Differential Expression Profile of Growth Hormone/Chorionic Somatomammotropin Genes in Placenta ofSmall- and Large-for-Gestational-Age Newborns

Jaana Mannik, Pille Vaas, Kristiina Rull, Pille Teesalu, Tiina Rebane,and Maris Laan

Institute of Molecular and Cell Biology (J.M., P.V., K.R., T.R., M.L.) and Department of Obstetrics andGynecology (P.V., K.R.), University of Tartu, and Women’s Clinic (P.V., K.R., P.T.) and Children’s Clinic ofTartu University Hospital (T.R.), 51014 Tartu, Estonia

Context: The human growth hormone/chorionic somatomammotropin (hGH/CSH) locus at 17q22-24, consisting of one pituitary-expressed postnatal (GH1) and four placenta-expressed genes (GH2,CSH1, CSH2, and CSHL1), is implicated in regulation of postnatal and intrauterine growth. A pos-itive correlation has been reported between the offspring’s birth weight and serum placental GH(coded by GH2) and placental lactogen (coded by CSH1, CSH2) levels in pregnant women.

Objective: The objective of the study was the investigation of the hypothesis that the mRNAexpression profile of placental hGH/CSH genes contributes to the determination of birth weight.

Design and Subjects: We developed a sensitive, fluorescent-labeled semiquantitative RT-PCR assaycoupled with gene-specific restriction analysis, capable of distinguishing alternative splice-products of individual placental hGH/CSH genes and quantification of their relative expressionlevels. The detailed profile of alternative transcripts of GH2, CSH1, CSH2, and CSHL1 genes inplacenta from uncomplicated term pregnancies of the REPROMETA sample collection wasaddressed in association with the birth weight of newborns, grouped as appropriate for ges-tational age (AGA; n � 23), small for gestational age (SGA; n � 15), and large for gestationalage (LGA; n � 34).

Results: The majority of pregnancies with SGA newborn showed down-regulation of the entirehGH/CSH cluster in placenta, whereas in the case of LGA, the expression of CSH1-1, CSH2-1, andCSHL1-4 mRNA transcripts in placenta was significantly increased compared with AGA newborns(P � 0.0001, P � 0.009, P � 0.002, respectively).

Conclusion: The expression profile of placental hGH/CSH genes in placenta is altered in pregnanciesaccompanied by SGA and LGA compared with AGA newborns, and thus, it may directly affect thecirculating fetal and maternal placental GH and placental lactogen levels. (J Clin Endocrinol Metab95: 0000–0000, 2010)

The human (h) GH/CSH locus, located on chromosome17q22-24 (1), is involved in regulating postnatal and

intrauterine growth (2). It contains five highly homolo-gous and structurally similar genes: a single ancestral GH1gene for pituitary GH and four placenta-expressed para-logs (CSHL1, CSH1, GH2, CSH2) (Fig. 1A) (3, 4). GH2

codes for placental GH (PGH), whereas the CSH1 andCSH2 genes encode jointly a single protein chorionic so-matomammotropin (CSH), alternatively named placentallactogen (PL). CSHL1 was originally considered as a pseu-dogene (5), although evidence for its expression in pla-centa (6–8) has been reported. The roles of GH in child’s

ISSN Print 0021-972X ISSN Online 1945-7197Printed in U.S.A.Copyright © 2010 by The Endocrine Societydoi: 10.1210/jc.2010-0023 Received January 6, 2010. Accepted February 18, 2010.

Abbreviations: AGA, Appropriate for gestational age; ANCOVA, analysis of covariance;BMI, body mass index; CSH, chorionic somatomammotropin; h, human; IUGR, intrauterinegrowth retardation; LCR, locus control region; LGA, large for gestational age; PGH, pla-cental GH; PL, placental lactogen; SGA, small for gestational age.

O R I G I N A L A R T I C L E

E n d o c r i n e R e s e a r c h

J Clin Endocrinol Metab, May 2010, 95(5):0000–0000 jcem.endojournals.org 1

J Clin Endocrin Metab. First published ahead of print March 16, 2010 as doi:10.1210/jc.2010-0023

Copyright (C) 2010 by The Endocrine Society

growth and adult intermediary metabolism are wellknown. The expression of GH2, CSH1, CSH2, andCSHL1 is coordinately induced during fetal developmentin the syncytiotrophoblasts of the placenta, and theirproducts may play an essential role in directing fetal andmaternal metabolism (2, 9).

Despite structural similarity, the four placental hGH/CSH cluster genes exhibit substantial heterogeneity intheir diversity patterns (10), expression levels and usage ofalternative splicing pathways, giving rise to three or fourprotein isoforms (Fig. 1, A and B) (6). The predominantsplicing pattern shared by GH2, CSH1, CSH2, and GH1

transcripts involves ligation of five common exons (Fig.1B). These mRNAs encode secreted proteins of about 200amino acids and with 85% or greater peptide sequenceidentity (6). The longest alternative mRNA transcripts ofGH2, CSH1, and CSH2 (GH2-2, CSH1-2, CSH2-2) re-tain intron 4 and therefore encode a new putative proteinwith a different C terminus (Fig. 1B) (6, 11). The GH2-3transcript results from the usage of an alternative donorsplice-site within exon 4 causing a 4-bp deletion and con-sequently a frame shift. The GH2-4 transcript skips theregular acceptor splice site and uses an alternative site 45bp downstream within exon 3 (12). Alternative splicingof CSHL1 differs from other hGH/CSH genes due toloss of the traditional donor splice site in intron 2. Thus,majority of CSHL1 transcripts miss exon 2 encoding thesignal peptide and therefore are unable to express se-creted protein (7).

The rise in circulating concentrations of PGH and PLprotein in maternal serum during gestation is well estab-lished using specific monoclonal antibodies (reviewed inRefs. 2 and 13). Reduced levels of both PGH and PL havebeen reported in women with fetal intrauterine growthretardation (IUGR)/small-for-gestational-age (SGA) preg-nancies (14–17).

Unlike the abundance of studies on pituitary-expressedGH1, the data about the expression profiles and use ofalternative splicing pathways of the human placenta-ex-pressed GH2, CSH1, CSH2, and CSHL1 genes is scarce.Detailed studies on the hGH/CSH cluster have been hin-dered by high-sequence identity among the genes and ex-tensive usage of alternative splicing pathways resulting inmultiple mRNA transcripts.

We addressed the detailed profile of alternative mRNAtranscripts of GH2, CSH1, CSH2, and CSHL1 genes inplacenta from uncomplicated term pregnancies in associ-ation with the birth weight of newborns, grouped as ap-propriate for gestational age (AGA), SGA, and large forgestational age (LGA). We developed a sensitive, fluores-cent-labeled semiquantitativeRT-PCRassaycoupledwithgene-specific restriction analysis, which proved to be ca-pable of distinguishing alternative splice-products of in-dividual placental hGH/CSH genes and quantification oftheir relative expression levels. Compared with normal-weight babies, significantly altered mRNA expression lev-els were detected in placentas from pregnancies with SGAand LGA newborns.

Materials and Methods

Experimental subjectsThe study was approved by the Ethics Review Committee of

Human Research of the University of Tartu (Estonia; permissions

GH1 CSHL1 CSH1 CSH2GH2A

GH2-1 (NM_002059.3)

PITUITARY-expression

PLACENTA-expression

1 2 3 4 5

B C53.5%

13kb 13kb 6.5kb6kb

GH2-2 (NM_022557.2)

GH2-3 (NM_022558.2)

GH2-4 (NM_022556.2)

CSH1 1

53.5%26.7%19.2%0.6%

CSH1-1 (NM_001317.3)

CSH1-3 (NM_022641.2)

CSH2-1 (NM_020991.3)

CSH2-3 (NM_022645.2)

EcoN I

1 2 3 4 5

1 2 3 4 5

93.3%0%6.7%0%

1 2 3 4 5CSHL1-1 (NM_022579.1)

CSH1-2 (NM_022640.2)

CSH2-2 (NM_022644.3)

0.8%

92.9%7.1%

1 2 3 4 +in4 5

BstE II

CSHL1-2 (NM_022581.1)

CSHL1-3 (NM_001318.2)

CSHL1-4 (NM_022580.1)

Rsa I

200bp

2.7%88.5%8%

p

FIG. 1. Organization of human GH/CSH genes in chromosome 17q22-24 and alternatively spliced transcripts of placental genes. A,Schematic representation of the hGH/CSH gene cluster. Rectanglesrepresent each of the five genes (five exons highlighted by coloredboxes), and dashed lines denote intergenic regions. The arrowheadsindicate the start and direction of transcription. B, Alternatively splicedtranscripts of GH2, CSH1, CSH2, and CSHL1 are drawn to approximatescale and are combined according to assay design into four groups.Exons are shown as boxes and introns as lines. The coding region isdenoted by black-filled area. Exon numbers are marked according tothe main transcripts of GH2 and CSH1. The horizontal arrows indicatethe binding sites for the RT-PCR primers. The vertical arrowheadsindicate the gene-specific restriction enzyme recognition sites for EcoNI(for CSH1 and CSH2), BstEII (for CSH1-2/CSH2-2), and RsaI (for CSHL1).The National Center for Biotechnology Information GenBank accessionnumber for each alternative mRNA transcript is indicated inparentheses. C, The relative abundance of each gene alternative mRNAtranscripts analyzed by semiquantitative RT-PCR and gene-specificrestriction detected on an ABI 3130XL genetic analyzer (see exampleson Fig. 2).

2 Mannik et al. GH/CSH Genes in Placenta of SGA and LGA Babies J Clin Endocrinol Metab, May 2010, 95(5):0000–0000

146/18, 27.02.2006; 150/33, 18.06.2006; 158/80, 26.03.2007). Awritten informed consent to participate in the study was obtainedfrom every family.

The study group was recruited at the Women’s Clinic ofTartu University Hospital (2006 –2008) in the framework ofthe REPROMETA study sample collection and comprised 72newborns born from uncomplicated, singleton pregnancies atgestational wk 38 – 42. All subjects were of white Europeanancestry and living in Estonia. Information regarding moth-er’s diseases, age, smoking, parity, parturition, childbirth his-tory, and somatometric data was obtained from medicalrecords during the course of pregnancy and after birth. Ad-ditionally, information regarding father’s diseases, age,height, and weight were documented. Fetal outcome data col-lected at delivery included weeks of gestation, gender, birthweight, crown-heel length, and head and abdominal circum-

ference. According to birth weight adjusted to sex and gesta-tional age, newborns were divided into three groups: AGA(birth weight between 10th and 90th centile), SGA (�10thcentile), and LGA (�90th centile). The weight centiles werecalculated on the basis of data from Estonian Medical BirthRegistry (18). Cases with documented fetal anomalies, chromo-somal abnormalities, preeclampsia, and gestational diabetes andfamilies with history of inherited diseases were excluded. Thebasic clinical characteristics of the study population are summa-rized in Table 1.

Tissue collection, RNA extraction, and reversetranscription

Full-thickness blocks of 2–3 cm were taken from middle re-gion of placenta within 2 h after cesarean section or vaginal

FIG. 2. GeneMapper version 4.0 electropherogram showing the amplified DNA fragments of fluorescent-labeled (6-FAM, HEX) reference gene(GAPDH) and alternative mRNA transcripts of placental hGH/CSH genes in term placenta. The expression of the genes was assessed bysemiquantitative RT-PCR (GAPDH, GH2) or RT-PCR combined with further gene-specific restriction analysis (CSH1, CSH2, and CSHL1), which wereafterward resolved using ABI 3130XL genetic analyzer. The x-axis shows the size of the detected fragments in base pairs, and the y-axisrepresents the signal intensity in relative fluorescent units. Boxed numbers below the x-axis mark the peaks of the internal size standard. Thepeaks corresponding to the amplicons from the reference gene GAPDH (196 bp) are shown on all panels. The peaks representing theamplified DNA fragments of the major transcripts of the studied hGH/CSH genes are shown on subpanels GH2-1 (364 bp), GH2-2 (390 bp),GH2-3 (360 bp) (A); CSH1-1 (304 bp), CSH2-1 (309 bp) (B); CSH1-2 (358 bp), CSH2-2 (401 bp) (C); and CSHL1-2 (326 bp), CSHL1-3 (220 bp)and CSHL1-4 (147 bp) (D).

J Clin Endocrinol Metab, May 2010, 95(5):0000–0000 jcem.endojournals.org 3

delivery, placed immediately into RNAlater (Ambion Inc., Aus-tin, TX) and kept at �20 C until RNA isolation. All samples havebeen collected by the same medical personnel.

Total RNA from 200–230 mg of tissue was homogenized andextracted using TRIzol reagent (Invitrogen, Carlsbad, CA) ac-cording to the manufacturer’s instructions. Isolated total RNAwas purified using NucleoSpin II isolation kit (Macherey-Nagel,Duren, Germany) and subsequently quantified by Nano-Drop1000 spectrophotometer (Thermo Scientific, Wilmington,DE). One microgram of total RNA was reverse transcribed tocDNA using first-strand cDNA synthesis kit (Fermentas, VilniusLithuania) in accordance with manufacturer’s instructions.

Assay designThe National Center for Biotechnology Information web

server (Bethesda, MD) was searched to retrieve sequence infor-mation of all predicted alternative mRNA transcripts for theplacenta-expressed hGH/CSH genes: GH2, CSH1, CSH2, andCSHL1. This information is summarized in Fig. 1. Primers weredesigned based on hGH/CSH locus sequence NG_001334.1 us-ing the Primer3 software (http://frodo.wi.mit.edu/primer3) (19),taking into account the information about alternative splicingand polymorphic positions in the coding region (10). Due to highsimilarity in DNA sequence of hGH/CSH genes (91–97%), ad-ditional gene-specific restriction digestion to guarantee specific-ity of RT-PCR products was used. The 5�-end of one gene specificprimer in each RT-PCR was labeled with an ABI-compatiblefluorescent dye (6-FAM, HEX; Metabion International AG, Mar-tinsried,Germany).PrimersequencesforRT-PCR,expectedampliconand restriction product sizes after gene-specific enzyme digestion arelistedinTable2.TheRT-PCRconditionsaregiveninthesupplementaldata,publishedassupplementaldataonTheEndocrineSociety’s Jour-nals Online web site at http://jcem.endojournals.org.

Capillary electrophoresisAfter amplification (GH2, reference gene GAPDH) and fur-

ther restriction analyses (CSH1, CSH2, CSHL1), the equalamount of reference gene and gene-specific product was com-bined with Hi-Di formamide (Applied Biosystems Inc., FosterCity, CA) including 0.2 �l internal size standard (MegaBACEET400-R size standard; GE Healthcare, Pittsburgh, PA) and re-solved on an Applied Biosystems 3130XL genetic analyzer. Thesamples were injected at 1.2 kV for 23 sec, run at 15 kV for 20min at 60 C. Data were detected using filter set D and analyzedwith GeneMapper version 4.0 or Peak Scanner version 1.0 soft-ware (Applied Biosystems). The resolution of this method allowsseparation of PCR products differing in length by as little as 1 bp(Applied Biosystems).

Data analysisAll samples were amplified at least in triplicate using two

different cDNAs made from the same individual. The relativeexpression level of each gene was calculated as follows: the valueof the peak area (in relative fluorescent units) of each target genewas divided with the value of peak area of the reference gene(GAPDH) from the same lane of the electrophoresis. Intraassaycoefficient of variation was 9–11%.

The statistical analyses were performed using the statisticalpackage SPSS version 17.0 (SPSS Inc., Chicago, IL) and R 2.9.0,a free software environment for statistical computing and graph-ics (http://www.r-project.org/). Descriptive statistics are given asmedian values and ranges. The study population was groupedaccording to birth weight adjusted to sex and gestational age ofthe newborns (see above). Nonparametric Wilcoxon rank-sumtest was used to compare continuous phenotypic variables ofwomen with AGA newborns to mothers with SGA and LGAnewborns. Differences in relative gene expression betweengroups were assessed by analysis of covariance (ANCOVA) us-

TABLE 1. Parental and offspring characteristics of the family trios in the study

Study group relative to birth weight

AGA (n � 23) SGA (n � 15) LGA (n � 34)Mother

Age (yr) 27 (20; 38) 26 (18; 34) 28.5 (17; 40)Height (cm) 168 (163; 177) 168 (160; 177) 168 (156; 182)BMI before pregnancy (kg/m2) 22.3 (17.4; 37.7) 20.7 (16.5; 42.8) 25 (20.5; 35)a

Gestational weight gain (kg) 15.8 (8; 39.3) 11 (2.5; 22)a 19 (9; 33)Women with parity 2 or more, n 4 2 7Women smoking during pregnancy, n 0 5a 0

FatherAge (yr) 31.5 (23; 54) 33 (23; 42) 28 (18; 44)Height (cm) 180 (172; 191) 178.5 (174; 184) 180 (168; 197)BMI (kg/m2) 26 (20; 29.5) 25.8 (17.7; 28.7) 26.4 (19.6; 37)

OffspringGestational age at birth (d) 285 (275; 295) 277 (266; 289)a 285.5 (267; 293)Birth weight (g)b 3960 (3340; 4470) 2586 (2194; 2811) 4717 (4364; 5228)Birth length (cm)b 51 (49; 55) 47 (45; 51) 54 (51; 57)Head circumference (cm)b 35 (33; 37) 32.5 (29; 35) 37 (35.5; 39)Abdominal circumference (cm)b 35 (32; 38) 31 (29; 34) 38 (36; 40)Placental weightb 650 (460; 880) 455 (390; 600) 777.5 (550; 1050)Boys/girls, n 14/9 7/8 23/11

Data are given as medians with ranges, except where indicated differently.a P � 0.05 vs. other two groups, Wilcoxon rank-sum test.b P � 0.05 among all three groups, Wilcoxon rank-sum test.

4 Mannik et al. GH/CSH Genes in Placenta of SGA and LGA Babies J Clin Endocrinol Metab, May 2010, 95(5):0000–0000

ing Bonferroni correction and gestational age as well as mother’sprepregnancy body mass index (BMI), weight gain, and smokingduring pregnancy as covariates. Square root (CSHL1) and log(GH2, CSH1, CSH2) transformations were applied to all quan-titative data to improve the approximation of normal distribu-tion. Linear regression analysis was used to assess the correlationbetween expressions of different alternative gene specific mRNAtranscripts. P � 0.05 was considered as significant.

Results

Characteristics of the study groupThe study sample consisted of 72 women with singleton

uncomplicated term (gestational wk 38–42) pregnancies,resulting in the birth AGA (n � 23), SGA (n � 15), or LGA(n � 34) newborns (Table 1).

As determined by the study design, birth weight,crown-heel length, and head and abdominal circumfer-ence of newborns were higher in the LGA group and lowerin case of SGA compared with the normal-sized babies(P � 0.05). The study groups differed significantly also inplacental weights (P � 0.05), which were closely corre-lated with birth weight (r � 0.80). In addition, womenwho delivered an LGA newborn tend to have a greaterprepregnancy BMI and women delivering a SGA newbornshowed a tendency to gain the least weight during gesta-tion compared with other groups (P � 0.05). Gestationalage at delivery was significantly different between the SGAand LGA groups. Besides, five of 15 women in the SGAgroup continued smoking during pregnancy. To avoidthese confounding effects, maternal prepregnancy BMI,weight gain, and smoking during pregnancy along withgestational age were included as covariates in statistical

analyses addressing the association between expressionprofile of hGH/CSH genes in placenta and birth weight.

Expression profile of alternative mRNA transcriptsof the GH2, CSH1, CSH2, and CSHL1 genes innormal term placenta

First, the detailed expression profile of individual pla-cental hGH/CSH cluster genes was assessed using 23 termplacenta samples from the uncomplicated pregnancies, re-sulting in the birth of AGA babies. For all hGH/CSH genesand their alternatively spliced transcripts, a wide range ofexpression level was detected in normal term placentaamong studied individuals (Fig. 3).

In term placentas three major (�10% of total) and oneminor transcript of placental GH gene GH2 was detected.In accordance with the earlier studies (20), the major tran-script was GH2-1, which formed more than half (53.5%)of the GH2 mRNA pool (Figs. 1, B and C, and 3A). Thecontribution of other transcripts to total GH2-derivedmRNA was measured 26.7% for GH2-2, 19.2% forGH2-3, and 0.6% for GH2-4 (Figs. 1, B and C, and 3A).The expression of GH2-1 and GH2-3 transcripts washighly correlated (r � 0.97), whereas lower correlationwas measured among other GH2 transcripts (r � 0.75),especially GH2-2 (r � 0.50).

The majority of the chorionic somatomammotropinencoding mRNA transcripts (�90%) in term placentawere derived from CSH1 (Fig. 1C). The major transcriptCSH1-1 containing all five coding exons was on average15-fold more abundant than the respective transcript fromCSH2 (CSH1-2) (Fig. 3B). The ratio of minor transcriptsretaining intron 4 CSH1-2 to CSH2-2 was 14:1 (Fig. 3C).

TABLE 2. Primer sequences and gene-specific restriction enzyme digestion for detection

Gene/primer Primer sequence (5�–3�) Amplicons (bp) Enzyme Restriction products (bp)GH2

ex2-F CGCCTGTACCAGCTGGCATAa

ex5-R ATTGAAGATCTGCCCAGTCC 320, 360, 364 nain4-R TTTCTCTCCCCAGTCCCTGG 390 na

CSH1/CSH2ex2-F CTCCAAGCCCATCGCGCGb

ex5-R GCACTGGAGTGGCACCTTa 601, 606, 316, 321 EcoNI 304, 309, 316, 321in4-R TTTCTCTCCCCCAGCCCTC 401 BstEII 358, 401

CSHL1ex1-F ACAGCTCACCTAGCGGCAATa

ex5-R AGGGTCTGCCCAGTCAGGT 277, 350, 457, 526 RsaI 147, 220, 326, 395GAPDH

F-ML CCATGGAGAAGGCTGGGGR-ML CCAAGTTGTCATGGATGACCc 196 na

The ML primers were originally published elsewhere (40). ex, Exon; in, intron; F, forward primer; R, reverse primer; na, not applicable.a Primer labeled at 5�-end with 6-FAM.b Primer labeled at 5�-end with 6-FAM when used with CSH1/CSH2 in4-R primer.c Primer labeled at 5�-end with HEX.

J Clin Endocrinol Metab, May 2010, 95(5):0000–0000 jcem.endojournals.org 5

The shortest transcripts of CSH genes, CSH1-3, andCSH2-3 were not detected.

Compared with the other hGH/CSH genes, the majorCSHL1 transcript CSHL1-3 (88.5% of CSHL1 mRNApool) lacks a signal peptide coding exon 2 (Fig. 1C, 3).Unlike all other hGH/CSH transcripts, CSHL1-3 mRNAmight be using an alternative AUG site in the exon 3 (Fig.1B). The average relative expression levels of alternativeCSHL1 transcripts in term placenta were detected 2.3,0.2, 0.07, and 0.02 for CSHL1-3, CSHL1-4, CSHL1-2,and CSHL1-1, respectively (Figs. 1C and 3D). The twotranscripts containing all five exons, CSHL1-1 andCSHL1-2 contributed to the CSHL1 mRNA pool at lowlevel (�5% together) compared with both exon 2-lackingtranscripts (Fig. 3D).

Significantly lower expression of GH2 in placentasof low-weight babies

The expression patterns of the three major transcriptsof GH2 gene (GH2-1, GH2-2, GH2-3) in placenta werecorrelated with birth weight (Fig. 4, A–C). When placentasamples were grouped based on the birth weight of new-borns as AGA, SGA, or LGA cases, the differences inGH2-1 mRNA quantity were statistically significantamong the subsamples [ANCOVA: F (2, 62) � 5.2301,

P � 0.008]. The expression of GH2-2 tran-script showed a similar trend [ANCOVA: F(2, 62) � 2.431, P � 0.096]. Compared withnormal-sized babies, the expression ofGH2-1 was about 1.1-fold lower in the SGA(P � 0.05) and about 1.3-fold higher in theLGA group (P � 0.006, Fig. 4A). Consis-tently, statistically different mean expressionlevels among the study groups were detectedalso for GH2-3 splice variant [ANCOVA: F(2, 62) � 3.290, P � 0.044; SGA vs. LGA P �0.04, Fig. 4C].

Increased expression of CSH transcriptsis characteristic to macrosomic newborns

The abundance of CSH1-1 and CSH2-1mRNA transcripts, the major products of thechorionic somatomammotropin CSH1 andCSH2 genes (�90% of mRNA pool, Fig. 1C),determines the level of circulating PL hormone.When placentas from AGA, LGA, and SGAgroups were compared, significant differentialexpression of these transcripts was detected[ANCOVA: CSH1-1 F (2, 58) � 15.744, P �0.0001; CSH2-1 F (2, 58) � 5.541, P � 0.006].Placental samples from pregnancies with LGAnewborns had an average approximately 1.6-fold higher expression levels of CSH1-1 (P �

0.0001, Fig. 4D) and CSH2-1 (P � 0.009, Fig. 4E) com-pared with the normal-size newborns. In case of SGA, theexpression of CSH1-1 was approximately 1.9-fold (P �0.0001, Fig. 4D) and CSH2-1 approximately 1.6-foldlower compared with LGA group (P � 0.084, Fig. 4E).

Male newborns have been shown to be taller andheavier then female babies at birth (21). In the currentstudy, the LGA group contained proportionally more pla-cental samples from pregnancies, resulting in the birth ofa boy. To exclude the possibility that the observed higherexpression of CSH1-1 in LGA group reflected the bias,additional analyses were conducted in study groups strat-ified by sex. No correlation was detected between CSH1-1transcript abundance and gender of the baby. Relativeexpression was higher in the LGA group for the placentasresulting in the birth of a girl and AGA/SGA groups in thebirth of a boy (Supplemental Fig. S1).

The expression of CSHL1 follows trends of thehormone-coding genes in the hGH/CSH cluster

The expression patterns of three detected CSHL1 tran-scripts (CSHL1-2, CSHL1-3, and CSHL1-4) in placentasfrom AGA, SGA, and LGA pregnancies were mutuallycorrelated and reflected birth weight (Fig. 4, F–H). Thehighest transcript levels were measured in the LGA and the

1.0

1.5

2.0

1.5

2.0

2.5

3.0

A e

xpre

ssio

n

A B

0.0

0.5

0.0

0.5

1.0

GH2-1 GH2-2 GH2-3Rel

ativ

e m

RN

A

CSH1-1 CSH2-1

1 5

2.0

2.5

3.0

2

3

4

expr

essi

on

DC

0.0

0.5

1.0

1.5

0

1

2

Rel

ativ

e m

RN

A

CSH2-2CSH1-2 CSHL1-2 CSHL1-3 CSHL1-4CSHL1 2 CSHL1 3 CSHL1 4FIG. 3. Relative expression level of major alternative mRNA transcripts of GH2,CSH1, CSH2, and CSHL1 genes in term placentas from pregnancies resulting in thebirth of AGA newborns (n � 23). The relative expression is given as ratio to thereference gene GAPDH. The boxes represent the 25th and 75th percentiles.The median is denoted as the line that bisects the boxes. The whiskers are linesextending from each end of the box covering the extent of the data on 1.5 Xinterquartile range. Circles represent the outlier values. A, GH2 mRNA transcripts.B, CSH1-1 and CSH2-1. C, CSH1-2 and CSH2-1. D, CSHL1 mRNA transcripts.

6 Mannik et al. GH/CSH Genes in Placenta of SGA and LGA Babies J Clin Endocrinol Metab, May 2010, 95(5):0000–0000

lowest in the SGA group. Differences among study groupsreached statistical significance for the CSHL1-4 transcript[ANCOVA: F (2, 55) � 9.494, P � 0.0001]. The CSHL1-4was on average 1.6-fold and 1.8-fold higher expressed inplacental samples from pregnancies with LGA newbornscompared with AGA (P � 0.003) and SGA (P � 0.002)babies, respectively (Fig. 4H).

Expression of placental hGH/CSH genes incorrelation with placental weight and newborngender

Theexpressionof thealternative transcriptsofhGH/CSHgenes was not correlated with placental weight within AGA,

SGA, and LGA subgroups (r � 0.5). Al-though no statistically significant differ-ence was detected in gene expression be-tween placentas from female and malenewborns, a trend for higher expressionof GH2 was observed in placenta tissueobtained from women giving the birth toa baby girl. This is in accordance with theearlier studies on PGH levels in maternalbloodstream (16, 22).

Discussion

We performed a systematic study on thequantitative expression profiles of GH2,CSH1, CSH2, and CSHL1 genes andtheir alternative mRNA transcripts insubstantial number of placental sam-ples of uncomplicated term pregnan-cies. Surprisingly, for the GH2 gene,almost half of the produced mRNA rep-resents transcripts with yet-unknownfunction and encoding for predicted al-ternative proteins (Fig. 1C). The GH2-2and GH2-3 splice products have aframe shift, resulting in a unique C ter-minus. The GH2-2 putative protein hasbeen predicted to contain membrane-spanning domain (11), and its expres-sion is restricted to a small fraction ofsyncytiotrophoblasts (23). Our studyindicated that the majority of the tran-script pool (�90%) encoding PL arisesfrom the CSH1 gene and average one15th of the CSH mRNA is transcribedfrom CSH2. Earlier reports have deter-mined the approximate ratio of relativeexpression of CSH1-1 to CSH2-1 to be5:1 (6) and 6:1 (4) at term. Almost3-fold difference could be explained by

a more sensitive detection method and larger sample sizein this study. As a novel finding, we detected CSHL1-3 asthe most abundant CSHL1 mRNA (88.5%), which usesan alternative AUG site in exon 3 and encodes a predictedprotein product of 128 amino acids. A previous report (7)showed that CSHL1-3 [alias hCS-L(1-3N-4-5)] was ini-tiated at the primary AUG in exon 1 and encoded a pu-tative protein of only 18 amino acids. The abundance ofalternative splicing variants of hGH/CSH genes might beexplained by three alternative scenarios: 1) these splicevariants are in fact translated and present as functionalproteins in the human placenta; 2) they are part of regu-

2.02.02.0

GH2-1 GH2-2

essi

on

GH2-3A

2 3 4 51 2 3 4* 511 2 4 5B C

in43

0.5

1.0

1.5

0.5

1.0

1.5

0.5

1.0

1.5

ativ

e m

RN

A e

xpre

P=0.006P 0 05 P 0 04

4 0.4

CSH1-1 CSH2-1

sion

1 2 3 4 5 1 2 3 4 5

0.00.00.0

Rel

a P=0.05

AGA SGA LGAn=23 n=15 n=34

P=0.04

D E

AGA SGA LGAn=23 n=15 n=34

AGA SGA LGAn=23 n=15 n=34

1

2

3

0.1

0.2

0.3

e m

RN

A e

xpre

ss

0 0.0

Rel

ativ

e

0 6 6on

FCSHL1-2 2 3 4 51 CSHL1-31 3 4 5

P<0.0001P<0.0001

0 6

CSHL1-4 5431

P=0.009

AGA SGA LGAn=21 n=14 n=32

G H

AGA SGA LGAn=21 n=14 n=32

0.2

0.3

0.4

0.5

0.6

2

3

4

5

6

mR

NA

exp

ress

io

0.2

0.3

0.4

0.5

0.6

0.0

0.1

0

1

Rel

ativ

e

0.0

0.1

P=0.002

AGA SGA LGAn=20 n=15 n=30

P=0.003

AGA SGA LGAn=20 n=15 n=30

AGA SGA LGAn=20 n=15 n=30

FIG. 4. Comparison of relative expression levels of major alternatively spliced mRNAtranscripts of GH2 (A–C), CSH1 (D), CSH2 (E), and CSHL1 (F–H) among term placentas frompregnancies resulting in the birth of AGA, SGA, and LGA newborns. The correspondingtranscript representing the presented data are shown on the top of each panel. An asteriskdenotes the 4-bp deletion in exon 4 of GH2-3. Relative expression of each transcript is givenas ratio to the reference gene GAPDH. The boxes represent the 25th and 75th percentiles.The median is denoted as the line that bisects the boxes. The whiskers are lines extendingfrom each end of the box covering the extent of the data on 1.5 � interquartile range. Circlesrepresent the outlier values. Plotted values are presented without covariate adjustment.Statistical differences between study groups were assessed by ANCOVA using Bonferronicorrection. Statistical tests were adjusted for gestational age as well as mother’s prepregnancyBMI, weight gain, and smoking during pregnancy. P values reflecting significant differences(P � 0.05) are shown.

J Clin Endocrinol Metab, May 2010, 95(5):0000–0000 jcem.endojournals.org 7

latory RNA machinery; and 3) they represent junk RNAresulting from still ongoing optimization of splicing reg-ulation of young placental hGH/CSH genes.

This is the first report showing that the majority ofplacentas from pregnancies resulting in the birth of SGAnewborns express lower levels of all placental hGH/CSHgenes when compared with the cases of AGA and LGA. Inconcordance, earlier studies reported a positive correla-tion between the levels of PGH and PL in the bloodstreamof pregnant women and the offspring’s birth weight (14–16). Thus, we suggest that low maternal hormone levelsmight be primarily directed by the reduced expression ofplacental hGH/CSH genes. Contradictory conclusion hasbeen reached in study (24) in which the up-regulation ofGH2 mRNA in IUGR placentas in comparison with nor-mal placentas was detected. Taking into account thatSGA/IUGR may have several etiological backgrounds andcomprises a heterogeneous group, selection criteria ofSGA/IUGR may explain this inconsistency. Study groupheterogeneity may also explain why all SGA placentas donot showdown-regulation for the entirehGH/CSH clusterin the present report.

Placental samples from pregnancies with LGA new-borns showed significantly higher amounts of CSH1-1,CSH2-1, and CSHL1-4 transcripts compared with preg-nancies with normal-sized newborns. Consistently, it hasbeen shown that elevated serum PL levels in uncompli-cated pregnancies were associated with increased neonatalbirth weight (25). It has been suggested that PL is contrib-uting to fetal growth by stimulating a catabolic state in themother in the second half of gestation via IGF-I and insulin(2, 26). Thus, increase in circulating maternal nutrientlevels results in an elevated nutrient supply to the fetus,which may lead to fetal macrosomia (LGA). This is sup-ported by the correlation of maternal PL with birth weightand BMI (27). On the other hand, because PL is alsopresent in the fetal circulation in relatively high concen-trations, it may have direct growth-promoting actions onfetal tissues (reviewed in 28). Recent studies suggest a rolefor autocrine/paracrine factors in the regulation of CSH1-1/CSH2-1 gene expression during pregnancy (reviewed inRef. 28).

In present study, we show that placenta-expressedhGH/CSH genes are an important part of the genetic net-work controlling fetal growth. What could be the molec-ular mechanisms leading to the differential expression ofthese genes? First, changes in regulatory control regionsmay alter the expression. Activation of the entire genecluster in placenta might be affected by polymorphisms orepimutations in locus control region (LCR) sequence re-sponsible for the functional activation of all hGH/CSH intissue-specific manner (29, 30). So far, it has been shown

that haplotypes of the LCR regulate tissue-specificallyGH1 transcription in promoter haplotype-dependentmanner (31). The expression of individual hGH/CSH genemight be altered by alternative allelic composition of thepromotor or other regulatory regions (e.g. placental generepeat units) affecting the efficacy of the binding of generegulatory factors (autocrine/paracrine/transcription fac-tors). Whether polymorphisms in LCR and/or other reg-ulatory regions of placenta-expressed hGH/CSH geneshave an effect on their expression remains to be elucidated.The second alternative explanation is that the number ofcells expressing hGH/CSH genes in placenta is reduced inpregnancies with SGA. It has been demonstrated that incase of IUGR, the relative levels of GH2 mRNA per cellwere comparable with those of normal placentas, but themean number of cells expressing GH2 mRNA per areawas significantly reduced compared with normal placen-tas (32). The hGH/CSH genes have shown to be expressedin syncytiotrophoblasts (33). The reduced number of syn-cytiotrophoblasts in placenta strongly implies dysfunctionin the development and differentiation of the placenta,which ultimately deprives the fetus of the nutrients re-quired for the optimal growth. Clear association betweenplacental measures and fetal growth has been also estab-lished (34), adding more support to the idea of the im-paired placental differentiation.

In summary, our study showed the abundance of alter-native splice products of placental hGH/CSH genes andtheir altered expression in placenta in pregnancies termi-nating with SGA and LGA newborns compared with AGAnewborns. In the case of SGA newborns, the expression ofthe entire hGH/CSH cluster tended to be down-regulated,whereas in cases of LGA, significantly increased transcriptlevels were detected for CSH1/CSH2 and CSHL1. Thismay reflect either polymorphic and epigenetic variation inregulatory regions of placenta-expressed hGH/CSH genesor compromised placental differentiation. The suscepti-bility to the SGA and LGA pregnancies may be mediatedby different genetic mechanisms. In the long term, this mayhave a clinically prognostic implication, because bothSGA and LGA newborns are shown to be at risk for adult-onset diseases (35). Reduced fetal growth has been asso-ciated with an increased incidence of cardiovascular dis-eases and type 2 diabetes in adulthood (35–38). Likewise,infants who are born LGA have a higher risk to developmetabolic syndrome (39).

Acknowledgments

We are very grateful to all the families who participated in thestudy. The personnel of the Department of Obstetrics and

8 Mannik et al. GH/CSH Genes in Placenta of SGA and LGA Babies J Clin Endocrinol Metab, May 2010, 95(5):0000–0000

Gynecology, Women’s Clinic of Tartu University, are thankedfor technical assistance.

Address all correspondenceand requests for reprints to: JaanaMannik, Ph.D., Institute of Molecular and Cell Biology, Uni-versity of Tartu; Riia Street 23, 51010 Tartu, Estonia. E-mail:jaana.mannik@ut.ee.

This work was supported by Howard Hughes Medical Insti-tute International Scholarship Grant 55005617 (to M. L.) andEstonian Science Foundation Grant 7471 (to M. L.). Additionalsupport was provided by Wellcome Trust International SeniorResearch Fellowship 070191/Z/03/Z in Biomedical Science inCentral Europe (to M.L.) and Estonian Ministry of Educationand Science Core Grant 0182721s06.

Disclosure Summary: The authors have nothing to disclose.

References

1. George DL, Phillips 3rd JA, Francke U, Seeburg PH 1981 The genesfor growth hormone and chorionic somatomammotropin are on thelong arm of human chromosome 17 in region q21 to qter. HumGenet 57:138–141

2. Handwerger S, Freemark M 2000 The roles of placental growthhormone and placental lactogen in the regulation of human fetalgrowth and development. J Pediatr Endocrinol Metab 13:343–356

3. Barsh GS, Seeburg PH, Gelinas RE 1983 The human growth hor-mone gene family: structure and evolution of the chromosomal lo-cus. Nucleic Acids Res 11:3939–3958

4. Chen EY, Liao YC, Smith DH, Barrera-Saldana HA, Gelinas RE,Seeburg PH 1989 The human growth hormone locus: nucleotidesequence, biology, and evolution. Genomics 4:479–497

5. Hirt H, Kimelman J, Birnbaum MJ, Chen EY, Seeburg PH, EberhardtNL, Barta A 1987 The human growth hormone gene locus: structure,evolution, and allelic variations. DNA 6:59–70

6. MacLeod JN, Lee AK, Liebhaber SA, Cooke NE 1992 Developmen-tal control and alternative splicing of the placentally expressed tran-scripts from the human growth hormone gene cluster. J Biol Chem267:14219–14226

7. Misra-Press A, Cooke NE, Liebhaber SA 1994 Complex alternativesplicing partially inactivates the human chorionic somatomam-motropin-like (hCS-L) gene. J Biol Chem 269:23220–23229

8. Hu L, Lytras A, Bock ME, Yuen CK, Dodd JG, Cattini PA 1999Detection of placental growth hormone variant and chorionic so-matomammotropin-L RNA expression in normal and diabetic preg-nancy by reverse transcriptase-polymerase chain reaction. Mol CellEndocrinol 157:131–142

9. Lacroix MC, Guibourdenche J, Frendo JL, Muller F, Evain-Brion D2002 Human placental growth hormone—a review. Placenta23(Suppl A):S87–S94

10. Sedman L, Padhukasahasram B, Kelgo P, Laan M 2008 Complexsignatures of locus-specific selective pressures and gene conversionon human growth hormone/chorionic somatomammotropin genes.Hum Mutat 29:1181–1193

11. Cooke NE, Ray J, Emery JG, Liebhaber SA 1988 Two distinct spe-cies of human growth hormone-variant mRNA in the human pla-centa predict the expression of novel growth hormone proteins.J Biol Chem 263:9001–9006

12. Boguszewski CL, Svensson PA, Jansson T, Clark R, Carlsson LM,Carlsson B 1998 Cloning of two novel growth hormone transcriptsexpressed in human placenta. J Clin Endocrinol Metab 83:2878–2885

13. Fuglsang J, Ovesen P 2006 Aspects of placental growth hormonephysiology. Growth Horm IGF Res 16:67–85

14. McIntyre HD, Serek R, Crane DI, Veveris-Lowe T, Parry A, JohnsonS, Leung KC, Ho KK, Bougoussa M, Hennen G, Igout A, Chan FY,

Cowley D, Cotterill A, Barnard R 2000 Placental growth hormone(GH), GH-binding protein, and insulin-like growth factor axis innormal, growth-retarded, and diabetic pregnancies: correlationswith fetal growth. J Clin Endocrinol Metab 85:1143–1150

15. Mirlesse V, Frankenne F, Alsat E, Poncelet M, Hennen G, Evain-Brion D 1993 Placental growth hormone levels in normal pregnancyand in pregnancies with intrauterine growth retardation. Pediatr Res34:439–442

16. Chellakooty M, Vangsgaard K, Larsen T, Scheike T, Falck-LarsenJ, Legarth J, Andersson AM, Main KM, Skakkebaek NE, Juul A2004 A longitudinal study of intrauterine growth and the placentalgrowth hormone (GH)-insulin-like growth factor I axis in maternalcirculation: association between placental GH and fetal growth.J Clin Endocrinol Metab 89:384–391

17. Spellacy WN, Buhi WC 1976 Glucagon, insulin and glucose levelsin maternal and umbilical cord plasma with studies of placentaltransfer. Obstet Gynecol 47:291–294

18. Karro H, Rahu M, Gornoi K, Baburin A 1997 Sunnikaalu jaotumineraseduse kestuse jargi Eestis aastail 1992–1994. Eesti Arst 4:299–303

19. Rozen S, Skaletsky H 2000 Primer3 on the WWW for general usersand for biologist programmers. Methods Mol Biol 132:365–386

20. Cooke NE, Ray J, Watson MA, Estes PA, Kuo BA, Liebhaber SA1988 Human growth hormone gene and the highly homologousgrowth hormone variant gene display different splicing patterns.J Clin Invest 82:270–275

21. Copper RL, Goldenberg RL, Cliver SP, DuBard MB, Hoffman HJ,Davis RO 1993 Anthropometric assessment of body size differencesof full-term male and female infants. Obstet Gynecol 81:161–164

22. Chellakooty M, Skibsted L, Skouby SO, Andersson AM, PetersenJH, Main KM, Skakkebaek NE, Juul A 2002 Longitudinal study ofserum placental GH in 455 normal pregnancies: correlation to ges-tational age, fetal gender, and weight. J Clin Endocrinol Metab 87:2734–2739

23. Liebhaber SA, Urbanek M, Ray J, Tuan RS, Cooke NE 1989 Char-acterization and histologic localization of human growth hormone-variant gene expression in the placenta. J Clin Invest 83:1985–1991

24. Sheikh S, Satoskar P, Bhartiya D 2001 Expression of insulin-likegrowth factor-I and placental growth hormone mRNA in placentae:a comparison between normal and intrauterine growth retardationpregnancies. Mol Hum Reprod 7:287–292

25. Henderson CE, Gatz M, LaRosa D, Divon MY 1995 Elevated hu-man placental (HPL) levels in uncomplicated pregnancies are asso-ciated with increased neonatal birthweight. Am J Obstet Gynecol172:293

26. Handwerger S 1991 Clinical counterpoint: the physiology of pla-cental lactogen in human pregnancy. Endocr Rev 12:329–336

27. Wolf HJ, Ebenbichler CF, Huter O, Bodner J, Lechleitner M, FogerB, Patsch JR, Desoye G 2000 Fetal leptin and insulin levels onlycorrelate in large-for-gestational age infants. Eur J Endocrinol 142:623–629

28. Handwerger S 2009 The growth hormone gene cluster: physiolog-ical actions and regulation during pregnancy. Growth Genet Horm25:1–8

29. Ho Y, Liebhaber SA, Cooke NE 2004 Activation of the human GHgene cluster: roles for targeted chromatin modification. Trends En-docrinol Metab 15:40–45

30. Kimura AP, Sizova D, Handwerger S, Cooke NE, Liebhaber SA2007 Epigenetic activation of the human growth hormone gene clus-ter during placental cytotrophoblast differentiation. Mol Cell Biol27:6555–6568

31. Horan M, Millar DS, Hedderich J, Lewis G, Newsway V, Mo N,Fryklund L, Procter AM, Krawczak M, Cooper DN 2003 Humangrowth hormone 1 (GH1) gene expression: complex haplotype-de-pendent influence of polymorphic variation in the proximal pro-moter and locus control region. Hum Mutat 21:408–423

32. Chowen JA, Evain-Brion D, Pozo J, Alsat E, García-Segura LM,Argente J 1996 Decreased expression of placental growth hormonein intrauterine growth retardation. Pediatr Res 39:736–739

J Clin Endocrinol Metab, May 2010, 95(5):0000–0000 jcem.endojournals.org 9

33. Alsat E, Guibourdenche J, Luton D, Frankenne F, Evain-Brion D1997 Human placental growth hormone. Am J Obstet Gynecol 177:1526–1534

34. Sands J, Dobbing J 1985 Continuing growth and development of thethird-trimester human placenta. Placenta 6:13–21

35. Kunz LH, King JC 2007 Impact of maternal nutrition and metabolismon health of the offspring. Semin Fetal Neonatal Med 12:71–77

36. Barker DJ 2005 The developmental origins of insulin resistance.Horm Res 64(Suppl 3):S2–S7

37. Gluckman PD, Hanson MA 2004 Living with the past: evolution,development, and patterns of disease. Science 305:1733–1736

38. Osmond C, Barker DJ 2000 Fetal, infant, and childhood growthare predictors of coronary heart disease, diabetes, and hyperten-sion in adult men and women. Environ Health Perspect 108(Suppl3):S545–S553

39. Boney CM, Verma A, Tucker R, Vohr BR 2005 Metabolic syn-drome in childhood: association with birth weight, maternal obe-sity, and gestational diabetes mellitus. Pediatrics 115:e290 –e296

40. Miller-Lindholm AK, LaBenz CJ, Ramey J, Bedows E, Ruddon RW1997 Human chorionic gonadotropin-beta gene expression in firsttrimester placenta. Endocrinology 138:5459–5465

10 Mannik et al. GH/CSH Genes in Placenta of SGA and LGA Babies J Clin Endocrinol Metab, May 2010, 95(5):0000–0000