Journal of Autoimmunity 24 (2005) 243e250

www.elsevier.com/locate/issn/08968411

Evaluation of IDDM8 susceptibility locus in a Russiansimplex family data set

Dimitry A. Chistiakova, Yuri A. Seryoginb, Rustam I. Turakulovc,*,Kirill V. Savost’anovb, Elena V. Titovichd, Lyubov’ I. Zilbermand,

Tamara L. Kuraevad, Ivan I. Dedovd, Valery V. Nosikovb

aLaboratory of Aquatic Ecology, Katholieke Universiteit Leuven, B-3000 Leuven, BelgiumbDepartment of Molecular Diagnostics, Federal Research Centre GosNIIgenetika, 113545 Moscow, Russia

cAustralian Genome Research Facility, University of Queensland, Brisbane QLD 4072, AustraliadEndocrinology Research Centre, 117036 Moscow, Russia

Abstract

Type 1 diabetes (T1D) susceptibility locus, IDDM8, has been accurately mapped to 200 kilobases at the terminal end ofchromosome 6q27. This is within the region which harbours a cluster of three genes encoding proteasome subunit beta 1 (PMSB1),

TATA-box binding protein (TBP) and a homologue of mouse programming cell death activator 2 (PDCD2). In this study, weevaluated whether these genes contribute to T1D susceptibility using the transmission disequilibrium test of the data set from 114affected Russian simplex families. The A allele of the G/A1180 single nucleotide polymorphism (SNP) at the PDCD2 gene, which

was significant in its preferential transfer from parents to diabetic children (75 transmissions vs. 47 non-transmissions, c2Z12.85, PcorrectedZ0.0038), was found to be associated with T1D. G/A1180 dimorphism and two other SNPs, C/T771 TBP and G/T(�271)PDCD2, were shown to share three common haplotypes, two of which (A-T-G and A-T-T) have been associated with higher

development risk of T1D. The third haplotype (G-T-G) was related to having a lower risk of disease. These findings suggest that thePDCD2 gene is a likely susceptibility gene for T1D within IDDM8. However, it was not possible to exclude the TBP gene frombeing another putative susceptibility gene in this region.� 2005 Elsevier Ltd. All rights reserved.

Keywords: Type 1 diabetes; IDDM8; PDCD2; Association; Russian population

1. Introduction

Type 1 diabetes (T1D) is an organ-specific disordercharacterized by the autoimmune destruction of pan-creatic b-cells followed by insulin deficiency. T1D isa complex disease, with a strong genetic component.Genome-wide scans have resolved several regions in the

* Corresponding author. SNP section, Australian Genome Research

Facility, University of Queensland, Brisbane QLD 4072, Australia.

Tel.: C61 7 3346 9682; fax: C61 7 3365 1823.

E-mail address: rust.turakulov@agrf.org.au (R.I. Turakulov).

0896-8411/$ - see front matter � 2005 Elsevier Ltd. All rights reserved.

doi:10.1016/j.jaut.2005.01.017

human genome showing linkage with the disease. Ofthese regions, the human leukocyte antigen (HLA)region of the chromosome is the major locus (IDDM1),conferring up to 40% susceptibility to T1D. Other non-HLA loci show modest genetic effects in conferringT1DM predisposition. One of these susceptibility loci,IDDM8, was mapped to the proterminal region ofchromosome 6q, 6q27 [1e4]. Further studies havesuggested that the locus might be localized to theterminal 200 kilobases of chromosome 6q27 [5]. Thisregion has been shown to contain three tightly clusteredgenes, PMSB1, TBP and PDCD2 encoding proteasome

244 D.A. Chistiakov et al. / Journal of Autoimmunity 24 (2005) 243e250

subunit beta 1, TATA-box binding protein and homo-logue of mouse programming cell death activator 2,respectively [6e10].

The PMSB1 gene encodes a core component of the20S multicatalytic proteinase complex of B-type family.A modified proteasome catalyses processing of class IMHC peptides in order for it to participate in theimmune response [11]. TBP regulates the expression ofa wide variety of target genes, including interleukin-2(IL-2) and the b2 microglobulin (B2M) subunit of themajor histocompatibility complex class I molecule[12,13]. IL-2 is itself a major functional candidate forautoimmune disease (including type 1 diabetes inhumans) because of its ability to control T cell functionand differentiation. Susceptibility to autoimmune T1Din the mouse model has been mapped directly to theIL-2 and B2M genes (Idd3 and Idd13 loci, respectively)[14,15]. PDCD2 is highly homologous in both mouseand rat RP-8. This protein was shown to be associatedwith thymocyte apoptosis in both species [6,16]. Thesedata, therefore, suggest that all three genes may beconsidered likely candidate genes for susceptibility toT1D.

In this investigation, we evaluate whether these genescontribute to T1D susceptibility in Russian diabeticpatients by estimating allele transfer from parents tooffspring, both affected and non-affected, in simplexfamilies, using the transmission disequilibrium test(TDT).

2. Materials and methods

2.1. Subjects

We studied 114 Russian simplex families, eachcontaining two siblings (one affected with T1D di-agnosed before the age of 17 years and one non-diabeticsibling). Sixteen simplex families were recruited from theSamara Diabetic Centre, the others being recruited fromthe Endocrinology Research Centre in Moscow. In-formed consent was obtained from all subjects prior toparticipation in this study. The research protocol wasapproved by the Ethics Committee of the Endocrinol-ogy Research Centre, and performed according toprinciples of the Helsinki Declaration.

Diabetes was diagnosed according to the criteriadefined by the National Diabetes Data Group [17].T1D was classified based on the presence of ketosis, lowbody mass index, and the need for insulin treatment.In all subjects, diagnosis of the disease was confirmed bythe presence of at least one of the two major isletautoantibodies: GAD65 antibodies and/or anti-tyrosine phosphate-like molecule (ICA512) antibodies[18,19]. C-peptide levels were measured in the bloodserum of patients using a commercially available

radioimmunoassay (Medipro AG, Teufen, Switzerland)[20]. HbA1c measurements were performed using high-performance liquid chromatography (DIAMAT, BIO-RAD, Hercules, CA, USA). Immunological and clinicalcharacteristics of diabetic and non-affected children aresummarized in Table 1.

2.2. DNA analysis

Genomic DNA was extracted from whole bloodsamples collected in disodium EDTA (3 mg/ml)according to the established protocol [21]. The promoterregion, exon 1 and exon 2 of the PDCD2 gene andthe promoter region of the TBP gene were sequencedin 30 diabetic siblings to find new SNPs. We used5#-GCCGACTCGGCGAAGCCCAGATCCAC-3# asforward primer and 5#-GGGAAGTGGGGGATCGCCATGCCTCA-3# as reverse primer to produce a 683-bpPCR product containing the promoter region and exon1 of PDCD2 for subsequent DNA sequencing. The PCRcocktail consisted of 50 mM TriseHCl pH 8.3, 16.6 mMammonium sulfate, 1.0 mM MgCl2, 0.1% Triton X-100,0.2 mM each dNTP, 1.0 U Taq DNA polymerase(Fermentas, Lithuania), 5 mM of each primer and 100 ngof genomic DNA in a total volume of 20 ml. PCR wascarried out on a T1 Thermocycler (Biometra, Goettin-gen, Germany) at 95 �C for 3 min followed by 30 cyclesof denaturation at 95 �C for 15 s, annealing at 65 �C for15 s and extension at 72 �C for 30 s, with final extensionat 72 �C for 10 min. To amplify a 436-bp PCR productrepresenting exon 2 of PDCD2, 5#-CACCGCTGCATCTTCCTCTTCT-3# forward primer) and 5#-CACCCATGCTCCCTATAATCTCTGA-3# (reverse primer)oligos were used under the same PCR cycling con-ditions, annealing at 62 �C. A 771-bp DNA fragmentcontaining the promoter region of the TBP gene wasamplified, using annealing at 60 �C and 5#-GTATAACATATGATTACGCCACAA-3# as forward primer

Table 1

Clinical characteristics of affected and non-affected children in 114

Russian simplex T1D families

Characteristic Affected sibs

(nZ114)

Non-affected sibs

(nZ114)

Male/female ratio 66/48 53/61

Age (years) 19.3G4.5 21.1G6.3

Duration of diabetes (years) 9.5G4.3

Insulin dose (U/kg) 1.15G0.05

Body mass

index (kg/m2)

18.5G2.2 23.0G2.5

HbA1c (%) 9.8G2.2 6.5G1.4

Basal serum C-peptide (pmol/ml) 0.25G0.04 0.41G0.04

GAD65 antibody-positive

patients, n(%)

100 (88)

ICA512 antibody-positive

patients, n(%)

81 (71)

Values are meanGSD.

Table 2

Description of mole T1D in a Russian sample

SNP dbSNP ID Restriction

enzyme

to digest PCR

product

Digestion buffer

(digestion

temperature, �C)

Duration of

digestion, h

Definition of

alleles

(length of digestion

products, bp)

Ala/Ser 11548695 MunI Fermentas G (37) 3 Ala allele: (97C22);

Ser allele:

undigestable (119)

Gly/Val 10334 SalI Fermentas O (37) 3 Gly allele:

undigestable (103);

Val allele: (79C24)

A/G 2056970 XbaI Fermentas R (37) 3 A allele:

undigestable (106);

G allele: (82C24)

T/C MlsI Fermentas R (37) 3 T allele: (21C81);

C allele:

undigestable (102)

C/T 9366249 NdeI Fermentas R (37) 2 C allele:

undigestable (134);

T allele: (110C24)

G/T SmuI Fermentas Y (37) 3 G allele: (125C121);

T allele:

undigestable (246)

G/A 8770 AatII Fermentas Y (37) 2 G allele: (120C31);

A allele:

undigestable (151)

245

D.A.Chistia

kovet

al./JournalofAutoim

munity

24(2005)243e

250

cular assays to detect SNPs within three candidate genes studied for association with susceptibility to

Gene Location within

the gene

(position from the

transcription

start, bp)

PCR primers, 5#/3# Annealing

temperature, �C

([Mg2C], mM)

PMSB1 Codon 171 F:CCTTCAAGGCTGGAGGCTGAGCAAT;

R:CCGCATGGCTCTGTCCAAGGAC

65 (1.5)

PMSB1 Codon 218 F:CTATGCAGATCCGGAGTGCTCG;

R:GTTGGCGACAGGAACCAGAC

60 (1.5)

PMSB1 Intron 4 (12911) F: CAGATGAAGAATTTCTTTAATC;

R: CTTCAGCCCCCTTCCTCCCT

55 (2.0)

TBP Promoter (�97) F: CCGCCCCGGAACTCCTCAAG;

R: TTGCTCCCACTAGGGCCGTG

62 (1.0)

TBP Codon 257 F: GTTCTTGGACTTCAAGATTCAGC;

R: CAATCATAATACATTTCAGACTTA

60 (1.0)

PDCD2 Promoter (�271) F: GGGTGCTCTGGGATGGTTCTG;

R: TTCCGCTGTAGGGTCCTCACTTTA

60 (1.0)

PDCD2 3#-UTR (1180)

isoform 2

F:GTGTGGAAGCAGGATGTAACAGATAC;

R:CTAATAAGTAGACACTGTGTAAGCAAGA

51 (1.0)

246 D.A. Chistiakov et al. / Journal of Autoimmunity 24 (2005) 243e250

and 5#-GGGTCACTGCAAAGATCACTAT-3# as re-verse primer. The PCR primers mentioned above wereused for sequencing the corresponding PCR productwith a Big Dye Terminator v1.1 Cycle sequencing kit(Applied Biosystems, Foster City, CA, USA). Sequenc-ing samples were loaded on the ABI PRISM 310Capillary Genetic Analyser (Applied Biosystems). Gelimages were analysed with the ABI PRISM DNASequencing Analysis version 3.4 software (AppliedBiosystems).

A (CAG)n trinucleotide microsatellite marker locatedwithin exon 2 of the TBP gene was amplified using PCRprimers, whose sequence has been previously published[22]. Fluorescence-based genotyping was performedwith an ABI PRISM 310 Genetic Analyser andGeneScan Analysis Software Version 3.1.2 (AppliedBiosystems). Putative SNPs located within correspond-ing candidate genes (PMSB1, TBP and PDCD2) werealso genotyped in simplex families using the PCR-RFLP(restriction fragment length polymorphism) approach.Two SNPs, T/C(�97) and G/T(�271), were discoveredafter sequencing the promoter region of the TBP andPDCD2 gene, respectively. Other SNPs were taken fromthe dbSNP database (http://www.ncbi.nlm.nih.gov/SNP/). PCR-RFLP assays for detecting each SNP aredescribed in Table 2. All restriction enzymes used inthese assays were manufactured in Fermentas (Vilnius,Lithuania). Following digestion, DNA products wereseparated in a 2% agarose gel with ethidium bromideusing pUC19/MspI as a DNA molecular weightstandard.

2.3. Statistical analysis

Using the GENEHUNTER 2.1 software [23], thetransmission disequilibrium test was performed onsimplex families to identify alleles and haplotypespreferentially transmitted from heterozygous parentsto diabetic children [24]. A P value (Pc) of less than 0.05,after correction for multiple comparisons, was consid-ered significant. For the (CAG)n marker, an overallTDT P value was also calculated.

The degree of pairwise linkage disequilibrium (LD)between markers was calculated using the 2LD software[25], and expressed as D#, which represents the pro-portion of the maximum possible allele association giventhe allele frequencies and the direction of association.D#Z1 corresponds to complete disequilibrium.

3. Results

Sequencing of genomic DNA from 30 diabeticchildren resulted in the finding of two new biallelicSNPs that had not been described in the dbSNPdatabase (Figs. 1 and 2). Both markers, T/C(�97) and

G/T(�271), are situated in the promoter regions of theTBP and PDCD2 genes, respectively. Genotyping 100unrelated non-affected individuals (parents) showed thatthere are common nucleotide substitutions, with a minorallele frequency higher than 0.3 (Table 3). For observedgenotype frequencies of both SNPs, no deviation fromthe HardyeWeinberg equilibrium was found (Table 3).

These new biallelic markers, along with five SNPstaken from the dbSNP database and the (CAG)ntrinucleotide repeat polymorphism at the PDCD2 gene,were evaluated to determine whether the PMSB1, TBPand PDCD2 genes could confer susceptibility to type 1diabetes. However, for two putative amino acid subs-titutions, AlaSer171 and Gly/Val218, derived from thedbSNP and located within the PMSB1 gene, a minor

Fig. 1. Identification of the polymorphic G/T(�271) nucleotide

substitution within the promoter region of the PDCD2 gene. PCR

products, amplified from genomic DNA of two unrelated subjects were

sequenced. The upper sequencing profile represents the T/T homozy-

gous variant of this dimorphism whereas the lower sequence represents

the G/T heterozygote.

Fig. 2. Restriction analysis of the newly identified T/C(�97)

dimorphism at the PDCD2 gene. PCR products amplified from

genomic DNA of ten unrelated individuals were digested with

restriction endonuclease MspI. Digestion DNA fragments were

electrophoretically separated in 2% agarose gel containing ethidium

bromide. Lanes 1e10 represent the following genotypes: lanes 1, 3, 6

and 9, C/C homozygote; lanes 2, 4, 7, 10 and 11, C/T heterozygote;

lane 8, T/T homozygote. Lane 12 contains the molecular weight DNA

marker, pUC19/MspI.

247D.A. Chistiakov et al. / Journal of Autoimmunity 24 (2005) 243e250

allele was not detected among the members of affectedRussian simplex families. Other markers were found tobe polymorphic in Russian patients. A significantpreferential transcription from parents to diabeticprogeny was primarily found for a minor allele of theC/T771 TBP, G/T(�271) PDCD2 and G/A1180PDCD2 dimorphisms and for a 200-bp allele of the(CAG)n microsatellite (Table 4). Further correction,however, was significantly preferable when transferringthe A allele of the G/A1180 SNP located at the PDCD2gene (Table 4). This did not happen due to thesegregation distortion because of the random patternof transmission of this allele from parents to unaffectedoffspring (corrected PZ0.21).

These observations suggest that the G/A1180 nucle-otide substitution at the PDCD2 gene is associated withT1D in the Russian family data set. Hence, of the threegenes tested, the PDCD2 gene represents the T1Dsusceptibility gene located within IDDM8 locus. How-ever, this association could theoretically be due tolinkage disequilibrium with the nearby gene. Currentdata suggest that LD blocks are 20e100 kb long [26].

Table 3

Allele and genotype frequencies of T(�97)C TBP and G(�271)T

PDCD2 SNPs in 100 unrelated Russian subjects

Marker Allele/

genotype

Frequency,

n (%)

Hardy-Weinberg

equilibrium

c2 (dfZ2) P

T/C(�97) TBP T 105 (52.5)

C 95 (47.5)

T/T 25 (25) 0.55 0.76

T/C 55 (55)

C/C 20 (20)

G/T(�271) PDCD2 G 124 (62)

T 76 (38)

G/G 38 (38) 0.014 0.99

G/T 48 (48)

T/T 14 (14)

The PDCD2, PMSB1 and TBP genes are closelyclustered within the distance of 50 kilobases (kb)(Fig. 3). We found all polymorphic markers tested arein linkage disequilibrium (Table 5) and, therefore, couldshare a common haplotype with this disease.

Among the markers tested, only the G/A1180dimorphic site at the PDCD2 gene showed an associa-tion with T1D. In the TDT, we estimated haplotypesconsisted of alleles of polymorphic markers, having thestrongest LD (D#>0.8) with the G/A1180 SNP. The C/T771 SNP and the (CAG)n microsatellite were locatedboth within the TBP gene, and the G/T(�271) di-morphism of the PDCD2 gene (Table 5). However, weexcluded from the analysis the multiallelic (CAG)nmarker because it produced multiple haplotypes thatcould significantly decrease the probability of findinga common predisposing/protective haplotype in a limitednumber of the affected families.

The TDT analysis resulted in identifying twohaplotypes, T-A-G and T-A-T, composed of alleles C/T771, G/A1180 and G/T(�271) SNPs, respectively.There was a significant preference for transmission ofthese haplotypes from parents to probands. In contrast,the third haplotype (T-G-G) was not preferentiallytransmitted from parents to diabetic children (Table 6).These significant differences in transmission did notoccur due to segregation distortion since the alleletransmission to unaffected siblings remained a randompattern. Hence, our data show that T-A-G and T-A-Thaplotypes are predispositions to the development ofT1D in affected Russian families whereas the T-G-Ghaplotype is associated with lower risk of the disease.

4. Discussion

Of six polymorphisms tested in this study, only the(CAG)n trinucleotide tandem repeat located in intron 2of the TBP gene had been previously evaluated in

Table 4

Transmission disequilibrium test of polymorphic markers located within the TBP, PMSB1 and PDCD2 genes in 114 Russian discordant sibling pairs

with type 1 diabetes

Gene Marker Allele Probands c2 (dfZ1) P Pc Non-affected sibs c2 (dfZ1) P Pc

T NT T NT

TBP (CAG)n 191-bp 6 9 1.20 0.27 8 7 0.13 0.72

194-bp 19 25 1.63 0.20 22 22 0 1.0

197-bp 36 42 0.92 0.34 40 38 0.10 0.75

200-bp 43 27 7.31 0.0069 >0.05 30 40 2.86 0.091

203-bp 21 22 0.05 0.82 25 18 2.28 0.13

Overall (dfZ4) 5.56 2.69 0.61

TBP C/T771 T 40 26 5.94 0.015 >0.05 28 38 3.03 0.082

TBP T/C(�97) C 68 54 3.21 0.073 56 66 1.64 0.20

PMSB1 A/G12911 G 38 27 3.72 0.054 30 35 0.77 0.38

PDCD2 G/T(�271) T 59 40 7.29 0.0069 >0.05 43 56 3.41 0.065

PDCD2 G/A1180 A 75 47 12.85 0.00038 0.0038 52 70 5.31 0.021 >0.05

248 D.A. Chistiakov et al. / Journal of Autoimmunity 24 (2005) 243e250

genetic studies. Increasing number of repeats within thispolyglutamine stretch was shown to be associated withsome inherited neurological and neurovascular disor-ders [27e29]. In our study, this marker showed noassociation with diabetes in Russian simplex families.

However, the G/A1180 dimorphism occurring at thePDCD2 gene has been found to be associated withdiabetes in the Russian family dataset. The A1180 allelepreferentially transmitted from parents to diabeticprogeny constitutes two common risk haplotypes incombination with alleles of the C/T771 and G/T(�271)biallelic markers situated at the TBP and PDCD2 genes,respectively. The alternative G allele is a part of theprotective T-G-G haplotype (Table 6). These datasuggest that the PDCD2 gene confers predisposition toautoimmune diabetes and, in addition, represent theT1D susceptibility gene within IDDM8 in a Russianpopulation.

The PDCD2 gene is mainly expressed in immature Tlymphocytes at the thymus and lymph nodes and less soin a variety of non-lymphoid tissues [30]. PDCD2contains the highly conserved MYND zinc-fingerdomain that functions as a strong transcriptionalrepressor [31]. PDCD2 target genes are not clearlydefined yet. It is proposed that PDCD2 regulates theexpression of host cell factor 1 (HCF-1), which couldmodulate GABP-mediated production of such impor-tant cytokine as IL-2 [32,33] through the co-activation

Fig. 3. Map of the chromosome region 6q27 containing a cluster of

three genes, PSMB1, TBP and PDCD2. The localization of poly-

morphic markers tested for susceptibility to type 1 diabetes is shown.

The lower scale represents physical distance in kilobases (kb).

of GA-binding protein (GABP), a transcription factor.PDCD2 expression is shown to be negatively regulatedby BCL6, which also controls expression of a variety ofgenes, including CD69, CD44,Leu-13, Their productscontribute in the differentiation of B cells [30,34]. Theoverexpression of BCL6 is found to inhibit cellapoptosis, is probably, due to its suppressing effects onPDCD2 [30,35]. These findings suggest that PDCD2could be directly involved in the immune and auto-immune responses. PDCD2 may be related to themaintenance of immune tolerance through mediatingapoptotic pathways in immature aberrant thymocytesand hence prevent further differentiation and expansionof autoreactive T cell clones. This could explaina putative role for the PDCD2 gene as the susceptibilitygene for T1D.

For PDCD2, two alternative mRNA transcriptsexist. The first isoform comprises 344 amino acid (a.a.)residues and is encoded by 1.3-kb mRNA. Thealternative 2.1-kb transcript encodes the PDCD2 iso-form 2 containing 228 a.a. Both protein variants havethe similar 220 a.a N-terminal that contains the MYNDzinc-finger domain. The first isoform is different fromisoform 2 by the distinct C-terminal domain, which maypossibly determine differences in functional significanceand expression pattern between the isoforms. However,these differences remain unknown and need to beclarified.

Interestingly, the G/A1180 SNP is located in the 3#untranslated region of mRNA that encodes a secondisoform of PDCD2 but does not occur in the transcriptencoding the first isoform. It would be interesting toevaluate the polymorphisms situated at the first isoformof PDCD2 to see whether they are associated with T1D.Since the G/A1180 nucleotide change is shown to bea component of disease-associated haplotypes sharedbetween polymorphic markers of two genes (PDCD2and TBP) a likely involvement of the TBP gene in T1Dsusceptibility cannot be excluded. Polymorphic markerswithin these genes are in tight LD and could constitutecomplex LD block(s). A few common disease-associatedhaplotypes, mainly contributing to the susceptibility/resistance to T1D, may exist within these blocks.

Table 5

Linkage disequilibrium estimates between polymorphic markers located within the PMSB1, TBP and PDCD2 genes

Marker G/T12911 PSMB1 C/T(�99) TBP (CAG)n TBP C/T771 TBP G/A1180 PDCD2 G/T(�271) PDCD2

G/T12911 PSMB1 0.83 (0.0008) 0.79 (0.002) 0.75 (0.007) 0.68 (0.012) 0.64 (0.019)

G/T(�99) TBP 13.9 0.93 (0.0001) 0.83 (0.0008) 0.77 (0.004) 0.75 (0.007)

(CAG)n TBP 21.6 7.6 0.90 (0.0002) 0.84 (0.0007) 0.79 (0.002)

C/T771 TBP 29.3 15.3 7.7 0.93 (0.0001) 0.85 (0.0005)

G/A1180 PDCD2 37.0 23.0 15.4 6.1 0.92 (0.0001)

G/T(�271) PDCD2 44.6 30.7 23.1 15.4 7.6

Linkage disequilibrium expressed as D# that represents the proportion of the maximum possible allele association given the allele frequencies and the

direction of the association. The P value is also presented in brackets following the D#. Distance between markers, in kilobases, is shown below the

diagonal.

249D.A. Chistiakov et al. / Journal of Autoimmunity 24 (2005) 243e250

Table 6

Transmission disequilibrium test of haplotypes comprising alleles C/T771 TBP, G/A1180 and G/T(�271) PDCD2 SNPs in 114 Russian discordant

sibling pairs with type 1 diabetes

Haplotypea Probands c2 (dfZ1) P Pc Non-affected sibs c2 (dfZ1) P Pc

Ta NT Ta NT

C-G-C 31 41 2.78 0.095 37 35 0.11 0.74

T-A-G 27 12 11.54 0.00068 0.0048 16 23 2.51 0.11

C-G-T 6 6 0 1.0 4 8 2.67 0.10

T-A-T 51 28 13.39 0.00025 0.0018 32 47 5.70 0.017 >0.05

T-G-G 17 31 8.17 0.0043 0.0030 29 19 4.17 0.041 >0.05

C-A-G 28 38 3.03 0.082 39 27 4.36 0.037 >0.05

T-G-T 5 9 2.29 0.13 8 6 0.57 0.45

a In the haplotype, the order of alleles is as follows C/T771-G/A1180-G/T(�271).

Some biochemical and immunological data suggestthat TBP may be involved in autoimmunity. Thisprotein regulates production of IL-1b, IL-2, IL-4, IL-8and other immune modulators and components [36e38]. Antibodies against TBP have recently been reportedin patients affected with autoimmune diseases such assystemic sclerosis, systemic lupus erythematosus andoverlap syndromes [39].

In conclusion, we have shown that the G/A1180 SNPat the PDCD2 gene is associated with T1D. Thissuggests the PDCD2 gene could represent the IDDM8susceptibility gene in the Russian population. Predis-posing T1D geneegene interactions have been found forthe tightly clustered TBP and PDCD2 genes. They sharetwo common risk haplotypes T-A-G and T-A-Tcomprising alleles of the C/T771 TBP, G/A1180PDCD2 and G/T(�271) PDCD2 SNPs, respectively.This observation suggests a role for the TBP gene as analternative susceptibility gene within the IDDM8susceptibility locus. In the future, developing high-density SNP maps for the TBP-PDCD2 genomic regionand their subsequent evaluation in large T1D-affectedfamily and population samples should resolve which ofthe genes is the true susceptibility gene at the IDDM8locus. It could also determine sequence variations withinboth genes that share the genetic predisposition to T1D.

References

[1] Luo DF, Bui MM, Muir A, Maclaren NK, Thomson G, She JX.

Affected-sib-pair mapping of a novel susceptibility gene to insulin-

dependent diabetes mellitus (IDDM8) on chromosome 6q25-q27.

Am J Hum Genet 1995;57:911e9.

[2] Luo DF, Buzzetti R, Rotter JI, Maclaren NK, Raffel LJ,

Nistico L, et al. Confirmation of three susceptibility genes to

insulin-dependent diabetes mellitus: IDDM4, IDDM5 and

IDDM8. Hum Mol Genet 1996;5:693e8.

[3] Davies JL, Cucca F, Goy JV, Atta ZA, Merriman ME, Wilson A,

et al. Saturation multipoint linkage mapping of chromosome 6q

in type 1 diabetes. Hum Mol Genet 1996;5:1071e4.

[4] Delepine M, Pociot F, Habita C, Hashimoto L, Froguel P,

Rotter J, et al. Evidence of a non-MHC susceptibility locus in

type I diabetes linked to HLA on chromosome 6. Am J Hum

Genet 1997;60:174e87.

[5] Owerbach D. Physical and genetic mapping of IDDM8 on

chromosome 6q27. Diabetes 2000;49:508e12.

[6] Kawakami T, Furukawa Y, Sudo K, Saito H, Takami S,

Takahashi E, et al. Isolation and mapping of a human gene

(PDCD2) that is highly homologous to Rp8, a rat gene associated

with programmed cell death. Cytogenet Cell Genet 1995;71:41e3.[7] Imbert G, Trottier Y, Beckmann J, Mandel JL. The gene for the

TATA binding protein (TBP) that contains a highly polymorphic

protein codingCAGrepeatmaps to 6q27.Genomics 1994;21:667e8.

[8] Okumura K, Nogami M, Taguchi H, Hisamatsu H, Tanaka K.

The genes for the alpha-type HC3 (PMSA2) and beta-type HC5

(PMSB1) subunits of human proteasomes map to chromosomes

6q27 and 7p12-p13 by fluorescence in situ hybridization.

Genomics 1995;27:377e9.[9] Trachtulec Z, Hamvas RMJ, Forejt J, Lehrach HR, Vincek V,

Klein J. Linkage of TATA-binding protein and proteasome

subunit C5 genes in mice and humans reveals synteny conserved

between mammals and invertebrates. Genomics 1997;44:1e7.

[10] Harland L, Crombie R, Anson S, de Boer J, Ioannou PA,

Antoniou M. Transcriptional regulation of the human TATA

binding protein gene. Genomics 2002;79:479e82.[11] Coux O, Tanaka K, Goldberg AL. Structure and functions of the

20S and 26S proteasomes. Annu Rev Biochem 1996;65:801e47.

[12] Rothenberg EV, Ward SB. A dynamic assembly of diverse

transcription factors integrates activation and cell-type informa-

tion for interleukin 2 gene regulation. Proc Natl Acad Sci U S A

1996;93:9358e65.

[13] Hobbs NK, Bondareva AA, Barnett S, Capecchi MR,

Schmidt EE. Removing the vertebrate-specific TBP N terminus

disrupts placental beta2m-dependent interactions with the mater-

nal immune system. Cell 2002;110:43e54.

[14] Denny P, Lord CJ, Hill NJ, Goy JV, Levy ER, Podolin PL.

Mapping of the IDDM locus Idd3 to a 0.35-cM interval

containing the interleukin-2 gene. Diabetes 1997;46:695e700.

[15] Serreze DV, Bridgett M, Chapman HD, Chen E, Richard SD,

Leiter EH. Subcongenic analysis of the Idd13 locus in NOD/Lt

mice: evidence for several susceptibility genes including a possible

diabetogenic role for beta 2-microglobulin. J Immunol 1998;160:

1472e8.

[16] Owens GP, Hahn WE, Cohen JJ. Identification of mRNAs

associated with programmed cell death in immature thymocytes.

Mol Cell Biol 1991;11:4177e88.

[17] National Diabetes Data Group. Classification and diagnosis of

diabetes mellitus and other categories of glucose intolerance.

Diabetes 1979;28(1039):1057.

[18] Naserke HE, Dozio N, Ziegler A-G, Bonifacio E. Comparison of

a novel microassay for insulin autoantibodies with the conven-

tional radiobinding assay. Diabetologia 1998;41:681e3.

250 D.A. Chistiakov et al. / Journal of Autoimmunity 24 (2005) 243e250

[19] Petersen JS, Hejnaes KR, Moody A, Karlsen AE, Marshall MO,

Hoier-Madsen M, et al. Detection of GAD65 antibodies in

diabetes and other autoimmune diseases using a simple radio-

ligand assay. Diabetes 1994;43:459e67.[20] Faber OK, Binder C, Markussen J, Heding LG, Naithani VK,

Kuzuya H, et al. Characterization of seven C-peptide antisera.

Diabetes 1978;27(Suppl 1):170e7.

[21] Kanai N, Fujii T, Saito K, Yokoyama T. Rapid and simple

method for preparation of genomic DNA from easily obtainable

clotted blood. J Clin Pathol 1994;47:1043e4.

[22] Polymeropoulos MH, Rath DS, Xiao H, Merril CR. Trinucleo-

tide repeat polymorphism at the human transcription factor IID

gene. Nucleic Acids Res 1991;19:4307.

[23] Kruglyak L, Daly ML, Reeve-Daly MP, Lander ES. Parametric

and nonparametric linkage analysis: a unified multipoint ap-

proach. Am J Hum Genet 1996;58:1347e63.

[24] Spielman RS, McGinnis ME, Ewens WJ. Transmission test for

linkage disequilibrium: the insulin gene region and insulin-

dependent diabetes mellitus (IDDM). Am J Hum Genet 1993;52:

506e16.

[25] Zapata C, Carollo C, Rodriguez S. Sampling variance and

distribution of the D# measure of overall gametic disequli-

brium between multiallelic loci. Ann Hum Genet 2001;65:395e406.

[26] Wall JD, Pritchard JK. Haplotype blocks and linkage disequilib-

rium in the human genome. Nat Rev Genet 2003;4:587e97.

[27] Perutz MF. Glutamine repeats and inherited neurodegenerative

diseases: molecular aspects. Curr Opin Struct Biol 1996;6:848e58.

[28] Rubinsztein DC, Leggo J, Crow TJ, DeLisi LE, Walsh C, Jain S,

et al. Analysis of polyglutamine-coding repeats in the TATA-

binding protein in different human populations and in patients

with schizophrenia and bipolar affective disorder. Am J Med

Genet 1996;67:495e8.

[29] Nakamura K, Jeong SY, Uchihara T, Anno M, Nagashima K,

Nagashima T, et al. SCA17, a novel autosomal dominant

cerebellar ataxia caused by an expanded polyglutamine in

TATA-binding protein. Hum Mol Genet 2001;10:1441e8.

[30] Baron BW, Anastasi J, Thirman MJ, Furukawa Y, Fears S,

Kim DC, et al. The human programmed cell death-2 (PDCD2)

gene is a target of BCL6 repression: implications for a role of

BCL6 in the down-regulation of apoptosis. Proc Natl Acad Sci U

S A 2002;99:2860e5.

[31] Lutterbach B, Sun B, Schuetz J, Hiebert SV. The MYND motif is

required for repression of basal transcription from the multidrug

resistance 1 promoter by the t(8;21) fusion protein. Mol Cell Biol

1998;18:3604e11.

[32] Scarr RB, Sharp PA. PDCD2 is a negative regulator of HCF-1

(C1). Oncogene 2002;21:5245e54.

[33] Vogel JL, Kristie TM. The novel coactivator C1 (HCF)

coordinates multiprotein enhancer formation and mediates

transcription activation by GABP. EMBO J 2000;19:683e90.

[34] Staudt LM, Dent AL, Shaffer AL, Yu X. Regulation of

lymphocyte cell fate decisions and lymphomagenesis by BCL-6.

Int Rev Immunol 1999;18:381e403.

[35] Kumagai T, Miki T, Kikuchi M, Fukuda T, Miyasaka N,

Kamiyama R, et al. The proto-oncogene Bc16 inhibits apoptotic

cell death in differentiation-induced mouse myogenic cells.

Oncogene 1999;18:467e75.

[36] Pesch J, Brehm U, Staib C, Grummt F. Repression of interleukin-

2 and interleukin-4 promoters by tumor suppressor protein p53.

J Interferon Cytokine Res 1996;16:595e600.

[37] Delgado M, Ganea D. Vasoactive intestinal peptide inhibits IL-8

production in human monocytes by downregulating nuclear

factor kappaB-dependent transcriptional activity. Biochem Bio-

phys Res Commun 2003;302:275e83.

[38] Buras JA, Reenstra WR, FentonMJ. NF beta A, a factor required

for maximal interleukin-1 beta gene expression is identical to the

ets family member PU.1. Evidence for structural alteration

following LPS activation. Mol Immunol 1995;32:541e54.

[39] Chauhan R, Handa R, Das TP, Pati U. Over-expression of TATA

binding protein (TBP) and p53 and autoantibodies to these

antigens are features of systemic sclerosis, systemic lupus

erythematosus and overlap syndromes. Clin Exp Immunol

2004;136:574e84.