Distinct biological activities of C3 and ADP-ribosyltransferase-deficient C3-E174Q

Distinct biological activities of C3 andADP-ribosyltransferase-deficient C3-E174QAstrid Rohrbeck, Tanja Kolbe, Sandra Hagemann, Harald Genth and Ingo Just

Institute of Toxicology, Medizinische Hochschule Hannover, Hanover, Germany

Keywords

ADP-ribosyltransferase; apoptosis;

C3 exoenzyme; proliferation; RhoA

Correspondence

A. Rohrbeck, Department of Toxicology,

Medizinische Hochschule Hannover,

Carl-Neuberg-Straße 1, D-30625 Hanover,

Germany

Fax: +49 511 5322879

Tel: +49 511 5322807

E-mail: [email protected]

(Received 25 October 2011, revised 15 May

2012, accepted 16 May 2012)

doi:10.1111/j.1742-4658.2012.08645.x

Low-molecular-weight GTP-binding proteins of the Rho family control the

organization of the actin cytoskeleton in eukaryotic cells. Dramatic reorga-

nization of the actin cytoskeleton is caused by the C3 exoenzyme derived

from Clostridium botulinum (C3), based on ADP-ribosylation of

RhoA ⁄B ⁄C. In addition, wild-type as well as ADP-ribosyltransferase-defi-

cient C3-E174Q induce axonal outgrowth of primary murine hippocampal

neurons and prevent growth cone collapse, indicating a non-enzymatic

mode of action. In this study, we compared the effects of C3-E174Q and

wild-type C3 in the murine hippocampal cell line HT22. Treatment of

HT22 cells with C3 resulted in Rho ADP-ribosylation and cell rounding.

The ADP-ribosyltransferase-deficient mutant C3-E174Q did not induce

either Rho ADP-ribosylation or morphological changes. C3 as well as

C3-E174Q treatment resulted in growth arrest, reduced expression of

cyclin D levels, and increased expression of RhoB, a negative regulator of

cell-cycle progression. Serum starvation induced apoptosis in HT22 cells, as

determined on the basis of increased expression of caspase-9 and Bax. C3

but not C3-E174Q protected serum-starved HT22 cells from apoptosis.

This is the first study separating ADP-ribosyltransferase-dependent from

ADP-ribosyltransferase-independent effects of C3. While morphological

changes and anti-apoptotic activity strictly depend on ADP-ribosyltransfer-

ase activity, the anti-proliferative effects are independent of ADP-ribosyl-

transferase activity.

Structured digital abstractl Rhotekin physically interacts with RHOA by pull down (View interaction)

Introduction

Low-molecular-weight GTP-binding proteins of the

Rho family control the organization of the actin cyto-

skeleton in eukaryotic cells and are involved in the reg-

ulation of gene expression, cell proliferation, apoptosis

and axonal growth [1,2]. The Rho family members

RhoA, B and C exhibit significant amino acid sequence

identity (approximately 85%) and are thought to inter-

act with the same effectors. RhoB appears to possess

unique functions compared to RhoA and RhoC. RhoB

is exclusively localized to membranes, both plasma

membrane and endosomes, even when inactive [3].

RhoA is cytosolic within the GDI complex, and only

moves to the plasma membrane upon activation and

dissociation of RhoGDI. Interestingly, RhoGDI-1 does

not bind to RhoB, consistent with the finding that

RhoB is always found in association with membranes

[4]. RhoB has a specialized function in intracellular

trafficking of cytokine receptors such as epidermal

growth factor receptor [5]. Additionally, RhoB protein

is relatively short-lived in cells, and its expression can

Abbreviations

ART, ADP-ribosyltransferase; C3, C3 exoenzyme derived from Clostridium botulinum; C3-E174Q, ADP-ribosyltransferase-deficient C3.

FEBS Journal 279 (2012) 2657–2671 ª 2012 The Authors Journal compilation ª 2012 FEBS 2657

http://www.uniprot.org/uniprot/Q9BST9

http://www.ebi.ac.uk/ontology-lookup/?termId=MI:0915

http://www.uniprot.org/uniprot/P61586

http://www.ebi.ac.uk/ontology-lookup/?termId=MI:0096

http://mint.bio.uniroma2.it/mint/search/interaction.do?interactionAc=MINT-8378406

be elevated by a number of stimuli, including epidermal

growth factor, transforming growth factor b and geno-

toxic stress [6,7]. Moreover, silencing of RhoA induced

strong up-regulation of both total and active RhoB

protein levels [8].

RhoA, RhoB and RhoC are substrates of bacterial

C3-like exoenzymes, which inactivate RhoA, B and C

by ADP-ribosylation at the amino acid asparagine at

position 41 [9]. In cultured cells, Rho ADP-ribosylation

causes dramatic changes in the actin cytoskeleton of

most cell types, resulting in rounding of cultured

fibroblasts or epithelial cells [10,11]. However, C3 from

Clostridium botulinum (C3bot) possesses an additional

axonotrophic activity independently of its inherent

ADP-ribosyltransferase (ART) activity, as C3 induces

axonal and dendritic growth, and, in addition, branch-

ing and synapse formation in cultured primary murine

hippocampal neurons [12]. This axonotrophic activity

is specific for C3bot, as C3 isoforms from other

microbes do not exhibit axon and dendrite growth-

promoting activity in hippocampal neurons [13]. More-

over, the axonotrophic activity of the ART-deficient

mutant C3bot-E174Q is as effective as the enzyme-

active C3bot. It is known that C3 stimulates growth

cone formation in neuronal cells N1E-115 by inhibition

of growth cone collapse through RhoA inactivation

[14]. On the other hand, C3 induces axonal outgrowth

from DRG (dorsal root ganglion) neurons, but forma-

tion of lamellipodia and filopodia in the growth cones

of DRG is not detectable under these conditions [15].

However, in addition to axon growth-promoting

activity, C3 causes inhibition of cell growth in cultured

rat pheochromocytoma PC-12 cells and formation of

neurites [16]. Growing evidence suggests that C3 influ-

ences cell proliferation by inactivation of RhoA. RhoA

is known to be instrumental in the kinetics of

cyclin D1 expression [17]. Moreover, others have

observed inhibition of cyclin D1 expression upon C3

treatment [18]. RhoA also suppresses p21 levels in

multiple normal and transformed cell lines [19]. Degra-

dation of G1 cyclin-dependent kinase inhibitor

p27(KIP1) is inhibited by C3, further supporting the

important role of RhoA in cell proliferation [20]. Inter-

estingly, RhoB negatively regulates cell proliferation

[21]. A negative role of RhoB in growth control would

contrast with the positive effects of RhoA and RhoC

[22].

Additionally, C3 also appears to play a role in sur-

vival signalling. It was shown that C3-catalyzed inacti-

vation of RhoA induces apoptosis in haematopoietic

cells [23] and causes adhesion-independent apoptosis

[24]. Recently, it has been reported that C3 results in

activation of caspase-3 and thus apoptosis of cardio-

myocytes [25]. By contrast, inactivation of RhoA by

C3 protects neurons from cell death [26]. In another

study, it was observed that, after contusion injury, cell-

permeable C3 decreased neuronal and glial apoptosis,

as detected by TUNEL [27].

In this study, the biological effects of C3 and C3-

E174Q were analyzed in the mouse hippocampal HT22

cells, a cell line that exhibits sensitivity to C3. C3 and

C3-E174Q both induced inhibition of cell proliferation

and cyclin D1 down-regulation as well as RhoB expres-

sion. These effects thus appear to be independent of the

ART activity of C3. In contrast, actin re-organization

and anti-apoptotic activity were specifically observed in

C3-treated cells, thus appeared to depend on the ART

activity. This report strongly indicates that C3 pos-

sesses ART-independent activities.

Results

ART dependency of the morphological changes

induced by C3

HT22 cells exhibited spindle-shaped morphology

(Fig. 1A). Upon C3 treatment for 72 h, a population

of HT22 cells became round and exhibited pronounced

Fig. 1. Morphology of HT22 cells after treatment with C3. HT22 cells were treated for 72 h with 500 nM of C3 or C3-E174Q. Untreated cells

served as a control. Phase-contrast microscopic images are shown. Scale bar = 50 lm.

Effect of C3 exoenzyme on hippocampal cells A. Rohrbeck et al.

2658 FEBS Journal 279 (2012) 2657–2671 ª 2012 The Authors Journal compilation ª 2012 FEBS

retraction fibers (Fig. 1). In contrast, treatment with

C3-E174Q did not cause any morphological changes

(Fig. 1A), suggesting that the morphological changes

are dependent on the ART activity of C3. C3bot

ADP-ribosylated RhoA from HT22 cells in a time-

and concentration-dependent manner, as evidenced by

the apparent shift of ADP-ribosylated RhoA to higher

molecular mass in SDS ⁄PAGE (Fig. 2A) and sequen-

tial [32P]ADP-ribosylation of non-ADP-ribosylated

Rho (Fig. 2B). In contrast, C3-E174Q did not ADP-ri-

bosylate cellular RhoA (Fig. 2A–C). Furthermore, C3-

E174Q did not possess any ART activity in a cell-free

system (Fig. S1). RhoA ADP-ribosylation by C3

resulted in a reduced level of RhoA-GTP, but treat-

ment with C3-E174Q did not affect the level of RhoA-

GTP (Fig. 3). These observations were consistent with

previous reports showing that C3-E174Q lacked ART

activity [13] and that ADP-ribosylation resulted in

RhoA inactivation [28,29].

Binding measurements for purified RhoA using

microscale thermophoresis

Next, we investigated binding of fluorescence-labelled

RhoA to C3 exoenzyme using microscale thermopho-

resis. Binding of C3 to RhoA was readily observed as

Fig. 2. Sensitivity of HT22 cells towards C3

exoenzyme. (A) Exposure of HT22 cells to

increasing concentrations of C3 causes a

molecular mass shift of RhoA in SDS ⁄ PAGE

and a decrease in RhoA level in a concentra-

tion- and time-dependent manner. Cells trea-

ted with the C3-E174Q did not show an

RhoA shift. (B) HT22 cells were exposed to

increasing concentrations of C3 for 8 or

24 h at 37 �C. Cells were lysed and sub-

jected to sequential [32P]ADP-ribosylation.

Phosphorimages from representative experi-

ments are shown. (C) Densitometric mea-

surements for a representative experiment.

A. Rohrbeck et al. Effect of C3 exoenzyme on hippocampal cells


a change in the thermophoretic property of the

fluorescently labelled RhoA upon complex formation.

The C3–RhoA complex shows a stronger increase of

normalized fluorescence than the unbound protein.

The signal shown in Fig. 4A is a binding curve, and

starts at an Fnorm of approximately 830 units. When

the concentration of C3 is increased, the microscale

thermophoresis signal increases to approximately

920 units. Thus, a significant amount of the RhoA is

in complex with C3. From the data, we inferred a

dissociation coefficient of 32.18 lM (Fig. 4A). We next

assessed the interaction of RhoA with C3-E174Q.

Figure 4B shows the resulting sigmoidal binding curve

for the C3-E174Q–RhoA interaction, with significant

differences between low and high C3-E174Q concen-

trations and a calculated Kd of 7.23 lM. These findings

indicate a four- to fivefold higher affinity of RhoA for

C3-E174Q compared to C3.

Distinct kinetics of RhoB expression induced by

C3 and C3-E174Q

RhoA ADP-ribosylation by C3 has been reported to

result in RhoB expression [30]. Consistently, RhoA

ADP-ribosylation in C3-treated HT22 cells was

accompanied by pronounced RhoB expression

(Fig. 5A). Interestingly, RhoB expression was also

observed in HT22 cells upon prolonged treatment with

C3-E174Q for 2–6 days (Fig. 5B). Under these condi-

tions, neither RhoA nor RhoB was ADP-ribosylated,

as evidenced by the lack of shift of RhoA and RhoB

to apparent higher molecular masses in SDS ⁄PAGE

(Fig. 5B). However, RhoB expression in C3-E174Q-

treated cells correlated with a decreased cellular level

of RhoA. C3-E174Q thus appeared to induce RhoB

expression independently of RhoA ADP-ribosylation.

Reduced cell proliferation upon treatment with

both C3 and C3-E174Q

RhoB has been implicated in the regulation of cell

proliferation, as ectopic expression of constitutively

active RhoB inhibits proliferation [31]. Next, the effects

of C3 and C3-E174Q on HT22 proliferation was analy-

sed over a 7-day period (Fig. 6). Untreated cells

showed a reduced growth rate, probably due to density

inhibition. The cells reach confluence and form a

monolayer at day 5 (Fig. 6). Upon treatment with

either C3 or C3-E174Q, exponential growth was

observed up to 2 days, and then proliferation ceased.

Fig. 3. GTP-RhoA levels were determined in lysates of HT22 cells using pull-down assay. HT22 cells were treated with either C3 or

C3-E174Q for various times. (A) Cell lysates were subjected to Rho binding by pull-down assay followed by western blot analysis using anti-

bodies against RhoA or b-actin. Western blot analyses from representative experiments are presented (n = 3). GTPyS = positive control.

(B,C) Cellular levels of GTP-RhoA proteins at 24 h (B) and 72 h (C) were quantified using KODAK 1D image analysis software. All signal intensi-

ties were normalized to the intensity of the corresponding b-actin signal.



In C3-treated cells, the number of viable cell decreased

by approximately 30%, probably due to C3-mediated

cytotoxicity. The number of C3-E174Q-treated cells

remained almost constant from 3 to 7 days, suggesting

that C3-E174Q inhibited cell proliferation (Fig. 6). To

determine whether the anti-proliferative activity of C3

and C3-E174Q was due to blocked G1–S transition, cel-

lular levels of cyclin D1 mRNA and cyclin D1 protein

were analysed by quantitative RT-PCR and western

blot analysis, respectively. C3 and C3-E174Q compara-

bly down-regulated both cyclin D1 mRNA (Fig. 7A)

and cyclin D1 protein (Fig. 7B) levels in time-series

experiments. As shown in Fig. 6B,C, untreated cells

show a time-dependent decrease in cyclin D1, probably

due to contact inhibition [32]. These observations

strongly suggest that C3-induced inhibition of cell pro-

liferation is independent of ART activity.

ART dependency of the anti-apoptotic

activity of C3

Depending on the cell line and the experimental condi-

tions, C3 has been reported to exhibit either pro-apop-

totic [33] or anti-apoptotic activity [34]. To determine

whether C3 promoted or inhibited apoptosis of HT22

cells, starvation-induced apoptosis of HT22 cells was

analysed in the presence and absence of C3. C3 treat-

ment for 48 h resulted in a significant reduction of bax

mRNA and caspase-3 mRNA (Fig. 8A). To elucidate

the role of additional apoptotic factors, expression of

caspase-8 and caspase-9 mRNA was assessed. Both

caspases were strongly down-regulated by C3

(Fig. 8A). However, C3-E174Q did not influence

expression of the genes studied (data not shown).

As p53 is an important player in various signalling

pathways including apoptosis, the protein level of p53

was examined. Wild-type C3 induced a decrease in

p53, as shown by western blot analysis. In contrast,

C3-E174Q did not alter p53 protein level (Fig. 8B).

Furthermore, starvation-induced apoptosis of HT22

cells resulted in expression of Bax (Fig. 8B, lanes 1

and 2). To test for changes in the expression of Bax,

HT22 cells were cultured for 24 h in serum-free med-

ium to induced apoptosis, and then incubated with C3

or C3-E174Q in serum-free medium for further 24 or

48 h (Fig. 8B, lanes 4–7). We observed a reduced pro-

tein level of Bax 48 h after apoptosis induction if C3

was added after 24 h starvation-induced apoptosis

(Fig. 8, Lane 4). C3-E174Q did not reduced Bax 48 h

after apoptosis induction in comparison with 72 h

Fig. 4. Microscale thermophoresis binding

analysis. The concentration of the fluores-

cently labelled RhoA is kept constant and

the C3 exoenzyme is titrated. (A) Binding

curve for labelled RhoA–C3. (B) Binding

curve for labelled RhoA–C3-E174Q. The

binding curve is sigmoidal and reaches a pla-

teau. Binding curves from representative

experiments are shown (n = 2).



serum-deprived control cells (Fig. 8, lanes 6 and 2).

Similar results were found for the pro-forms of

caspase-3 and caspase-9 (Fig. 9).

Next, we determined the enzymatic activity of

caspase-3 using a caspase-3 ⁄ 7 ApoONE assay. Serum

starvation for 48 h induced was a threefold increase in

caspase-3 ⁄ 7 activity compared with control cells

(Fig. 10A). This finding strongly supports previous

reports showing that serum starvation results in induc-

tion of cell death [35,36]. Consistent with the results of

western blot analysis (Fig. 9), caspase-3 activity was

reduced in C3- but not in C3-E174Q-treated cells at

48 h after apoptosis induction.

To further provide evidence for the anti-apoptotic

activity of C3, staurosporin-induced apoptosis of

HT22 cells was analysed for its responsiveness to C3.

Staurosporin treatment strongly activated caspases in

HT22 cells. C3 (but not C3-E174Q) reduced staurospo-

rin-induced caspase activation (Fig. 10B).

Finally, staurosporine-induced loss of membrane

integrity was analysed using acridine orange ⁄ ethidiumbromide staining. Staurosporin-treated HT22 cells

lost their spindle-like morphology, shrank, detached

from the matrix and were stained orange, indicating

loss of membrane integrity. Loss of membrane integ-

rity was decreased in C3-treated cells but not in

C3-E174Q-treated cells, further indicating that the

anti-apoptotic activity of C3 depended on the ART

activity.

Discussion

Most cultured cell lines are almost insensitive to C3,

unless C3 has been fused to ectopic cell entry domains.

A previous study showing that C3 and C3-E174Q

induced biological effects in primary hippocampal neu-

rons [13] indicated that neuron-derived cells exhibit

remarkable sensitivity to C3bot independently of fused

cell entry domains. In this study, SV40-transformed

hippocampal neuronal HT22 cells were used as a cell

culture model to differentially study the biological

effects of C3 and C3-E174Q [37].

Fig. 5. RhoB up-regulation. (A) HT22 cells were exposed to 500 nM

C3-E174Q for up to 6 days or 500 nM C3 for 24 h at 37 �C. Cells

were lysed and submitted to western blot analysis for RhoA, RhoB

and b-actin (n = 3). (B) HT22 cells were exposed to 500 nM C3 or

C3-E174Q for up to 6 days. Cellular levels of RhoB proteins were

determined by western blot analysis and the signal intensity was

measured densiometrically (n = 3). The signal intensity was normal-

ized to the intensity of the corresponding b-actin signal. The differ-

ences in results were not statistically significant.

Fig. 6. Anti-proliferative effects of C3

exoenzyme. Cell numbers were counted in a

trypan blue exclusion assay using a

Neubauer counting chamber. Viable cells are

not detected by trypan blue but exclude the

dye. Incubation of HT22 cells with 500 nM of

wild-type C3 for 7 days caused a significant

inhibition in cell number 72 h after C3 appli-

cation compared to untreated cells. Results

were statistically significant relative to the

control at 72 h (with the exception of

C3-E174Q at 5 days) (P £ 0.05). Experiments

for each sample were performed in triplicate,

and three independent experiments were

performed (n = 9 for each value).



C3 induced morphological changes in HT22 cells

(including cell rounding and pronounced formation of

retraction fibres), RhoA ADP-ribosylation and RhoA

degradation. Furthermore, C3 exhibited anti-prolifera-

tive and anti-apoptotic activity. These effects have

been reported for cell-permeable versions of C3 in var-

ious cellular systems including other neuronal cell lines

such as PC-12 cells. All these effects have been attri-

buted to C3-catalysed ADP-ribosylation. Consistent

with this view, we found that C3-induced cell rounding

as well as the anti-apoptotic activity strictly depend on

Rho ADP-ribosylation. In particular, apoptosis

induced by serum starvation or staurosporin is specifi-

cally inhibited by C3 (but not by C3-E174Q). Recently,

it was shown that inhibition of the Rho ⁄ROCK (Rho

associated kinase) pathway by C3 exoenzyme rescues

transplanted cells from apoptosis both in vitro and

in vivo [38]. Another study showed that inhibition of

RhoA activity by C3 attenuated thrombin-induced cell

death in cultured neurons and astrocytes [39]. In agree-

ment with these studies, we show down-regulation of

caspases and pro-apoptotic Bax in C3-treated HT22

cells in which apoptosis was induced by serum starva-

tion or staurosporin. In addition, we demonstrate inhi-

bition of caspase-3 activity by C3. All these findings

strongly suggest an anti-apoptotic effect of C3 in culti-

vated hippocampal HT22 cells. In animal models, ben-

eficial neuro-protective and neuro-regenerative effects

were observed with both C3 and C3-E174Q [40,41].

Possibly, anti-apoptotic or pro-apoptotic effects of C3

depends on tissue and cell types, but it appears that

C3 is predominantly anti-apoptotic in neuronal cells.

Whereas C3 specifically exhibited cell rounding and

anti-apoptotic activity, both C3 and C3-E174Q

reduced cell proliferation as well as cyclin D1 expres-

sion with comparable kinetics. Thus we conclude that

C3-E174Q enters HT22 cells comparably to C3.

C3-E174Q did not exhibit ART activity, as evidenced

Fig. 7. Effect of C3 on cell-cycle regulation

of HT22 cells. (A) Quantitative RT-PCR of

C3bot-treated cells. Summary of differential

expression of the cyclin D1 gene verified by

quantitative RT-PCR in comparison with

untreated control cells. Each experiment

was performed in triplicate and the runs

were repeated. Error bars indicate the

standard deviation among the samples.

Statistical differences between C3-treated

and control cells were determined using a

two-sided Student’s t test (*P £ 0.05;

**P £ 0.01; ***P £ 0.001). (B) For western

blot analysis, HT22 cells were exposed to

500 nM C3 or C3-E174Q for up to 6 days at

37 �C. Cells were lysed and subjected to

western blot analysis against cyclin D1

and b-actin. Western blots from representa-

tive experiments are shown (n = 3).

(C) Densitometric measurements for cyclin

D1 (means ± SE) from three independent

experiments. The results were not statisti-

cally significant.



by analysing ART activity in the presence of high

C3-E174Q concentrations in a cell-free system or upon

prolonged treatment of HT22 with C3-E174Q for up

to 5 days. Not even traces of Rho ADP-ribosylation

were detected by the detection methods used (effector

pull-down assay, gel shift assay, direct and sequential

ADP-ribosylation). The biological activity of

C3-E174Q thus appeared to be independent of ART

activity. In addition to reduced cyclin D expression,

C3-E174Q induced (late) RhoB expression. The kinet-

ics of C3-E174Q-induced late RhoB expression clearly

differed from the kinetics of early RhoB expression

induced by C3. Notably, RhoB expressed in

C3-E174Q-treated cells was not ADP-ribosylated,

Fig. 8. Effect of C3 on apoptosis of HT22

cells. (A) HT22 cells were cultured for 24 or

48 h in serum-free medium followed by

incubation with 1000 nM C3 or C3-E174Q in

serum-free medium for a further 24 or 48 h

(total 72 h). Summary of differential expres-

sion of various apoptosis genes verified by

quantitative RT-PCR in comparison with

72 h serum-free control cells. Each experi-

ment was performed in triplicate and the

runs were repeated. Error bars indicate

standard deviation among the samples.

Statistical differences between C3-treated

and 72 h serum-free control cells were

determined using a two-sided Student’s t

test (*P £ 0.05; **P £ 0.01). (B) For

western blot analysis, cells were cultured

for 24 or 48 h in serum-free medium

followed by incubation with 1000 nM C3 or

C3-E174Q in serum-free medium for a

further 24 or 48 h (total 72 h) at 37 �C. Cells

were lysed and subjected to western blot

analysis for p53, Bax and b-actin. Western

blots from representative experiments are

shown (n = 3). (C) Densitometric measure-

ments for Bax (means ± SE) from five

independent experiments. Statistical

differences between C3-treated and 72 h

serum-free control cells were determined

using a two-sided Student’s t test

(*P £ 0.05).



further excluding the presence of ART activity in

C3-E174Q-treated cells. In C3-treated cells, RhoA and

RhoB were ADP-ribosylated and thus inactive,

whereas in C3-E174Q-treated cells, newly expressed

RhoB was not ADP-ribosylated and was thus active

(Fig. S2). Inhibited proliferation of C3-treated cells

may therefore be attributed to RhoA inactivation,

while inhibited proliferation of C3-E174Q-treated cells

instead appears to depend on active RhoB.

RhoB expression results from ‘de-suppression’ of

RhoA-mediated suppression of the rhoB promoter,

and is thus intrinsically tied to RhoA inactivation [30].

Against this background, the observation that

C3-E174Q induced RhoB expression suggests that

C3-E174Q inhibits RhoA by a mechanism that is

independent of ART activity. C3-E174Q-induced

RhoB expression was less pronounced compared to

Fig. 9. Effect of C3 on regulation of caspases. HT22 cells were cul-

tured for 24 or 48 h in serum-free medium followed by incubation

with 1000 nM C3 or C3-E174Q in serum-free medium for a further

24 or 48 h (total 72 h). Cells were lysed and submitted to western

blot analysis against caspase-3 (A), caspase-9 (B) and b-actin.

Western blots from representative experiments are shown (n = 3).Fig. 10. Caspase-3 ⁄ 7 activity in cell lysates. (A) HT22 cells were cul-

tured for 24 h in serum-free medium followed by incubation with

1000 nM C3 or C3-E174Q in serum-free medium for a further 48 h.

Caspase-Apo-ONE reagent (100 lL) was added, and cells were

further incubated for 30 min at room temperature. Fluorescence

was measured on a spectrofluorometer with 485 nm excitation and

520 nm emission. Values are means ± SD (n = 3). Statistical differ-

ences between C3-treated and control cells were determined using

a two-sided Student’s t test (*P £ 0.05; **P £ 0.01). (B) HT22 cells

were cultivated in Dulbecco’s modified Eagle’s medium with 10%

fetal bovine serum. Cells were incubated with staurosporin 1 h

before addition of 1000 nM C3 or C3-E174Q, and further incubated

for 48 h at 37 �C. Caspase-Apo-ONE reagent (100 lL) was added,

and fluorescence was measured after 30 min. Data are means of

triplicate experiments. (C) Acridine orange ⁄ ethidium bromide

staining was performed to show the viability of the cells (green:

viable, orange: apoptosis). HT22 cells were cultivated in Dulbecco’s

modified Eagle’s medium with 10% fetal bovine serum. Cells were

incubated with staurosporin 1 h before addition of 1000 nM C3 or

C3-E174Q, and further incubated for 48 h at 37 �C. Apoptotic cells

show a degraded nucleus and non-intact cell membrane, and

were stained by both acridine orange and ethidium bromide. Magnifi-

cation · 20.



C3-induced RhoB expression, allowing the conclusion

that C3-E174Q inhibited RhoA less efficiently com-

pared to C3. This view is consistent with the observa-

tion that C3 (but not C3-E174Q) reduced the cellular

level of RhoA-GTP in HT22 cells. The mechanism by

which C3-E174Q inhibits RhoA is most likely distinct

from a covalent modification and may include RhoA

sequestration. This is supported by the findings of

microscale thermophoresis. In these experiments, RhoA

binds with four- to fivefold higher affinity to C3-E174Q

than to C3. It is conceivable that RhoA is retained in

the cytosol through sequestration by C3-E174Q.

In summary, we demonstrate that murine hippocam-

pal HT22 cells are sensitive to both C3 and C3-E174Q.

C3 induced cell rounding, inhibition of cell prolifera-

tion and anti-apoptotic effects. C3-E174Q induced

RhoB expression and inhibition of cell proliferation

independently of ART activity, with RhoB probably

being involved in anti-proliferative effects.

Experimental procedures

Cell culture

Murine hippocampal HT22 cells were cultivated in Dul-

becco’s modified essential medium (Biochrom AG, Berlin,

Germany, +10% fetal bovine serum, 100 gÆmL)1 penicillin,

100 unitsÆmL)1 streptomycin and 1 mM sodium pyruvate)

at 37 �C and 5% CO2. Upon confluence, cells were pas-

saged.

For the growth kinetics experiments, cells were seeded

onto 3.5 cm plates at a concentration of 50 000 cellsÆmL)1.

Cells were grown for 24 h before treatment, and then C3

exoenzyme from Clostridium botulinum was added to the

medium at a concentration of 500 nM. After 12, 24 and

48 h, the medium was removed and the cells were washed

with NaCl ⁄Pi.

After the indicated time points, cells were detached with

0.25% trypsin solution. A 1 mL volume of culture medium

was added to neutralize the trypsin action. Cells were

counted every day by the trypan blue exclusion assay using

a Neubauer counting chamber (Carl Roth GmbH, Karls-

ruhe, Germany) to determine the number of viable cells.

For apoptosis experiments, cells were seeded onto 3.5 cm

plates at a concentration of 100 000 cellsÆmL)1. After 24 h,

the medium was changed to serum-free medium, and 48 h

later, cells were treated with 1000 nM C3 in serum-free

medium. The medium was replaced every 48 h by new

serum-free protein-containing medium.

Cell lysis for western blot analysis

After toxin treatment, cells were washed and scraped into

Laemmli sample buffer. The obtained suspension was sha-

ken at 37 �C for 10 min. Ultrasonic disruption was per-

formed using a cycle of 10 · 5 s, 5 · 10% sonic energy

with a sonotrode (Bandelin Electronic, Berlin, Germany).

The lysate was then incubated at 95 �C for 10 min and sub-

jected to SDS ⁄PAGE.

Western blot analysis

Complete lysate proteins were separated using SDS ⁄PAGE

and subsequently transferred onto nitrocellulose membranes

by a tank blot system. The membranes were blocked using

5% w ⁄ v non-fat dried milk for 60 min; incubation with pri-

mary antibody was performed overnight at 4 �C, and treat-

ment with the secondary antibody was performed at room

temperature for 1 h. For immunoblotting, the following

primary antibodies were used: RhoA was identified using a

mouse monoclonal IgG from Santa Cruz Biotechnologies

(Santa Cruz, CA, USA); antibodies against RhoB (rabbit

polyclonal IgG) were obtained from Bethyl Laboratories

(Montgomery, TX, USA); Bax (p-19) monoclonal antibody

was purchased from Santa Cruz Biotechnologies, pAkt

(Ser473), caspase-3, p53 and cyclin D1 antibodies were pur-

chased from Cell Signaling Technologies, and caspase-9

rabbit polyclonal antibody antibody was purchased from

Biomol GmbH (Hamburg, Germany); Identification of

C3bot was achieved using an affinity-purified rabbit poly-

clonal antibody that was raised against the full-length

exoenzyme C3bot (accession number CAA41767). Actin

(Sigma-Aldrich, Munich, Germany) was used as a loading

control.

For the chemiluminescence reaction, ECL Femto (Pierce ⁄Thermo Fisher Scientific Inc., Rockford, IL, USA) or

Immobilon (Millipore, Schwalbach, Germany) was used.

All signals were analysed densitometrically using KODAK

1D software (Kodak GmbH, Stuttgart, Germany) and

normalized to b-actin signals.

Expression and purification of recombinant

C3 proteins

C3 wild-type and C3-E174Q were expressed as recombinant

glutathione S-transferase (GST) fusion proteins in Escheri-

chia coli TG1 harbouring the respective DNA fragment in

plasmid pGEX-2T (Amersham Life Sciences, Arlington

Heights, IL, USA). Bacteria were grown at 37 �C in 1 L of

LB medium containing 100 lgÆmL)1 ampicillin to an atten-

uance at 595 nm of 0.7. Isopropyl-thio-b-D-galactoside was

added to a final concentration of 0.2 mM, and the cultures

were incubated at 37 �C for another 3 h. Bacteria were sed-

imented at 7700 g (15 min, 4 �C) and resuspended in

20 mL lysis buffer (50 mM Tris, pH 8, 150 mM NaCl, 2 mM

MgCl2, 2 mM dithiothreitol), complemented with EDTA-

free protease inhibitor cocktail (Roche Pharma AG, Gren-

zach-Wyhlen, Germany). Bacteria were lysed by means of a

French pressure cell press system (SIM Aminco Spectronic



Instruments, New York, USA), and the bacterial debris

was sedimented at 12 000 g (15 min, 4 �C). The supernatant

was added to 4 mL of a 50% slurry of glutathione–

Sepharose 4B beads in lysis buffer, and incubated for 4 h at

4 �C while shaking. The slurry was poured into a dis-

posable Econo-Pac� chromatography column (Bio-Rad

Laboratories GmbH, Munchen, Germany) and washed five

times with 10 bed volumes of lysis buffer. For cleavage of

the fusion proteins from glutathione S-transferase, the

beads were incubated with five ‘‘NIH’’ units of thrombin

for 12 h at 4 �C. Thereafter, the protein was eluted with

12 mL lysis buffer. Thrombin was removed by precipitation

with benzamidine–Sepharose beads (AP Biosciences, New

York, USA). After centrifugation at 500 g (10 min, room

temperature), the supernatant was exchanged with 20 mM

HEPES pH 7.5 using PD-10 columns (GE healthcare,

Munchen, Germany), sterile-filtered (0.22 lm) and used for

cell culture experiments as indicated. ART activity was

measured by an in vitro ADP-ribosylation assay.

ADP-ribosylation of Rho in HT22 cells

To verify the effectiveness of ADP-ribosylation of Rho by

C. botulinum exoenzyme C3, the HT22 cells were either

left untreated or were incubated with increasing concentra-

tions of the exotoxin (10–1000 nM) for 8–24 h. The cells

were then washed with NaCl ⁄Pi and scraped into 100 lLof lysis buffer (20 mM Tris ⁄HCl (pH 7.4), 1% Triton

X-100, 10 mM NaCl, 5 mM MgCl2, 1 mM phen-

ylmethanesulfonyl fluoride, 5 mM dithiothreitol). The

obtained suspension was shaken at 37 �C for 10 min.

Ultrasonic disruption was performed using a cycle of

10 · 5 s, 5 · 10% sonic energy with a sonotrode (Bandelin

Electronic). Protein concentrations were measured by the

Bradford method. Cell lysates containing equal amounts

of protein were incubated with 1000 nM recombinant

C. botulinum exoenzyme C3 and 1 lCi [32P]NAD (Amer-

sham Life Sciences, Arlington Heights, IL, USA) in 20 lLof 4· buffer containing 50 mM HEPES (pH 7.3), 10 mM

MgCl2, 10 mM dithiothreitol, 10 mM thymidine and 10 lM

NAD at 37 �C for 20 min. The reaction was terminated

by addition of Laemmli sample buffer, and then incubated

at 95 �C for 10 min. Samples were resolved by

SDS ⁄PAGE on 15% gels, and the ADP-ribosylated Rho

was analyzed by phosphorimaging (Cyclone, Packard

American Instrument, MA, USA).

Pull-down assay

RhoA activity was measured by pull-down assay using a

GST fusion protein of the Rho binding domain. HT22 cells

were homogenized in lysis buffer [20 mM Tris ⁄HCl (to a

total of 25 lL) pH 7.4], 1% Triton X-100, 10 mM NaCl,

5 mM MgCl2, 1 mM phenylmethanesulfonyl fluoride, 5 mM

dithiothreitol). Cleared lysates were incubated for 60 min at

4 �C with GST–Rho binding domain-coupled beads (20–

30 lg per sample). Precipitates were washed three times

with the binding buffer and suspended in the SDS sample

buffer. Proteins were separated by 15% SDS ⁄PAGE and

transferred to a nitrocellulose membrane. GTP-bound

RhoA and total RhoA were detected by western blot analy-

sis using a monoclonal RhoA antibody (Santa Cruz Bio-

technology).

RNA isolation

RNA extraction was performed using an RNeasy Mini Kit

(Qiagen, Santa Clarita, CA, USA) according to the manu-

facturer’s instructions. The RNA concentration of the sam-

ples was then measured using a NanoDrop ND-1000

spectrophotometer (PeqLab Biotechnology GmbH, Erlan-

gen, Germany).

RT-PCR

RNA (2 lg) from each sample was mixed with an appro-

priate quantity of water (to a total of 25 lL) and dena-

tured for 5 min at 65 �C by using an Eppendorf

Thermomixer (Eppendorf AG, Hamburg, Germany). The

reaction mix for the reverse transcription comprised 2 lL10· reverse transcription buffer (Omniscript RT-Kit,

Qiagen, Hilden, Germany), 2 lL dNTPs, 2 lL random

hexamers (primers), 0.25 lL RNasin and 1 lL reverse

transcriptase (Omniscript RT Kit, Qiagen, Hilden, Ger-

many), and was added previously cooled samples. The

composition of the mix is appropriate for an RNA con-

centration between 50 ng and 2 lg. The samples were

subsequently incubated for 1 h at 37 �C. During this step,

the RNA is converted to cDNA. The enzymes were then

denaturated by incubation for 5 min at 95 �C in the Ep-

pendorf Thermomixer. Finally the samples were cooled

and frozen at )20 �C.Real-time RT-PCR measurements were performed using

an ABI PRISM 7500 sequence detection system instrument

(Applied Biosystems, Carlsbad, CA, USA). PCR reactions

were performed according to the manufacturer’s instruc-

tions using GoTaq� qPCR Master Mix (Promega GmbH,

Mannheim, Germany). Gene expression levels were normal-

ized to those of b2-microglobulin, which was found to be

stably expressed. The specificity of primers was confirmed

by agarose-gel electrophoresis of PCR products.

Each experiment was performed in triplicate and the runs

were repeated. Mean CT values were calculated using the

ABI PRISM software, and relative gene expression levels were

expressed as the difference between mean CT values for the

target gene and the control gene b2-microglobulin. A nega-

tive control was always included in RT-PCR experiments.

Additionally, a paired two-tailed Student’s t test was per-

formed, and the results were considered significant when

the P value was <0.05.



The primers (Table 1) were designed in several steps as

described below. The mRNA sequences of the single genes

were found on http://www.ncbi.nlm.nih.gov/. The cDNA

sequences of the same genes were found on http ⁄ ⁄genome.ucsc.edu ⁄ cgi-bin ⁄ hgGateway. Primer design was

performed using web tool Primer3Plus (http://www.

bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi). We

used the UCSC Genome Browser (http://genome.ucsc.edu)

to control the intron spanning of primers. PCR primers

were synthesized by Eurofins (Ebersberg, Germany).

Caspase activity assay

Caspase-3 ⁄ 7 activity was measured using the Apo-ONE�homogenous caspase-3 ⁄ 7 assay (Promega GmbH, Man-

nheim, Germany). Cells were seeded in 96-well plates, and

the next day, the medium was replaced with serum-free

medium for 48 h. After apoptosis induction, cells were

incubated for 24 and 48 h with 1000 nM C3 in serum-free

medium. Cells were lysed, and caspase-3 ⁄ 7 activity was

measured by cleavage of the caspase-3 ⁄ 7 substrate rhoda-

mine 110 [bis-(N-benzyloxycarbonyl-L-aspartyl-L-glutamyl-L-

valyl-L-aspartic acid amide)] (Z-DEVD-R110). Samples were

measured on a spectrofluorometer with 485 nm excitation

and 520 nm emission. Control cells were treated with 5 lM

staurosporin.

Staurosporin from Streptomyces spheroides (Sigma-

Aldrich, St. Louis, MO, USA) was kept in a stock solution

of 10 mM in 100% dimethyl sulfoxide and diluted to a final

concentration of 1 lM in serum-free medium before incuba-

tion. Controls were incubated with a corresponding concen-

tration of dimethyl sulfoxide. When the effect of

staurosporin concentration was investigated, final concen-

trations of 5000 and 1000 nM were used. Cells were incu-

bated with staurosporin 1 h before addition of C3.

Acridine orange ⁄ ethidium bromide staining of

cells

To determine cell viability, cells were subjected to acridine

orange ⁄ ethidium bromide staining. Cells were treated with

1 lM staurosporin for 1 h, then washed with NaCl ⁄Pi, and

1000 nM C3 or C3-E174Q was added. After 48 h, 10 lL of

a solution containing 5 mgÆmL)1 acridine orange and

10 mgÆmL)1 ethidium bromide was added. The cells were

then visualized by fluorescence microscopy (Zeiss Axiovert

200 M, Carl Zeis GmbH, Gottingen, Germany), using a

blue filter.

Microscale thermophoresis binding analysis

Thermophoresis was used to measure the binding interactions

between RhoA and C3 exoenzyme. For the experiments,

RhoA was labelled using Monolith NT� Protein Labeling

Kit Red-NHS (NanoTemper Technologies GmbH, Munich,

Germany) according to the manufacturer’s instructions. NT-

647-labelled RhoA was used at a concentration of 250 nM.

C3 or C3-E174Q was titrated in 1 : 1 dilutions starting at

30 lM (16 samples of a serial dilution). The experiments were

performed in HEPES buffer with 0.01% Tween in standard

treated capillaries (NanoTemper Technologies GmbH).

The measurements were performed using a NanoTemper

Monolith NT.015 instrument. All measurements were per-

formed at 20%, 40% and 80% IR-Laser (infra red-Laser),

with a laser-on time of 15 s, and a laser-off time of 5 s.

Table 1. Primer pairs used for quantitative RT-PCR (Ccnd1 ¼ cyclin D1; Bax ¼ BCL2-associated X protein; Casp9 ¼ caspase 9; Casp3 ¼caspase 3; Casp8 ¼ caspase 8; Apaf1 ¼ apoptotic peptidase activating factor 1; BID ¼ BH3 interacting domain death agonist; B2M ¼ beta-2

microglobulin).

Gene Reference sequence Primer Length (bp) Product (bp)

Proliferation Ccnd1 NM_007631.2 Forward: AGTGCGTGCAGAAGGAGATT

Reverse: CACAACTTCTCGGCAGTCAA

20 238

Apoptosis Bax NM_007527.3 Forward: CGAGCTGATCAGAACCATCA

Reverse: CTCAGCCCATCTTCTTCCAG

20 191

Casp9 NM_015733.4 Forward: ACGCTCTGCTGAGTCGAGA

Reverse: CCTTGGCCTGTGTCCTCTAA

19

20

169

Casp3 NM_009810.2 Forward: GGGCCTGTTGAACTGAAAAA

Reverse: CCGTCCTTTGAATTTCTCCA

20 242

Casp8 NM_009812.2 Forward: GCGTGGAACAGGAAGTGAGT

Reverse: TGGGATGTAGTCCAAGCACA

20 248

Apaf1 NM_009684.2 Foward: GTTCAAAGCCGAGACAGGAG

Reverse: ATTGACTTGCTCCGAGTGCT

20 187

BID NM_007544.3 Forward: TCACAGACCTGCTGGTGTTC

Reverse: GTCTGGCAATGTTGTGGATG

20 219

Housekeeping B2M NM_009735.3 Forward: ATTCACCCCCACTGAGACTG

Reverse: GCTATTTCTTTCTGCGTGCAT

20

21

192



Sixteen subsequent thermophoresis measurements for each

IR-Laser option were performed to determine the binding

affinity. Plotting the normalized fluorescence Fnorm =

Fhot ⁄Fcold at given time t against the labelled RhoA concen-

tration produced a binding curve. The binding curves were

fitted, and Kd values were obtained.

Reproducibility of the experiments and statistics

All experiments were performed independently at least three

times. Results from representative experiments are shown in

the figures. Values (n ‡ 3) are means ± SEM. The two-

sided unpaired Student’s t test was used throughout the

study to assess the statistical significance of the differences

between two sets of data. Differences were considered to be

statistically significant at P £ 0.05.

Acknowledgements

We thank Moran Jerabek-Willemsen (NanoTem-

per Technologies GmbH, Munich, Germany) and

Professor Dietmar J. Manstein (Department of

Biophysical Chemistry, Medical School of Hanover,

Germany) for kind support with microscale thermo-

phoresis experiments. This work was supported by

funding from the Deutsche Forschungsgemeinschaft

(project JU231 ⁄ 5).

References

1 Hall A (1998) Rho GTPases and the actin cytoskeleton.

Science 279, 509–514.

2 To KC, Church J & O’Connor TP (2008) Growth cone

collapse stimulated by both calpain- and Rho-mediated

pathways. Neuroscience 153, 645–653.

3 Ellis S & Mellor H (2000) Regulation of endocytic

traffic by rho family GTPases. Trends Cell Biol 10,

85–88.

4 Michaelson D, Silletti J, Murphy G, D’Eustachio P,

Rush M & Philips MR (2001) Regulation by hypervari-

able regions and RhoGDI binding. J Cell Biol 152,

111–126.

5 Wallar BJ, Deward AD, Resau JH & Alberts AS (2007)

RhoB and the mammalian Diaphanous-related formin

mDia2 in endosome trafficking. Exp Cell Res 313, 560–

571.

6 Engel ME, Datta PK & Moses HL (1998) RhoB is

stabilized by transforming growth factor b and antago-

nizes transcriptional activation. J Biol Chem 273, 9921–

9926.

7 Fritz G, Kaina B & Aktories K (1995) The ras-related

small GTP-binding protein RhoB is immediate-early

inducible by DNA damaging treatments. J Biol Chem

270, 25172–25177.

8 Ho TT, Merajver SD, Lapiere CM, Nusgens BV &

Deroanne CF (2008) RhoA-GDP regulates RhoB

protein stability. Potential involvement of RhoGDIa.J Biol Chem 283, 21588–21598.

9 Just I, Huelsenbeck SC & Genth H (2010) Clostridium

botulinum C3 exoenzyme: Rho-inactivating tool in cell

biology and a neurotrophic agent. Open Toxinol J 3,

19–23.

10 Paterson HF, Self AJ, Garrett MD, Just I, Aktories K

& Hall A (1990) Microinjection of recombinant p21rho

induces rapid changes in cell morphology. J Cell Biol

111, 1001–1007.

11 Shiokawa S, Sakai K, Akimoto Y, Suzuki N,

Hanashi H, Nagamatsu S, Iwashita M, Nakamura Y,

Hirano H & Yoshimura Y (2000) Function of the

small guanosine triphosphate-binding protein RhoA

in the process of implantation. J Clin Endocrinol

Metab 85, 4742–4749.

12 Just I, Rohrbeck A, Huelsenbeck SC & Hoeltje M

(2011) Therapeutic effects of Clostridium botulinum C3

exoenzyme. Naunyn Schmiedebergs Arch Pharmacol 383,

247–252.

13 Ahnert-Hilger G, Holtje M, Große G, Pickert G,

Mucke C, Nixdorf-Bergweiler B, Boquet P, Hofmann F

& Just I (2004) Differential effects of Rho GTPases on

axonal and dendritic development in hippocampal neu-

rons. J Neurochem 90, 9–18.

14 Kozma R, Sarner S, Ahmed S & Lim L (1997) Rho

family GTPases and neuronal growth cone remodelling:

relationship between increased complexity induced by

Cdc42Hs, Rac1, and acetylcholine and collapse induced

by RhoA and lysophosphatidic acid. Mol Cell Biol 17,

1201–1211.

15 Jin Z & Strittmatter SM (1997) Rac1 mediates collaps-

ing-1-induced growth cone collapse. J Neurosci 17,

6256–6263.

16 Nishiki T, Narumiya S, Morii N, Yamamot M,

Fujiwara M, Kamata Y, Sakaguchi G & Kozaki S

(1990) ADP-ribosylation of the rho ⁄ rac proteins

induces growth inhibition, neurite outgrowth and

acetylcholine esterase in cultured PC-12 cells. Biochem

Biophys Res Commun 167, 265–272.

17 Watts KL, Cottrell E, Hoban PR & Spiteri MA (2006)

RhoA signaling modulates cyclin D1 expression in

human lung fibroblasts; implications for idiopathic

pulmonary fibrosis. Respir Res 7, 88.

18 Danen EHJ, Sonnenveld P, Sonnenberg A & Yamada

KM (2000) Dual stimulation of Ras ⁄mitogen-activated

protein kinase and RhoA by cell adhesion to

fibronectin supports growth factor stimulated

cell cycle progression. J Cell Biol 151,

1413–1422.

19 Adnane J, Bizouarn FA, Qian Y, Hamilton AD &

Sebti SM (1998) p21WAF1 ⁄CIP1 is upregulated by the



geranylgeranyltransferase I inhibitor GGTI-298 through

a transforming growth factor b- and Sp1-responsive

element: involvement of the small GTPase RhoA.

Mol Cell Biol 18, 6962–6970.

20 Weber JD, Hu W, Jefcoat SC Jr, Raben DM & Baldas-

sare JJ (1997) Ras-stimulated extracellular signal-related

kinase 1 and RhoA activities coordinate platelet-derived

growth factor-induced G1 progression through the inde-

pendent regulation of cyclin D1 and p27. J Biol Chem

272, 32966–32971.

21 Du W & Prendergast GC (1999) Geranylgeranylated

RhoB mediates inhibition of human tumor cell

growth by farnesyltransferase inhibitors. Cancer Res 59,

5924–5928.

22 van Golen KL, Wu ZF, Qiao XT, Bao LW & Marajver

SD (2000) RhoC GTPase, a novel transforming onco-

gene for human mammary epithelial cells that partially

recapitulates the inflammatory breast cancer phenotype.

Cancer Res 60, 5832–5838.

23 Moorman JP, Bobak DA & Hahn CS (1996) Inactiva-

tion of the small GTP binding protein Rho induces

multinucleate cell formation and apoptosis in murine

T lymphoma EL4. J Immunol 156, 4146–4153.

24 Bobak D, Moorman J, Guanzon A, Gilmer L & Hahn

C (1997) Inactivation of the small GTPase Rho disrupts

cellular attachment and induces adhesion-dependent

and adhesion-independent apoptosis. Oncogene 15,

2179–2189.

25 Krijnen PA, Sipkens JA, Molling JW, Rauwerda JA,

Stehouwer CD, Muller A, Paulus WJ, van Nieuw

Amerongen GP, Hack CE, Verhoeven AJ et al. (2010)

Inhibition of Rho–ROCK signaling induces apoptotic

and non-apoptotic PS exposure in cardiomyocytes via

inhibition of flippase. J Mol Cell Cardiol 49, 781–790.

26 Bertrand J, Di Polo A & McKerracher L (2007)

Enhanced serviva and regenration of axotomized retinal

neurons by repeated delivery of cell-permeable C3-like

Rho antagonists. Neurobiol Dis 25, 65–72.

27 Dubreuil CI, Winton MJ & McKerracher L (2003) Rho

activation patterns after spinal cord injury and the role

of activated Rho in apoptosis in the central nervous

system. J Cell Biol 162, 233–243.

28 Genth H, Schmidt M, Gerhard R, Aktories K & Just I

(2003) Activation of phospholipase D1 by ADP-ribosy-

lated RhoA. Biochem Biophys Res Commun 302,

127–132.

29 Genth H, Gerhard R, Maeda A, Amano M, Kaibuchi

K, Aktories K & Just I (2003) Entrapment of Rho

ADP-ribosylated by Clostridium botulinum C3 exoen-

zyme in the Rho-guanine nucleotide dissociation inhibi-

tor-1 complex. J Biol Chem 278, 28523–28527.

30 Hulsenbeck J, Dreger SC, Gerhard R, Fritz G, Just I &

Genth H (2007) Upregulation of the immediate early

gene product RhoB by exoenzyme C3 from Clostridium

limosum and toxin B from Clostridium difficile.

Biochemistry 46, 4923–4931.

31 Wang X, Chen Y, Wang Y, Zhu X, Ma Y, Zhang S &

Lu J (2009) Role of RHOB in the antiproliferative

effect of glucocorticoid receptor on macrophage

RAW264.7 cells. J Endocrinol 200, 35–43.

32 Chassot AA, Lossaint G, Turchi L, Meneguzzi G,

Fisher D, Ponzio G & Dulic V (2008) Confluence-

induced cell cycle exit involves pre-mitotic CDK inhibi-

tion by p27(Kip1) and cyclin D1 downregulation. Cell

Cycle 7, 2038–2046.

33 Hippenstiel S, Schmeck B, N’Guessan PD, Seybold J,

Krull M, Preissner K, Eichel-Streiber CV & Suttorp N

(2002) Rho protein inactivation induced apoptosis of

cultured human endothelial cells. Am J Physiol Lung

Cell Mol Physiol 283, L830–L838.

34 Mills JC, Stone NL, Erhardt J & Pittman RN (1998)

Apoptotic membrane blebbing is regulated by myosin

light chain phosphorylation. J Cell Biol 140,

627–636.

35 Gerber HP, Dixit V & Ferrara N (1998) Vascular endo-

thelial growth factor induces expression of the antia-

poptotic proteins Bcl-2 and A1 in vascular endothelial

cells. J Biol Chem 273, 13313–13316.

36 Fujio Y, Guo K, Mano T, Mitsuuchi Y, Testa JR &

Walsh K (1999) Cell cycle withdrawal promotes myo-

genic induction of Akt, a positive modulator of myocyte

survival. Mol Cell Biol 19, 5073–5082.

37 Liu J, Li L & Suo WZ (2009) HT22 hippocampal

neuronal cell line possesses functional cholinergic

properties. Life Sci 84, 267–271.

38 Koyanagi M, Takahashi J, Arakawa Y, Doi D,

Fukuda H, Hayashi H, Narumiya S & Hashimoto N

(2008) Inhibition of the Rho ⁄ROCK pathway reduces

apoptosis during transplantation of embryonic stem

cell-derived neural precursors. J Neurosci Res 86, 270–

280.

39 Donovan FM, Pike CJ, Cotman CW & Cunningham

DD (1997) Thrombin induces apoptosis in cultured

neurons and astrocytes via a pathway requiring tyro-

sine kinase and RhoA activities. J Neurosci 17, 5316–

5326.

40 Boato F, Hendrix S, Huelsenbeck SC, Hofmann F,

Grosse G, Djalali S, Klimaschewski L, Auer M, Just I,

Ahnert-Hilger G et al. (2010) C3 peptide enhances

recovery from spinal cord injury by improved regenera-

tive growth of descending fiber tracts. J Cell Sci 123,

1652–1662.

41 Holtje M, Djalali S, Hofmann F, Munster-Wandowski

A, Hendrix S, Boato F, Dreger SC, Grosse G, Henne-

berger C, Grantyn R et al. (2009) A 29-amino acid frag-

ment of Clostridium botulinum C3 protein enhances

neuronal outgrowth, connectivity, and reinnervation.

FASEB J 23, 1115–1126.



Supporting information

The following supplementary information is available:

Fig. S1. ADP-ribosylation of recombinant GST-RhoA

by C3.

Fig. S2. RhoB up-regulation in C3- and C3-E174Q-

treated HT22 cells.

This supplementary material can be found in the

online version of this article.

Please note: As a service to our authors and readers,

this journal provides supporting information supplied

by the authors. Such materials are peer-reviewed and

may be reorganized for online delivery, but are not

copy-edited or typeset. Technical support issues arising

from supporting information (other than missing files)

should be addressed to the authors.



Distinct biological activities of C3 and ADP-ribosyltransferase-deficient C3-E174Q

Documents

Transcript of Distinct biological activities of C3 and ADP-ribosyltransferase-deficient C3-E174Q