Effect of null mutations in the AbNIK1 gene on saprophytic and parasitic fitness of Alternaria...

Plant Pathology

(2008)

57

, 937–947 Doi: 10.1111/j.1365-3059.2008.01864.x

© 2008 The Authors Journal compilation © 2008 BSPP

937

Blackwell Publishing Ltd

Effect of null mutations in the

AbNIK1

gene on saprophytic and parasitic fitness of

Alternaria brassicicola

isolates highly resistant to dicarboximide fungicides

B. Iacomi-Vasilescu

b

, N. Bataille-Simoneau

a

, C. Campion

a

, A. Dongo

a

, E. Laurent

c

, I. Serandat

d

, B. Hamon

a

and P. Simoneau

a

*

a

UMR PaVé A77, 2 Bd Lavoisier, F-49045 Angers cedex, France;

b

USAMV, 59 Bd Marasti, Ro-71331 Bucarest, Romania;

c

FNAMS, Centre Technique des Semences, Impasse du Verger, F-49800 Brain sur l’ Authion; and

d

GEVES-SNES, BP24, F-49071 Beaucouzé, France


field isolates highly resistant to dicarboximide fungicides (DCF) and carrying non-sense codonsor micro-deletions in the

AbNIK1

gene encoding a group III histidine kinase were characterized at the protein level usingspecific antibodies. These isolates, as well as laboratory mutants expressing the same resistant phenotype, were shownto correspond to null mutants. The fitness of these isolates was compared to that of wild-type isolates by measuring i)mycelial growth, ii) sporulation and iii) conidial germination under standard conditions. None of these factors wereaffected in the resistant isolates. Mycelial growth was also measured under stress conditions. Unlike suboptimal incubationtemperatures or exposure to the superoxide ion generator menadione, osmotic stress generated by high sorbitol concen-trations in the culture medium significantly affected the growth of

AbNIK1-

null mutants compared to wild-types. Theeffects of these mutations on parasitic fitness were estimated under both controlled and field conditions after inoculationof radish with individual isolates, to measure their aggressiveness, or with mixed conidial suspensions, to measure theircompetitive ability against wild-type isolates. These tests on radish seedlings revealed that DCF-resistant isolates werestill aggressive. Despite this, the data obtained in the competition experiments showed that the loss of the abilityto synthesize AbNIK1p in

A. brassicicola

DCF-resistant mutants was linked to a severe decrease in their competitiveness.

Keywords

: competitiveness, dicarboximide fungicides, histidine-kinase null mutants, osmosensitivity

Introduction

Most commonly used fungicidal molecules inhibit thebiosynthesis of cellular components such as amino acids,nucleotides, pigments, sterols or polysaccharides. Inter-ference in cell signalling pathways has also been shown tohave deleterious effects on living organisms. For instance,many bacterial toxins exert their toxicity throughinactivation or hyperactivation of cAMP signalling (Barth

et al

., 2004). Similarly, over the last decade, severalstudies have strongly suggested that some fungicides mayalso interfere with fungal intracellular signal transductionpathways. Quinoxyfen, a phenoxyquinoline introducedfor control of powdery mildew diseases, has been shownto inhibit mildew infection by disrupting G-protein pro-duction and early cell signalling events (Wheeler

et al

.,2003). Dicarboximide fungicides (DCF), which are highlyactive broad-spectrum compounds, and phenylpyrolles,

which have mainly been used to control

Botrytis cinerea

,are both believed to exert their toxic effects on fungithrough activation of the osmoregulation pathway(Kojima

et al

., 2004; Ma & Michailides, 2005). In fungi,adaptation to high osmolarity conditions is regulated byMAP kinase cascades, the high osmolarity glycerol(HOG) pathway in

Saccharomyces cerevisiae

and theosmosensitivity (OS) pathway in

Neurospora crassa

andin several other filamentous fungi. Although similar, thereare still differences between these two signalling pathways.Indeed, in

S. cerevisiae

, the only histidine kinase, Sln1, isa transmembrane osmosensor protein that autophospho-rylates under low osmolarity conditions and negativelyregulates the downstream phosphorylation cascade(Maeda

et al

., 1994). Under higher osmolarity conditions,Sln1 is no longer phosphorylated and the activated HOGpathway modulates downstream transcription regulatorsto allow glycerol synthesis (Akhtar

et al

., 1997). Infilamentous fungi, there are several histidine-kinases,including Sln1 orthologs (Catlett

et al

., 2003). Althoughthe function of most of them is still unclear, several studieshave demonstrated the key role of group III histidine

*E-mail: [email protected]

Published online 7 May 2008

Plant Pathology

(2008)

57

, 937–947

938

B. Iacomi-Vasilescu

et al.

kinases (GIII-HK), also called OS1, in

N. crassa

(Alex

et al

., 1996), as positive regulators of Os and Os-relatedpathways (Yoshimi

et al

., 2005). Interestingly, thesedifferences in signalling pathways between yeast andfilamentous fungi seem to be associated with phenotypicdifferences, since

S. cerevisiae

is naturally resistant toDCF. These observations, and the fact that exposure toDCF results in abnormal glycerol accumulation infilamentous fungi (Pillonel & Meyer, 1997), stronglysuggest that these fungicides target the osmoregulationpathway by interacting with GIII-HK. Indeed, laboratoryand field isolates that carry mutations in GIII-HK anddisplay resistance to DCF have been isolated from severalfungal species (Cui

et al

., 2002; Miller

et al

., 2002; Dry

et al

., 2004, Yoshimi

et al

., 2004; Avenot

et al

., 2005b).Concerning field isolates, the level of resistance to DCFseems to be correlated with the type of mutation. Fieldisolates of

B. cinerea

bearing point mutations in the

BcOS1

gene were characterized by moderate sensitivity toDCF, i.e. IC

50

(the concentration which reduced growth by50%) lower than 5 mg L

–1

(Oshima

et al

., 2002, 2006).These mutations resulted in a single amino-acid change inthe HAMP repeat region, a structural landmark of GIII-HK (Catlett

et al

., 2003). By contrast, highly resistantisolates (IC

50

above 10 mg L

–1

) of

Alternaria alternata

and


were isolated from the field andfound to bear insertions, deletions or nonsense mutationsin

Os1

orthologous genes (Dry

et al

., 2004; Avenot

et al

.,2005b). While

B. cinerea

is still controlled by DCF,provided the number of applications of these fungicidesremains low, the existence of highly resistant field isolatesamong

Alternaria

spp. populations may represent a seriousproblem for the management of related plant diseases. Topredict their evolution, an estimation of the fitness cost ofthe resistance is essential.

Besides their well-documented role in the adaptation offilamentous fungi to high osmolarity, it has been suggested

that GIII-HK might have essential functions in theresponse of fungi to oxidative stress and in developmentalprocesses such as conidiation (Viaud

et al

., 2006). It isanticipated that the inability of

A. brassicicola

DCF-resistantmutants to synthesize AbNIK1p might significantlyimpact their fitness, at least in the absence to dicarbo-ximide exposure. In the study presented here, this hypothesiswas tested using both

in vitro

comparative phenotypiccharacterization of

A. brassicicola

mutant and wild-typeisolates and field inoculation with mixtures of resistantand wild-type isolates.

Materials and methods

Fungal isolates

In vitro

tests were conducted using eight field isolates of

A. brassicicola

that were previously characterized assensitive (five isolates) or highly resistant (three isolates) toDCF and phenylpyrroles (Avenot

et al

., 2005b). Fouradditional resistant laboratory isolates were used. Theywere obtained after transferring, onto selective medium,mycelial tips from fast-growing sectors of some wild-typeisolates on DCF-amended media. All the isolates used inthis study (Table 1) were purified by monospore isolation.

Mycelial growth

Mycelial discs of pathogens (8 mm in diameter) removedfrom the margins of a 7-day-old culture were transferredto potato dextrose agar (PDA) plates. Three replicateswere used per measurement. Plates were incubated in thedark for 5 days at 16

°

C, 25

°

C or 30

°

C and radial growthwas measured. To test the sensitivity to osmotic andoxidative stress, the mycelial disks were transferred ontoPDA containing 0·4–0·8

m

sorbitol or 0·25–1 m

m

menadione, respectively.

Table 1 List of Alternaria brassicicola isolates used in this study

Isolate Origin Phenotypea

Genotypeb

AbNIK1 locus Abmic4 locus Abmic9 locus Abmic11 locus

Abra20 Field (Raphanus sativus) DicS PPS Wild-type 109 bp 116 bp 230 bpAbra43 Field (R. sativus) DicS PPS Wild-type 109 bp 113 bp 206 bpAbra CM Field (B. oleracea) DicS PPS Wild-type 109 bp 116 bp 209 bpAbra246T7 Field (R. sativus) DicS PPS Wild-type ndc nd ndAbra263T4 Field (R. sativus) DicS PPS Wild-type nd nd ndAbra41 Field (R. sativus) DicHR PPHR Mutant: frameshift/microdeletion (ΔCA) 113 bp 113 bp 209 bpAbra3 Field (R. sativus) DicHR PPHR Mutant: nonsense/CAA → TAA 109 bp 110 bp 236 bpAbra7407 Field (Brassica oleracea) DicHR PPHR Mutant: nonsense/TGG → TGA 109 bp 113 bp 203 bpAbra43M Parental isolate Abra43 DicHR PPHR Mutant:nonsense/CAG → TAG 109 bp 113 bp 206 bpAbraCMM Parental isolate AbraCM DicHR PPHR nd 109 bp 116 bp 209 bpAbra246T7M Parental isolate Abra246T7 DicHR PPHR nd nd nd ndAbra263T4M Parental isolate Abra263T4 DicHR PPHR nd nd nd nd

aDicS PPS, sensitive to dicarboximides and phenylpyrroles; DicHR PPHR, highly resistant to dicarboximides and phenylpyrroles.bGenotypes at the AbNIK1 locus are from Avenot et al. (2005b); genotypes at the microsatellite loci were determined only for isolates that were selected for the field experiments.cnd, not determined.

Plant Pathology

(2008)

57

, 937–947

Fitness cost of dicarboximide resistance in

A. brassicicola 939

Conidial germination rate

The spore germination rate of

A. brassicicola

isolates wastested as follows. Spore suspensions (10

5

spores mL

–1

)were prepared in distilled sterile water from 7-day-oldcultures. Then, for each isolate, three 20-

μL aliquots ofthe spore suspensions were spread onto the surface ofwater agar (2% w/v) plates. After incubation for 24 h at25°C in the dark, the number of germinated spores (100spores were observed per plate) was determined under amicroscope.

Sporulation on growth medium

PDA plates were inoculated with mycelium plugs asdescribed above. After 7 days of growth, conidia werewashed off with distilled water containing 0·1% Tween20 by gently scraping the surface of the plate, allowed tosediment for 30 min and suspended in 0·1% Tween 20.The absorption value of the suspension was then measuredat a wavelength of 600 nm using a spectrophotometer.The concentration of the conidial suspension was estimatedusing the regression equation developed by Huang &Levy (1995) after its validation with serial dilutions of aspore suspension of A. brassicicola isolate Abra43 previouslycalibrated using a haematocytometer.

Pathogenicity tests under controlled conditions

Commercial radish (Raphanus sativus cv. Radis National)seed lots were used for the pathogenicity tests. Seeds werefirst disinfected by soaking in 1% sodium hypochlorite for10 min, rinsed with sterile distilled water, soaked for 1 hin a calibrated spore suspension (105 spores mL–1)prepared as above, and dried at room temperature onsterile filter paper. Seeds were placed on water agarmedium (1·2%) in Petri dishes and developmental stagesand disease severity rated for 100 seeds after 7 days’incubation at 24°C in the dark. Developmental stageswere scored using a 0–3 grade scale (0, no germination; 1,root emergence; 2, cotyledon emergence; 3, well-developed

seedling). Disease severity was scored on seedlings using a0–9 grade scale (0, no disease symptoms; 1, 1–2 mmnecrosis on seedling stem; 3, extension of necrosis allaround the stem; 5, a third of the radicular system orhypocotyl affected; 7, the whole radicular system or aerialpart affected and covered with spores; 9, seedling killedand covered with spores).

For competition experiments, conidial suspensions ofAbra20 (S) and Abra41 (R) with three different ratiosof resistant and sensitive conidia (80:20%, 50:50% or20:80% R:S) were used. At 4 and 6 days post-inoculation,seedlings were collected, frozen in liquid nitrogen andstored at –80°C until use for DNA extraction.

Real-time QPCR amplification

DNA was extracted from inoculated seedlings using theFastDNA kit (Qiagen), as described by the manufacturer.Primers were selected to amplify a 112-bp fragment (fromnt positions 1761 to 1872) of the AbNIK1 gene (GenBankAcc. No. AY700092). Probes were designed to match thewild-type sequence (probe W) or the (CA)-deletedsequence from isolate Abra41 (probe ΔCA) and weresynthesized by Applied Biosystems. The W probe wasdual-labelled with 6-carboxyfluorescein (6-FAM) fluo-rescent reporter dye and the minor groove binding (MGB)nonfluorescent quencher (Applied Biosystems). The ΔCAprobe used VIC dye for fluorescence and MGB asquencher. The primer and probe sequences are shown inTable 2. The QPCR assays were conducted in 96-wellplates with the ABI PRISM 7000 Sequence DetectionSystem instrument (Applied Biosystems) using the TaqManPCR master mix (25-μL reaction mixtures) according tothe manufacturer’s instructions. After 10 min denaturationat 95°C, there were 40 cycles each with a denaturationstep at 95°C for 15 s and a hybridization-elongation stepat 60°C for 1 min.

Absolute QPCR was employed to determine theAbra41 and Abra20 quantities in inoculated plantsamples. These samples and the negative (pure water) andpositive (10-fold dilution series of DNA extracted from

Table 2 List of primers and probes used in this study

Name Sequence Description

AbNIKS 5′-TGGTGTTGAGGGTACCTGGAA-3′ Sense primer for genotyping at the AbNIK1 locusAbNIKR 5′-TCCTCTTGCGACGGCTGTA-3′ Reverse primer for genotyping at the AbNIK1 locusW probe 6FAM-5′-ATGAACCTCACAACACA-3′-MGB Specific to the wild-type allele of AbNIK1ΔCA probe VIC-5′-CCATGAACCTCAACACA-3′-MGB Specific to the (CA) deleted allele of AbNIK1 Abmic4S 5′-CACGACGTTGTAAAACGACCTGGCCTTGGCTGTCTAGCG-3′ Sense primer for genotyping at the Abmic4 locus with

5′ M13 tail (underlined)Abmic4R 5′-TCCAGTCGATAAGATCAAACC-3′ Reverse primer for genotyping at the Abmic4 locusAbmic9S 5′CACGACGTTGTAAAACGACCCGAGAGAAGCAACAT CTG3′ Sense primer for genotyping at the Abmic9 locus with

5′ M13 tail (underlined)Abmic9R 5′-TAGGCGTGATCTTGCCGAGG-3′ Reverse primer for genotyping at the Abmic9 locusAbmic11S 5′-CACGACGTTGTAAAACGACGGTGGTTGAGTGCTTGTATTTG-3′ Sense primer for genotyping at the Abmic11 locus with

5′ M13 tail (underlined)Abmic11R 5′-TCGGGCTTGATATCCTTTG-3′ Reverse primer for genotyping at the Abmic11 locusM13S IRD700-5′-CACGACGTTGTAAAACGA-3′ M13 primer for labelling microsatellite amplification products

Plant Pathology (2008) 57, 937–947

940 B. Iacomi-Vasilescu et al.

the two fungal isolates) control samples were run intriplicate.

Competition experiments in the field

The investigations were carried out for 3 years (2003–05)during summer at the FNAMS experimental station nearAngers, (France, 47°30′N). Radish (cv. Flamboyant) seedswere sown in 20-m2 plots and each plot was separated bya 2-m buffer zone which was free of plants. The experimentsconducted each year involved a randomized block design.In 2003 there were seven treatments: inoculation withtwo wild-type isolates (Abra20 and Abra43), four resistantisolates (Abra3, Abra41, Abra7407 and Abra43M) and anon-inoculated control. In 2004 and 2005 there were fivetreatments: inoculation with four different ratios ofresistant (Abra41) and sensitive (Abra20) conidia(100% R, 80:20% R:S, 50:50% R:S or 100% S) anda non-inoculated control. For each treatment, one blockreceived fungicide application and one block did not.Fungicide application was performed with Rovral AquaFlo (500 g L–1 iprodione, Bayer Cropscience) at therecommended dose (1·5 L ha–1) 3 days before inoculation.Plants were artificially inoculated at the sillique-formationstage by uniformly spraying 2·5 L of a spore suspension(105 spores mL–1) per individual block. At the end of theexperiment, at 35–41 days post-inoculation dependingon the investigation year, seeds were harvested fromdried silliques. Infection levels were determined on 200seeds from each lot using the standard plating technique.Alternaria brassicicola isolates, 20–30 per contaminatedseed lot, were purified by monospore isolation and usedfor phenotype and genotype determinations. Phenotypingwas performed by measuring growth on PDA mediumamended or not with iprodione (10 mg L–1). Stocksolutions (10 000 mg L–1) of iprodione were prepared inacetone and added to sterilized medium before solidification.

Genotype determination

Each isolate re-isolated from the competition experimentsin the field was typed at the AbNIK1 locus and at threepolymorphic microsatellite loci. DNA was extracted frommycelium collected by scraping the surface of Petri platecultures, according to the microwave miniprep proceduredescribed by Goodwin & Lee (1993). Typing at theAbNIK1 locus was performed using a QPCR assay withW and ΔCA probes as described above, and alloweddiscrimination between the AbNIK1 ΔCA mutant allelefrom Abra41 and other wild-type or resistant alleles.Typing at Abmic4, Abmic9 and Abmic11 microsatelliteloci (Avenot et al., 2005a) was performed after amplificationwith the relevant primer pairs (Table 2) labelled withIRD700. Amplification products were separated on aLiCor 4300 DNA analyser (Sciencetec). Allele identifica-tion at these loci allowed further characterization of theorigins of fungi re-isolated from contaminated seeds, asthe two inoculated isolates (Abra20 and Abra41) had rareallelic combinations at the three explored loci. Identical

haplotypes were not found among a collection of 160A. brassicicola isolates from cultivated and wild crucifers(unpublished results).

Western blot

Western blot analyses were carried out to check the effectsof the previously identified mutations in the AbNIK1 geneat the protein level. Protein samples were prepared frommycelia obtained by growing a conidial suspension (200conidia mL–1) for 24 h in potato dextrose broth (PDB).Mycelia were collected by filtration on filter paper andground with a mortar and pestle to a fine powder in liquidnitrogen. Ice-chilled buffer containing protease andphosphatase inhibitors (50 mm sodium phosphate, pH 7·4,1 mm EDTA, 5% (v/v) glycerol, 1 mm PMSF, 50 mmNaF, 5 mm sodium pyrophosphate, 0·1 mm sodium vana-date, 10 mm β-glycerophosphate) was added to the powder,and the suspensions were homogenized. After centrifugingthe suspensions at 10 000 g for 10 min, the proteinconcentration in the resulting supernatants was calculatedusing a BCA protein assay reagent (Pierce). Equalquantities (25 μg) of protein samples were loaded on 10%polyacrylamide gels and blotted onto nitrocellulosemembranes (Schleicher and Schuell). Antibody bindingwas visualized using an ECL Plus Western blottingdetection reagent (Amersham Biosciences) after bindingof a horseradish peroxidase-conjugated secondary antibody.AbNIK1 detection was performed using antibodiesaffinity-purified from rabbit antisera raised against asynthetic peptide whose sequence corresponded toresidues 364–378 of the AbNIK1 sequence.

Data analyses

Percentage data from the competition experiments on therelative frequency (field conditions) or fungal biomass(controlled conditions) of the resistant and wild-typeisolates were treated graphically. The pairwise t-test wasused to compare the observed values with the initialvalues in the inoculum. All other data for each fitnesscomponent (radial growth, sporulation, spore germinationand aggressiveness) were subjected to analysis of variance(anova). Multiple-means comparisons were supported byTukey’s test and two-means comparisons by t-test.

Results

Molecular characterization of resistant field isolates

Analysis of the nucleotide sequence of the AbNIK1 geneencoding a GIII-HK from A. brassicicola previouslyrevealed the presence of single-nucleotide polymorphismand microdeletions leading to nonsense and frameshiftmutations in the iprodione-resistant Abra41, Abra3,Abra7407 and Abra43M isolates (Avenot et al., 2005b).These results suggest that the different field resistantmutant isolates investigated here all had null mutations inthe AbNIK1 gene. To further test this hypothesis, antibodies


Fitness cost of dicarboximide resistance in A. brassicicola 941

specific to the GIII-HK from A. brassicicola were developedand used to detect AbNIK1 among proteins extractedfrom wild-type and resistant isolates. As shown in Fig. 1,a signal at c. 130 kDa was observed on immunoblots ofproteins extracted from the wild-type Abra20 and Abra43isolates, while no signal was observed with proteins fromthe resistant Abra41 and Abra7407 isolates. Similarresults were obtained with the other resistant field isolateunder investigation, Abra3 (not shown). A fainter signalwas detected at c. 110 kDa with all the tested proteinextracts. This signal, which was also observed when thespecific antibodies were replaced with pre-immune serum,probably resulted from nonspecific binding. Interestingly,signals at 55 kDa and 70 kDa were obtained with proteinextracts from Abra41 and Abra7407, respectively, i.e.approximately the expected sizes of the truncatedAbNIK1 proteins synthesized by these mutants.

Fitness components under standard in vitro conditions

Three fitness components (mycelium radial growth,sporulation and spore germination) were measured understandard conditions (PDA medium at 25°C) for 12isolates belonging to two different sensitivity groups(Table 3). There was high variability among the testedisolates in mycelial growth, even within the same sensitivitygroup. However, the means for each group were notsignificantly different (P > 0·05). Mycelial growth rateranged from 4·9 to 6·7 mm per day with a mean of5·8 mm per day in the wild-type isolates, and from 5·3 to7·0 mm per day with a mean of 6·0 mm per day in thegroup of resistant isolates. Similarly, sporulation capacitiesranged from 2·55 × 103 to 8·21 × 103 spores per mm2 inthe wild-type isolates and from 1·77 × 103 to 4·08 × 103

spores per mm2 in the group of resistant isolates, but themeans did not significantly differ (P > 0·05) between thetwo groups. As these variations might reflect differences inthe genetic background of isolates, laboratory mutantswere also compared with their wild-type relatives. Such

pairwise comparisons between isolates with the samegenetic background revealed that all the laboratorymutants had a reduced capacity to produce conidia.Indeed, the sporulation capacities of these isolateswere only 30% (isolate AbraCMM) to 80% (isolateAbra246T7M) that of their wild-type relatives. Forconidial germination, no significant differences (P > 0·05)were detected between the means of each group. Allisolates showed high percentages of conidial germination,irrespective of their sensitivity to DCF.

Fitness components under stress conditions

Mycelial growth of A. brassicicola isolates was measuredunder different stress conditions: suboptimal incubationtemperatures and presence of oxidant or osmoticum inthe culture medium (Fig. 2a,b and c, respectively).

The growth effects of low temperature (16°C) and hightemperature (30°C) were almost identical on wild-typeisolates, i.e. 32·8 and 38·4% inhibition, respectively, com-pared to the standard temperature (25°C). Some of theresistant isolates were found to be very sensitive to hightemperature, with less than 50% residual growth at 30°C(isolates Abra3, Abra7407 and Abra246T7M), but nosignificant differences (P > 0·05) were recorded betweenthe groups of wild-type and resistant isolates at the twotested temperatures.

The addition of the reactive oxygen species (ROS)-generating compound menadione to the culture mediumhad only a slight effect on the mycelial growth of

Figure 1 Immunodetection of AbNIK1p in protein extracts from wild-type and resistant Alternaria brassicicola isolates. Proteins were extracted from liquid cultures of wild-type (Abra43 and Abra20) and DCF-resistant (Abra7407 and Abra41) isolates, analysed by SDS-PAGE and blotting with monospecific polyclonal antibodies raised against a synthetic peptide with a sequence corresponding to a portion of the N-terminal part of AbNIK1p. Asterisks indicate the positions of immunoreactive polypeptides with sizes corresponding to complete (wild-type isolates) or truncated (resistant isolates) forms of the AbNIK1 protein.

Table 3 Growth parameters of wild-type and dicarboximide-resistant Alternaria brassicicola isolates under standard conditions

Isolate

Mycelial growth (mm day–1)

Sporulation (sporenumber × 103 mm–2)

Spore germination(%)

Wild-type isolatesAbra20 4·9 (0·0)adb 3·07 (0·13)bc 89 (0·1)abAbra43 4·9 (0·1)d 2·57 (0·15)c 82 (0·2)bAbra CM 6·3 (0·0)ab 8·21 (0·23)a 91 (0·0)aAbra246T7 6·3 (0·1)ab 3·84 (0·28)b 97 (0·5)aAbra263T4 6·7 (0·2)a 2·55 (0·01)c 97 (1·0)aMean S 5·8 (0·1) A 4·05 (0·10) A 91·2 (0·4) AResistant isolatesAbra41 5·3 (0·3)cd 3·76 (0·12)b 84 (1·5)bAbra3 5·4 (0·2)c 4·08 (0·18)b 90 (0·5)aAbra7407 5·8 (0·0)bc 3·47 (0·21)b 89 (1·0)abAbra43M 6·4 (0·0)ab 1·77 (0·08)d 97 (0·0)aAbraCMM 6·1 (0·2)b 2·45 (0·08)c 72 (2·0)cAbra246T7M 6·1 (0·1)b 3·11 (0·21)b 95 (1·5)aAbra263T4M 7·0 (0·2)a 1·31 (0·06)d 94 (0·0)aMean R 6·0 (0·1) A 2·85 (0·07) A 88·7 (0·8) A

aStandard deviations shown in parentheses.bStatistical analysis within groups: means of individual isolates followed by the same letter are not different according to Tukey test (P > 0·05).Statistical analysis between groups: mean values of group followed by the same capital letter are not significantly different according to Tukey test (P > 0·05).



A. brassicicola isolates, irrespective of their sensitivity toDCF. Even at the higher concentration tested (1 mm),more than 50% residual growth was still observed for thetwo groups of isolates. One of the selected resistantisolates (AbraCMM) was found to be much more sensitivethan the other isolates, with only 19% residual growth inthe presence of 1 mm menadione. However, the corre-sponding wild-type isolate (AbraCM) was also sensitiveto oxidative stress, with 40% residual growth in thepresence of 1 mm menadione.

The growth of A. brassicicola under high osmoticpressure was obtained by including sorbitol in the culturemedium. Wild-type isolates were usually resistant to thesetreatments, with mean growth inhibition percentages ofonly 4 and 10·7% in the presence of 0·4 m and 0·8 msorbitol, respectively. The AbraCM isolate was again themost sensitive isolate (35·7% inhibition with 0·8 msorbitol) in this group. By contrast, the mean growthinhibition percentages for the resistant group weresignificantly (P < 0·05) higher in the presence of sorbitol,

Figure 2 Effects of various stress conditions on the growth of A. brassicicola isolates. Residual growth of several Alternaria brassicicola isolates under (a) suboptimal incubation temperatures (16°C: grey bars; 30°C: dark bars), or the presence of (b) menadione (0·25 mM: grey bars; 1 mM: dark bars) or (c) sorbitol (0·4 mM: grey bars; 0·8 mM: dark bars) compared to standard growth conditions (PDA medium without additive at 25°C). Asterisks indicate mean values for the groups of sensitive (mean S) and resistant (mean R) isolates are significantly different (P < 0·05) for a given stress condition.



irrespective of the concentration used. For example, in thepresence of 0·8 m sorbitol in the culture medium, theresidual growth of Abra263T4M was only 26·2%, whileunder the same conditions its wild-type relative stillretained 97·6% of its mycelial growth rate.

Aggressiveness and competition experiments under controlled conditions

Aggressiveness was measured as the potential for anisolate to produce necrosis on seedlings from artificiallyinoculated radish seeds at 7 days post-inoculation. Onthis basis, with the exception of Abra3, which was notvery aggressive, all the other selected isolates were foundto have similar aggressiveness (P > 0·05), with a necroticindex ranging from 5·3 for AbraCMM and its wild-typerelative to 7·3 for Abra43 (Fig. 3). The effect of inoculationon seedling development was also recorded. Inoculationof seeds with A. brassicicola had no effect on this parameterand the mean developmental index observed forinoculated seedlings (2·7) was not significantly different(P > 0·05) from that obtained for non-inoculated controls(2·8). It was, however, noticed that the radical length wassignificantly reduced (P < 0·05) in inoculated seedlings,irrespective of isolate, compared to non-inoculatedseedlings, with mean lengths at 7 days of 18·3 mm and48·5 mm, respectively.

To compare the capacity of resistant and wild-typeisolates to colonize seedlings, one resistant isolate(Abra41), which had a 2-nt deletion in the AbNIK1 gene,and one wild-type isolate (Abra20) were selected andmixed at different ratios to inoculate seeds. Aggressive-ness of these two isolates was not significantly different(P > 0·05) when singly inoculated to radish seeds (Fig. 3).

In planta development of each isolate was estimated usingQPCR with fluorescent probes specific to the two differentallelic forms of the AbNIK1 gene. Preliminary tests withserial dilutions of DNA extracted from isolates Abra41and Abra20 confirmed the specificity of each probe andthe linear relationship between threshold cycles (Cts) andthe amount of target DNA (R2 = 0·97). As the amplifica-tion efficiencies were similar (Δ = 0·03) with the two setsof primers and probes, it was possible to monitor theparallel progression of the two fungi in planta using thistechnique. As estimated by this technique, the initial ratiosused to inoculate seeds were 18:82% S:R, 47:53% S:Rand 78:22% S:R. Plants were sampled at 4 and 6 dayspost-inoculation, i.e. when the mean necrotic indexeswere 3·9 ± 0·2 and 5·6 ± 0·3, respectively. Irrespective ofthe initial ratio used, 6 days after inoculation thewild-type isolate Abra20 had always colonized the plantsmore efficiently than the resistant isolate Abra41 (Fig. 4).For instance, when nearly equal amounts of the twoisolates were used to inoculate seeds, DNA from Abra20already represented 73% of the total fungal DNA inseedlings at 4 days and 96% at 6 days, i.e. values signifi-cantly different (P < 0·05) from the initial value (47%) inthe inoculum.

Aggressiveness under field conditions

A field experiment was conducted in 2003 with singleisolates to compare the seed transmission efficiencies oftwo wild-type (Abra20 and Abra43) and four resistant(Abra41, Abra3, Abra7407 and Abra43M) isolates underboth selective and non-selective pressure. In the absence ofDCF treatment, the A. brassicicola contamination levelsof seeds from plants inoculated with the wild-type isolates

Figure 3 Aggressiveness of different Alternaria brassicicola isolates on radish seedlings. Aggressiveness was tested under controlled conditions by inoculation of radish seeds and estimated as the potential to produce necrosis at 7 days post-inoculation. Co: control non-inoculated seeds. Different letters (individual isolates) or capital letters (groups of isolates) indicate a significant difference at the 5% level by the Tukey test.



were above 50%, while they were below 20% whenresistant isolates were used as inoculum source (Fig. 5). Asexpected, when the plants were treated with iprodionebefore inoculation, the A. brassicicola contaminationlevels of seeds from plants inoculated with the wild-typeisolates decreased to less than 20%, while those of plantsinoculated with the resistant isolates were 1·5- to 3·2-foldhigher than under non-selective pressure. Irrespective ofthe plant treatment, the contamination levels of seeds withsaprophytic Alternaria sp. were low (around 20%) for allthe seed lots heavily contaminated with A. brassicicolaand vice versa.

Competition experiments in the field

Field competition experiments were conducted for twosuccessive years (2004 and 2005) by inoculating plantswith mixtures of conidia from one wild-type isolate(Abra20) and one resistant isolate (Abra41). Althoughcomparable results were obtained during the two years,the contamination levels observed in 2005 for all treat-ments were always lower and only the data obtained in2004 are given in Table 4. For this experiment, thepercentages of seed contamination measured for controlplants inoculated with single isolates (Abra20 or Abra41)were identical to those obtained in 2003 in similar treat-ments. When mixtures of equal quantities of conidia from

the two isolates were used (inoculum 1), the percentagesof seed contamination reached 50% under both non-selective and selective pressure. When an 80:20% R:Sratio was used (inoculum 2), the seed contamination levelswere always lower.

In order to determine whether fungi re-isolated fromseeds corresponded to Abra20 or Abra41, 25–30 isolatesper contaminated seed lot were characterized for theirsensitivity to iprodione and genotyped at four loci, i.e. theAbNIK1 gene and three polymorphic microsatellite loci(Abmic4, Abmic9 and Abmic11). It was thus possible todemonstrate that more than 90% of the re-isolatedisolates originated from either Abra20 or Abra41 and not

Figure 4 Competition between wild-type and DCF-resistant isolates of Alternaria brassicicola co-inoculated on radish seeds under controlled conditions. The relative capacities of a wild-type (Abra20) and a DCF-resistant (Abra41) isolates of A. brassicicola to colonize radish seedlings were estimated by co-inoculating seeds with mixtures of conidia from the two fungi at three different ratios and measuring in planta the quantity of DNA from each fungus using specific QPCR probes at 4 and 6 days post-inoculation. For each measurement, the percentage of DNA from Abra20 (white bars) and Abra41 (black bars) relative to total fungal DNA is given. Asterisks indicate percentages of DNA from the wild-type isolate at 4 or 6 days post-inoculation significantly different (P < 0·05, pairwise t-test) from those measured in the inoculum.

Figure 5 Seed transmission efficiencies of wild-type and resistant isolates of Alternaria brassicicola under selective and non-selective pressure. Radish plants were inoculated in the field with conidial suspensions of different A. brassicicola isolates 3 days after treatment with an aqueous solution of Rovral (selective pressure; black bars) or with equivalent amounts of water (non-selective pressure; grey bars). Infection levels of seeds harvested from experimental plants are expressed as the percentage of seeds contaminated with A. brassicicola (diagram bars) and with saprophytic Alternaria sp. (numbers above the bars). Co: control non-inoculated plants.

Table 4 Contamination by Alternaria brassicicola of radish seeds harvested from experimental field plants

Inoculum Phenotypea

Fungicidetreatment

Seeds contaminated with A. brassicicola (%)

Abra20 DicS PPS OsR – 53+ 18·5

Abra41 DicHR PPHR OsS – 18+ 58

Abra20/Abra4150%/50%

_ – 50+ 55·5

Abra20/Abra4120%/80%

_ – 10·5+ 5

aDicS PPS OsR, sensitive to dicarboximides and phenylpyrroles and resistant to high osmotic pressure; DicHR PPHR OsS, highly resistant to dicarboximides and phenylpyrroles and sensitive to high osmotic pressure.



from other contaminating A. brassicicola isolates. Takingthe phenotypic and genotypic data into account, in theabsence of dicarboximide pressure, when plants wereinoculated with the 80:20% or 50:50% R:S ratio,seed-contaminating fungi at harvest originating from theDCF-resistant Abra41 isolate only represented 35% and0%, respectively (Fig. 6), i.e. values significantly different(P < 0·05) from the initial values in the inoculum.

Discussion

The set of DCF-resistant isolates used in this study comprisedfield isolates and mutants selected in the laboratory. Basedon immunodetection experiments with specific antibodiesagainst AbNIK1p, all the field isolates were found tocorrespond to null mutants for this protein. Theseobservations confirmed at the protein level previousresults obtained with these isolates at the gene level(Avenot et al., 2005b). The Western blot analysis carriedout here allowed rapid characterization of the resistantisolates and may therefore prove very useful for large-scalescreening of GIII-HK-deficient isolates among DCF-resistant mutants.

Saprophytic fitness was estimated by measuringdifferent growth parameters under standard conditions

(PDA growth medium at 25°C) and mycelial growthunder different stress conditions for DCF-resistant andwild-type isolates.

Irrespective of the temperature tested, no significantdifference in mycelial growth was observed between thegroup of wild-type isolates and the group of resistantisolates. An interdependence of growth temperature,intracellular glycerol and MAP kinase signalling in thehyperosmotic stress response was shown in S. cerevisiae(Wojda et al., 2003; Panadero et al., 2006). The results ofthe present study suggest that if such interdependence alsoexists in A. brassicicola, activation of the HOG-relatedpathway upon exposure to low or elevated temperaturesis probably independent of AbNIK1p. Miller et al. (2002)obtained similar results when comparing the lineargrowth rates of wild-type Neurospora crassa with thoseof OS1 mutants.

For all the other fitness components tested, except thesensitivity to high osmolarity, i.e. sporulation, conidiagermination and sensitivity to menadione, the meanvalues measured for wild-type and resistant isolates werenot significantly different. In B. cinerea, a severe reductionin macroconidia formation was noted upon inactivationof BOS1, a NIK1/OS1 ortholog, under standard axenicculture conditions (Viaud et al., 2006). Based on thisobservation and the fact that microconidia formation wasnot affected in these bos1-null mutants, the authorssuggested that BOS1p is probably involved in the regula-tion of holoblastic conidiation. The present results showingthat AbNIK1-null mutants were still able to produceconidia are in line with this hypothesis, as A. brassicicolais known to produce conidia enteroblastically (Kendrick& Carmichael, 1973). It should be mentioned that aprevious study carried out with A. brassicicola labo-ratory mutants resistant to iprodione reported apositive effect of resistance on sporulation (Huang &Levy, 1995). However, it is difficult to compare thosedata with those of the present work, as the isolatesused in the those other cases had not been geneticallycharacterized and thus may not have been AbNIK1-nullmutants.

Studies on the incidence of mutations in components ofthe HOG pathway on the sensitivity of fungi to oxidativestress have generated contrasting results. Hog1-relatedMAPK from S. pombe, Candida albicans and Aspergillusnidulans were shown to be activated by ROS and to mediateoxidative stress responses, while S. cerevisiae Hog1p didnot appear to play a significant role in oxidative stressresistance [reviewed by Moye-Rowley (2003) and Aguirreet al. (2006)]. Inactivation of the GIII-HK BOS1 in B.cinerea led to increased resistance to menadione (Viaudet al., 2006) while OS1-null mutants and wild-type iso-lates of N. crassa were equally sensitive to the effect of thiscompound (Miller et al., 2002). Similarly, no differencesin the sensitivity of A. brassicicola AbNIK1-null mutantsand wild-type isolates were observed in the presentstudy.

Previous characterization of some of the isolates used inthis study showed that most of the DCF-resistant isolates

Figure 6 Competition between wild-type and DCF-resistant isolates of Alternaria brassicicola under field conditions. Radish plants in the field were treated with an aqueous solution of Rovral (iprodione) or with equivalent amounts of water (no fungicide) and inoculated 3 days later with mixtures of conidia from a wild-type (Abra20) and a DCF-resistant (Abra41) isolate at two different ratios: 50% R: 50% S (inoculum 1) and 80% R:20% S (inoculum 2). The relative frequencies of Abra20 (white bars), Abra41 (black bars) and contaminant (grey bars) isolates (final ratios) in seeds harvested from experimental plants were determined after phenotype (sensitivity to iprodione) and genotype (allelic combination at AbNIK1-Abmic4-Abmic9-Abmic11 loci) characterization of 20–30 isolates per contaminated seed lot. Asterisks indicate frequencies of haplotypes identical to Abra20 re-isolated from seeds significantly different (P < 0·05, pairwise t-test) from those of the initial inoculum.



were more sensitive to NaCl exposure than DCF-sensitiveisolates. In the present study, osmosensitivity was testedby measuring the effect of sorbitol on mycelial growth.This sugar, unlike NaCl, is a neutral molecule that doesnot generate ionic stress and thus may be more suitable forestimating the sensitivity of isolates to high osmoticpressure. For all the DCF-resistant isolates tested, a severereduction (up to 75%) in radial growth rate was observedin the presence of a high sorbitol concentration (0·8 m),while the average growth rate of DCF-sensitive isolates inthese conditions was 90% of that measured on standardculture medium. This result was not surprising, as GIII-HK are known to have a key regulatory role in theresponse of filamentous fungi to osmotic stress, and nullmutants with increased sensitivity to exposure to highconcentrations of sorbitol or other neutral sugars havealready been described in other fungal species such asMagnaporthe grisea (Motoyama et al., 2005) and B. cinerea(Viaud et al., 2006).

Tests on radish seedlings, under controlled conditions,confirmed previous observations that DCF-resistantisolates were still aggressive (Iacomi-Vasilescu et al.,2004). Similar observations were reported for the riceblast fungus by Motoyama et al. (2005), who showed thatthe Δhik1 mutant was fully pathogenic on rice plants. Bycontrast, results obtained with B. cinerea suggested thatBOS1 is an important pathogenicity factor in this fungus,with a role in the post-penetration stages of the infectionprocess (Viaud et al., 2006). Interestingly, when singleisolates were used as inoculum source under non-selectivefield conditions, the frequency of re-isolation of theinoculated fungus from harvested seeds was much lowerfor the DCF-resistant laboratory mutant Abra43M thanfor the sensitive parental isolate Abra43, although the twoisolates had similar aggressiveness under controlledconditions. This could be explained by the fact that, in thefield experiments, the fungus had to overcome severeosmotic stress conditions consecutive to the gradualdecrease in the water potential in maturing seeds.

The results obtained with the three other field resistantisolates tested under field conditions also showed weakrecovery from seeds in the absence of DCF pressure. Inparallel, recovery of saprophytic Alternaria from seedswas always higher in these samples than in those heavilycontaminated by A. brassicicola, irrespective of the isolateused as inoculum source. Taken together, these observa-tions suggest that AbNIK1-null mutants may be unable toefficiently compete with other saprophytic fungi alsofound in the seed environment.

The data obtained during competition experiments incontrolled conditions clearly showed that the loss of theability to synthesize AbNIK1p in A. brassicicola DCF-resistant mutants was linked to a severe decrease in theircompetitiveness. Indeed, dual inoculation of plants withmixtures of wild-type and AbNIK1-null mutants resultedin a rapid reduction in the in planta biomass ratio ofresistant versus wild-type isolates. Similar results wereobtained by Ziogas et al. (2005) who showed thatlaboratory mutants of B. cinerea cross-resistant to DCF

and phenylpyrroles could not compete in planta with thewild-type isolate and were suppressed by the sensitiveisolate after a few disease cycles. These experiments wereperformed under controlled conditions and apparentlyhave not yet been confirmed by additional experimentsunder field conditions.

Indeed, field experiments to estimate the competitive-ness of isolates are much more difficult than laboratory oreven greenhouse experiments, because of the immigrationof conidia from non-inoculants and difficulties in clearlydifferentiating isolates. Hence, these experiments remainrare in plant pathology (Karaoglanidis et al., 2001),although they are critical to obtain data on pathogenfitness in actual field environments. In the experimentalfield conditions in this study, as judged from non-inoculatedcontrol plants, interference with migrating conidia fromoutside the field was negligible. Moreover, molecularmarkers were used to type the inoculated isolates at theAbNIK1 locus and at three other microsatellite loci anddiscriminate them from non-inoculants. The results ofthese field competition experiments confirmed that A.brassicicola DCF-resistant isolates were weak competitorsof the wild-type isolate in planta in the absence of DCFtreatments.

In conclusion, it was shown that, unlike B. cinerea,A. brassicicola-null mutants for GIII-HK showed no signifi-cant reduction in characteristics determining saprophyticfitness, except for an increased sensitivity to high concen-trations of neutral sugars. The cost for this phenotypictrait linked to DCF-resistance was a loss of competitivenessin a non-selective environment that mainly affected thefungus during the seed-colonization stage of the infectionprocess. This may explain why in B. cinerea only isolateswith amino-acid substitution and moderate resistance toDCF have been collected from the field (Oshima et al.,2002; Cui et al., 2004), while the field isolation of GIII-HK-null mutants highly cross-resistant to DCF andphenylpyrroles was possible in A. brassicicola (Avenotet al., 2005b) as well as in A. alternata (Dry et al., 2004).The data presented here suggest, however, that there is alow risk of the spread and persistence of such AbNIK1-null mutants and, at least in plants cultivated for seedproduction, this risk would be restricted to crops thathave undergone continuous DCF fungicide treatments.

Acknowledgements

This work was supported by the Contrat de PlanEtat-Région Pays de la Loire (2000–06) and was also partof the ECONET exchange program 2005–06. We thankDavid Manley for correcting the English version of themanuscript.

References

Aguirre J, Hansberg W, Navarro R, 2006. Fungal responses to reactive oxygen species. Medical Mycology 44, S101–7.

Akhtar N, Blomberg A, Adler L, 1997. Osmoregulation and protein expression in a pbs2delta mutant of Saccharomyces



cerevisiae during adaptation to hypersaline stress. FEBS Letters 403, 173–80.

Alex LA, Borkovich KA, Simon MI, 1996. Hyphal development in Neurospora crassa: involvement of a two-component histidine kinase. Proceedings of the National Academy of Sciences, USA 93, 3416–21.

Avenot H, Dongo A, Bataillé-Simoneau N et al., 2005a. Isolation of 12 polymorphic microsatellite loci in the phytopathogenic fungus Alternaria brassicicola. Molecular Ecology Notes 5, 948–50.

Avenot H, Simoneau P, Iacomi-Vasilescu B, Bataillé-Simoneau N, 2005b. Characterization of mutations in the two-component histidine kinase gene AbNIK1 from Alternaria brassicicola that confer high dicarboximide and phenylpyrrole resistance. Current Genetics 47, 234–43.

Barth H, Aktories K, Popoff MR, Stile BG, 2004. Binary bacterial toxins: biochemistry, biology, and applications of common Clostridium and Bacillus proteins. Microbiology and Molecular Biology Reviews 68, 373–402.

Catlett NL, Yoder OC, Turgeon BG, 2003. Whole-genome analysis of two-component signal transduction genes in fungal pathogens. Eukaryotic Cell 2, 1151–61.

Cui W, Beever RE, Parkes SL, Weeds PL, Templeton MD, 2002. An osmosensing histidine kinase mediates dicarboximide fungicide resistance in Botryotinia fuckeliana (Botrytis cinerea). Fungal Genetics and Biology 36, 187–98.

Cui W, Beever RE, Parkes SL, Templeton MD, 2004. Evolution of an osmosensing histidine kinase in field strains of Botryotinia fuckeliana (Botrytis cinerea) in response to dicarboximide fungicide usage. Phytopathology 94, 1129–35.

Dry IB, Yuan KH, Hutton DG, 2004. Dicarboximide resistance in field isolates of Alternaria alternata is mediated by a mutation in a two-component histidine kinase gene. Fungal Genetics and Biology 41, 102–8.

Goodwin DC, Lee SB, 1993. Microwave miniprep of total genomic DNA from fungi, plants, protists and animals for PCR. BioTechniques 15, 438–44.

Huang R, Levy Y, 1995. Characterization of iprodione-resistant isolates of Alternaria brassicicola. Plant Disease 79, 828–33.

Iacomi-Vasilescu B, Avenot H, Bataillé-Simoneau N, Laurent E, Guénard M, Simoneau P, 2004. In vitro fungicide sensitivity of Alternaria species pathogenic to crucifers and identification of Alternaria brassicicola field isolates highly resistant to both dicarboximides and phenylpyrroles. Crop Protection 23, 481–8.

Karaoglanidis GS, Thanassoulopoulos CC, Ioannidis PM, 2001. Fitness of Cercospora beticola field isolates resistant and sensitive to demethylation inhibitor fungicides. European Journal of Plant Pathology 107, 337–47.

Kendrick B, Carmichael JW, 1973. The hyphomycetes. In: Ainsworth GC, Sparrow FK, Sussman AS, eds. The Fungi, Vol. IVa. New York, USA: Academic Press, 321–509.

Kojima K, Takano Y, Yoshimi A, Tanaka C, Kikuchi T, Okuno T, 2004. Fungicide activity through activation of a fungal signalling pathway. Molecular Microbiology 53, 1785–96.

Ma Z, Michailides TJ, 2005. Advances in understanding molecular mechanisms of fungicide resistance and molecular

detection of resistant genotypes in phytopathogenic fungi. Crop Protection 24, 853–63.

Maeda T, Wurgler-Murphy SM, Saito H, 1994. A two-component system that regulates an osmosensing MAP kinase cascade in yeast. Nature 369, 242–5.

Miller TK, Renault S, Selitrennikoff CP, 2002. Molecular dissection of alleles of the osmotic-1 locus of Neurospora crassa. Fungal Genetics and Biology 35, 147–55.

Motoyama T, Kadokura K, Ohira T et al., 2005. A two-component histidine kinase of the rice blast fungus is involved in osmotic stress response and fungicide action. Fungal Genetics and Biology 42, 200–12.

Moye-Rowley S, 2003. Regulation of the transcriptional response to oxidative stress in fungi: similarities and differences. Eukaryotic Cell 2, 381–9.

Oshima M, Banno S, Okada K et al., 2006. Survey of mutations of a histidine kinase gene BcOS1 in dicarboximide-resistant field isolates of Botrytis cinerea. Journal of General Plant Pathology 72, 65–73.

Oshima M, Fujimura M, Banno S et al., 2002. A point mutation in the two-component histidine kinase BcOS-1 gene confers dicarboximide resistance in field isolates of Botrytis cinerea. Phytopathology 92, 75–80.

Panadero J, Pallotti C, Rodriguez-Vargas S, Randez-Gil F, Prieto JA, 2006. A downshift in temperature activates the high osmolarity glycerol (HOG) pathway, which determines freeze tolerance in Saccharomyces cerevisiae. Journal of Biological Chemistry 281, 4638–45.

Pillonel C, Meyer T, 1997. Effect of phenylpyrroles on glycerol accumulation and protein-kinase activity of Neurospora crassa. Pesticide Science 49, 229–36.

Viaud M, Fillinger S, Liu W et al., 2006. A class III histidine kinase acts as a novel virulence factor in Botrytis cinerea. Molecular Plant-Microbe Interactions 19, 1042–50.

Wheeler IE, Hollomon DW, Gustafson G et al., 2003. Quinoxyfen perturbs signal transduction in barley powdery mildew (Blumeria graminis f.sp. hordei). Molecular Plant Pathology 4, 177–86.

Wojda I, Alonso-Monge R, Bebelman JP, Mager WH, Siderius M, 2003. Response to high osmotic conditions and elevated temperature in Saccharomyces cerevisiae is controlled by intracellular glycerol and involves coordinate activity of MAP kinase pathways. Microbiology 149, 1193–204.

Yoshimi A, Kojima K, Takano Y, Tanaka C, 2005. Group III histidine-kinase is a positive regulator of Hog1-type mitogen-activated protein kinase in filamentous fungi. Eukaryotic Cell 4, 1820–8.

Yoshimi A, Tsuda M, Tanaka C, 2004. Cloning and characterization of the histidine kinase gene Dic1 from Cochliobolus heterostrophus that confers dicarboximide resistance and osmotic adaptation. Molecular Genetics and Genomics 271, 228–36.

Ziogas B, Anastasios N, Markoglou N, Spyropoulou V, 2005. Effect of phenylpyrrole-resistance mutations on ecological fitness of Botrytis cinerea and their genetical basis in Ustilago maydis. European Journal of Plant Pathology 113, 83–100.

Effect of null mutations in the AbNIK1 gene on saprophytic and parasitic fitness of Alternaria...

Documents

Transcript of Effect of null mutations in the AbNIK1 gene on saprophytic and parasitic fitness of Alternaria...