Insect Molecular Biology (2000)

9

(2), 169–177

© 2000 Blackwell Science Ltd

169

Blackwell Science, Ltd

Expression patterns of the larval and adult hexamerin genes of

Musca domestica

M. de L.

Capurro,

1

C. K.

Moreira-Ferro,

2

O.

Marinotti,

2

A. A.

James

3

and A. G.

de Bianchi

1

1

Departamento de Bioquímica, Instituto de Química, Universidade de São Paulo, Brasil,

2

Departamento de Parasitologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, Brasil,

3

Department of Molecular Biology and Biochemistry, University of California, Irvine, CA, USA

Abstract

Hexamerins are proteins found in high abundance inthe haemolymph of larval and adult insects. The expres-sion patterns of the genes encoding the house fly,

Muscadomestica

, hexamerins were determined by Nor thernanalyses using cDNAs as probes. A cDNA, A1, hybridi-zed to a fat body-specific messenger RNA (mRNA) whichis detectable in larvae until pupation. Antibodies raisedto the larval-specific hexamerin, Hex-L, bind recombinantprotein encoded by a 5

′′′′

rapid amplification of cDNAends (

RACE

) product of A1, A2, indicating that theA cDNAs likely represent the genes encoding Hex-L. TheF1, F2 and F3 cDNAs, corresponding to genes encodingan adult, female-enriched hexamerin, Hex-F, hybridizedwith an mRNA isolated from protein-fed females whichhas a temporal expression profile similar to that observ-ed for the accumulation of Hex-F. Furthermore, expres-sion of the mRNAs hybridizing to the F cDNAs iscorrelated with the abundance of Hex-F protein duringthe gonotrophic cycles. The mRNA transcriptionprofiles indicate that the Hex-L and Hex-F genes areregulated in a sex-, tissue- and developmental phase-dependent manner. This stage-specific expression ofhexamerins contrasts with the expression patterns ofhexamerins seen in other insects. The conceptualtranslation products of larval hexamerin cDNAs showedidentity with larval serum protein 1 (LSP1)-typehexamerins while the deduced products of the femalehexamerin cDNAs showed the highest identity with LSP2-

type hexamerins. Genomic analyses showed that thelarval hexamerin and female hexamerin genes from

M. domestica

belong to two distinct multigenic families.

Keywords:

Musca domestica

, house fly, hexamerins,arylphorins.

Introduction

Hexamerins are high molecular weight proteins found mostlyin the haemolymph of insects and whose function has beenproposed as storage proteins (Telfer & Kunkel, 1991). Wepreviously isolated and characterized two hexamerins, Hex-Land Hex-F, from the house fly,

Musca domestica

. Hex-L is alarval-specific glycoprotein with an apparent native molecularweight of 500 000, and is composed of subunits with molecu-lar weights of 83 000 and 89 000 (de Bianchi

et al.

, 1983;Marinotti & de Bianchi, 1986a,b; Marinotti

et al.

, 1988). Hex-Lis synthesized in the larval fat body and is secreted into thehaemolymph, attaining its highest concentration at the endof the feeding stage. Hex-L synthesis ceases at the larvalwandering stage and during the pupal stages, the proteinis endocytosed by the fat body, accumulated in granules,and is progressively hydrolysed. Three days after adultemergence, Hex-L is no longer detectable in the insects.Hex-F is an adult-specific hexamerin, previously designatednon-vitellogenic female protein (NVFP) (Capurro

et al.

,1997), expressed in abundance in females, and has amolecular weight of 430 000 (Pereira

et al.

, 1989; Capurro

et al.

, 1997). Hex-F is composed of subunits with amolecular weight of 70 000. In contrast to Hex-L, Hex-F isnot detectable in larval and pupal stages. This protein issynthesized by adult fat body and is induced by a proteindiet. The variation in abundance of Hex-F during adultfemale life follows a pattern similar to the one observedfor yolk proteins, attaining its maximum level at aboutthe middle of the gonotrophic cycle, and declining there-after until the end of the cycle. Hex-F is also detected inadult males; however, its level never surpasses 10% ofthat observed in females. The function of Hex-F is notknown, but it has been suggested that it may be astorage protein for amino acids used during the finalstages of egg formation (Pereira

et al.

, 1989; Capurro

et al.

, 1997).

Received 4 March 1999; accepted 25 October 1999. Correspondence: DrMargareth de Lara Capurro, Department of Molecular Biology andBiochemistry, 3205 Bio

S

ci II, University of California, Irvine, CA 92697–3900, USA. E-mail: mcapurro@uci.edu

IMB173.fm Page 169 Tuesday, March 21, 2000 2:38 PM

170

M. de L. Capurro

et al.

© 2000 Blackwell Science Ltd,

Insect Molecular Biology

,

9

, 169–177

Here we show that Hex-L gene expression and proteinsynthesis stop coordinately in larvae indicating a potentialtranscriptional control mechanism for Hex-L synthesis.Similarly, the expression patterns of the genes encodingHex-F parallels the abundance of the proteins throughoutthe course of the gonotrophic cycle, suggesting thatHex-F synthesis is controlled mainly at the level of genetranscription. In addition, the independent expressionpatterns of the larval and adult hexamerins in

M.domestica

contrast with those seen in other Diptera andhemi- and holometabolous insects. Adult expression of ahexamerin in these other insects results from either areactivation of a hexamerin gene previously expressedat the larval stage (Zakharkin

et al.

, 1997), or is a con-tinuous expression of the same hexamerin gene from thelarval through the pupal and adult stages (Shirras &Bownes, 1989; Ancsin & Wyatt, 1990; Benes

et al.

, 1990;Faria

et al.

, 1994; Jamroz

et al.

, 1996). Both Hex-L andHex-F are likely to be encoded by distinct multicopygene families.

Results

Electrophoretic analysis of the haemolymph proteins in

Musca domestica

The electrophoretic profile of

M. domestica

haemolymphproteins reveals the presence of a number of abundantstage- and sex-specific polypeptides (Fig. 1A). During the

larval and pupal stages, Hex-L is the major polypeptide inthe haemolymph (de Bianchi

et al.

, 1983). An immunoblotdeveloped with antiserum raised to Hex-L (de Bianchi

et al.

,1983) shows that this protein is accumulated during the larvalstage, decreases in the pupal stage, and is not detectedin adult flies (Fig. 1B). An immunoblot developed with

M.domestica

Hex-F antibodies (Pereira

et al.

, 1989) revealsthat Hex-F accumulates abundantly in females followinga protein diet (Fig. 1C; Capurro

et al.

, 1997). The levelof Hex-F accumulation in males never surpasses 10%of the amount observed in females (Pereira

et al.

, 1989;Capurro

et al.

, 1997). Therefore, this protein is not evidentin the male samples in Fig. 1 because of the small amountsof haemolymph that were resolved in the gels and blottedon to the membranes.

The A1 and A2 cDNAs correspond to a gene whose expression pattern is similar to Hex-L

A cDNA, A1, 381 bp in length, was isolated from a libraryconstructed from mRNA isolated from the dissected fatbody of feeding-stage larvae. Following primary sequencingand analysis of the conceptual translation product, it wasdetermined that A1 did not represent a full-length cDNA.A gene amplification protocol (5

′

rapid amplification of cDNAends (

RACE

)) was used to generate a second clone, A2,which contained a portion of the 5

′

end of the transcrip-tion product. The deduced amino acid sequences of A1and A2 showed 71% identity with calliphorin, a previously

Figure 1. Electrophoretic analysis of M. domestica haemolymph proteins. (A) Coomassie blue-stained proteins from 2.5 × 10–2 µl of larval and pupal haemolymph and 1 µl of adult haemolymph, separated by SDS-PAGE in a 10% polyacrylamide gel. (B) and (C) Antibody detection of antigens immunologically reactive to the anti Hex-L and Hex-F antisera. Proteins from gels identical to that one presented in (A) were transferred to nitrocellulose membranes and incubated with the M. domestica Hex-L (B) or Hex-F antisera (C). The identification of reactive polypeptides was performed as described in the Experimental procedures. Larva: 3, 4 and 5 indicate days after hatching; 3 and 4 correspond to the feeding stages and 5 to the wandering stage. Pupa: 1–4 indicate days of the pupal stage. Female and male: AA, adult insects maintained on a water and sugar diet for 72 h; 1–4, protein diet for 24, 48, 72 and 96 h, respectively. Hex-L: larval hexamerin polypeptides. Hex-F: adult female hexamerin polypeptides. PPV: yolk protein precursor polypeptides. S: molecular weight markers (myosin = 205 000; β-galactosidase = 116 000; phosphorylase B = 97 400; bovine serum albumin = 45 000; carbonic anhydrase = 29 000). The position of the markers is indicated by dots on the right side of panel A.

IMB173.fm Page 170 Tuesday, March 21, 2000 2:38 PM

Musca domestica

hexamerins

171

© 2000 Blackwell Science Ltd,

Insect Molecular Biology

,

9

, 169–177

characterized

Calliphora vicina

hexamerin (Schenkel

et al.

,1985) (Table 1). In addition, the A1 and A2 cDNAs encodea deduced protein with similarities to the larval serumprotein 1 (LSP1) family of proteins (Table 1; Fig. 2). Althoughthe A2 cDNA was obtained using A1 as a primer, they showdifferences in the overlapping regions of their deduced aminoacid sequences (Fig. 2) making it likely that A1 and A2 areproducts of different alleles or of different genes in theHex-L family.

The A1 cDNA hybridized with a 2.6-kb messengerRNA (mRNA) abundantly expressed in fat body derivedfrom 2–5-day-old larvae (Fig. 3), a temporal expressionprofile that overlaps that observed for Hex-L synthesis(de Bianchi

et al.

, 1983). Protein synthesis stops atthe beginning of the wandering stage (de Bianchi

et al.

,1983), and this is consistent with the expressionprofile of the corresponding mRNA (C.K. Moreira-Ferro,unpublished).

Expression of the A2 cDNA in

Escherichia coli

The A2 cDNA was cloned into the

Nco

I and

Sma

I restrictionsites of the expression vector pAKSS, as described in Experi-mental procedures. The plasmid construct expressed a fusionprotein with an approximate apparent molecular weight of68 kDa, which is compatible with the expected polypeptidesize encoded by the A2 cDNA plus the GST N-terminalfusion protein and His tag on the C-terminal end sequence(Fig. 4). This fusion protein was recognized by

M. domestica

anti-Hex-L specific serum in an immunoblot confirming thatthe A2 clone encodes a segment of the Hex-L polypeptide.

Hex-F mRNA detection during the first and the second gonotrophic cycle of

Musca domestica

We had previously reported that a series of cDNA clones,designated F0, F1, F2 and F3, encode a major serumprotein, NVFP, that has similarities to the LSP2 family

Table 1. Identity and similarity among the deduced amino acid sequences from M. domestica hexamerins encoding cDNAs and other dipteran hexamerins.

Identity (%)a Similarity (%)a

A1 A2 F1 F2 F3 A1 A2 F1 F2 F3

C. vicina LSP1 71 71 42 33 52 84 86 60 51 70D. melanogaster LSP1 64 64 45 34 48 78 78 60 52 65C. vicina LSP2 43 36 63 64 64 67 54 77 78 79D. melanogaster LSP2 39 32 63 56 60 65 48 77 72 74

aThe percentage of identity and similarity were obtained using Clustal W program (Thompson et al., 1994). GenBank accession numbers: C. vicina LSP1, M76481; D. melanogaster LSP1, β subunit, U63556; D. melanogaster LSP2, X97770; C. vicina LSP2, U89789; M. domestica A1 cDNA, AF188890; A2 cDNA, AF092177, F1 cDNA, AF188889, F2 cDNA, U72651, F3 cDNA, AF188888.

Figure 2. Amino acid similarities among the A1, A2 and LSP1 proteins. Amino acid sequences were deduced from the A1 and A2 cDNAs and aligned with the D. melanogaster LSP1 protein. Identical amino acids for A1 and A2 are indicated by blank spaces. Dashes represent a lack of corresponding information. Amino acids are represented as the standard single-letter abbreviations. GenBank accession numbers: M. domestica A1, AF188890; M. domestica A2, AF092177; D. melanogaster LSP1, β subunit, U63556.

IMB173.fm Page 171 Tuesday, March 21, 2000 2:38 PM

172

M. de L. Capurro

et al.

© 2000 Blackwell Science Ltd,

Insect Molecular Biology

,

9

, 169–177

of proteins (Capurro

et al.

, 1997) (Fig. 5). The proteinhas been redesignated Hex-F to reflect its similarity tohexamerins. Northern analysis using the F clones as probesshows that a 2.2-kb mRNA displays a temporal expres-sion profile similar to that observed for Hex-F protein. Hex-FmRNA expression initiates with a protein-rich meal anddecreases at the end of egg maturation. No hybridizing

mRNAs are detected either in females reared with a sugardiet, or in the ovaries of females fed on a protein diet (Fig. 6).

Determination of the number of

Musca domestica

hexamerin genes

Genomic DNA from

M. domestica

was digested withseveral restriction enzymes and hybridized separately withthe A1 and F2 cDNAs (Fig. 7). The restriction enzymeswere selected based on the cDNA sequence so that theywould digest the genomic DNA outside the known genesequence. Using the A1 cDNA as a probe, fragments of5.1 and 14.2 kb were generated with

Xho

I. Digestion with

Kpn

I yielded major fragments of 2.4 and 4.0 kb, and lightlyhybridizing fragments of

≈

2.5 and 4.5 kb. Double diges-tion with

Xho

I and

Kpn

I produced a pattern similar to

Kpn

Ialone. Digestion with

Cla

I produced a major fragment of

≈

7.0 kb and a lighter one at

≈

12.9 kb, and digestion with

Bam

HI produced three lightly hybridizing fragments of

≈

4.1,7.0 and

≈

8–9 kb. Double digestion with

Bam

HI and

Cla

Iproduced a major fragment at 1.4 kb and a minor one at1.7 kb. The size of the fragments in the

Xho

I digestionproducts most likely reflects the presence of at least twogenes with complementarity to the A1 cDNA. The diffusebands may reflect allelic polymorphism in the populationof flies used to generate the genomic DNA.

Similar analysis was performed with the F2 cDNA as aprobe.

Xho

I yielded a hybridizing fragment of 4.6 kb,

Kpn

Iproduced three major fragments at 2.3, 3.5 and 4.6 kb,and double digestion yielded similar-sized fragments tothe

Kpn

I digested clone. Digestion with

Cla

I produced twohigh molecular weight fragments between

≈

18 and 22.1 kb.An additional fragment of

≈

9.0 kb showed a faint signal.Digestion with

Bam

HI yielded major fragments at 5.9 and

Figure 3. Expression of A1 mRNA during the M. domestica life cycle. (I) (A) Total RNA isolated from M. domestica larval fat bodies, pupae and adult insects maintained on different diets was submitted to electrophoresis, transferred to nylon membranes and probed with 32P-labelled A1 cDNA, as described in Experimental procedures. (B) rRNA stained with ethidium bromide. Larva: days 2–4, feeding stage; day 5, beginning of wandering stage. Pupa: days 1–5, pupal stage. Female and male: (AA) adult insects maintained on sugar-water diet for 72 h; 1–4, protein diet for 24, 48, 72 and 96 h, respectively. (II) RNA and hexamerin quantification during the M. domestica life cycle. The bars represent mRNA levels determined by densitometry of the autoradiogram presented in I-A. Quantification of Hex-L protein (dashed line) was performed by de Bianchi et al. (1983). Larva: days 2–4, feeding stage; day 5, wandering stage. Pupa: days 1–5, pupal stage. Adult: (1) recently emerged insects; (2) protein diet for 24 h.

Figure 4. SDS-PAGE and immunoblot of protein extracts from E. coli expressing GST-A2-Hisx6. The proteins within bacterial extracts were fractionated on a 12% polyacrylamide SDS gel and visualized by Coomassie blue staining (A). The resolved proteins were transferred to nitrocellulose and probed with M. domestica anti-Hex-L (B) or anti-GST (C). Each lane represents soluble polypeptides from 0.1 ml bacterial culture. Molecular weight markers are indicated in kDa on the left. Lane 1, protein expressed by pAKSS-A2 (GST-A2-Hisx6). Lane 2, protein expressed by pAKSS without insert (GST-Hisx6). The arrows indicate the position of the GST-A2-Hisx6 fusion protein.

IMB173.fm Page 172 Tuesday, March 21, 2000 2:38 PM

Musca domestica

hexamerins

173

© 2000 Blackwell Science Ltd,

Insect Molecular Biology

,

9

, 169–177

Figure 5. Amino acid similarities among the F series of clones and the D. melanogaster LSP2 protein. Amino acid sequences were deduced for the F1, F2, and F3 clones and aligned with the LSP2 sequence. Identities are indicated by blank spaces and dashes represent gaps introduced to improve alignment, or a lack of corresponding sequence. The LSP2 and F2 proteins in the figure were adapted from Capurro et al. (1997). GenBank accession numbers: M. domestica F1, AF188889; M. domestica F2, U72651; M. domestica F3, AF188888; D. melanogaster LSP2, X97770.

Figure 6. Hex-F mRNA detection during the first and second gonotrophic cycles of M. domestica. (I) Northern blot of total RNA isolated from adult female probed with 32P-labelled F1, F2 and F3 cDNAs. (A) Autoradiograms. (B) rRNA stained with ethidium bromide. The numbers above the figures correspond to ovary stages (S4–S10) (Adams, 1974). (II) RNA and Hex-F protein quantification profiles during the first and second gonotrophic cycle. The autoradiograms from IA were analysed by densitometry and normalized by rRNA (IB) (bars). Pereira et al. (1989) performed the Hex-F quantification.

IMB173.fm Page 173 Tuesday, March 21, 2000 2:38 PM

174

M. de L. Capurro

et al.

© 2000 Blackwell Science Ltd,

Insect Molecular Biology, 9, 169–177

10 kb, and a minor signal at 8.6 kb. Double digestion withClaI and BamHI gives a pattern similar to BamHI exceptthat a minor signal at ≈ 12 kb becomes evident. The multiplefragments resolved in the ClaI digestion likely reflect multiplegenes with similarity to the F2 cDNA probe.

Discussion

Musca domestica has two hexamerins, Hex-L, which ispresent during the larval and pupal stages, and Hex-F,which is found only in adults (de Bianchi et al., 1983; Pereiraet al., 1989). The presence of ‘larval-like’ hexamerins inadults has been described in other Dipteran insects(Benes et al., 1990; Zakharkin et al., 1997); however, anadult-specific hexamerin has only been described in M.domestica (Capurro et al., 1997).

The M. domestica Hex-L is an LSP1-type hexamerin(Telfer & Kunkel, 1991) composed of 26% aromatic amino

acids and 3.5% methionine (Marinotti & de Bianchi,1986a). Hex-L is synthesized by the larval fat bodies andis secreted into the haemolymph during the feeding stage.Radioactive labelling of Hex-L in dissected fat body invitro revealed that its synthesis is interrupted at the begin-ning of the wandering stage, and that the protein is thenendocytosed by the fat-body cells (de Bianchi et al., 1983;Marinotti & de Bianchi, 1986a,b). During the pupal stage,the amount of Hex-L decreases and the protein is notdetected in adult flies.

Analysis of the A1 and A2 cDNAs indicates that theylikely represent genes that encode Hex-L. Antibodies raisedto Hex-L recognize the recombinant fusion protein expressedfrom A2. This 2.6-kb mRNA detected by A1 in Northernanalysis is sufficient to encode polypeptides of 83 or89 kDa, the size of the Hex-L subunits detected by sodiumdodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) (de Bianchi et al., 1983; Marinotti & de Bianchi,1986a).

Interestingly, the expression profile of the 2.6-kb mRNAdetected by the A1 cDNA probe indicates that the cor-responding gene is active through the end of the larvalstages. This correlates with the protein synthesis profiledetected by de Bianchi et al. (1983). This apparent cou-pling of mRNA expression and protein synthesis suggeststhat some level of transcriptional control is used in Hex-Lsynthesis.

The control of dipteran hexamerin gene expression isnot well understood, but there is evidence that ecdysoneand juvenile hormone may play a role in both inductionand repression (Lepesant et al., 1986; Jones et al., 1993;Antoniewski et al., 1995). In C. vicina, calliphorin biosynthesisceases two days before a decrease of the correspondingmRNA levels in larval fat bodies is observed (Sekeris &Scheller, 1977). In Drosophila melanogaster, LSP synthesisis interrupted at the end of larval stage, but the mRNAscan still be detected in pupae (Powell et al., 1984), and inDacus oleae, the hexamerin mRNA can be detected untilthe end of the pupal stage, much after the protein synthesisstops (Patrinou-Georgoulas et al., 1987). These data indic-ate the existence of translational regulation mechanismscontrolling hexamerin synthesis in Dipteran insects, althoughtranscriptional regulation may also occur. Our dataindicate that the M. domestica larval hexamerin is mostlikely subject to transcriptional regulation as the principalform of synthesis control. In the mosquitoes, Aedes aegyptiand Anopheles gambiae, hexamerin transcription is inter-rupted at the time of pupal moult, but in these species it isnot clear whether transcriptional or translational mechan-isms control hexamerin synthesis (Korochkina et al., 1997;Zakharkin et al., 1997; Gordadze et al., 1999). Gordadzeet al. (1999) suggested that in Ae. aegypti, the regulationof steady-state levels of the hexamerin transcripts and theproteins may occur at multiple levels, potentially involving

Figure 7. Southern Blot of digested M. domestica DNA. Genomic DNA from M. domestica was digested with the indicated restriction enzymes and fragments separated by agarose gel electrophoresis. The DNA was then transferred to a nylon membrane filter and probed by hybridization with 32P-labelled A1 cDNA or F2 cDNA, as described in the Experimental procedures.

IMB173.fm Page 174 Tuesday, March 21, 2000 2:38 PM

Musca domestica hexamerins 175

© 2000 Blackwell Science Ltd, Insect Molecular Biology, 9, 169–177

transcription, RNA stability as well as translatability, andprotein stability in the haemolymph and fat body.

The adult specific hexamerin, Hex-F, is composed of12% aromatic amino acids and has a low content ofmethionine (1%) (Capurro et al., 1997), which defines Hex-F as a LSP2-type of hexamerin (Telfer & Kunkel, 1991).Hex-F is synthesized abundantly during vitellogenesis infemales, but in males the amount of protein does notexceed 10% of that found in females. The quantification ofHex-F production in the haemolymph showed a temporalcorrelation between the protein synthesis pattern and thegonotrophic cycles (Pereira et al., 1989). In D. melanogaster,LSP2 synthesis in adults seems to coincide with vitello-genesis (Benes et al., 1990). However, in M. domestica,this coincidence becomes more evident because all of theovarioles develop synchronously.

The F1, F2 and F3 cDNAs hybridized to a 2.2-kb mRNAfound specifically in adult fat bodies. The transcription ofHex-F genes shows sex-, stage- and tissue-specific regula-tion. Hex-F mRNAs are detected only after a proteinaceousmeal is ingested by the female flies, in accordance withthe previously obtained protein quantification data (Pereiraet al., 1989). The expression patterns of the genes encod-ing Hex-F parallels the abundance of the protein through-out the course of the gonotrophic cycle. In contrast to whatis seen for other described dipteran hexamerins, our dataindicate that a transcriptional regulation is likely to be theprincipal form of M. domestica hexamerin synthesis control.

The Southern blot analyses of genomic DNA indicatethat multiple genes most likely encode the M. domesticaHex-L. Possibly, the different genes contribute their productsto the mature protein. Two-dimensional electrophoresisanalysis revealed at least three different subunits for thisprotein (Marinotti & de Bianchi, 1986a). By 5′ RACE, usingan A1 cDNA-specific antisense oligonucleotide, eight dif-ferent Hex-L encoding cDNAs were obtained (C. K. Moreira-Ferro, unpublished). Hex-F is also encoded by multiplegenes and four Hex-F encoding cDNAs were characterized(Capurro et al., 1997). The distinct hybridization patternsof the Hex-L and Hex-F encoding cDNAs showed thatthese genes belong to different families. Multigenefamilies were described for other dipteran hexamerins.Calliphorin is encoded by a multigene family, with more thantwenty members located in tandem in one chromosome(Schenkel et al., 1985), D. melanogaster LSP1 hexamerinis composed of three subunit types encoded by threedifferent genes (Wolfe et al., 1977) and Ae. aegypti AaHex1and 2 subunits are also encoded by more than one gene(Gordadze et al., 1999). Single-copy genes encoding thesubunits of hexamerins were described in D. melanogasterLSP2 (Akam et al., 1978), C. vicina protein II (Schenkel et al.,1985) and An. gambiae AgHex1.1 (Zakharkin et al., 1997).

The analysis of the deduced amino acid sequences ofthe cDNA clones showed that the larval cDNAs, A1 and

A2, present higher identity and similarity with LSP1-typehexamerins, while the adult cDNAs encode proteins withhigher identity and similarity to the LSP2-type hexamerins.The absence of a LSP2-like hexamerin in larvae is unusualamong Diptera. Furthermore, the presence of a female-enriched hexamerin in the adult stage represents anotherunique observation of the hexamerin subclasses, not onlyamong Diptera but also in other insect orders. To date noother insect has been shown to synthesize a uniquelyfemale-specific or enriched hexamerin at the adult stage.Adult expression of a hexamerin is either a re-expression ofa larval protein or is a continuous expression from larvaethrough the adult. These data suggest a potentially differentutilization by M. domestica of these hexamerins and anadult specialization, to date unique to this dipteran species.

Experimental procedures

Insects

A wild strain of M. domestica was reared in the laboratoryaccording to Ribolla et al. (1993).

Isolation of haemolymph, fat bodies and ovaries

Larval haemolymph was collected by puncturing the anterior endof the animals and pooled in centrifuge tubes containing a fewcrystals of phenylthiocarbamide. Adult haemolymph was obtainedfrom CO2-anaesthetized insects by cutting the wings and remov-ing the haemolymph droplets from the wounds with a capillarytube. Both larval and adult haemolymph was centrifuged at 11 000 gfor 5 min at 4°C, and the supernatants used for the experiments.Fat body and ovaries were dissected in 0.15 M NaCl, and storedat –70°C or used immediately for RNA extraction.

Construction and screening of larval fat body cDNA library

A cDNA library of 1.2 × 109 recombinant clones was constructedfrom polyadenylated RNA prepared from fat body dissected from4-day-old M. domestica larvae. The cDNA was cloned into thephage λgt11 expression vector (cDNA Synthesis System Plus,Amersham International plc) utilizing the EcoRI restriction site.The cDNA clone, A1, was isolated during an immunoscreen forthe major haemolymph lipoprotein (lipophorin). The A1 DNA insertwas isolated, ligated into the plasmid vector pBluescript SK (+1–)phagemid (Strategene), and sequenced.

Northern blotting

Total RNA was isolated from M. domestica ovaries, carcasses(whole bodies without ovaries), larval fat body, pupa and adultflies maintained on different diets, using the Trizol reagent andthe protocol recommended by the manufacturer (Gibco-BRL).Purified RNA was subjected to electrophoresis through a 1.4%agarose gel (4 µg per lane) and blotted on to nylon membranes(Sambrook et al., 1989). The filters were prehybridized for 5 minwith 0.12 M Na-Phosphate buffer, pH 7.2, containing 50% forma-mide, 0.25 M NaCl, 7% SDS and 1 mM ethylenediaminetetra-aceticacid (EDTA) and hybridized for 16 h at 42°C with 32P-labelled

IMB173.fm Page 175 Tuesday, March 21, 2000 2:38 PM

176 M. de L. Capurro et al.

© 2000 Blackwell Science Ltd, Insect Molecular Biology, 9, 169–177

cDNA. The filters were washed with 0.1× SSC containing 0.1%SDS at 55°C.

Southern blotting

DNA from recently emerged adult house flies was isolatedaccording to Sambrook et al. (1989). Ten micrograms of DNAwere digested with several restriction enzymes, subjected toelectrophoresis through a 0.8% agarose gel and transferred tonylon membranes according to Sambrook et al. (1989). Themembranes were prehybridized for 5 min at 65°C, in Churchbuffer (Church & Gilbert, 1984), and hybridized for 16 h at 60°Cwith 32P-labelled cDNAs. The membranes were washed twice for15 min at 60°C in 20 mM Na2HPO4 containing 0.05% orthophos-phoric acid and 10% SDS.

Expression of Musca domestica cDNA-A2 recombinant protein

The cDNA-A2 was modified to create NcoI and SmaI sitesusing site-directed mutagenesis by PCR. The sequence ofthe primers were 5′-CGCGGATCCATGGGTGCCAAGAACTG-3′and 5′-TCCCCCGGGTCCTCAGTGTCATC-3′ (small caps indicatethe mutagenesis sites). Subsequently, the PCR product wasdigested with NcoI and SmaI to permit its cloning into pAKSSvector (Stratmann et al., 1997). The expressed A2 peptide wasfused to glutatione S-transferase (GST) on the N terminus andsix consecutive histidine residues on the C terminus (GST-A2-Hisx6). The expression of the fusion protein was controlled bythe inducible tac promoter. The plasmids encode the ampicillinresistance gene.

Immunoblot analysis

Proteins dissolved in 60 mM Tris–HCl, pH 6.8, containing 2.5% SDS(w/v), 0.36 M β-mercaptoethanol, 0.5 mM EDTA, 10% glycerol(v/v), and 0.005% bromophenol blue (w/v) were submitted toSDS-PAGE (Laemmli, 1970) and afterwards either stained withCoomassie blue R or transferred to nitrocellulose membranes. Themembranes containing the transferred proteins were incubatedwith 200-fold diluted M. domestica Hex-L antiserum (de Bianchiet al., 1983) or M. domestica Hex-F antiserum (Capurro et al.,1997). A goat anti-rabbit immunoglobulin conjugated with alkalinephosphatase and BCIP/NBT tablets (Sigma) was used to visualizethe reactive proteins (Harlow & Lane, 1988). The membranescontaining the GST protein were incubated with 2000-fold dilutedmonoclonal anti-GST serum. A goat anti-mouse immunoglobulinFc specific fragment conjugated with peroxidase and the enhancedchemiluminescence system (ECL) from Amersham were used tovisualize the reactive bands.

5′ rapid amplification of cDNA ends

The 5′ RACE for Rapid Amplification of cDNA Ends Kit, Version2.0 (Gibco-BRL), was used to amplify the 5′ region of the larvalhexamerin cDNAs. In the first strand cDNA synthesis, 1 µg of totalRNA from M. domestica larval fat bodies, isolated with Trizolreagent (Gibco-BRL), was primed using an A1 cDNA–specificantisense oligonucleotide, A1R4 (CGGCGGCCGCGCATCATGG-TTTCGT). For PCR amplification of target cDNA we used the nestedprimer, A1R3 (CGGCGGCCGCAACATGGGATCGCGCATCA). Theresulting products were cloned in pBC KS (Stratagene) andsequenced.

Acknowledgements

The authors would like to thank Lynn Olson for help inpreparing the manuscript and Neuza S. Fernandez formaintaining the flies. Thanks also go to Lisette Clark fortechnical assistance. This work was supported by grantsfrom Fundação de Amparo à Pesquisa do Estado de SãoPaulo (FAPESP) (AGdeB and OM) and the John D. andCatherine T. MacArthur Foundation (AAJ). AGdeB and OMare CNPq research fellows.

References

Adams T.S. (1974) The role of juvenile hormone in houseflyovarian follicle morphogenesis. J Insect Physiol 20: 263–276.

Akam, M., Roberts, D., Richards, G. and Ashburner, M. (1978)Drosophila: The genetics of two major larval proteins. Cell 13:215–225.

Ancsin, J.B. and Wyatt, G.R. (1990) Purification and characterizationof two hemolymph proteins from Locusta migratoria. MolecularInsect Science (Hagedorn, H.H., Hildebrand, J.G., Kidwell,M.G. and Law, J.H., eds), pp. 275–276. Plenum Press, NewYork.

Antoniewski, C., O’Grady, M.S., Edmonson, R.G., Lassieur, S.M.and Benes, H. (1995) Characterization of an EcR/USP hetero-dimer target site that mediates ecdysone responsiveness ofthe Drosophila LSP-2 gene. Mol Gen Genet 249: 545–556.

Benes, H., Edmondson, R.G., Fink, P., Kejzlarova-Lepesant, J.,Lepesant, J.A., Miles, J.P. and Spivey, D.W. (1990) Adult expres-sion of the Drosophila Lsp2 gene. Dev Biol 142: 138–146.

Capurro, M.deL., Marinotti, O., Farah, C.S., James, A.A. and deBianchi, A.G. (1997) The nonvitellogenic female protein ofMusca domestica is an adult-specific hexamerin. Insect MolBiol 6 (1): 97–104.

Church, G.M. and Gilbert, W. (1984) Genomic sequencing. ProcNatl Acad Sci USA 81: 1991–1995.

de Bianchi, A.G., Marinotti, O. and Espinoza-Fluentes, F.P. andPereira, S.D. (1983) Purification and characterization of Muscadomestica storage protein and its developmental profile.Comp Biochem Physiol 76B: 861–867.

Faria, F.S., Garcia, E.S. and Goldenberg, S. (1994) Synthesis of ahemolymph hexamerin by the fat body and testis of Rhodniusprolixus. Insect Biochem Mol Biol 24: 59–67.

Gordadze, A.V., Korochkina, S.E., Zakharkin, S.O., Norton, A.L.and Benes, H. (1999) Molecular cloning and expression oftwo cDNAs from the mosquito, Aedes aegypti. Insect Mol Biol8 (1): 55–66.

Harlow, E. and Lane, D. (1988) Antibodies–A Laboratory Manual.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Jamroz, R.C., Beintema, J.J., Stam, W.T. and Bradfield, J.Y. (1996)Aromatic hexamerin subunit from adult female cockroaches(Blaberus discoidales): Molecular cloning, supression by juvenilehormone, and evolutionary perspectives. J Insect Physiol 42:115–124.

Jones, G., Manczak, M. and Horn, M. (1993) Hormonal regula-tion and properties of a new group of basic hemolymphproteins expressed during insect metamorphosis. J BiolChem 268: 1284–1291.

Korochkina, S.E., Gordadze, A.V., York, J.L. and Benes, H.

IMB173.fm Page 176 Tuesday, March 21, 2000 2:38 PM

Musca domestica hexamerins 177

© 2000 Blackwell Science Ltd, Insect Molecular Biology, 9, 169–177

(1997) Mosquito hexamerins: characterization during larvaldevelopment. Insect Mol Biol 6 (1): 11–21.

Laemmli, U.K. (1970) Cleavage of structural proteins duringthe assembly of the head of bacteriophage T4. Nature 227:680–685.

Lepesant, J.A., Maschat, F., Kejzlarova-Lepesant, J., Benes, H. andYanicostas, C. (1986) Developmental and ecdysteroid regula-tion of gene expression in the larval fat body of Drosophilamelanogaster. Arch Insect Biochem Physiol 1: 133–141.

Marinotti, O. and de Bianchi, A.G. (1986a) Structural propertiesof Musca domestica storage protein. Insect Biochem 16:709–716.

Marinotti, O. and de Bianchi, A.G. (1986b) Uptake of storageprotein by Musca domestica fat body. J Insect Physiol 32:819–825.

Marinotti, O., Nunes, L.R. and de Bianchi, A.G. (1988) Hetero-geneous glycosylation of Musca domestica arylphorin.Biochem Biophys Res Commun 151: 1004–1010.

Patrinou-Georgoulas, M., Souliotis, B.L. and Dimitriadis, G.J.(1987) A study on the developmental appearance of serumproteins and its mRNA in the insect Dacus oleae. CompBiochem Physiol 87B: 179–188.

Pereira, S.D., Marinotti, O. and de Bianchi, A.G. (1989) Non-vitellogenic female protein in Musca domestica. Arch InsectBiochem Physiol 11: 245–255.

Powell, D., Sato, D., Brock, H.W. and Roberts, D.B. (1984) Regula-tion of the larval serum proteins of Drosophila melanogaster.Dev Biol 102: 206–215.

Ribolla, P.E.M., Daffre, S. and de Bianchi, A.G. (1993)Cathepsin B and acid phosphatase activities during Muscadomestica embryogenesis. Insect Biochem Mol Biol 23 (2):217–223.

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular

cloning. A Laboratory Manual. Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, NY.

Schenkel, H., Kejzlarova-Lepesant, J., Berreur, P., Moreau, J.,Scheller, K., Bregagere, F. and Lepesant, J.A. (1985) Identifica-tion and molecular analysis of a multigene family encodingcalliphorin, the major larval serum protein of Calliphora vicina.EMBO J 4: 2983–2990.

Sekeris, C.E. and Scheller, K. (1977) Calliphorin, a major pro-tein of the blowfly: correlation between the amount of protein,its biosynthesis, and the titer of translatable calliphorin-mRNAduring development. Dev Biol 59: 12–23.

Shirras, A.D. and Bownes, M. (1989) Cricklet: a locus regulatinga number of adult functions of Drosophila melanogaster. ProcNatl Acad Sci USA 86: 4559–4563.

Stratmann, T., Schmid, S.R., Harper, J.F. and Kang, A.S.(1997) Bacterial expression and purification of recombinantPlasmodium yoelii Circumsporozoite protein. Protein Expres-sion Purification 11: 72–78.

Telfer, W.H. and Kunkel, J.G. (1991) The function and evolution ofinsect storage hexamerins. Annu Rev Entomol 36: 205–228.

Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) ClustalW: improving the sensitivity of progressive multiple sequencealignment through sequence weighting, position-specific gappenalties and weight matrix choice. Nucleic Acids Res 22:4673–4680.

Wolfe, J., Akam, M.E. and Roberts, D.B. (1977) Biochemical andimmunological studies on Larval Serum Protein 1, the majorhaemolymph protein of Drosophila melanogaster third-instarlarvae. Eur J Biochem 79: 47–53.

Zakharkin, S.O., Gordadze, A.V., Korochkina, S.E., Mathiopoulos, K.D.,Della Torre, A. and Benes, H. (1997) Molecular cloning andexpression of a hexamerin cDNA from the malaria mosquito,Anopheles gambiae. Eur J Biochem 246 (3): 719–726.

IMB173.fm Page 177 Tuesday, March 21, 2000 2:38 PM