ELSEVlER Jourt1;ll of Immur>ologicaJ ~klhods 271 (2003) S3 - 63

Determination of the eicosanoid response to inflammatory stimuliin whole blood and its pharmacological modulation ex vivo

Sonja von Aulock, Corinna Hermann, Thomas Hartung"

Biochemicul Pharmarofogy. Unil'en;ity ofKUlwlJ'~. POD M655. 78457 KO/m " ,,: , Gcrmanv

Received 5 August 2002; received in revised ronn 2 January 2003; accepted 13 March 200 3

Recog nition of pathogens by immune cells initiates the release o f numerous signali ng molecu les. includi ng cytokincs andeicosanoids. Here, we describe a simple procedure by which cicosanoids such as prostaglandin E, (PGE 2). leukotrienc 8~

(LTB~) and u uomboxane 8 2 (Tx B2) can be measured us ing commercial enzyme immunoassays (ElAs) in the supernatant ofwhole blood stimulated with inflammatory stimuli. This is illustrated for numerous stimuli. The kinetics by whichlipopo lysaccharide (LPS) induces cyclooxyg cnasc (COX ).2 expression in this setup were determined by quantitat ive reversetranscrip tion polymerase chain reaction (RT-PCR). The cicosanoid respon se of the blood of 160 healthy volunteers to I ugrmlLPS .....as measured.

To determine whether the action or a drug in vivo is represente d ex vivo in the ciccsanoidresponse of blood. one volunteertook a standard dose o f a number of commercially available cyclooxygcnase inhibitors on different days and the cicosanoidresponse of his blood to LPS was determined before ingestion as well as 2 and 6 h afterwards. The efficacy of the differentphnrrnaccuricals on cyclooxygcnasc but not lipoxygenase products or cytokincs could be moni tored ex vivo. Similarly. ex vivocicosanoid release was measured in blood from 10 volunteers who had taken 50 mg Ilurbip rofcn.

The method described extends approaches for studying whole blood cytokinc release to the lipid mediators formed fromarachidonic acid. These important signaling molecules represent targets for pharmacological intervention, which can now bemon itored in vitro, as well as ex vivo employing the same model . Furthermore , the assay could be used to characterize theimmun e status of patient groups or to monitor the course of disease.Cl 2003 Elsevier Science B.Y. All rights reserved.

K~"'"()I"(Jr Whole blood; Human; F.icosanoids; Lipopolysaccharide

..fbbrn"ialions: COX. cyelooxYl!C'fIa:ie; EIA. enzyme: inununo­assay ; GAP-DH. glyceraldehyde-J-pbosphete dehydrogenase; IL,

inlmeulr;in; LPS, lipopolysaccharide; LT. leulr;ollienc; PG. prosta­gland in; Rl-PCR. reverse uanscription polymer.lse chain reaction;

Tx. thromboxane.• Corresponding author, Tel.: +49-7531-111'4116; fall: +49­

7531·8114117.F.-mail address: Thomas.Hartung@uni·konstanz.d<':

(T. Har ru ngj .

I. Introduction

The potential of blood to release cytokines. e.g.intcrlcukin- t p (IL· l r'» or rumor necrosis factor-c. inresponse to an inflammatory stimulus. e.g. endotoxin,has proven a useful measure or the immune status ofpatients with. e.g. mult iple s cl e ro s is (Beck .:I al.,19XK). leishmaniasis (Frankcnburg and KI:lUS. I'N l l,

(}022-17591031S _ see front matter C 2( 0) Elscvicr Science B.V. All rights rescrved.doi: I0,I016150022·1759(03)00IHO-7

OI;ochidoni~ acid

Fig. I. Schematic representation of eicosanoid metabolism, COX-Iis expressed in the stomach, intestine, kidneys and thrombocytes. I1 sproducts play a key role in gasrrcintesunal cell protection, thrum­bocyte aggregation and kidney function. COX-2 is induced byinflammatory stimuli and its product~ play a role in pain. in­flanunation and fe\·er. COX~2 is expressed wnstilulin~ly in thebrain, kid~ and in lhe sexual organs.

Because of the role eicosanoids play in inflamma­tion, pa in and fever. their product ion is a target ofpharmaceutical intervention. Although acetyl-salicylicacid has been on the market for over 100 years, thereis still research into more effecti ve and more selec tiveinhibitors of cicosanoid release. However, their effectsOil isolated enzymes or cell lines have been reported todiffer from the effects in vivo (Muchcll et ul.. 1l)93; de

Lcva l ct al., 200 I ).Ex vivo stimulation of whole blood appears to

reflect closely what happens in vivo. The immune cellsare present in natural ratios and can interact with eachother. As no isolation procedure beyond the drawing ofblood is requ ired, the assay is characterized by fewpreparation art ifacts and standardized performance.Volunteers are not exposed d irect ly to potential lyhazardous agents such as lipopolysaccharide (LPS) asin the case of human experi mental endo toxemia. yetinformati on about immune modulation under condi­tions of leukocytc activation or ovcractivetion can heobtained. The commercial enzym e immunoassays(EIAs) used do not require pr ior extrac tion of thecicosanoids for these measurements.

As described previously for lcukc triene formation(Fradin et al.. 19IN). we used LPS and seven further

TxB,

~:;:::::"'" ''' l C~rX' 1I'GO, COX-2

I perc..d....'"+I\' lICtlon

f'GH,

/~"'.PGI prmlaElan,bn.: T.....,

I PGo , I

" "'''. "f'GF·2u

PGF- lu

6 ·kclO

LOX

LTF. ,

~-IIf'ETE•LTB• .-LTA,

•LTC,

•tro,

•

rheumatoid arthritis {Zan gcrlc Cl al., IQ92), sepsis(Erte l Cl al., 19(3), carcinoma (Elsasscr-Bcilc cl al.,19Q3), HIV infec tion (Hartung et al., 199R) and bOITe­liosis (Ditcrich et al.. 200 I ). Similarly, this test hasbeen successfully employed to evaluate the effects ofimmunomodulatory treatment. c.g. in healthy volun­teers treated with granuloc yte co lony-stimulating fac­tor {Hartung et al .. 1995. 1999 ; von Aulock et al..2000) or IL- IO tChcmoff COl al., 1995l. or in pat ientstreated with granulocytc -macrophage colony stimu­lating factor (Harrung et al., 20(0). Standardized kitvers ions are now commercially ava ilable. since themethod also appears to have d iagnostic value espe ­cially in sepsis patients (Reiukc Clul.. 1( 99 ). Simi larly.stimulation of blood with staphylococcal enterotoxinB (SEB) and measurement of inducible lymphokin essucb as IL-2 or IL-4 has been evaluated as a simple testfor the Irnmunoroxic effects of drugs and chemicals(Lang czaat er al.. 200 1) and can be employe d tomeasure a further parameter of immune status (Her­mann et al ., unpublished observations). such as forHIV infection (Harrung et al.• I99X),

In contrast. measurement of the release of eico­sanoids by blood in response to stimulation hasmainly been used 10 estab lish selectivity of NSAlDs(Glaser et al., 1995; Riendeau et al.. 2001; Brideanet al., 1996: Blain ct al.. 2002) and has not beenevaluated systematically with respect to determinin gmodulation of the eicosanoid response in the courseof disease, although these lipid mediators play animportant role in the immune response, Eicosanoidsregulate vase- and bronchotonus. induce pain andfever and have Immunosuppressive or chemotacticproperties.

Constitutive cy clooxyge nas e- t and inducib lecyclooxygcnase-z (COX. prostaglandin - endoperox­ide synthase> convert arachidonic acid released fromthe cell membrane in response to stimulation toPGH2, which is then furthe r metabolised by otherenzymes 10 var ious prostagtandins. prosrecyclin andthrornbcxan cs (Fig. 1). In general, thromboxane A2

(TxA2), which is rapidly metabolised to inactiveTxB2, and the leukotrienes (LTB4 as well as pcptt­doleukotrienes LTCJ LTD 4) arc cons idered 10 bc pro­inflammatory factors (R o la-P lcszczynski . 19X1) ),while predominantly anti-inflammatory characteris­tics are attributed to prostacyclin and prostaglandinE l (PGE2 ) ·

immune stimuli to initiate eicosanoid release in wholeblood. We characterized the kinetics of eicosanoidformation and their concordan ce with COX-2 expres­sion. Furthermore. we estab lished normal values forthe release of PGE2• LTB4 and TxB2 in response to astandard stimulus in 160 volunteers. We further inves­tigated whether the effects of in vivo treatment withCOX inhibitors could be followed by ex vivo stim­ulation of their whole blood .

2. Me thods

2./. Differential blood COUllts

Differential blood count" were routinely performedon the blood of all volunt eers to rule out acute infec­tions [Pentra 60. ABX Diagnostics. Monrpe tlie r,France).

2.2. Characterization of eicosanoid release

The stimul i endotox in (LPS, I or 10 Ilglml) fromSalmonella abortus equ i, lipoteicboic acid (LTA. 10Ilglml) from Staphylococcus aurvus, enterotoxins Aand B from S. aureus (SEA and SEB, I ug/ml),heat-killed S. aureus, streptolysin 0 (SLO), comple­ment facto r 5a (C5a), phorbol myr istate acetate(PMA. 100 nglml) and phytohemagglutinin (PHA)were all from Sigma (Dciscnhofcn. Germany) andmummyI dipept ide (MOP. I ug/ml) was fromHachcm (Heidelberg, Germany). The stimuli wereadded to 800 III RPMI 1640 (BioWhittaker, verv­iers. Belgium) supplemented with 100 IV penicillin,lOO ug/m l streptomycin (Gibco BRL. Life Technol­og ies, Karlsruhc. Germany) and 2.5 IU/ml heparin(Liqueminw. Hoffinann LaRoche, Grcnzac h-Why­lent Germany) and 200 III fresh. hepari nized wholeblood in 1.5 ml polypropylene tubes (EppendorfHamburg. Gennany). After incubation at 37 "C and5% CO2• cells were sedimented by centrifugationand supematants were frozen in aliquots at - 80 "Cuntil eicosanoid measurement. The concentrations ofLTB4 • PGE2 and TxB2• i.e. the inactive metaboliteof TxA 2• were measured by EIA (Cayman. SPIEurope. Gif sur Yvctte Cedex , France) accordingto the manufacturer 's instructions after appropriatedilution in EIA buffer supplied in the kits.

2.3. Measurement ofcyclooxygenase expression

Fresh. heparinized whole blood ( I ml) was added tosterile vac utainers (Sarsredr. Numb recht. Germany).which had been pre-f il led with 4 ml RPMI 1640supplemented with penicillin, streptomycin and hep­arin as above, and 10 ug/ml LPS from S. abortus equior no stimulus. At diffe rent time points, RNA wasprepared with QIAamp RNA Blood Mini Kit (Qiagen,WIden, Germany) accord ing to the manufacturer'sins truc tions. inc luding DNA digest ion with theRNase-free DNase Set (Qiagen ). ]0.2 III RNA werereverse transcribed in a sample volume of 20 IIIcontai ning 2.5 Il M Oligo dT 1ft (Gibco BRL. customprimer), MgCJ2 (5 mM). dNTP (I mM each), RNAseinhibitor (1 VIll I). murine lcukernia virus reversetranscriptase (2.5 U/Ill) in PeR buffer (all PE AppliedBiosysrems, Weiterstadt . Gennany). Samples wereincubated at 2 1 "C for 10 min. 42 "C for 15 min. 94-c for 5 min and 5 "C for 5 min in a GeneAmp PeRSystem 2400 (PE App lied Bicsysrcms). A total of2 IIIcDNA was added to PeR master mix. containing 3mM MgCI2, 400 nM sense, respectively. antisenseprimers for cycloo xygenase-2 pub lished in tnigucz etal. (199S) or housekeeping primers for glyceralde­hyde-3-phosphate dehydrogenase (GAP-OH) (forwardgaaggtg aaggtcggagtc , reverse gaagatggtgatgggatttc,TIB Molbiol. Berlin. German y) in Faststart Light­Cyelcr DNA Master SYBR Green 1 (Roche Diagnos­tics, Mannhcim, Germany). pe R was perfor med in aLigh tCyclcr T~ Instrument, using thermal settings asfollows: denaturat ion and activation of the polymeraseal95 "C for 10 min and 50 cycl es of 95 "C for 0 s. 63"C for 5 s and 72 "C for 20 s. A melting curve analysiswas performed after PeR to check the specificiry ofthe reaction. Fit point quantification was performedusing LightCycler3 software.

2.4. Volunteer study

Blood was drawn from a tota l of 160 healthyvolunteers at the Universit y of Konstanz on 1\\'0days.This occurred during the same two hours on bothdays. Fresh, heparinized blood ( I ml). heparinizedblood was added to sterile Vacutai ners (Sarstedt),which had been pre-filled w ith 4 ml RPMI 1640supplemented with penicillin, streptomycin and hcp­arin as above. and I pg/ml LP$ from S. abortus equi.

56

After incubation for 24 h at 37 °C and 5% eCh, cellswere sedimented by centrifugation and supernarantswere frozen in aliqucts at - 80 "C until cicosanoidmeasurement as described.

3. Results

3J Eicosanoid response a/ whole blood to differentinflammato ry stimuli

o

LPS lTA SEA SEB MDPS,aur. SLO cs. PHAPMA

300 C

~ 300

o" 0

~ ~ 200

•~ I OO

c LPS LTA SEA SEB MDPS.aur. si.o CSa PHA PMA

A variety of compounds including componentsfrom Gram-positive bacteria initiated the release ofeicosanoids in human whole blood of five donors , ofwhich the supematants were pooled before measure­ment (Fig. 2). LTB4 and TxB2 were measured after 4 hof incubation, whereas PGE2 was measured after 24 hof incubation. Only streptolysin 0 and the compte-

One tablet of 400 mg ibupro fen (Ibuprofcn Klinge,Klingc Pharma. Munich. Ger many}, 500 mg para­cetamol (Benuron, Bene Arznci mittel. Munich. Ger­many), 200 mg phenylbutazon (Ambene, Merckle,Blaubeuren , Ger many), 50 mg flurbiprofen (Froben,BASF Generics, Ismaning, Germany), 25 mg role­coxib (Vioxx, MSD Sharp and Dohmc, Hear, Ger­many), 50 mg indomethacin (Amuno, MSD Sharp andDohme , Hear, Germany), 50 mg sodium diclofenac(Vcltaren. Novartis Pharma, Numbcrg, Germany), 500mg acety lsalicylic acid (Aspirin, Baycr, Levcrkusen.Germany), 100 mg celecoxi b (Celebres. Scarlc, Nurn­berg, Germany) or no medication was taken orally byone of the authors (TH, medical doctor, male, age 37,85 kg) at 9 a.m. on different days with at least two daysin between settings . Blood was taken before ingestionas well as 2 and 6 h later. lncubations were performedin Vacutainers as described above for 4 or 24 h. IL-\ ~~

was measured using an ELlSA based on an antibodypair from Endogen (Biozol, Eching, Germany) withrccomhinant hu IL- !I>, from NIBSC (Potte rs Bar,Herts. UK) as standard .

Two group s of five volunteers (mean age 27.6±O.9years, mean weight 77± 2 kg) each took 50 mgl1urbiprofen \ week apart. Blood was taken beforeingestion and \, 9 and 25 h later, and stimulated with10 ug/ml LPS for 24 h. This study was part of aclinical study performed at the University of Konstanzaccording to the Declaration of Helsinki and Edin­burgh and approved by the Ethical Committee of theUniversity of Konstanz.

2.5. Drug studies

2.6. Statisticsc l PS lTA SEA SEB MDPS.aur, SLO cs, PHA PMA

Analysis of variance with Tukey post-test wasperfo rmed using GraphPad Prism 3.00 (Graph PadSoftware, San Diego, CA), P<0. 05 was consideredsignificant. Data are presented as means ±S.E.M. ofthe number of blood donors indicated, calculated perml blood, i.e. corrected for the dilution factor of5 in theincubation.

Fig, 2. Eicosanoid response to different stimuli. Release of PGEz,l](B~ and LlB. in 20"10 whole blood incuba tions with blood fromhealthy volunteers stimulated with a variety of different stimuli,Eicosanoids in the supematants were measured by EIA; PGE1 wasmeasured after 24 h, TxB2 and LTB., after 4 h. Data are normalizedto LgS-mdu ced eico, anoid reteas c. Supernata nrs of five donorswere poo led before measu rement .

"ment factor C5a failed to induce significant amo untsof an y eicosanoid. The o the r stimuli empl oyedinduced cha racteristic individual patterns of eicosa­noid release. For instance , LTA induced more PGE2and TxB2 than LPS, but less LTll" whereas phorbolmyris tate ace tate induced more Tx B2 but less PGE2and LTB4 than the LPS stimulus. None of the stimuliinduced more than I ng/ml LTE.. and PGI2 (data nOIShO"'l1).

3.1. Dose response of whole blood stimulated .....ithLPS

Whole blood from six healthy donors was stimu­lated with I ng, 100 ng or 10 pg/ml LPS for 24 h. an dthe three eicosanoids PGE2, TxB2 and LTB4 weremeasured in the superna tams (fig. J). Compared tothe larger quantities of the cycloo xygenase productsPGE2 and TxB2, of which up to 100 nglml weredetected, little leukotrien e B4 • i.e. less than J ng LTBJml blood , was formed.

3.3. Kinetics of whole blood response to stimulationwith LPS

12' A

100

] 75~•"~ 50~

25

0c

12' n100

~ 75

~" 502

25

0e

J C

l og tOOng lOllSLPS

LPS

In whole blood from six healthy blood donorsincubated in the prese nce of 10 ug/ml LPS, the time­dependent release of LTB 4, PGE2 and TxB2 ove r aperiod of 24 h was measured (Fig. 4). PGE2 formationsteadi ly increased unt il 24 h and was delayed com­pared to LTB4 and TxB2 release. After 24 h incubation ,the total amounts of PGE2 and TxB2 were app roxi­mately eq ua l. LTB 4 peaked at 6 h. then levelsdecreased, though they remained elevated above basalvalues at 24 h. TxB2 levels remained stable around 60nglml between 8 and 24 h.

3.4. Kinetics of cyctooxygenase expression in re­sponse to stimulation with 10 J1g/ml LPS

Expression of COX-2 mRNA in response tostimulat ion with LPS was quantified ove r 24 handnormalized to GAP- DH expression (Fig. 5) . Interest­ingl y, the COX-2 exp res sion curve showed twopeak s. the ea rlier one correlating with the ea rlyTxB2 peak, ind icating that COX-2 expression is thepacemaker for Tx B1 release and that the early TxB2

peak doe s not result from basal COX-J activity.

Fig. J . CoocrntT1llion dependence of eirosanoid release to LPS.TWe>1ly pctte>1t human whole blood from Sill healthy volunteers WII5

stimulated with differen t concentrations ofLPS from S. aOOrtuJ t'lIIifor 24 h. Eicosanoids .....en: measured in tile supem atants by EIA.Data arc mcans :!:S,E.M.

PGE2 prod uction kinetic s shown abov e were notmirrored in the curve, indicati ng that ano ther enzymeis the pacemaker for its release. Although the fourdonors reacted on different levels. the shapes o f thecurves were similar for all four donors . PGE2 andTx B2 release were measured in samples run in

'0000

'" 1000

~I:V .57'10

' 00cv7 6'1o "T~

~.~ "cv64'1>

• ~,~~ 0.1

00' PGE, TUJ, LTIl,

Fig. 6. lntenndividual differences ill response to stimulation withlPS. Twenty percent human whole blood was incubated in thepresen ce of I flg/ml lPS for 24 h. Eicosanords were determined inthe supem atnnts 11)' EIA. Data are box -and-whiskers plot, for 160blood donors , i.e. the boxes show the 25th and 75th percL'Iltile; thehorizontal line in the box shows th e median value; the whiskersshow the highest and the lowest va lu('s; CV is the coefficien t ofvariance , Basal release of cicosano id.' in COll1rvl incuba tions were4 0:tO.17 nglm l PG E2. O.2S±O.03 ngim! LTH4 and 2.1:to. I:! ng/ml

TxB! .

The response of blood from 160 healthy volun­teers at the University of Konstanz is displayed as abox and whiskers plot (Fig. 6 ). The average age ofthe group was 30.2± O.9 and the sex distribution was75 female/SS male. The release of PG~ and TxB2 inthe blood of females (16.9 ±1.6 ng/ml PGE2 and

3.5. Response afblood fro m 160 heallhy vo lunteers tostimulation with 1 pg/ml LPS

Fig. 5. Kinetics of COX-2 mRNA expression in response to LPS.Twenty percent human whole blood from four hcahhy votumcerswas stimulak'd with 10 pg/ml lPS from S. ahvnu,T equi: Rl\A wasisolated at the time points indicated . reverse transcribed and

quantitative PCR was performed for COX-2 and GAP-OI l. Datashow the quot ient of COX-2 express ioll to GAI'DJ! expression, i.e.fold increase over basal levels±S,E.M .

' 00 ....... dono r 1

< -6-donor 2~ --donor 3E 10 -K- donor 4~~

T ~

<c1 ~

X8

0.'0 2 , 6 8 10 12 14 16 18 20 22 24

time [hJ00 , , , • " " 14 16 " " " "lime Ill!

us B

'00

]" 75

~.. so"

"0

0 , , , ," n 14 16 " zo " "time (hI, C

),~ ,~

0'0- ·' -,-",-',-',,-,',-,.,-,.,-,.,- ,,:-,. ,:-,",'

\i_Ill]

parallel after 24 h incubation (data not shown).Interestingly. the donor with the greatest COX-2expression was not the donor with the highestPGE2 or TxB 2 production.

Fig. 4. KillClk s of ecosanoid release in response 10 LPS. Twentypm:ent hurna.n whole blood from four healthy volulIl/XfS wasstimulated with 10 J.l&,'ml lPS from S. uhf>rlus equi. Eicosanoidswere measured in the supernatarnsatthe time point~ indicated. Dalaare mC311s± S.E.M.

"'00 A

",~~ so~

as

59

77.8±5.3 ng/ml TxB2) was slightly less than in theblood of males (20.9± 1.6 ng/ml PGE2 and 99.4±5.9ng/ml TxB2, both p<O.05 , Mann-Whitney test),whereas the release of LTB4 was the same in bloodfrom males (l.5 ±O.1 ng/ml) and females ( 1.4±O.1ng/ml, n.s.), The coefficients of variation (CV) ofcicosanoid release (76% for PGE2, 64% for LTB4

and 57% for TxB2) were slightly higher than for therelease of turner necrosis factor a (50%) or IL. 10(44%, data not shown), indicating that the inter­individual differences are slightly greater for eicosa­noid release than for cytokine release.

3.6. Effects of the ingestion of cycloaxygenaseinhibitors on the ex vivo eicosanoid response to LPS

One of the authors took onc standard dose of eachof the listed drugs. All drugs were well tolerated andno side effects were reported. None of the drugs hadsignificant effects on differential blood cell counts(data not shown). Control values were taken on threedays at the beginning, middle and end of the study.Blood drawn before and at 2 h as well as 6 h afterdrug ingestion was stimulated with I ug/ml LPS.LT8 4 and TxB2 were determined in the supcrnatanrsafter 4 h incubation and PGE2 was measured after 24h (Table I). Values were normalized to the eicosanoidrelease at the time point before drug ingestion on therespective day. The different drugs had different

potencies and different duration of action. Forinstance, acetyl-salicylic acid, paracetamol and rofe­coxib were only able to reduce LPS-induced PGE2

release by less than a third, while ibuprofcn had astrong short-term effect, but LPS-induced PGE2 hadreturned to normal values within 6 h of ingestion ofthe tablet. Flurbiprofen still had the strongest effect ofall drugs on PGE2 release 6 h after ingestion. Ingeneral , the findings regarding the inhibition ofPGE2 release were mirrored by TxB2 release, whichwas to be expected. as both are downstream productsof COX. Some drugs also affected LTB4 levels andthe lipoxygenase system (Table I). However. none ofthe drugs had significant effects on IL-l ~>, release.

To confirm the findings described above, twogroups of five healthy volunteers each took one tabletof 50 mg flurbiprofen. Blood was drawn before (0 h),and 1, 9 and 25 h after ingestion. No side effects werereported and there were no effects on the differentialblood cell count as compared to values taken 2 weeksbeforehand to establish the diurnal changes (data notshown). Pturbiprofen was very effective in reducingLI'S (10 pg/ml) induced PGE2 and TxB2 releasewithin I h of ingestion (Fig. 7A and Bl. This effectheld for 25 h regarding r GE2 production, thoughTxB2 values had returned to normal values within25 h. These results indicate that flurbiprofen mightadditionally act on an enzyme further downstreamfrom cyclooxygenase in the pathway of PGE2 pro-

Table 1Effect of different cyclcoxygcnasc inhibitors on LPS-indueed eicosanoid release

Treatment (mg) rGE~ (24 h) LTB4 (4 h) TxB1 (4 h) IL·! II (24 h)

2 6 66 2 6 66 26 66 2 h 66

Control IOU 132.H 104.1 49.7 95.9 954 11 3.7 110.5(Mean± S,E.M,) ± l.? 1 ± J.OI ± 8.3 ± 3,91 ± 1.O3 ± 2,15 25.7 15.7lbuprofen (400) 21.4 104.9 87,2 48.5 65 97.9 112.7 105.6Paracetamol (500) 71.7 60.2 112.4 1l7 .7 102.S 77.2 180.6 148.2Phenylbutazon (200) 19.6 34.5 74 40.1 36.9 29.2 137.6 107.8Flurbiprofen (50) 6 2.4 9J 117.5 23.2 31.2 Ill.? 108,0Rofeccxib (25) 96.2 81.1 46.2 R3.9 35.8 IIS .2 102.1 88.5Indomethacin (50) 33.1 23.4 123.8 54.4 24.3 2R.2 145.5 !lO ADiclofenae (50) 10.7 23.1 87.3 113.R 21 50.2 133.5 148.3Acetylsalicylic acid (500) 7 1.9 61.2 56.8 89 54.2 116.6 130,1 115.1Cetecoxib (100) 9.6 31.4 59,8 6" 30.1 42.2 128.6 !OH

Onc author took one standard dose (shown in mg) of different cyclooxygenase inhibitors at least 2 days apart. Blood was taken before inge<;tionas well as 2 and 6 h later and stimulated with I Jlg/mlLPS. Eicosanoid" were measured in the supcrnatants by EIA (PGE2 after 24 h, LTB4andTxB1 alter 4 h incubation). tL-II\ was measured by ELlSA after 24 h incubation. Mediator release before ingestion was set 10 100%. Controlvalues were taken on three different days and are shown a, means±S.E.M.

4. Discu ssion

and kinetics of eicosanoid release in response to themodel inflammatory stimulus endotoxin. The methodis simple to per form and close 10 the in vivo situation,as all populations of blood eells are present in naturalratios. This is a relevant aspect. because TxB2, LTB4

and PGE1 can be released by both monocytes [N ich­ols et al., 191\7; Nusing et aI., 1940: Jucrgcns er al..19<>2: Parngnuni et al. 19Q4: Aibiki and Cook, 19\)7)and neutrophils [Docrfk-r cl al.. 19X9: lheng et al..1990: Saareks er ul.. 19Q31. though this was not foundfor both populations by all investigators. Furthermore,platelets, which were also present in the whole bloodincubations. express the highest amoun ts of throm­boxane synthase fNusing et ~1I .. I(1)01and can releaseTxB2• not only in response to coagulation. which wasprevented here with heparin. but also in response toIL- I r~ (Reulc et al., 19%) or ionopho re [Snnreks et al..19( 3) st imulation . However, as plate lets have nonucleus and therefore make no mRNA, their contri­bution to elcosanoid release can on ly come from theirconst itutive COX-I . Studies in d ifferentially purifiedcell populations do not cons ider transcellular active­lion processes and protein binding which might occurin vivo and may be altered in the course of disease.However, tbis is con trolled ill the whole blood assaydescribed here.

Further benefits ofthis test are thut in our experiencethe sterile vacutaincrs can be pre-f il led with mediumand the LPS stimulus and stored for at least 2 yearswithout losing potency, so also limiting day to dayvariability and the time required to perfor mthe assay.Moreover. the cicosanoid conce ntrations in the super­natants can now be measured by non-radioactive com­mercially avai lable EIAs. Th e supematants can becollected and stored at - 80 QC unti l measurementand. furthermo re. cytokine release capacity can alsobe measu red using the same supcmatants. therebypermitting easy and exact assessment of corre lations.The relatively high concent rations of LPS used in theassay (I or 10 ~lg!ml) induce fairly high levels ofeicosanoid release in blood from healthy patients with­out being toxic, so facilitating their detection with thismeth od and maki ng pri o r ex tractio n pro ceduresunnecessary. The LPS concentrations also allow dctcc­tion of potentially lower levels of eicosanoid release inimmunologically challenged patient blood as well asunder pharmacological cyc loox ygenase inhibi tion.This method could also be adapted for immune mon-

...

101 2 14 16 182022 2426

lime [h)

•••

o 2 4 6 8

100 C

d "

00 2 4 6 8 10 12 14 16 18 20 22 24 26

150 H time [hI

]100,..s.ii ••~ 50 ••

60

" A

~ 50,.£,Eo"~ • •

In this study, a method for the assessment of theeicosancid response of human whole blood wasestabli shed by determining dose- response curves

o 2 4 6 8 10 1214 16 18 20 22 24 26

time [hJ

duction. Ll' Svinduced re lease of IL- I~ was no taffected by Ilurbiprofen (Fig. 7C).

Fig. 7. Effect of SO mg nurbiprofen on Lf'S.induced ei~id

response . Ten healthy "olunteer5 took one 50 mg tablet ofnllfbipl'llfcn at 0 h (8 a.m.). Blood was t.aken at diffcTl:TII rime:poin ts and samc tated ..i tb 10 " g m] LPS for 24 h. PGE1 andTxB:...-ee ~"lIrtd in the surernatanlSby EtA. Dau are means ±S.E.M;u p« l-Ol. "·p<O.OOI compared 100 h.

61

itoring of animal blood as the eicosanoid structures areidentical in all mammals. in contrast to the cyrck inesfor which there are often no suitable antibodies avail­able [Hrideau et al., 200 1I.

A variety of inflamm atory stimuli were shown toinduce characteristic patterns of cicosanoid release.Further investigation s on the pyrogenic capacity ofother inflammatory stimuli may elucidate their role inthe induction of fever and pain. for instance by meansof PGE2 induction. This has been shown indirectly invivo for endotoxin, as pretreatment of subjects withthe cyclooxygenase inhibitor ibuprofen before admin­istration of Escherichia coli LPS markedly attenuatedflu-like symptoms. fever, tachycardia increased meta­bolic rate and the st imulation of stress hormonerelease. and the subjects could not di stin gui shbetween administration of endotoxin and saline ascould the positive con trols who received endo toxinbut no ibuprofen IRO:\'haug et al.. IQ88). The impor­tance of eicosanoids for the production and physio­logical action of other mediators of inflammation isincreasingly recognized (Dcsscin et al.. 1986; Akamaet al., 1990; Rola-Plcszczynski and Stankova. 19Q2;Saner and Ila rtung. 199-'). However. within the net­work of pro- and anti-inflammatory mediators. littleattention has been paid to the possible interactions ofcytc kincs with eicosanoids or the potential coregula­tory mechanisms implied by correlations of eicosa­noid and cytokine levels in the serum of patients. Suchinteractions can also be studied using this model. bothat the level of COX-2 indu ction and cicosanoidrelease.

The quantitative reverse transcription polymerasechain reaction (RT-PCR) for COX-2 implies that therate of production of TxB 2 in response to LPS islimited by COX-2 expression. whereas another me­chanism contro ls the rate of PGEz production .Increased levels of COX-2 expression have beenreported in the synovial tissue of patients with bothrheumatoid arthritis and ostcoarthritis. as well as insome tumor tissues. and may play a role in thepethogenes is of Alzheimer 's di sease (Uin7 andBnme . 19(9). The possibility of COX-2 mRNAquantification may be used to exp lore the role ofCOX-2 expression and its correlation with diseaseseverity in different tissues and diseases. As COX-2mRNA was already induced \ h after stimulationwith lPS. the whole blood cicosanoid response

assay does not pennit the discrimination of COX-Ifrom COX-2 activity.

The relatively narrow d istribution of eicosanoidrelease levels induced in a large number of healthyindividuals (11= 160) suggests that reference valuesmight be establis hed for this type of reaction per­formed under standardized conditions. Higher gener­ation of TxB2 in blood from males in comparison toblood from females is consistent with data reportedpreviously in a smaller number of volunteers {Hanscner al.. 19:\9).

Furthermore, the clear effects of a number ofdifferent cyclcoxy genase inhibitors taken in vivoon the eicosanoid response ex vivo indicate that thismethod is sufficiently sensitive to capture the mod­ulation of the eicosanoid response in the course ofdisease or as a result of the use of medication. Sucha study is curren tly underway, investigating theeffects on inflammatory parameters. including eico­sanoid release. of periopcrauve filgrastim treatmentof patients undergoing major abdominal operations.The different cyclooxygenasc inhibitors employedappa rentl y had di fferent potencies rega rding theinhibition of cyclooxygenase activity, although thedata from this experiment in one volunteer shouldnot be ovennterpreted. This may be a function of theconcentrations employed though these were standardtablets. More probably. differ ing cfflcacies in sup­pressing prostanoid release stern from their differentmodes of action, whethe r thei r effects are reversibleand from their half-life in the scrum. Althou ghacetyl-salicy lic acid irreversibly inhibits cyclooxyge­nase by acetylation of a single serine residue (Rothcl al.. 1(75), its half-life in the serum seems to betoo short to also acetylate newly induced COX-2.Ibuprofen inhibits COX by substrate competitionwith arachidonic acid (Rome and lands. 1975). Inthe presen t study it effec tive ly inhibited PGEzrelease 2 h after ingestion, though this effect wasno longer observed 6 h after ingestion. The obser­vation that celecoxib was more potent than rofecoxibis in line with data attributing a greater COX-VCOX-I ratio to rofecoxib (Riendeau et al., 2001).Flurbiprofen and indomethac in block the metabolismof arachidonic acid by interacting with the bindingsite of arachidonic acid to the cyclooxyg enase(Mancini er al., \(97). Both substances effectivelyinhibited cyclooxygenase activity 2 and 6 h after

62

ingestion . This was confirmed in another study inwhich ten healthy volunteers took one 50 mg tabletof flurbiprofen and LPS-inducible eicosanoids andIL- I B were measured. Flurbiprofen very effectivelydecreased LPS-induciblc PGE2 and TxB2 though nolIL-H~ release. This effect still held 25 h alter intakefor PGE2 although TxB1 release had returned tonormal levels . This indicates that flurbiprofcn mayalso act on an enzyme further downstream in theproduction of prostaglandins .

Taken together, the standardized human wholeblood mode l assessing Ll'Svinduciblc cicosanoldrelease promises to be a simple in vitro and ex vivomeasure of a rele vant parameter of the immunesystem. The broad app licability, similar to LPS-indu­ciblc whole blood mono kine release and staphy lococ­cal enterotox in B-inducible whole blood lymphok inerelease, will permit a broad range of studies .

Acknowledgements

The authors are grateful for promp t help andtechnical assistance from Stephanie Traub, KathrinGraf, lna Scuffcrt, Lars Hareng and Pascal Renner.

References

Aibiki, M., Cook , l.A .. 1997. Ulinastat in, a human trypsin inhibitor.inhibits endotoxin-induced thrombc xane B. pWlluction in hu­man monocyte" Cri, Care Mcd. 25. 430-434.

Akama, H., lchikawa , Y., Matsushita, Y.• Shinnza wa, T , Homma,M., 1990. Mononuc lear cells enhance prostaglandin E~ produc­tion of pol}worphonuclear lcukccytes via mmor necrosis factoralpha , Biocbem. Biophys. Res. Commun. 168, 857 - 862.

Beck. 1.. Rondot. P., Catinot. L.. Falccff E.. Kirchner, R , Wietzer­bin. J., 1988. Increased production of interferon gamma andtumor necrosis factor pr~ede, clinical manife statio n in multiplesclerosis: do cytc kines trig ger off exaccrbations? Acta Neurcl.

Scand. 78, 318 -323.Blain. H, Boilcau. C, Lapicque. F., Ncdclcc, E.. Locuil!c. D..

Gulllaume. C.. Gaucher. A" Jeandcl. C.• Nctter, P., Jouzeau.J.Y.. 2002. Limitat ion of the in vitro whole blood assay forpredicting the COX selectivity of NSAJDs in clinical use. Br;1 Clin. l'harmacoL 53. 255 -265.

Brideau. c.. Kargman. S., Liu, S.. Dal1ob , AL. , Ehrich, E.W.,Rodg er. I.W , ere», CC., 1996. A human whole blood assayfor clinical evaluation of biochemical efficacy of cyclooxygc­nase inhibito,-.; . Inflamm. Res. 45. 68 -74.

Brideau, C , Van Stadcn, C. Cban, C c. , 2001. In vitro effects of

cyclooxygenase inhib itors in whole blood ofhorses. dogs. andcats. Am. J. Vc\. Res. 62, 1755 -1760.

Chcrnoff A.E., Granowitz, E.V., Shapiro. L., vannicr, E., Lonne­man n. G.. Angel , J.B .. Ker medy. J.S .. Rabson. A.R .. Wolff.S.M" Dinarello, CA.. 1995 , A randormzed. contro lled trial ofIL-W in humans. Inhibition of inflammatory cyto kine produc­tion and immune responses. J. lrnmuncl. 154.5492-5499.

de Leval, X" Delarge, L. Devel, P., ?\Jevcn. P., Michaux. c., Ma sc­

reel. B., Piroue, B.. David. J.L, Hcnmtin. Y.. Dogn. J.M . 200 I.Evaluation of class ical NSAlDs and COX-2 selective inhibitorson purified ovin c enzymes and human whole blood . Prostaglan­dins Lcukot. Esscru. Fat. Acids 64. 211-216.

Dcssein, AJ.. Lee. T.H., Elsas, P., Ravalesc. Ld., Silbcrstcin, D.,David, lR .. Austen. K.F.. Lew;s, R.A., 19S6. Enhancement bymonokines of leukotriene generation by human co sinophils andneutrophils stimu lated with calcium ionophorc A2318 7. J. lm­munol. 136. 3R29 - J83 S.

Diterich. L, Harte r, L., Hasslcr, D.. Wcndel, A, lIartung, T., 200!.Modulation of cytokinc release in ex vivo-stimulated bloodfrozu borrcliosis patients. Infect. Immun. 69. 6R7-694.

Doerfler, M.E" Dan ncr. R.L. . Shelhamer, J.H., Parril1o, JE"1989 . Bacterial lipopclysaccharides prime human neutr\lphilsfor enh anced production of 1cukotriene B4 . J. Ctin. Invest. 83,970-977.

Elsasser-Beile. U., V{ln Kleist, S., Fiscbcr, R., Martin. M" werte­rJuer, U., Gallati, H., Montiug, l .S., 1993. Impaired cytokineproduction in whole blood eel! culture s of patients with urclog­ical carc inomas. J Cancer Res. Clin. Onco!. 119,430 -433.

Ertel. W., Krombach. F., Krcrncr, J.P., Jarrar. D., Thiele, V..Eymann. J., Mucnzing. S.. Faist. E., Messmer; K.. Schildbcrg,F.\V., 1993. Mec hanisms of cytokine cascade activation inpatients with sepsis: nor mal cytokinc transcription despite re­duced CD 14 recc ptor expression. Surgery 114, 243 - 250(Discuss ion 250-1).

Fmdin, A., Zirrolli. lA.. Maclouf J.. Vausbinder. L.. Henson.P.M., Murphy, R.C ., 1989. Platelet-activat ing factor and teu­korricnc biosynthesis in whole blood. A model for the studyof transcellula r arachidonate metabo lism. J lrnrnunol. 143,

3680 - 3685.Frankcnburg. S.. Klaus. S.. 1991. Production of interferon gamma

in cultures of whole blood obtained in the course of and afterhealing of cutaneo us leishmaniasis. Ann. Trop . Med. Parasitol.85,401 -405,

Glaser, K., Sung, M.L.. O'Neill, K., Belfast, M., Hartman. D.,Carlsou. R., Kreft, A, Kubrak, D., Hsiao . CL.. Weichman,13.. 1995. Eto dolac selectively inhibits human prostaglandinGIH synthase 2 (PGHS-2) versus human PGHS- l. Eur J. Phar­

macol. 2Rl . 107-1I l.Hamen, J.B., Wilsgard. L., Olscn. J.O.. Svcnsson. B.. Osterud, B.,

1989. Th e effect of hpopnlysaceharidcs (Lt' S) on generation ofthromboxanc A. and thrombopla, tin activity in whole blood ofmales, female s and female, on oral contraceptives . Thromb.Hacmust. 61, 493 - 496.

Hartung.vf., Docke. WD., Gar nncr, F., Krieger, G" Sauer. A., Ste­vcns. P.• Volk, H.D., Wcudcl. A.. 1995. Effect of grJHulocytecolony_>timulating factor treatment on ex vivo blood cytok inc

response in human volunteers. Blood 85, 2482 - 241\9.

63

Hanu ng, T., Pitrak, D.L., Footc, M.. Shatzen, E.M., vcrral. S.c..we ndel. A., 1998. Pilgrastim restores interlcukin-Z productionin blood from patients with advance d human immunodefici encyvirus infection. J . Infect. Dis. I?S. 686-692.

Hartung. T . Doecke. WD ., Btmdscbuh. D., Foote. M.A. , Gnmner,E , Hennann, C , Lcnz, A.• Milwcc. S., Rich, B., Simon. B.,volk. H.D., von Aulock. S., Wcndel. A .. 1999. Effect of fllgras ­rim treatmen t on inflammatory cytokines and Iyrnphocyte func­tions, Clin Pharmacol. Ther. 66, 415-424,

Hartung, T , von Aulock. S.. Freita g, M., Hoxtermann, S., Stucker.

M., Hoffmann, K., Altmeyer, P" Konke , A.. Wendel, A., 2000.Blood cyto kine response of low-dose molgramostim (rhGM ­CS!-l-treated patients. Cytokine 12, 1570 -1574.

I linz, 13. , Brunc, K., 1999. Specific COX- 2 inhibitors : prospec ts oftherapy with new analgesic and anti-int1ammatory substances.Wien. Klin. wochenschr. I ll . 103- 112.

Iniguez, M.A., Pablos. JL., Carrcira. P.E., Cabrc. F., Gomcz-Rcino.U " 1991( Detection of COX· I and COX-2 iscforrns in synovialfluid cells from inflamma tory j oint diseases. Br. J. Rbeumatol.37,773 - 778.

rucrgcns . U.R., Christiansen. S,C" Stcvenso», DD ., Zuraw, BL,1992, Arachidonic acid metabolism in monccytes of aspirin­sensitive asthmatic patients before and after oral aspirin chal­lenge. J. Allergy en». lmruunol. 90. 636-645.

Langc7.aal.1., Co ecke. S., Hartung, T" 2001. Whole blood cytokineresponse as a measure cfimmunotox icity, Toxicol.Tn Vitro 15.313 - 318.

Mancini. J.A .. Vickers. P.J., O'Neill. G.P., Boily, C , Falgucyret,J.P., Ricndeau . D., 1997. Altered sensi tivity ofaspirin-accrylatcdprostaglandi n GIH synthasc-2 to inhibition by nonstero idal anti­inflammatory drugs. Mol. Pharmacol. 51, 52 -60.

~litchell, J.A., Akarascrccnont. P., Th icmcrrnann, c.. Flower, RJ.,Vane, J.R. , 1993. Selectivity of nonsteroidal amhnflammarcrydrugs as inhibitors of constitutive and inducib le cyclocxyge­nasc. Proc. Natl. Acad. s«. U, S. A. 90, 11693 - 11697.

Nichols, F.e.. Schenkcin , H.A .. Ruthe rford. R.B., 19H7. Prosta­glandin E2> prostaglandin El imd thromboxane Bl release fromhuman rnonocytcs treated with C3b or bacterial lipopolysac­char ide. Biocblm. Biophys Acta 927,149 -157.

Nusmg, R., Lesch, R., Ullrieh , v., 1990. Immuno histochemicallocalization of thromboxane synthase in human tissues. Eicosa­noids 3, 53-58.

Patrignani, P., Panar,l" M.R., Grcco, A., Fusco, 0 ., Natoli, c..lacobelli. S., Cipollone, E , Ganci, A" Crcmincn. C.. MacloufJ., et al., 1994 . Biochemical and pharmacological characte r­ization of the cyclooxygenase activity of human blood prosta­glandin endoperoxide synthases. J. Pharmacol. Exp. Thcr, 271,

1705- 1112.Rcale, M., Barbacane, R.C., Frydas, S.. Anogia nakis, G., Traketcl­

lis. A., Dimitriadou . D" Vacalis. D.. Placido. Ee.• De Fazio, P"

Porreca. E., Di Fcbbo. C , Conti , P., 1996, Human recombinaminterleuk tn- I beta induces thromboxane A2 release in polymor­

phonuclear leukocytes. macrophages and platelets: effect of IL-Ir~'Ceptor antagnnist Mol. Cell. Biochern. 159. 163 -1 68.

Rcinkc, P., Dockc, W.D., Kox, w. , Zuckcrmann. H., Volk, H.D.,

1999. New developments in the immuncdiagnosis of patients inintensive care. Dtsch. Mcd. wochenschr. 124, 1527 -1 529.

R"vlmug. A.. Michie. H.R., Man,on, J.M., wane-s. J.M., Dinarello.CA" Wolft', S.M. Wilmore, D.W. 198H. Inhibition of cycro­oxygenase attenua tes the mel3h"lic response to endotoxin inhumans. Arch. Surg . 123, 162- 170.

Riendeau, D., Pcrcival, M.D., Brideau , C , Cbatlcson. S., Dubc, D..Ethier, 0_. raigueyrer, J.p.. Fricscn . R.W., Cordon. R.. Greig,G., Guay, J.. Manc ini. J.. Oucllct. M., Wong, E.. Xu. L., Bovce.S., Visco, D" Girard. Y., Prasi t. P" Zamboni, R., Rodger. I.W.,Grcsscr, M., Ford -Hutchinson , A.W.. Young, R.N., C han, C'C;2001. Etcrtcoxib (MK-0663): preclinical profile and cmnpa ri,,,nwith other agents that selectively inhibit e yc looxygena~e·2. J.Pharmacol. Exp. Ther. 296, 558 -566.

Rola-PleszCfytlski, M . 1989. Leukotricncs and the immune system.J. Lipid Medial. I, 149 -1 59.

Rola-Pleszczynski. M.. Stankova, J., 1992. Cytokinc gcne regula­tiun by PGEl • LTB4 and PAE Mcd. Inflamm. 1, 5 - 8.

Rome, L.H , Lands, W.E., 1975. Structural requ iremen ts tor time­<Jepen<lent inhibition of prostaglandin biosynth esis by anti-in­flammatory drugs. Proc. N31l. Acad . Sci. U. S , A. 72 , 4863­41;65.

Roth. G'). , Stanfcrd. N.. Majerus. P,W.. 1975. Acetyla tion ofpro,­taglandin synthase by aspirin. J'roc . Natl. Aead. Sci. U, S, A. 72,3073 -3076.

S;ulreks, v., Riutta, A. , Mucha, I., Alanko. 1.. Vapaatalo , H., 1993.Nicotine and eotinine modula te ciccsancid production in humanIeukocytes and platelet rich plasma. fur. J. Pharmacol. 248,345 -349.

Saner, A., Hartung. T.. 1994. LTD4 augment s TNF release in vivoand in vitro. Agents Actions 4 1, C I55 -CI 56.

von Aulock, S.. Boneberg. E.M., Harrung, T., 2000 , IntermittentG-CSF (fllgrastim) treatment cannot induce lymphocytosis involunteers. Chn. Pharmacol, Thcr. 68, 104,

Zangcrle, r.F., De Grootc , D., Lopes, M., Mculeman. RJ., Vrindts,Y. , Fauchet, E , Dchan.L. Jadoul. M.. Radoux. D.. Fwnchim\lIlt.P, 1992. Direct stimulat ion of cytoklnes (IL- I beta. TNF-alpha.IL--6, IL·2. IFN-gamma and GM-CSF) in whole blood: 11. Ap­plication to rheumatoid arthritis and osteoartbritis Cytokine 4.568 ~575 ,

Zheng, H.. Crowley, J.L Chan. lC., Hoffrnann, 11.. Hatheril\.J.R.. lshizaka. A.. Raffin, TA., 1990. Attenuation of tUlI10rnecros is factor-induced endot helial cell cytotoxicity and neu­troph il chemiluminescence. Am , Rev, Respir, Dis . 142 .1073 - 1078.