ARTICLE IN PRESS

Ticks and Tick-borne Diseases 1 (2010) 23–29

Contents lists available at ScienceDirect

Ticks and Tick-borne Diseases

1877-95

doi:10.1

� Corr

E-m

journal homepage: www.elsevier.de/ttbdis

Diversity of Borrelia genospecies in Ixodes ricinus ticks in a Lyme borreliosisendemic area in Switzerland identified by using new probes for reverseline blotting

Lise Gern �, Veronique Douet, Zully Lopez, Olivier Rais, Francisca Moran Cadenas

Institute of Biology, Laboratory of Eco-Epidemiology of Parasites, University of Neuchatel, Emile Argand 11, Case postale 158, 2009 Neuchatel, Switzerland

a r t i c l e i n f o

Article history:

Received 7 September 2009

Received in revised form

30 October 2009

Accepted 2 November 2009Available online 16 December 2009

Keywords:

Borrelia burgdorferi

Ixodes ricinus

Reverse line blotting

5S-23S intergenic spacer

Relapsing fever-like spirochaetes

9X/$ - see front matter & 2009 Elsevier Gmb

016/j.ttbdis.2009.11.001

esponding author. Tel.: +41 32 718 3000; fax

ail address: lise.gern@unine.ch (L. Gern).

a b s t r a c t

In Europe, 7 Borrelia species belonging to the Borrelia burgdorferi sensu lato complex have been reported

in Ixodes ricinus ticks. In addition, another Borrelia, related to the relapsing fever spirochaetes, has also

been described. In the present study, we designed probes for reverse line blotting allowing detection

and identification of all these Borrelia species after amplification of the variable spacer region between

the 23S and 5S ribosomal genes. These new probes allowed us investigate the diversity of Borrelia in 915

I. ricinus collected on the south-facing slope of Chaumont (Switzerland). Among the 159 infected ticks, 7

Borrelia species were identified, and B. spielmanii and relapsing fever-like (RFL) spirochaetes were

identified in this area for the first time. B. valaisiana and B. spielmanii were significantly less present in

male than in female or nymphal ticks. Mixed infection with RFL spirochaetes and Lyme borreliosis

spirochaetes were detected in 4 ticks. In addition, the set of probes could identify the recently described

species, B. bavariensis.

& 2009 Elsevier GmbH. All rights reserved.

Introduction

Lyme borreliosis (LB) is a multisystemic disease caused byspirochaetes belonging to the Borrelia burgdorferi sensu lato (sl)complex. In Europe, these spirochaetes are transmitted by the hard-bodied tick, Ixodes ricinus. At present, LB spirochaetes constitute agroup of 15 different Borrelia species included in the B. burgdorferi slcomplex (Chu et al., 2008; Richter et al., 2006; Rudenko et al., 2009).Among them, 7 species, B. burgdorferi sensu stricto (ss), B. garinii,B. afzelii, B. valaisiana, B. lusitaniae, B. spielmanii, and B. bissettii havebeen identified in the tick I. ricinus in Europe (Hanincova et al., 2003;Hulınska et al., 2007; Rauter and Hartung, 2005; Richter et al., 2006).In addition, another Borrelia, related to the relapsing feverspirochaete B. miyamotoi, first described in I. persulcatus in Asia(Fukunaga et al., 1995), has also been identified in I. ricinus inEurope, more specifically in Sweden (Fraenkel et al., 2002), inGermany and France (Richter et al., 2003), in Poland (Wodecka,2007), and in the Czech Republic (Hulınska et al., 2007).

In Switzerland, B. burgdorferi ss, B. garinii, B. afzelii, B. valaisiana,and B. lusitaniae have been reported in I. ricinus ticks (Jouda et al.,2004a, 2004b; Poupon et al., 2006; Burri et al., 2007; Moran Cadenaset al., 2007a, 2007b). In these studies, B. burgdorferi sl was detectedin ticks using polymerase chain reaction (PCR) followed by the use of

H. All rights reserved.

: +41 32 718 3001.

restriction fragment length polymorphism (RFLP) (Jouda et al.,2004a, 2004b) or the reverse line blotting (RLB) (Alekseev et al.,2001; Rijpkema et al., 1995; Poupon et al., 2006; Burri et al., 2007;Moran Cadenas et al., 2007a, 2007b) to identify borreliae at thegenospecies level. However, knowledge on the genetic diversity ofBorrelia species in tick populations remained partially unknownsince different Borrelia could not be identified at the genospecieslevel mainly due to the lack of specific probes.

Quantitative and qualitative information on the Borrelia

genospecies diversity infecting ticks is crucial to our under-standing of the epidemiology, prevention, and diagnosis of LB andother diseases due to the genus Borrelia. The aim of this study wasto develop probes for RLB to detect the largest diversity of Borrelia

species in I. ricinus ticks and to gain more information about theprevalence of the diverse spirochaetes in ticks collected in a sitewhere a long-term study on tick phenology and B. burgdorferi slprevalence in ticks is underway (Jouda et al., 2004a; MoranCadenas et al., 2007a).

Materials and methods

Tick collection sites

Questing ticks were collected monthly from January 2007 toDecember 2007 on the south-facing slope of Chaumont Mountain(471010N, 061560E) using the same protocol as described in Moran

ARTICLE IN PRESS

L. Gern et al. / Ticks and Tick-borne Diseases 1 (2010) 23–2924

Cadenas et al. (2007a). Nymphs and adults were placed separatelyin vials containing fresh grass and kept alive (at room tempera-ture and relative humidity close to 95%) until detection of Borrelia

sp. infection. Ticks were then processed as described in MoranCadenas et al. (2007a).

Detection and identification of Borrelia species by polymerase chain

reaction and reverse line blotting

To extract DNA, ticks were boiled for 15 min at 100 1C in 100ml0.7 M NH4OH, cooled quickly, and boiled again for 15 min in openvials to evaporate the ammonia (10ml samples were retained forPCR analysis). To check for cross-contamination, negative controlswere included during DNA extraction, which consisted of reagentswithout ticks.

l. ricinus ticks were analysed for B. burgdorferi sl genospecies byPCR and RLB. Primers B5S-Bor and 23S-Bor were used to amplifythe variable spacer region between 2 repeated copies of the 23S

and 5S ribosomal genes (Alekseev et al., 2001). PCR amplificationswere run in a Whatman Biometra Tgradient Thermocycler 96(Gottingen, Deutschland) using a touchdown PCR program (Burriet al., 2007). Negative and positive controls were included in eachPCR. In negative controls, water replaced DNA samples. Isolates ofB. burgdorferi ss (B31), B. garinii (NE11), B. afzelii (NE632),B. lusitaniae (PotiB1, PotiB2, PotiB3), and B. valaisiana (VS116)were used as positive controls.

For Borrelia identification by RLB, PCR products were hybri-dised to 7 different oligonucleotide probes (75 pmol) described inRijpkema et al. (1995) and in Poupon et al. (2006) blotted in lineson an activated Biodyne C membrane (Pall Europe Ltd., Ports-mouth, UK) using a Miniblotter 45 (Immunetic, Cambridge, MA).For this study, 8 new oligonucleotide probes (100 pmol) weredesigned (Table 1, see below). Hybridisation was visualized byincubating the membrane with enhanced chemiluminescencedetection liquid (GE Healthcare, Otelfingen, Switzerland) and byexposing the membrane to X-ray film (Hyperfilm, GE Healthcare).

Design of new probes

New probes were designed from sequences of the 5S-23S rDNAspacer region already published in Richter et al. (2006) and Younsiet al. (2005) for B. spielmanii (SpiNE2 and SpiNE3) and B. lusitaniae

(LusiNE1 and LusiNE2), respectively, and in Brown et al. (2006),Picken and Picken (2000), Postic et al. (1994, 1998), and Schneideret al. (2000) for B. bissettii (BisNE1 and BisNE2) (Table 1).

Table 1RLB probes used in this study.

Probe Sequence (50-30)

SL CTTTGACCATATTTTTATCTTCCA

SS AACACCAATATTTAAAAAACATAA

GA AACATGAACATCTAAAAACATAAA

AF AACATTTAAAAAATAAATTCAAGG

VSNE TATATCTTTTGTTCAATCCATGT

GANE CAAAAACATAAATATCTAAAAACATAA

GANE1 AAAATCAATGTTTAAAGTATAAAAT

LusiNE TCAAGATTTGAAGTATAAAATAAAA

LusiNE1 CATTCAAAAAAATAAACATTTAAAAACAT

LusiNE2 AAATCAAACATTCAAAAAAATAAAC

SpiNE2 GAATGGTTTATTCAAATAACATA

SpiNE3 GAATAAGCCATTTAAATAACATA

BisNE1 AAACACTAACATTTAAAAAACAT

BisNE2 AACTAACAAACATTTAAAAAACAT

RFLNE CTATCCATTGATCAATGC

Additionally, the sequencing of the ospA gene of 2 DNA extractsreacting with the generic probe SL only, allowed the identification ofB. garinii (NEd4 and NEd5 on Fig. 1), showing 99% homology with asequence, accession no. CP001318 deposited in GenBank. Therefore,a new probe GANE1 (Table 1, Fig. 1) was designed on the spacerregion to identify this B. garinii type. Finally, a probe (RFLNE) wasalso designed to detect relapsing fever-like (RFL) spirochaetes (Table1) after sequencing of the spacer region, the flagellin gene and the16S rDNA gene of some DNA samples.

Gene sequencing

Fragments of the 5S-23S rDNA spacer region, the ospA gene, the16S rDNA gene and of the flagellin gene of Borrelia DNA sampleswere amplified and sequenced. The 5S-23S rDNA spacer regionfragment was amplified using primers B5S-Bor and 23S-Bor(Alekseev et al., 2001). The PCR conditions were the same asdescribed in Moran Cadenas et al. (2007b) and Burri et al. (2007).

For the ospA gene amplification, we used primers OspA-1F andOspA-3R (350 bp) (OspA-1F: 50-CAAAATGTTAGCAGCCTTG-30 andOspA-3R: 50-GTGTATTCAAGTCTGGTTCC-30). Aliquots of DNA suspen-sions (10ml) were diluted in 50ml Taq buffer containing 1.5 mMMgCl2 (Qiagen, Switzerland), 0.4 mM for each dNTP, 0.2mM for eachprimer and 1.5 U Taq DNA polymerase (Qiagen). The mixture washeated for 3 min at 94 1C, and subjected to 40 cycles of 30 sdenaturation at 94 1C, 30 s each for the first annealing reaction at55 1C, with a 1 min extension and a final extension for 10 min at 72 1C.

For amplification of a 600-nucleotide fragment of the 16S rDNAgene, primers 16S1A and 16S1B and 16S2A and 16S2B were usedin a nested PCR as described in Richter et al. (2003). For geneamplification and sequencing of an approximately 1350-bpfragment of the 16S rDNA gene and of an approximately 800-bpfragment of the flagellin gene, we used primers Bf1 and Br1(Raoult et al., 1998) and Fla120F and Fla920R (Scoles et al., 2001),respectively (cited in Richter et al., 2003). Aliquots of DNAsuspensions (10ml) were diluted in 50ml Taq buffer containing1.5 mM MgCl2 (Qiagen), 0.4 mM for each dNTP, 1mM of eachprimer, 1.5 U of Taq DNA polymerase (Qiagen). A touchdown PCRprogram was used: initial denaturation for 3 min at 94 1C,followed by 5 cycles of 30 s at 94 1C. Then during the subsequentcycle sets, the annealing temperature was lowered from 62 1C to57 1C by 1 1C for 30 s and at 72 1C for 1 min for the 16S rDNA geneand 40 s for the flagellin gene. An additional 45-cycle set with 30 sat 94 1C, 30 s at 57 1C, and 1 min at 72 1C for the 16S rDNA gene and40 s for the flagellin gene was used. The PCR ended by a finalextension for 10 min at 72 1C.

Target organism Reference

B. burgdorferi sensu lato Rijpkema et al. (1995)

B. burgdorferi sensu stricto Rijpkema et al. (1995)

B. garinii Rijpkema et al. (1995)

B. afzelii Rijpkema et al. (1995)

B. valaisiana Poupon et al. (2006)

B. garinii Poupon et al. (2006)

B. garinii This paper

B. lusitaniae Poupon et al. (2006)

B. lusitaniae This paper

B. lusitaniae This paper

B. spielmanii This paper

B. spielmanii This paper

B. bissettii This paper

B. bissettii This paper

Relapsing fever-like This paper

ARTICLE IN PRESS

Fig. 1. Accession numbers and alignment of the 5S-23S rDNA intergenic spacer region of Borrelia garinii sequences identified in this study.

L. Gern et al. / Ticks and Tick-borne Diseases 1 (2010) 23–29 25

PCR products were purified using a commercially available kit(Qiagen, QIAquick PCR Purification Kit) and sequenced. All thesequencing was done by Microsynth AG (Balgach, Switzerland).Each obtained sequence was compared with available sequencesfrom the international databank (NCBI BLAST) using a softwarepackage (Bioedit, Tom Hall Ibis Biosciences, Karlsbad, CA 92008).Nucleotide sequences of the 5S-23S rDNA spacer region ofB. burgdorferi sl or RFL spirochaetes have been deposited in theGenBank database.

Statistical analysis

The Chi-square test was used to compare prevalences ofinfection in I. ricinus males and females, and Fisher’s test was usedto compare the prevalences of the various genospecies in nymphs,males, and females.

Results

In order to identify and detect Borrelia genospecies that are notfrequently reported in I. ricinus, we designed new probes to detectB. bissettii, B. spielmanii, and various B. lusitaniae strains. The 2probes, BisNE1 and BisNE2, for B. bissettii (Table 1) were testedwith strains DN127 and CA128 obtained from the Instituto de

Microbiologia, Bellinzona, Switzerland. These probes did not showcross-reaction with any other tested DNA from B. burgdorferi ss,B. garinii, B. afzelii, B. lusitaniae, B. valaisiana, B. spielmanii, and RFLspirochaetes (Fig. 2). Probes designed to detect B. spielmanii

(SpiNE2 and SpiNE3) (Table 1) were tested with extracted DNAfrom B. spielmanii strains IPT204, PCEq17N5, and A14S obtainedfrom the Institut Pasteur, Paris, France. The first 2 strainshybridised with SpiNE1, whereas strain A14S hybridised withSpiNE2. Similarly, no cross-reaction was observed with any othertested DNA from B. burgdorferi ss, B. garinii, B. afzelii, B. lusitaniae,B. valaisiana, B. bissettii, and RFL spirochaetes (Fig. 2). The spacerregion between primers B5S-Bor and 23S-Bor (410 bp) as well asthe ospA gene between primers OspA-1F and OspA-3R (350 bp) ofBorrelia DNA extract that reacted with probes SpiNE2 and SpiNE3,were sequenced. For the spacer DNA fragment, we obtained 100%homology with B. spielmanii AM055829, but on a smallerfragment of the spacer (147 bp) (GenBank accession no.GQ387037), no other spacer sequence is available on GenBank.The identity of Borrelia was then confirmed by sequencing theospA DNA fragment. The ospA sequence showed 100% homologywith B. spielmanii strains A14S (AF102057) and PC-Eq17N5(DQ133517).

Two new probes (LusiNE1 and LusiNE2) (Table 1) weredesigned to avoid the cross-reactivity observed with someB. afzelii (GenBank accession no. GQ387035, GQ387036) with

ARTICLE IN PRESS

Ref. Probes

Borrelia genospecies

B. b

urgd

orfe

ri sl

B. b

urgd

orfe

riss

B. g

arin

ii

B. a

fzel

ii

B. v

alai

sian

a

B. l

usita

niae

B. s

piel

man

ii

B. b

isse

ttii

Rel

apsi

ng fe

ver-

like

1

SL

SS

GA

AF

2

VSNE

GANE

LusiNE AF

This

pap

er

GANE1 SS

LusiNE1 GA

LusiNE2SpiNE2SpiNE3BisNEBisNE1RFLNE

Strong hybridisation (for details, see the text).

Some B. afzelii cross-react with LusiNE but are identified as B. afzelii.

Some B. garinii cross-react with LusiNE1 but are identified as B. garinii

Some B. burgdorferi ss cross-react with GANE1 but are identified as B. burgdorferi ss.

AF

GA

SS

AF

GA

SS

Fig. 2. Hybridisation of various Borrelia sp. DNA with specific probes. 1 Rijpkema et al. (1995). 2 Poupon et al. (2006).

L. Gern et al. / Ticks and Tick-borne Diseases 1 (2010) 23–2926

probe LusiNE. However, some cross-reactivity could not beavoided with LusiNE1. In fact, some B. garinii DNA hybridisedwith this probe (Fig. 2).

Cross-reactivity was also observed with B. burgdorferi ss thathybridised with the new probe GANE1, for example, B. burgdorferi

ss (B31) weakly cross-reacted with GANE1 (Table 1 and Fig. 2). Agreat diversity in spacer gene sequence was observed amongB. garinii (Fig. 1). All tested B. garinii DNA hybridised with probeGANE1 (Fig. 1). NEd1 hybridised with probe GA, NEd2 with probesGA and GANE, and NEd3 with probe GANE, although thesequences showed mutations at the loci where the probes weredesigned (Fig. 1).

Sequencing of the spacer region of one DNA sample extractedfrom one female tick (GenBank accession no. GQ387038) showed96% homology with B. miyamotoi AY531879, the only availablesequence of this fragment of the spacer region in GenBank. Theflagellin gene and the 16S rDNA gene of one additional isolate(NE4632) (unpublished data) were also sequenced. The flagellin

gene showed 100% homology with the sequence of a Europeanrelapsing fever-like (RFL) spirochaete strain (AF529084) andsimilarly the 16S rDNA gene sequence showed 100% homologywith the sequence of a European RFL spirochaete strain

(AF529085). DNA extracted from ticks collected in the Neuchatelarea in 2005 (unpublished data) reacting with the SL probe onlywas tested using the RFLNE probe. Eight samples (5 nymphs, 2females, and one male) hybridised with the new probe RFLNE.Partial sequencing of the 16S rRNA gene was performed for 3DNAs. All sequences were identical and showed 100% homologywith the RFL spirochaetes’ sequence AY253149. Probe RFLNE didnot show cross-reaction with DNA from B. burgdorferi ss, B. garinii,B. afzelii, B. lusitaniae, B. valaisiana, B. spielmanii, and B. bissettii

(Fig. 2).Using the new set of probes presented in Table 1 and

Fig. 2, we tested 915 I. ricinus nymphal and adult tickscollected in our study site by PCR followed by RLB, and 159(17.4%) were found infected with Borrelia sp. In nymphs, theinfection rate reached 19.5% (94/481), whereas in adults itreached 15% (65/434). Females (40/225, 17,8%) were morefrequently infected than males (25/209, 12%) (Chi-square test,p=0.053). Mixed infections with 2 or 3 Borrelia specieswere detected in 20.1% (32/159) infected ticks (Table 2).Most mixed infections (25/32, 78%) were detected in nymphsand only 22% (7/32) in females, whereas none was detectedin males.

ARTICLE IN PRESS

Table 2Borrelia species identification in infected I. ricinus ticks.

Stage n (%) Single infections Mixed infections

Ba Bg BgNE Bb Bv Bl Bs sl RFL Bg

+BgNE

Bg

+Bv

BgNE

+Bv

Bb

+Ba

Bb

+RFL

Ba

+RFL

BgNE

+Ba+Bv

BgNE

+Bg+Bv

Bb

+Ba+Bv

Nymph 94 (59) 27 12 0 15 11 1 0 2 1 11 2 1 2 1 3 1 3 1

Adult 65 (41) 14 8 3 13 7 2 3 0 8 2 1 0 3 0 0 0 1 0

Total 159 (100) 41 20 3 28 18 3 3 2 9 13 3 1 5 1 3 1 4 1

(%) 26 13 2 18 11 2 2 1 6 8 2 1 3 1 2 1 3 1

Ba, B. afzelii; Bg/BgNE, B. garinii; Bb, B. burgdorferi sensu stricto; Bv, B. valaisiana; Bl, B. lusitaniae; Bs, B. spielmanii; sl, unidentified species; RFL, relapsing fever-like

spirochaetes.

0%

25%

50%

75%

100%

Nymphs(n = 94)

Females(n = 40)

Males(n = 25)

RFL

Sl

Bl

Bs

Bv

BgNE

Bg

Bb

Ba

Fig. 3. Distribution of Borrelia spp. identified in infected ticks. RFL, relapsing fever-like spirochetes; Sl, unidentified species; Bl, B. lusitaniae; Bs, B. spielmanii;

Bv, B. valaisiana; BgNE, B. garinii reacting with probe GANE; Bg, B. garinii; Bb, B. burgdorferi sensu stricto; Ba, B. afzelii.

L. Gern et al. / Ticks and Tick-borne Diseases 1 (2010) 23–29 27

The new probes allowed the detection of B. spielmanii and RFLspirochaetes in this area. B. garinii was the most frequentlydetected species (reacting with probes GA, GANE, and GANE1:62/159, 39%), followed by B. afzelii (51/159, 32.1%), B. burgdorferi

ss (35/159, 22%), and B. valaisiana (28/159, 17.6%). RFL spir-ochaetes accounted for 8.2% (13/159) of the detected species andB. lusitaniae and B. spielmanii for 1.9% (3/159) each. Thedistribution of the different Borrelia species in nymphs, males,and females is presented in Fig. 3. B. valaisiana and B. spielmanii

were significantly less present in males than in females andnymphs (Fisher’s test, p=0.017 and p=0.038, respectively). TwoDNA extracts could not be characterized at the species level, andsequencing did not bring any answer.

During the writing of this manuscript, a new Borrelia species,B. bavariensis, formerly included in the B. garinii species (OspAserotype 4), has been proposed (Margos et al., 2009). Therefore, wetested our probes with 4 isolates obtained from xenodiagnosticticks fed on 2 Apodemus sylvaticus mice, that we had identified asB. garinii (OspA serotype 4) (Huegli et al., 2002). All 4 isolatesreacted with probes GANE1, GA, and LusiNE1. The spacer regionsequence of 2 isolates (NE2802 and NE2806, GenBank accessionnos. GQ903682 and GQ903683, respectively) showed 100% homol-ogy with strain PBi (GenBank accession no. CP000013.1, completesequence genome) and 100% homology with PBi (GenBankaccession no. FJ546494, 163 pb) now proposed as B. bavariensis. Inaddition, the spacer region sequence of 3 isolates (NE4861, NE4874,GenBank accession nos. GQ903684 and GQ903685, respectively,and NE4891, showing 100% homology with the 2 other sequences)from questing ticks collected in the Neuchatel area in 2007 andreacting with probes GANE1, GA, GANE, and LusiNE1, showed 98%homology with strain PBi (GenBank accession no. CP000013.1,complete sequence genome).

Discussion

In Europe, B. burgdorferi ss, B. garinii, B. afzelii, and B. spielmanii

are clearly associated with disease in humans (Baranton and DeMartino, 2009). In addition, B. lusitaniae (Collares-Pereira et al.,2004; da Franca et al., 2005; de Carvalho et al., 2008), B. bissettii

(Rudenko et al., 2008), and B. valaisiana (Diza et al., 2004; Saitoet al., 2007), although previously considered as non-pathogenic,have recently been reported as causing diseases as well. All theseLB-related species are detected and identified by the set of probesused in this study (Rijpkema et al., 1995; Poupon et al., 2006;present study). Eight new probes for RLB were developed tohybridise the whole panel of Borrelia species reported in I. ricinus

ticks. Two probes allow identification of different groups ofB. spielmanii, 2 the detection of B. lusitaniae, 2 of B. bissettii, andone of B. garinii (GANE1). In addition, the set of probes couldidentify the recently described species, B. bavariensis (Margos etal., 2009). Although some of these probes cross-react with otherBorrelia species, this is a problem only in case of mixed infectionof cross-reacting isolates. Moreover, the design of the probeRFLNE allowed us to identify RFL spirochaetes.

The new set of probes was used to determine the Borrelia speciesdiversity in a LB endemic area where a long-term study is underway(Jouda et al., 2004a; Moran Cadenas et al., 2007a). Using new probes,B. spielmanii and RFL spirochaetes were firstly identified in this site.B. spielmanii has not previously been reported in Switzerland.B. spielmanii, formerly designated A14S, has been described inI. ricinus ticks from France (Richter et al., 2004), the Czech Republic(Derdakova et al., 2003), Ukraine (Nefedova et al., 2005), and Germany(Fingerle et al., 2008; Skuballa et al., 2007; Rauter et al., 2002). Thisspecies is known to cause erythema migrans in humans and has beenidentified in the skin of patients in the Netherlands (Van Dam et al.,

ARTICLE IN PRESS

L. Gern et al. / Ticks and Tick-borne Diseases 1 (2010) 23–2928

1993), in Denmark (I. Livey, unpublished results cited by Richter et al.,2006), Hungary (Foldvari et al., 2005), Germany (Michel et al., 2004),and Slovenia (Maraspin et al., 2006; Fingerle et al., 2008). Interest-ingly, in this study, B. spielmanii was detected exclusively in adultI. ricinus ticks, as previously reported for ticks collected in 5 sites inGermany (Fingerle et al., 2008). However, the infection prevalenceobserved here is rather low compared to the B. spielmanii infectionprevalences described by Fingerle et al. (2008) in Germany.

The other newly identified RFL spirochaetes in the study siteare also reported for the first time in Switzerland. The observedprevalence of these RFL spirochaetes (8.2%) is in line with theprevious report of RFL spirochaete infection (varying from 5.6% to16.7%) in 3 different sites in France and Germany (Richter et al.,2003). Interestingly, the authors of this study mentioned theabsence of mixed infections between RFL spirochaetes and agentsof LB in the same tick, whereas such mixed infections weredetected in the present study in 4 I. ricinus nymphs: In 3 nymphs,these spirochaetes were associated with B. afzelii, and in onenymph they were associated with B. burgdorferi ss. In Europe,rodents, more specifically small rodents and squirrels, are knownto act as reservoir hosts for B. afzelii and B. burgdorferi ss (Humairand Gern, 1998; Humair et al., 1995, 1999). Therefore, these hostspecies are suspected to be reservoirs for RFL spirochaetes.However, B. afzelii and B. burgdorferi have also been reportedassociated with other hosts, and studies are necessary to elucidatethe source of infection of ticks with RFL spirochaetes; all the moreso, since in Poland, B. miyamotoi DNA was identified in oneI. ricinus tick removed from a red deer (Cervus elaphus) (Wodecka,2007). The exact pathogenic role of the RFL spirochaetes reportedin I. ricinus has not been established, as yet.

Using the probes designed in this paper, in addition to thosepreviously developed by Rijpkema et al. (1995) and Poupon et al.(2006), in the RLB test, we were able to detect and differentiatethe B. burgdorferi genospecies described in I. ricinus as well as RFLspirochaetes in a single test. Therefore, the use of this new set ofprobes constitutes a further improvement in Borrelia detectionand identification. This technique is particularly suitable forstudies investigating the Borrelia genospecies diversity in a largenumber of ticks in a given area.

Acknowledgements

We would like to thank Martine Garnier and Muriel Cornetfrom the Institut Pasteur in Paris (France) for providing us withB. spielmanii DNA and Simona Casati from the Instituto deMicrobiologia in Bellinzone (Switzerland) for B. bissettii DNA.We are grateful to Pierre-Franc-ois Humair for the design of theospA primers, to Caroline Burri and Delphine Huegli for providingstrains and to Jason Grant for reviewing the English of thismanuscript. Results obtained here are part of a project financedby the Swiss National Science Foundation (FN 320030-113936) toL. Gern. This paper is catalogued by the EDEN Steering Committeeas EDEN0161 (http://www.eden-fp6project.net/). The contentsare the sole responsibility of the authors and do not necessarilyreflect the views of the European Commission.

References

Alekseev, A.N., Dubinina, H.V., Van de Pol, I., Schouls, L.M., 2001. Identification ofEhrlichia spp. and Borrelia burgdorferi in Ixodes ticks in the Baltic regions ofRussia. J. Clin. Microbiol. 39, 2237–2242.

Baranton, G., De Martino, S.J., 2009. Borrelia burgdorferi sensu lato diversity and itsinfluence on pathogenicity in humans. In: Lipsker, D., Jaulhac, B. (Eds.), LymeBorreliosis. Curr. Probl. Dermatol. 37, Karger, Basel, pp. 1–17.

Brown, R.N., Peot, M.A., Lane, R.S., 2006. Sylvatic maintenance of Borreliaburgdorferi (Spirochaetales) in Northern California: untangling the web oftransmission. J. Med. Entomol. 43, 743–751.

Burri, C., Moran Cadenas, F., Douet, V., Moret, J., Gern, L., 2007. Ixodes ricinusdensity and infection prevalence of Borrelia burgdorferi sensu lato along anorth-facing altitudinal gradient in the Rhone Valley (Switzerland). Vector-Borne Zoonotic Dis. 7, 50–58.

Chu, C.-Y., Liu, W., Jiang, B.-G., Wang, D.-M., Jiang, W.J., Zhao, Q.-M., Zhang, P.-H.,Wang, Z.-X., Tang, G.-P., Yang, H., Cao, W.-C., 2008. Novel genospecies ofBorrelia burgdorferi sensu lato from rodents and ticks in Southwestern China. J.Clin. Microbiol. 46, 3130–3133.

Collares-Pereira, M., Couceiro, S., Franca, I., Kurtenbach, K., Schafer, S.M., Vitorino,L., Gonc-alves, L., Baptista, S., Vieira, M.L., Cunha, C., 2004. First isolation ofBorrelia lusitaniae from a human patient. J. Clin. Microbiol. 42, 1316–1318.

da Franca, I., Santos, L., Mesquita, T., Collares-Pereira, M., Baptista, S., Vieira, L.,Viana, I., Vale, E., Prates, C., 2005. Lyme borreliosis in Portugal caused byBorrelia lusitaniae? Clinical report on the first patient with a positive skinisolate. Wien. Klin. Wochenschr. 117, 429–432.

de Carvalho, I.L., Fonseca, J.E., Marques, J.G., Ullmann, A., Hojgaard, A., Zeidner, N.,Nuncio, M.S., 2008. Vasculitis-like syndrome associated with Borrelia lusitaniaeinfection. Clin. Rheumatol. 27, 1587–1591.

Derdakova, M., Beati, L., Pet’ko, B., Stanko, M., Fish, D., 2003. Genetic variabilitywithin Borrelia burgdorferi sensu lato genospecies established by PCR-single-strand conformation polymorphism analysis of the rrfA-rrlB intergenic spacerin Ixodes ricinus ticks from the Czech Republic. Appl. Environ. Microbiol. 69,509–516.

Diza, E., Papa, A., Vezyri, E., Tsounis, S., Milonas, I., Antoniadis, A., 2004. Borreliavalaisiana in cerebrospinal fluid. Emerg. Infect. Dis. 10, 1692–1693.

Fingerle, V., Schulte-Spechtel, U.C., Ruzic-Sabljic, E., Leonhard, S., Hofmann, H.,Weber, K., Pfister, K., Strle, F., Wilske, B., 2008. Epidemiological aspects andmolecular characterization of Borrelia burgdorferi s.l. from southern Germanywith special respect to the new species Borrelia spielmanii sp. nov. Int. J. Med.Microbiol. 298, 279–290.

Foldvari, G., Farkas, R., Lakos, A., 2005. Borrelia spielmanii erythema migrans,Hungary. Emerg. Infect. Dis. 11, 1794–1795.

Fraenkel, C.-J., Garpmo, U., Berglund, J., 2002. Determination of novelBorrelia genospecies in Swedish Ixodes ricinus ticks. J. Clin. Microbiol. 40,3308–3312.

Fukunaga, M., Takahashi, Y., Tsuruta, Y., Matsushita, O., Ralph, D., McClelland, M.,Nakao, M., 1995. Genetic and phenotypic analysis of Borrelia miyamotoi sp.nov., isolated from the ixodid tick Ixodes persulcatus, the vector for Lymedisease in Japan. Int. J. Syst. Bacteriol. 45, 804–810.

Hanincova, K., Taragelova, V., Koci, J., Schafer, S.M., Hails, R., Ullmann, A.J., Piesman,J., Labuda, M., Kurtenbach, K., 2003. Association of Borrelia garinii andB. valaisiana with songbirds in Slovakia. Appl. Environ. Microbiol. 69,2825–2830.

Huegli, D., Hu, C.M., Humair, P.-F., Wilske, B., Gern, L., 2002. Apodemus species miceare reservoir hosts of Borrelia garinii OspA serotype 4 in Switzerland. J. Clin.Microbiol. 40, 4735–4737.

Hulınska, D., Votypka, J., Krız, B., Holınkova, N., Novakova, J., Hulınsky, V., 2007.Phenotypic and genotypic analysis of Borrelia spp. isolated from Ixodes ricinusticks by using electrophoretic chips and real-time polymerase chain reaction.Folia Microbiol. 52, 315–324.

Humair, P.F., Gern, L., 1998. Relationship between Borrelia burgdorferi sensu latospecies, red squirrels (Sciurus vulgaris) and Ixodes ricinus in enzootic areas inSwitzerland. Acta Trop. 69, 213–227.

Humair, P.F., Peter, O., Wallich, R., Gern, L., 1995. Strain variation of Lyme diseasespirochetes isolated from Ixodes ricinus ticks and rodents collected in twoendemic areas in Switzerland. J. Med. Entomol. 32, 433–438.

Humair, P.F., Rais, O., Gern, L., 1999. Transmission of Borrelia afzelii from Apodemusmice and Clethrionomys voles to Ixodes ricinus ticks: differential transmissionpattern and overwintering maintenance. Parasitology 118, 33–42.

Jouda, F., Perret, J.-L., Gern, L., 2004a. Ixodes ricinus density, and distribution andprevalence of Borrelia burgdorferi sensu lato infection along an altitudinalgradient. J. Med. Entomol. 41, 162–169.

Jouda, F., Perret, J.-L., Gern, L., 2004b. Density of questing Ixodes ricinus nymphsand adults infected by Borrelia burgdorferi sensu lato in Switzerland: spatio-temporal pattern at a regional scale. Vector-Borne Zoonotic Dis. 4, 23–32.

Maraspin, V., Ruzic-Sabljic, E., Strle, F., 2006. Lyme borreliosis and Borreliaspielmanii. Emerg. Infect. Dis. 12, 1177.

Margos, G., Vollmer, S.A., Cornet, M., Garnier, M., Fingerle, V., Wilske, B., Bormane,A., Vitorino, L., Collares-Pereira, M., Drancourt, M., Kurtenbach, K., 2009. A newBorrelia species defined by multilocus sequence analysis of housekeepinggenes. Appl. Environ. Microbiol. 75, 5410–5416.

Michel, H., Wilske, B., Hettche, G., Goettner, G., Heirmerl, C., Reischl, U., Schulte-Spechtel, U., Fingerle, V., 2004. An ospA-polymerase chain reaction/restrictionfragment length polymorphism-based method for sensitive detection andreliable differentiation of all European Borrelia burgdorferi sensu lato speciesand OspA types. Med. Microbiol. Immunol. 193, 219–226.

Moran Cadenas, F., Rais, O., Jouda, F., Douet, V., Humair, P.F., Moret, J., Gern, L.,2007a. Phenology of Ixodes ricinus and infection with Borrelia burgdorferi sensulato along a north- and south-facing altitudinal gradient on ChaumontMountain, Switzerland. J. Med. Entomol. 44, 683–693.

Moran Cadenas, F., Schneider, H., Lommano, E., Burri, C., Moret, J., Gern, L., 2007b. Acomparison of two DNA extraction approaches in the detection of Borreliaburgdorferi sensu lato from live Ixodes ricinus ticks by PCR and reverse lineblotting. Vector-Borne Zoonotic Dis. 7, 555–561.

Nefedova, V.V., Korenberg, E.I., Andreichuk, Iu.V., Gorelova, N.B., Markov, A.V.,Fadeeva, I.A., Evstaf’ev, I.L., 2005. Genetic characterization of pathogenic

ARTICLE IN PRESS

L. Gern et al. / Ticks and Tick-borne Diseases 1 (2010) 23–29 29

Borrelia, group A14S, isolated in Ukraine. Zh. Mikrobiol. Epidemiol. Immuno-biol. 7, 23–27 (in Russian).

Picken, R.N., Picken, M.M., 2000. Molecular characterization of Borrelia spp. isolatesfrom greater metropolitan Chicago reveals the presence of Borrelia bissettii.Preliminary report. J. Mol. Microbiol. Biotechnol. 2, 505–507.

Postic, D., Assous, M.V., Grimont, P.A., Baranton, G., 1994. Diversity of Borreliaburgdorferi sensu lato evidenced by restriction fragment length polymorphism ofrrf (5S)-rrl (23S) intergenic spacer amplicons. Int. J. Syst. Bacteriol. 44, 743–752.

Postic, D., Marti Ras, N., Lane, R.S., Hendson, M., Baranton, G., 1998. Expandeddiversity among Californian Borrelia isolates and description of Borrelia bissettiisp. nov. (formerly Borrelia Group DN127). J. Clin. Microbiol. 36, 3497–3504.

Poupon, M.-A., Lommano, E., Humair, P.-F., Douet, V., Rais, O., Schaad, M., Jenni, L.,Gern, L., 2006. Prevalence of Borrelia burgdorferi sensu lato in ticks collectedfrom migratory birds in Switzerland. Appl. Environ. Microbiol. 72, 976–979.

Raoult, D., Ndihokubwayo, J.B., Tissot-Dupont, H., Roux, V., Faugere, B., Abegbinni,R., Birtles, R.J., 1998. Outbreak of epidemic typhus associated with trench feverin Burundi. Lancet 352, 353–358.

Rauter, C., Hartung, T., 2005. Prevalence of Borrelia burgdorferi sensu latogenospecies in Ixodes ricinus ticks in Europe: a metaanalysis. Appl. Environ.Microbiol. 71, 7203–7216.

Rauter, C., Oehme, R., Diterich, I., Engele, M., Hartung, T., 2002. Distribution ofclinically relevant Borrelia genospecies in ticks assessed by a novel, single-run,real-time PCR. J. Clin. Microbiol. 40, 36–43.

Richter, D., Schlee, D.B., Matuschka, F.R., 2003. Relapsing fever-like spirochetesinfecting European vector tick of Lyme disease agent. Emerg. Infect. Dis. 9,697–701.

Richter, D., Schlee, D.B., Allgower, R., Matuschka, F.R., 2004. Relationships of anovel Lyme disease spirochete, Borrelia spielmani sp. nov., with its hosts inCentral Europe. Appl. Environ. Microbiol. 70, 6414–6419.

Richter, D., Postic, D., Sertour, N., Livey, I., Matuschka, F.R., Baranton, G., 2006.Delineation of Borrelia burgdorferi sensu lato species by multilocus sequenceanalysis and confirmation of the delineation of Borrelia spielmanii sp. nov. Int. J.Syst. Evol. Microbiol. 56, 873–881.

Rijpkema, S.G., Molkenboer, M.J., Schouls, L.M., Jongejan, F., Schellekens, J.F., 1995.Simultaneous detection and genotyping of three genomic groups of Borrelia

burgdorferi sensu lato in Dutch Ixodes ricinus ticks by characterization of theamplified intergenic spacer region between 5S and 23S rRNA genes. J. Clin.Microbiol. 33, 3091–3095.

Rudenko, N., Golovchenko, M., Grubhoffer, L., Oliver, J.H., 2009. Borrelia carolinensissp. nov., a new (14th) member of the Borrelia burgdorferi sensu lato complexfrom the Southeastern region of the United States. J. Clin. Microbiol. 47,134–141.

Rudenko, N., Golovchenko, M., Mokracek, A., Piskunova, N., Ruzek, D., Mallatova,N., Grubhoffer, L., 2008. Detection of Borrelia bissettii in cardiac valve tissue of apatient with endocarditis and aortic valve stenosis in the Czech Republic. J.Clin. Microbiol. 46, 3540–3543.

Saito, K., Ito, T., Asashima, N., Ohno, M., Nagai, R., Fujita, H., Koizumi, N., Takano, A.,Watanabe, H., Kawabata, H., 2007. Case report: Borrelia valaisiana infection in aJapanese man associated with traveling to foreign countries. Am. J. Trop. Med.Hyg. 77, 1124–1127.

Schneider, B.S., Zeidner, N.S., Burkot, T.R., Maupin, G.O., Piesman, J., 2000. Borreliaisolates in Northern Colorado identified as Borrelia bissettii. J. Clin. Microbiol.38, 3103–3105.

Scoles, G.A., Papero, M., Beati, L., Fish, D., 2001. A relapsing fever group spirochetetransmitted by Ixodes scapularis ticks. Vector-Borne Zoonotic Dis. 1, 21–34.

Skuballa, J., Oehme, R., Hartelt, K., Petney, T., Bucher, T., Kimmig, P., Taraschewski,H., 2007. European hedgehogs as hosts for Borrelia spp. in Germany. Emerg.Infect. Dis. 13, 952–953.

Van Dam, A.P., Kuiper, H., Vos, K., Widjojokusumo, A., de Jongh, B.M., Spanjaard, L.,Ramselaar, A.C., Kramer, M.D., Dankert, J., 1993. Different genospecies ofBorrelia burgdorferi are associated with distinct clinical manifestations of Lymeborreliosis. Clin. Infect. Dis. 17, 708–717.

Wodecka, B., 2007. Significance of red deer (Cervus elaphus) in the ecologyof Borrelia burgdorferi sensu lato. Wiad. Parazytol. 53, 231–237(in Polish).

Younsi, H., Sarih, M., Jouda, F., Godfroid, E., Gern, L., Bouattour, A., Baranton, G.,Postic, D., 2005. Characterization of Borrelia lusitaniae isolates collected inTunisia and Morocco. J. Clin. Microbiol. 43, 1587–1593.