 592

42:5895-5898. 593

47. Maekawa S, Yoshioka M, Kumamoto Y. 1992. Proposal of a new scheme for the 594

serological typing of Enterococcus faecalis strains. Microbiol Immunol 36:671-681. 595

48. Peterson J, Garges S, Giovanni M, McInnes P, Wang L, Schloss JA, Bonazzi V, 596

McEwen JE, Wetterstrand KA, Deal C, Baker CC, Di Francesco V, Howcroft 597

TK, Karp RW, Lunsford RD, Wellington CR, Belachew T, Wright M, Giblin C, 598

David H, Mills M, Salomon R, Mullins C, Akolkar B, Begg L, Davis C, 599

Grandison L, Humble M, Khalsa J, Little AR, Peavy H, Pontzer C, Portnoy M, 600

Sayre MH, Starke-Reed P, Zakhari S, Read J, Watson B, Guyer M. 2009. The 601

NIH Human Microbiome Project. Genome research 19:2317-2323. 602

32

49. Murray BE, Mederski-Samaroj B. 1983. Transferable beta-lactamase. A new 603

mechanism for in vitro penicillin resistance in Streptococcus faecalis. J Clin Invest 604

72:1168-1171. 605

50. Zhao C, Hartke A, La Sorda M, Posteraro B, Laplace JM, Auffray Y, 606

Sanguinetti M. 2010. Role of methionine sulfoxide reductases A and B of 607

Enterococcus faecalis in oxidative stress and virulence. Infect Immun 78:3889-3897. 608

609

610

611

33

Legend to Figures 612

Figure 1. A) Reverse phase chromatographic analysis (Sephacil Peptide C8 5 µm ST 4.6/250 613

column) of enterocin O16. The antimicrobial activity eluted in the absorption peak fraction. 614

For details see M&M. B) Mass spectrometry analysis of the peak fraction in A. Intens. 615

(Intensity); a.u., arbitrary units. 616

Figure 2. A) Genetic organization of the ef1097 locus corresponding to nucleotides 1065720 - 617

1067250 in the E. faecalis V583 chromosome. B) Nucleotide sequence and translation of the 618

ef1097 and ef1097b genes. Enterocin O16 amino acid residues are indicated in bold. The -35 619

and -10 regions, transcript initiation site (+1), ribosomal binding site (RBS) and ef1097 start 620

and stop codon are underlined. R1 and R2 denote FsrA binding site repeat sequence motifs 621

identified by Del Papa et al. (11). 622

Figure 3. Functional genetic analysis of inhibition of L. sakei LMGT2313 by E. faecalis 623

V583. Lack of EF1097 (b), Gelatinase (c), or both activities (d) results into loss of the 624

antimicrobial peptide activity. Supplementing the Gelatinase in trans processes the EF1097 625

precursor into active antimicrobial peptide (e). 626

Figure 4. Enterocin O16 activity in cell free supernatants of V583 wt and mutants. E. faecalis 627

were grown O/N, then diluted 50x and cultivated further to late log-phase. Cell free 628

supernatants (50µL) were mixed 1:1 and incubated 1 h at room temperature and applied in 629

wells before plates were overlaid with indicator L. sakei LMGT2313. Enterocin O16 630

activation occurs extracellularly only in presence of both EF1097 and Gelatinase (a, e). 631

Supernatants from: a: wild-type; b: ΔgelE; c: Δef1097; d: ΔgelEΔef1097; e: Δef1097(gelE+) + 632

ΔgelE (ef1097+); f: Δef1097 + ΔgelEΔef1097; g: ΔgelE + ΔgelEΔef1097. 633

634

0

5

10

15

20

25

30

35

40

45

50

0

10

20

30

40

50

60

70

80

90

100

20 21 23 24 25 26 28 29 30 32 33 34 35 37 38 39

% 2

-Pro

pa

no

l

Ab

so

rba

nc

e 2

80

nm

(m

AU

)

mL

7175.88

7231.59

0.3

0.2

0.1

0

6800 6900 7000 7100 7200 7300

Inte

ns

. [a

. u

.] x104

m/z

B

TTTAAAAGATTTAGATAACGTGAAGTTATTTTGACTTAGCAATTGAGAGTTTCCTTGAGAAAGGGGACTCTTTTTTTATTTTCTATATTC

GTTTCAGAAGGTTTAGACAAGCTCAAAAAATATTTCAAGAGAGCTGCGTTGTTTTCAAAATAGAACCTAGCATTACCTCGAACGTACCTC

AAATAACCTGTGTCTTTTTTTGAATCATTAGTTCAAATTGATGTGATCACTAGTGAGAAAAATCAGCTCTAGGATATATAGGAAAATATA

ef1097 R2

AGCATCAAATAGGGATTTCGATGATAAATTATCTTTTTCCTTGTTATGATTATAACAAGGAAAAAGAAAGTAGGGATTTATTTATGGAAT

M E

R1 -35 -10 +1 RBS

TACAGGTGACAAAAAAGGCTAAATTTTTTTGTTTGGCGATGGCATTACTAATGACATTAGGTATTTTTATCAGCGCTGGTACAAGTGTTT

L Q V T K K A K F F C L A M A L L M T L G I F I S A G T S V

ATGCATCTGACCAGCTAGAGGATTCAGAAGTTGAGGCTGTAGCAAAAGGACTGGAAGAAATGTATGCGAATGGAGTGACGGAAGATAACT

Y A S D Q L E D S E V E A V A K G L E E M Y A N G V T E D N

TTAAAAACTATGTCAAAAATAATTTTGCTCAGCAAGAGATTTCTTCAGTTGAGGAAGAATTAAATGTAAATATTTCTGATGCTTCAACAG

F K N Y V K N N F A Q Q E I S S V E E E L N V N I S D A S T

TAGTTCAAGCACGTTTTAATTGGAATGCATTAGGAAGTTGCGTTGCTAACAAAATCAAAGATGAGTTTTTTGCAATGATTAGTATCAGCG

V V Q A R F N W N A L G S C V A N K I K D E F F A M I S I S

CAATTGTAAAAGCTGCACAAAAGAAAGCCTGGAAAGAATTAGCAGTGACTGTATTACGCTTCGCTAAAGCCAATGGGTTAAAGACGAATG

A I V K A A Q K K A W K E L A V T V L R F A K A N G L K T N

CTATTATTGTAGCTGGACAACTAGCTTTATGGGCAGTTCAATGTGGGCTAAGCTAATGAATTTAAAAGATCATGTTACGGAAATAGTAAT

A I I V A G Q L A L W A V Q C G L S stop

ef1097b M N L K D H V T E I V I

TACTTTTATCATCGCTTTTGTGTATACTTGGATAGATTCAGGAGAAATTGAAATCTTAAAAACTCTTTTGATAACAATAATATTTTTAGC

T F I I A F V Y T W I D S G E I E I L K T L L I T I I F L A

CATGTTCTATGCAATACCCAAAATCACCAATAGAAAAAGAAAATGAAGTGGTTTTAGAAAGATAATGTGATAGGAAGTGTAAGAGGAGGT

M F Y A I P K I T N R K R K stop

AACGAGCCTTCTCTTGCTTATAGAAAAAAAGAGCTAAAACCTTTATTTTATAAGGTTTTAGCTCTTTTTTGTTTTTCTCTACTTTTCTAA

AAATGGAGACGGCGGGAGTCGAACCCGCGTCCAAACATATTGCCACTTAAATCTCTACGTTCATAGACACTCATTTAAAGGTTCGCTTTA

CAGCGTGCCGAGTGACAGGCATTCTGTATTGCTAGTCTGGTAAGCTCCTCTAAATTTTACAGACGGAAAAATTTAGCGTATCCCACTTCG

ATTAGGACCCTGACCCGAGCACATGGGCGATGCCGGGAGGATCTTCGCTAGCTGGTTTTTAGGCAGCTAAAGCGAAAGAATTGTTTTCGT

TTTTAGCAGTTATATTTAACTGTAACGTTTTAACGTAGCCGTAACCTACGAAACGCAATTCAAGCTCAACTATGCCTGTCGAATCCGTAA

ef1096 Pef1097

ef1097 ef1096 ef1097b ssrA

1065720 1067250

A

B

Fsr quorum sensing system and cognate Gelatinase orchestrate the expression and processing of...

Documents

Transcript of Fsr quorum sensing system and cognate Gelatinase orchestrate the expression and processing of...