European Journal of Pharmacology 627 (2010) 8–15

Contents lists available at ScienceDirect

European Journal of Pharmacology

j ourna l homepage: www.e lsev ie r.com/ locate /e jphar

Molecular and Cellular Pharmacology

Demethoxycurcumin suppresses migration and invasion of MDA-MB-231 humanbreast cancer cell line

Supachai Yodkeeree a,c, Chadarat Ampasavate b, Bokyung Sung c, Bharat B. Aggarwal c, Pornngarm Limtrakul a,⁎a Deparment of Biochemistry, Faculty of Medicine, Chiang Mai University, Chiang Mai 50200, Thailandb Deparment of Pharmaceutical Science, Faculty of Pharmacy, Chiang Mai University, Chiang Mai 50200, Thailandc Cytokine Research Laboratory, Department of Experimental Therapeutics, The University of Texas M.D. Anderson Cancer Center, Houston, Texas 77030, USA

⁎ Corresponding author. Tel.: +66 053 945323; fax: +E-mail address: plimtrak@mail.med.cmu.ac.th (P. Lim

0014-2999/$ – see front matter © 2009 Elsevier B.V. Adoi:10.1016/j.ejphar.2009.09.052

a b s t r a c t

a r t i c l e i n f o

Article history:Received 15 May 2009Received in revised form 11 September 2009Accepted 28 September 2009Available online 7 October 2009

Keywords:CurcuminoidsDemethoxycurcuminMatrix metalloproteinases (MMPs)Urokinase plasminogen activator (uPA)Nuclear factor-kappa B (NF-κB)Cancer invasion

Demethoxycurcumin (DMC) is one of the main active compounds of curcuminoids found in turmeric powder,which is used as a spice in Asian cooking and traditional medicine. Recent studies reveal that DMC has severalbiological activities including anti-inflammation and anti-cancer activities. However, the molecular mechanismby which DMC has anti-metastasis activity in breast cancer cells remains poorly understood. Here, we report forthefirst time thatDMC inhibitedadhesion,migrationand invasionofMDA-MB-231humanbreast cancer cells. Forcancer cellmigration and invasion, extracellularmatrix (ECM) degradation processes are required.MDA-MB-231cells treated with DMC had decreased levels of ECM degradation-associated proteins including matrixmetalloproteinase-9 (MMP-9), membrane type-1 matrix metalloproteinase (MT1-MMP), urokinase plasmino-gen activator (uPA) and uPA receptor (uPAR), while the level of uPA inhibitor (PAI-1) was up-regulated.Moreover, DMC also reduced the expression of intercellular adhesion molecule-1 (ICAM-1) and chemokinereceptor 4, (CXCR4), which is involved in modulation of the tumor metastasis process. We also found that DMCtreatment inhibited the DNA binding activity of nuclear factor-kappa B (NF-κB), which is known to mediate theexpressionofMMPs, uPA, uPAR, ICAM-1, andCXCR4. Thesefindings strongly suggest that themechanismofDMC-mediated anti-invasive activity involvesmodulation of the expression of invasion-associatedproteins, possibly bytargeting NF-κB in MDA-MB-231 cells.

66 053 894031.trakul).

ll rights reserved.

© 2009 Elsevier B.V. All rights reserved.

1. Introduction

Cancer invasion and metastasis are the leading causes of mortalityin patients with breast cancer. Tumormetastasis consists of a complexcascade of events, including cell adhesion, invasion, and angiogenesis(Cavallaro and Christofori, 2001). Degradation of the extracellularmatrix (ECM) by proteolytic enzymes is a crucial step in tumormetastasis. Among these enzymes, matrix metalloproteinase (MMPs)and urokinase plasminogen activator (uPA) play a key role indegrading components of the ECM (Liotta et al., 1980).

Many reports have demonstrated that uPA plays an importancerole in tumor metastasis and over-expression of uPA in breast canceris a strong indicator of a poor prognosis (Bertrand et al., 2002; Looket al., 2002). The uPA system consists of uPA, its receptor uPAR and itsinhibitor, plasminogen inhibitor type 1 and type 2 (PAI-1 and -2).Upon binding of uPA and uPAR, active uPA converts plasminogen tothe active serine protease plasmin (Dano et al., 1999), which isinvolved in the degradation of the ECM. Moreover, the binding of uPAto uPAR also generates signal transduction that allows enhanced cell

migration (Tang andWei, 2008). MMPs are amultigene family of zinc-dependent endopeptidases capable of degrading essentially all ECMcomponents. In breast cancer, up-regulation of several MMPs, such asMMP-2, -3, -7, -13 and MT1-MMP, is generally associated with breastcancer metastasis (Balduyck et al., 2000; Mylona et al., 2007).Therefore, to regulate the expression of ECM degradation enzymesare considered as a target for therapeutic intervention.

Nuclear factor κB (NF-κB), a transcription factor, plays an importantrole in carcinogenesis as well as in the regulation of inflammatoryresponses. Several genes involved in tumor metastasis have beenidentified as being regulated by NF-κB. A recent study reported thatNF-κB promotes migration andmetastasis of breast cancer cells throughup-regulationof the chemokine receptor, CXCR4(Helbig et al., 2003), andadhesive molecule, ICAM-1 (Lerebours et al., 2008). Moreover, over-expression of MMPs and uPA is also regulated by NF-κB (Connelly et al.,2007; Sliva et al., 2002). The frequent over-expression of NF-κB in tumorcells suggests that selected tumor cellsmay acquiremetastatic activity byaberrant expression of metastasis relevant genes during theirprogression.

Demethoxycurcumin (DMC) is a natural phenolic compound foundin the rhizome of many Curcuma species such as, C. longa linn,C. aromatica and C. phaeocaulis (Zhang et al., 2008a). Generally, therhizome of these species is utilized as a spice, flavoring agent, and in

9S. Yodkeeree et al. / European Journal of Pharmacology 627 (2010) 8–15

traditional medicine. DMC is a structural analog of curcumin and showsalmost the same biological effect as curcumin, such as anti-oxidative(Suzuki et al., 2005), anti-inflammatory (Huang et al., 1995) and anti-angiogenesis (Kimet al., 2002) activities.However, inhibition byDMCofthe induction ofmigration and invasion inhumanbreast cancer cells hasnot been reported and little is known about the molecular mechanismsof its anti-metastasis effects.

In this study, the effect of DMC on the invasion and motility ofMDA-MB-231 cells was investigated by looking at the impact of DMCon ECM degradation-associated proteins, including uPA, uPAR, PAI-1,MMP-9, MT1-MMP, adhesive molecule ICAM-1, cytokine receptorCXCR4, and transcription factors NF-κB, in order to understand themechanisms of its anti-metastasis effect.

2. Materials and methods

2.1. Chemicals

Dulbecco'sModifiedEagle'sMedium(DMEM)withorwithoutphenolred, penicillin–streptomycin, trypsin–EDTAwere purchased fromGIBCO-BRL (Grand island, NY, USA). Fetal bovine serum (FBS) was purchasedfrom Hyclone (Logan, Utah, USA). Plasminogen, gelatin, laminin, caseinand 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide(MTT) were purchased from Sigma-Aldrich (St. Louis, MO, USA).Fibronectin and antibodies against MT1-MMP and PAI-1were purchasedfrom Chemicon (Chemicon international, Euromedex, France). Anti-bodies against uPA, uPAR, p65, ICAM-1, CXCR-4 and poly (ADP-ribose)polymerase (PARP) were purchased from Santa Cruz Biotechnology(Santa Cruz, CA, USA). Matrigel was purchased from Becton Dickinson(Bedford, MA, USA). DMC was purified from the rhizome of C. longa linnaccording to theprocedureoutlined inaprevious report (Yodkeereeet al.,2009).

2.2. Cell lines

MDA-MB-231humanbreast cancer cells andNIH3T3fibroblastsweregrown in DMEM supplemented with 100U/ml penicillin, 100 μg/mlstreptomycin, and10%heat-inactivated FBS. Culturesweremaintained at37 °C in a 5% CO2/95% air atmosphere.

2.3. MTT assay for cell viability

Cell viability was measured with the conventional MTT reductionassay, as described previously with slight modification (Mosmann,1983). Briefly,MDA-MB-231 cellswere inoculated at a density of 5×103

cells/well in 96-well plates for 24 h, in 200 μl of DMEM with 10% FCS.Then culture supernatant was removed and DMEM containing variousconcentrations of DMC was added and incubated for 24 h. MTT dye(15 μl, 5 mg/ml) was added and the plate was incubated for anadditional 4 h. The absorbance of MTT-formazan was measured, usinga microplate reader, at 540 nmwith a reference wavelength of 630 nm.

2.4. Cell invasion assay

The invasive behavior of MDA-MB-231 cells was tested using themodified Boyden chamber assay as described previously (Yodkeereeet al., 2009). Briefly, polyvinylpyrrolidone-free polycarbonate filters(Millipore) (8 μM pore size) were coated with matrigel (15 μg/filter).The medium in the lower chamber contained serum-free cultureconditioned medium of NIH 3T3 fibroblast cells, which acts as achemoattractant. MDA-MB-231 cells (1.5×105 cells/chamber) wereplated into theupper chamberwithorwithoutvarious concentrationsofDMC and incubated for 8 h at 37 °C, 5% CO2. After incubation, the non-invading cells were removed from the upper surface of the membrane.The invading cells on the lower surface of the membrane were fixedwith methanol for 1 min, stained with toluidine blue for 5 min and

washed 3 times with water. The cells that had actively migrated to theunder surface of the filter were dissolved with 20% acetic acid andindirectly quantitated by measuring the absorbance at 570 nm. Controlexperiment was performed in the absence of a chemoattractant.The results of three independent experiments were averaged aftersubstraction of background.

2.5. Wound healing motility assay

MDA-MB-231 cells were plated in 12-well plates at 3×105 cell/well and cultured in medium containing 10% FBS to near confluence ofthe cell monolayer. The cells were carefully wounded using a yellowpipette tip, and cellular debris was removed by washing with DMEM.The wounded monolayer was incubated with or without DMC (1, 7.5and 15 μM) for 24 h in DMEM serum-free medium. Cell migration intothe wound area was photographed under phase-contrast microscopy.

2.6. Cell adhesion assay

The cell adhesion assay was performed using a slight modificationof a method described previously (Yodkeeree et al., 2008). Briefly, the96-well plates were coated with 50 μg/ml, 100μl/well of matrigel,20 μg/ml, 100 μl/well of fibronectin, 20 μg/ml, 100 μl/well of lamininand incubated for 16 h at 4 °C. Nonspecific binding sites were blockedwith 0.1% bovine serum albumin (BSA) for 1 h at 4 °C, followed bywashing three times with phosphate-buffered saline (PBS). The cellswere incubated with or without DMC (1, 7.5 and 15 μM) for 24 hbefore seeding. The treated cells was trypsinized and resuspensed inDMEM serum-free medium; 30,000 cells/well were added to eachcoated well. The cells were incubated at 37 °C for 1 h and the non-adherent cells were removed by shaking the plate at 500 g for 30 s andwashing with DMEM 3 times. The cells were fixed with 4%paraformaldehyde for 15 min and stained with 0.5%w/v crystal violetin 20% methanol for 10 min. Unbound dye was removed in tap waterand the plate was dried in air. Bound dye was extracted with 20%acetic acid. The absorbance of the samples was measured at 570 nm,using a microplate reader.

2.7. Zymography

The uPA secretion in culture conditioned mediumwas examined bymeans of casein-plasminogen zymography (Yodkeeree et al., 2008).MDA-MB-231 (5×105 cells/well) were seeded into 6-well plates andmaintained for 24 h in DMEM with 10% FBS. Subconfluent cell cultureswere incubated for 24 h with various concentrations of DMC in DMEMserum-free medium, and the culture supernatants were collected froman equal number of cells. The culture supernatant was separated byelectrophoresis on 10% PAGE copolymerized with 1 mg/ml of β-caseinand10 μg/mlhumanplasminogenunder non-reducing conditions. Afterelectrophoresis, the gel waswashed 2 times for 30 minwith 2.5% TritonX 100 and incubated for 18 h at 37 °C in Tris buffer (50 mM Tris–HCl,200 mMNaCl, 10 mMCaCl2, pH 7.4). Gels were stained with CoomassieBrillant Blue R (0.1%w/v) and destained in 30% methanol, 10% aceticacid. uPA activity appeared as a clear band against a blue background.Digestion bands were quantitated by Bio 1D software (Viber Lourmat).

The secretion of MMP-9 into culture medium was assayed bygelatin zymography. The culture supernatant was collected fromtreated cells. Without heating and under non-reducing conditions, thesample underwent electrophoresis on 0.1% w/v gelatin-containing10% polyacrylamide gels (PAGE) in the presence of SDS. Afterelectrophoresis, the gel was washed 2 times for 30 min with 2.5%Triton X 100 and incubated for 18 h at 37 °C in Tris buffer (50 mMTris–HCl, 200 mM Nacl, 10 mM CaCl2, pH 7.4). Gels were stained anddestained as described above.

10 S. Yodkeeree et al. / European Journal of Pharmacology 627 (2010) 8–15

2.8. Preparation of whole-cell lysates, cytoplasm and nucleus extract

Whole-cell extraction was used to determine the expression ofuPA, uPAR, PAI-1, MT1-MMP, ICAM-1 and CXCR-4 in MDA-MB-231cells. Briefly, the cells were seeded at 5×105 cells/well into 6-wellplates and incubated for 24 h in DMEM containing 10% FBS. Cells weretreated with various concentrations of DMC in DMEM serum-freemedium for 24 h. Treated cells were extracted by incubation for20 min on ice with lysis buffer (20 mM HEPES, pH 7.4, 2 mM EDTA,250 mM NaCl, 0.1% Nonidet P-40, 2 µg/ml leupeptin, 2 µg/mlaprotinin, and 1 mM phenylmethylsulfonyl fluoride). The cell lysatewas centrifuged, and the supernatant was collected.

The nucleus and cytoplasm extracts were used to determine thetranslocation of p65 (NF-κB) from cytosol to nucleus. Moreover,the nucleus extract was used to investigate NF-κB DNA binding activity.The cells were treated with various concentrations of DMC for 8 h andwere then washed with ice-cold PBS and suspended in 100 μl of lysisbuffer (10 mMHEPES, pH7.9, 10 mMKC1, 0.1 mMEDTA, 0.1 mMEGTA,1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 2 μg/mlleupeptin, 2 μg/ml aprotinin, and 0.5 mg/ml benzamidine). The cellswere allowed to swell on ice for 15 min, after which 5 μl of 10% NonidetP-40 was added. The tubes were then agitated on a vortex for 5 s andthen centrifuged for 30 s; the supernatant represents the cytosolicextract, and the nuclear pellets were resuspended in 25 μl of ice-coldnuclear extraction buffer (20 mM HEPES, pH 7.9, 0.4 M NaCl, 1 mMEDTA, 1 mM EGTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonylfluoride, 2.0 pg/ml leupeptin, 2.0 μg/ml aprotinin, and 0.5 mg/mlbenzamidine), and the tubes were incubated on ice for 30 min withintermittent vortexing. This nuclear extract was then microcentrifugedfor 12 min at 14,000g; the supernatant represents the nuclear fraction.

2.9. Western blot analysis

To determine the levels of protein expression, we prepared whole-cell lysate, nuclear and cytosolic extracts and separated them by SDS-PAGE. After electrophoresis, proteins were electroblotted to aHybond-C Extra nitrocellulose membrane (Amersham Biosciences),blotted with the appropriate antibodies, and detected by enhancedchemiluminescence (thermoscientific) and exposure to an x-ray film(Kodak) for 1 up to 30 min.

Fig. 1. Effect of DMC on invasion and migration of MDA-MB-231 cells. (A) MDA-MB-231 ceconcentrations (0–15 μM) for the cell invasion assay and incubated for 8 h in 37 °C. The cellSection 2. (B) For the cell migration assay, confluent cultures of MDA-MB-231 cells were woumedium with or without DMC for 24 h. Cells were photographed under phase-contrast micrexperiments. Sample groups were significantly different from the control group (⁎⁎P<0.01

2.10. Electrophoreticmobility shift assay (EMSA) of nuclear NF-κB andAP-1

DNA binding activity of activator protein-1 (AP-1) and NF-κB inMDA-MB-231 cells was assessed by EMSA as described (Manna et al.,1998). Briefly, nuclear extracts prepared from the cells treated withDMC were incubated with 32P-end-labeled, 45mer double-strandedNF-κB oligonucleotides (15 μg of protein with 16 fmol of DNA) fromthe human immunodeficiency virus long terminal repeat (5′TTGTTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAG GCGTGG-3′, boldfaceindicates NF-κB-binding sites) or incubated with 32P-end-labeledAP-1 consensus oligonucleotide (5′-CGCTTGATGACTCAGCCGGAA-3′boldface indicatesAP-1binding sites) (SantaCruzBiotechnology, Inc) for30 min at 37 °C. The DNA–protein complex formed was separated fromfree oligonucleotide on 6.6% native polyacrylamide gels. The dried gelswere visualized, and radioactive bandswere quantifiedwith a PhosphorImager (Amersham Biosciences) using an ImageQuant software.

2.11. Statistical analysis

Statistical analyses were performed using one-way ANOVA. P<0.05or P<0.01was considered statistically significant. All comparisonsweremade relative to untreated controls and significance of differences isindicated as ⁎P<0.05 and ⁎⁎P<0.01. All statistical analyses wereperformed using SPSS 10.0 software.

3. Results

3.1. DMC inhibits invasion and motility of MDA-MB-231 cells

During the migration phase of metastasis, breast cancer cells mustpass through the ECM. To evaluate whether DMC exerts effects on theinvasive behavior of cancer cells, we measured the invasive ability ofcells by using a matrigel-coated membrane. As shown in Fig. 1A,treatment of the cells with DMC resulted in a significant inhibition ofMDA-MB-231 cell invasion pass through the matrigel with an IC50 of9 μM. Moreover, incubation of MDA-MB-231 cells with increasingconcentrations of DMC led to a concentrationdependent decrease in thenumber of migrating cells into the wound area (Fig. 1B). It has to benoted that the cell invasion andmigration assaywere performedwith anon-cytotoxic concentration of DMC. The effect of DMC on cell viability

lls were seeded onto a matrigel-coated filter containing DMC at the various indicateds that actively migrated to the lower surface of filters were quantitated as described innded by scratching with a pipette tip and the cells were incubated in DMEM serum-freeoscopy. The data for the invasion assay represent the mean±S.D. of three independent).

11S. Yodkeeree et al. / European Journal of Pharmacology 627 (2010) 8–15

was determined byMTT assay. The non-cytotoxic concentration of DMCthat resulted in >80% cell survival is below 20 μM(data not show). Thisconcentration was used in all subsequent experiments.

3.2. DMC reduced MDA-MB-231 cell adhesion to matrigel, fibronectinand laminin

The adhesion of cancer cells to ECM molecules is the first step oftumor cell invasion. To determinewhether DMC inhibitedMDA-MB-231attachment to matrigel, fibronectin and laminin, a cell adhesion assaywas performed. The result showed that treatment of the cells with DMCat 15 μM for 24 h significantly reduced cell attachment to matrigel,fibronectin and laminin by 25%, 21%, and 44% respectively, whencompared with the vehicle control (Fig. 2).

3.3. Effect of DMC on expression of ECM degradation-associated protein

Since over-expression and activation of MMPs and the uPA/uPAR/PAI-1 system play an important role in breast cancer cell invasion bystimulating degradation of the ECM and cell migration, we determined

Fig. 2. Effect of DMC on the adhesion of MDA-MB-231 cells to ECM molecules. Matrigel, fibroblocked with BSA for 1 h at 4 °C. MDA-MB-231 cells treated with the indicated concentraincubation, non-coated cells were removed, and adherent cells were stained using crystal viand absorbance was measured at 570 nm. Cancer cell adhesion is presented as a percenexperiments. Sample groups were significantly different from the control group (⁎P<0.05)

whether the anti-invasive activity of DMC was correlated withregulation of the uPA/uPAR/PAI-1 system, MMP-9, and MT1-MMPexpression. As shown in Fig. 3A, DMC treatment significantly reduceduPA, uPAR and MT1-MMP expressions in a dose-dependent manner,with an IC50 of 10, 13 and 15 μM respectively, while the level of PAI-1,a specific endogenous inhibitor of uPA, was increased by DMC in a dos -dependent manner. Moreover, the result of the zymography assayshowed that DMC reduced uPA and MMP-9 secretions from MDA-MB-231 cells in a dose-dependent manner, with an IC50 of 11 and 13 μM,respectively (Fig. 3B and C).

3.4. Effect of DMC on ICAM-1 and CXCR4 expressions

To investigate whether DMC can inhibit the expression of theadhesive molecule, ICAM-1, and CXCR4, the chemokine receptor thatmediates the homing of cancer cells to a specific organ, MDA-MB-231cells were treated with various concentrations of DMC for 24 h andthe levels of ICAM-1 and CXCR-4 were determined by Western blotanalysis. As shown in Fig. 4A, ICAM-1 protein expression was reduced

nectin, or laminin was coated onto the surface of 96-well plates. The coated wells weretion of DMC for 24 h were collected and added to the ECM-coated plate. After 1 h ofolet staining. After extensive washing, the stained cells were lysed with 10% acetic acid,tage of untreated control. The data represent the mean±S.D. of three independent.

Fig. 3. Analysis the level of ECM degradation-associated proteins inMDA-MB-231 cells treated with DMC. The cells were treated with various concentrations of DMC for 24 h. The celllysate was prepared and used to analyze the level of uPA, uPAR, PAI-1 and MT1-MMP expressions usingWestern blot analysis (A). The conditioned mediumwas used to analyze thesecretion of uPA (B) andMMP-9 (C) from cells, using zymography assay. The intensity of protein bands was quantified by densitometry, where the untreated group represents 100%.The data represent the mean±S.D. of three independent experiments. Sample groups were significantly different from the control group (⁎P<0.05 and ⁎⁎P<0.01).

12 S. Yodkeeree et al. / European Journal of Pharmacology 627 (2010) 8–15

in DMC-treated cells in a dose-dependent manner. Moreover, DMC at20 μM also reduced the expression of CXCR4 (Fig. 4B).

3.5. DMC reduced DNA binding activity of NF-κB in MDA-MB-231 cells

The expression of MMPs and uPA genes is regulated by NF-κB andAP-1 transcription factors. To clarify the involvement of NF-κB and AP-1protein in the mechanism of DMC action, MDA-MB-231 cells weretreated with various concentrations of DMC. The nuclear extract was

Fig. 4. Effect of DMC on the expression of ICAM-1 and CXCR4 in MDA-MB-231 cells. The ceprepared, equal amounts of proteins were loaded and β-actin was used as protein loadingintensity of protein bands was quantified by densitometry, where the untreated group rep

analyzed byEMSA forNF-κB andAP-1DNAbinding activity. As shown inFig. 5A, DMC strongly inhibited NF-κBDNAbinding activity, with an IC50of 12 μM but slightly decreased AP-1 binding activity at a high dose;however, there were no significant differences (Fig. 5B). Further, theexpression of p65 (NF-κB) in nuclear and cytoplasmic extracts wasanalyzed byWestern blot to assess the possible inhibitory effect of DMCon NF-κB translocation from cytoplasm to nucleus. The result showedreduced levels of p65 in the nucleus but not cytosol of the cells treatedwith DMC in a dose-dependent manner (Fig. 6A and B).

lls were treated with the indicated concentrations of DMC for 24 h. The cell lysate wascontrol. The level of ICAM-1expressions was determined by Western blot analysis. Theresents 100%.

Fig. 5. Inhibition by DMC of the binding activity of NF-κB. MDA-MB-231 cells were treated with the indicated concentration of DMC for 8 h, and then nuclear extracts were preparedand analyzed for NF-κB binding activity, using 32P-labeled NF-κB specific oligonucleotide as described in the Section 2. The intensity of NF-κB binding activity was quantified bydensitometry, where the untreated group represents 100%. Data from a typical experiment are depicted and similar results were obtained in additional two independentexperiments.

13S. Yodkeeree et al. / European Journal of Pharmacology 627 (2010) 8–15

4. Discussion

Natural curcuminoids have been used as a chemopreventive agentfor a wide variety of cancers, including colon, pancreatic and breastcancers (Kunnumakkara et al., 2008). Several studies have shown thatthree forms of curcuminoids have similar biological activities butdifferent potency. Interestingly, in some cases, DMC showed the highestpotency of the three forms of curcuminoids, having antiproliferativeactivity against MCF-7 breast carcinoma cells (Simon et al., 1998),nematocidal activity (Kiuchi et al., 1993), and the ability to decreasenitric oxideproduction, and to causedownregulation of COX-2 and iNOSexpression (Zhang et al., 2008b). Moreover, we have found thatDMC inhibits HT1080 cell invasion with higher potency than curcuminbut not significantly different from that of bisdemethoxycurcumin(Yodkeeree et al., 2009). Although, the anti-invasive property of DMChas been reported, there is no direct evidence to show that DMC exertsan effect on the development of breast cancer metastasis.

Tumor invasion and metastasis are multistep and complexprocesses that include cell adhesion, proteolytic degradation ofECM, cell migration to basement membranes to reach the circulatorysystem, and remigration and growth of tumor at the metastatic site

Fig. 6. Effect of DMC on the translocation of NF-κB from cytoplasm to nucleus.MDA-MB-cytoplasmic extracts were prepared and subjected to SDS-PAGE, followed by Western blot wprotein loading controls, respectively. The intensity of protein bandswas quantified by densitdepicted and similar results were obtained in additional two independent experiments.

(Chambers et al., 2002). Hence, interruption of one or more of thesesteps is one approach for anti-metastatic therapy. The present study isthe first to demonstrate that DMC at a non-cytotoxic dose significantlyinhibits MDA-MB-231 cell invasion through the basement membrane(Fig. 1). Moreover, DMC also reduced the cell motility which is neededfor migration from the primary site to a secondary site.

The initial invasive action of metastatic cells involves the interactionof tumor with the ECM molecules through the process of cell matrixadhesion, which enhances the survival or invasiveness of tumor cells(Bogenrieder and Herlyn, 2003; Luo et al., 2007). Laminin, fibronectinand type IV collagen are principal components of the ECM (Pignatelliand Stamp, 1995). The results from our cell adhesion assay showed thatDMC significantly reduced cell adhesion to matrigel (basementmembrane), fibronectin and laminin, compared to the control group(Fig. 2). This result reveals that DMC can inhibit the invasion of MDA-MB-231 cells by reducing cell adherence to the basement membrane.

The invasive phenomenon of cancer cells depends on thecombined action of several ECM degradation enzymes. Several reportsdemonstrated that high levels of uPA (Meijer-van Gelder et al., 2004)and MMP (Delassus et al., 2008) expressions correlate with theinvasive capacity of breast cancer cells. Moreover, these enzymes are

231 cells were treated with the indicated concentration of DMC for 8 h. Nuclear andith anti-p65 (NF-κB) antibody. β-actin and PAPR were used as cytoplasm and nucleusometry, where the untreated group represents 100%. Data from a typical experiment are

14 S. Yodkeeree et al. / European Journal of Pharmacology 627 (2010) 8–15

highly expressed in aggressive breast tumors and are associated withclinical outcome (Duffy, 2002). Therefore, controlling the activity orthe expression of ECM degradation enzymes is considered atherapeutic target for breast cancer. To further explore the exactmechanism of inhibition of invasion induced by DMC, we examinedthe effect of DMC on the expression of ECM degradation enzymes.Western blot analysis showed that DMC reduced the proteinexpression of uPA, uPAR and MT1-MMP while the level of PAI-1, thephysiological uPA inhibitor, was enhanced. Moreover, the secretion ofuPA and MMP-9 from MDA-MB-231 cells was decreased (Fig. 3).These data collectively support the inhibitory effect of DMC on cancerinvasion via reduced ECM degradation.

Recently, elevated expression of ICAM-1 has been reported in lung(Yasuda et al., 2001), gastric (Maruo et al., 2002), and breast cancertissues (Rosette et al., 2005), with highest levels in samples frompatientswithmetastasis. Interestingly, down-regulated ICAM-1 expres-sion can reducebreast cancer cell invasionandmetastasis. In thepresentstudy, DMC inhibited the expression of ICAM-1 inMDA-MB-231 cells ina dose-dependent manner. Moreover, the effect of DMC on theexpression of the chemokine receptor, CXCR4 was also determined.The expression of CXCR4 has been reported to be high in breast cancerand mediates the directional homing of primary breast cancer cells to asecondary organ site (Schmid et al., 2004). Our data revealed that a highconcentration of DMC reduced the level of CXCR4 expression in MDA-MB-231 cells.

NF-κB transcription factor is constitutively activated in manycancers, including breast cancer, and has been shown to contribute tothe development and progression of tumors (Nakshatri et al., 1997).Many studies have shown that inhibition of NF-κB activity couldsuppress angiogenesis, invasion and metastasis by down regulatingthe expression of NF-κB downstream target genes, such as VEGF(Rhode et al., 2007), uPA (Jiang et al., 2004), uPAR (Chang et al., 2007),MMP-9 (Pandey et al., 2008), COX-2 (Sharma et al., 2006), ICAM-1(Sung et al., 2008) and CXCR4 (Helbig et al., 2003). A commonlyknown NF-κB consists of a p50/p65 heterodimer. NF-κB is retained inthe cytoplasm in an inactive form, bound by an inhibitory proteincalled inhibitor of κB (IκB) in most resting cells. The activation of NF-κB occurs as it is transported from the cytoplasm to the nucleus uponthe degradation of the inhibitory subunit. In the nucleus, NF-κB bindsto cognate sequence in the promoter region of many target genes.Therefore, NF-κB DNA binding activity is a hallmark for its activation.Here, we found that treatment with DMC of MDA-MB-231 cellsresulted in inhibition of NF-κB DNA binding activity in a dose-dependent manner, although it only slightly inhibited AP-1 at a highdose (Fig. 5). Moreover, the translocation of NF-κB from cytoplasm tonucleus was inhibited by DMC (Fig. 6). These results are comparablewith MMP-9, MT1-MMP, uPA, uPAR and adhesion molecule expres-sions and they are also in agreement with an earlier report of theinhibition of NF-κB by DMC in macrophage and leukemia cells.

Curcumin, the parent structure of DMC, has been reported to haveanti-metastatic properties in vitro and in vivo (Hong et al., 2006), but itspharmacokinetic features have indicated a poor systemic bioavaibility,whichmay be related to its inadequate absorption, avidmetabolismandpoor stability (Sharma et al., 2004; Wang et al., 1997). Commerciallyavailable curcuminoids used for nutritional supplements contain 77%curcumin, 20% demethoxycurcumin and 3% bisdemethoxycurcumin(Limtrakul et al., 2004). A recent study reported thatDMC ismore stablethan curcumin (Han et al., 2008b). Moreover, stability of curcumin isimproved by DMC (Han et al., 2008a). Our findings indicated that DMChas a higher potency than curcumin in reducing MDA-MB-231 cellinvasion (data not shown). These data suggest that DMC may have asynergistic effectwith curcuminwith regard to thepharmacological andbiological activity of curcuminoids.

In conclusion, our data indicate that DMC is able to inhibit adhesion,migration and invasion of MDA-MB-231 human breast cancer cells.Characterization of the detailed mechanism of the inhibitory effect of

DMC revealed a reducedexpression of invasion-associatedproteinsdue,in part, to reduce NF-κB activation. The results provide a theoreticalfoundation for the possibility of DMC as a potential agent for thetreatment of breast cancer metastasis.

Acknowledgments

This work was supported by grants from the National ResearchCouncil of Thailand and the Royal Golden Jubilee Ph.D. Program ofThailand.

References

Balduyck, M., Zerimech, F., Gouyer, V., Lemaire, R., Hemon, B., Grard, G., Thiebaut, C.,Lemaire, V., Dacquembronne, E., Duhem, T., Lebrun, A., Dejonghe, M.J., Huet, G.,2000. Specific expression of matrix metalloproteinases 1, 3, 9 and 13 associatedwith invasiveness of breast cancer cells in vitro. Clin. Exp. Metastasis 18, 171–178.

Bertrand, J.R., Pottier, M., Vekris, A., Opolon, P., Maksimenko, A., Malvy, C., 2002.Comparison of antisense oligonucleotides and siRNAs in cell culture and in vivo.Biochem. Biophys. Res. Commun. 296, 1000–1004.

Bogenrieder, T., Herlyn, M., 2003. Axis of evil: molecular mechanisms of cancermetastasis. Oncogene 22, 6524–6536.

Cavallaro, U., Christofori, G., 2001. Cell adhesion in tumor invasion and metastasis: lossof the glue is not enough. Biochim. Biophys. Acta 1552, 39–45.

Chambers, A.F., Groom, A.C., MacDonald, I.C., 2002. Dissemination and growth of cancercells in metastatic sites. Nat. Rev. Cancer 2, 563–572.

Chang, H.J., Kim, M.H., Baek, M.K., Park, J.S., Chung, I.J., Shin, B.A., Ahn, B.W., Jung, Y.D.,2007. Triptolide inhibits tumor promoter-induced uPAR expression via blockingNF-kappaB signaling in human gastric AGS cells. Anticancer Res. 27, 3411–3417.

Connelly, L., Robinson-Benion, C., Chont, M., Saint-Jean, L., Li, H., Polosukhin, V.V.,Blackwell, T.S., Yull, F.E., 2007. A transgenic model reveals important roles for theNF-kappa B alternative pathway (p100/p52) in mammary development and linksto tumorigenesis. J. Biol. Chem. 282, 10028–10035.

Dano, K., Romer, J., Nielsen, B.S., Bjorn, S., Pyke, C., Rygaard, J., Lund, L.R., 1999. Cancerinvasion and tissue remodeling—cooperation of protease systems and cell types.APMIS 107, 120–127.

Delassus, G.S., Cho, H., Park, J., Eliceiri, G.L., 2008. New pathway links from cancer-progression determinants to gene expression of matrix metalloproteinases inbreast cancer cells. J. Cell Physiol. 217, 739–744.

Duffy, M.J., 2002. Urokinase plasminogen activator and its inhibitor, PAI-1, as prognosticmarkers in breast cancer: from pilot to level 1 evidence studies. Clin. Chem. 48,1194–1197.

Han, G., Bi, R., Le, Q., Zhao, L.L., Dong, Y., Lin, Q.H., 2008a. Study on effect ofdemethoxycurcumin in Curcuma long on stability of curcumin. Zhong Yao Cai 31,592–594.

Han, G., Cui, J.J., Bi, R., Zhao, L.L., Zhang, W.G., 2008b. Study on stability of curcumine,demethoxycurcumin and bisdemethoxycurcumin. Zhongguo Zhong Yao Za Zhi 33,2611–2614.

Helbig, G., Christopherson 2nd, K.W., Bhat-Nakshatri, P., Kumar, S., Kishimoto, H.,Miller, K.D., Broxmeyer, H.E., Nakshatri, H., 2003. NF-kappaB promotes breastcancer cell migration and metastasis by inducing the expression of the chemokinereceptor CXCR4. J. Biol. Chem. 278, 21631–21638.

Hong, J.H., Ahn, K.S., Bae, E., Jeon, S.S., Choi, H.Y., 2006. The effects of curcumin on theinvasiveness of prostate cancer in vitro and in vivo. Prostate Cancer Prostatic Dis. 9,147–152.

Huang,M.T.,Ma,W., Lu, Y.P., Chang, R.L., Fisher, C.,Manchand, P.S., Newmark, H.L., Conney,A.H., 1995. Effects of curcumin, demethoxycurcumin, bisdemethoxycurcumin andtetrahydrocurcumin on 12-O-tetradecanoylphorbol-13-acetate-induced tumor pro-motion. Carcinogenesis 16, 2493–2497.

Jiang, J., Slivova, V., Valachovicova, T., Harvey, K., Sliva, D., 2004. Ganoderma luciduminhibits proliferation and induces apoptosis in human prostate cancer cells PC-3.Int. J. Oncol. 24, 1093–1099.

Kim, J.H., Shim, J.S., Lee, S.K., Kim, K.W., Rha, S.Y., Chung, H.C., Kwon, H.J., 2002.Microarray-based analysis of anti-angiogenic activity of demethoxycurcumin onhuman umbilical vein endothelial cells: crucial involvement of the down-regulation of matrix metalloproteinase. Jpn. J. Cancer Res. 93, 1378–1385.

Kiuchi, F., Goto, Y., Sugimoto, N., Akao, N., Kondo, K., Tsuda, Y., 1993. Nematocidalactivity of turmeric: synergistic action of curcuminoids. Chem. Pharm. Bull. (Tokyo)41, 1640–1643.

Kunnumakkara, A.B., Anand, P., Aggarwal, B.B., 2008. Curcumin inhibits proliferation,invasion, angiogenesis and metastasis of different cancers through interaction withmultiple cell signaling proteins. Cancer Lett. 269, 199–225.

Lerebours, F., Vacher, S., Andrieu, C., Espie, M., Marty, M., Lidereau, R., Bieche, I., 2008. NF-kappa B genes have a major role in inflammatory breast cancer. BMC Cancer 8, 41.

Limtrakul, P., Anuchapreeda, S., Buddhasukh, D., 2004. Modulation of humanmultidrug-resistance MDR-1 gene by natural curcuminoids. BMC Cancer 4, 13.

Liotta, L.A., Tryggvason, K., Garbisa, S., Hart, I., Foltz, C.M., Shafie, S., 1980. Metastaticpotential correlates with enzymatic degradation of basement membrane collagen.Nature 284, 67–68.

Look,M.P., vanPutten,W.L.,Duffy,M.J., Harbeck,N., Christensen, I.J., Thomssen, C., Kates, R.,Spyratos, F., Ferno,M., Eppenberger-Castori, S., Sweep,C.G., Ulm, K., Peyrat, J.P.,Martin,P.M., Magdelenat, H., Brunner, N., Duggan, C., Lisboa, B.W., Bendahl, P.O., Quillien, V.,

15S. Yodkeeree et al. / European Journal of Pharmacology 627 (2010) 8–15

Daver, A., Ricolleau, G., Meijer-van Gelder, M.E., Manders, P., Fiets, W.E., Blankenstein,M.A., Broet, P., Romain, S., Daxenbichler, G., Windbichler, G., Cufer, T., Borstnar, S.,Kueng,W., Beex, L.V., Klijn, J.G., O'Higgins, N., Eppenberger, U., Janicke, F., Schmitt, M.,Foekens, J.A., 2002. Pooled analysis of prognostic impact of urokinase-typeplasminogen activator and its inhibitor PAI-1 in 8377 breast cancer patients. J. Natl.Cancer Inst. 94, 116–128.

Luo, B.H., Carman, C.V., Springer, T.A., 2007. Structural basis of integrin regulation andsignaling. Annu. Rev. Immunol. 25, 619–647.

Manna, S.K., Zhang, H.J., Yan, T., Oberley, L.W., Aggarwal, B.B., 1998. Overexpression ofmanganese superoxide dismutase suppresses tumor necrosis factor-induced apoptosisand activation of nuclear transcription factor-kappaB and activated protein-1. J. Biol.Chem. 273, 13245–13254.

Maruo, Y., Gochi, A., Kaihara, A., Shimamura, H., Yamada, T., Tanaka, N., Orita, K., 2002.ICAM-1 expression and the soluble ICAM-1 level for evaluating the metastaticpotential of gastric cancer. Int. J. Cancer 100, 486–490.

Meijer-van Gelder, M.E., Look, M.P., Peters, H.A., Schmitt, M., Brunner, N., Harbeck, N.,Klijn, J.G., Foekens, J.A., 2004. Urokinase-type plasminogen activator system inbreast cancer: association with tamoxifen therapy in recurrent disease. Cancer Res.64, 4563–4568.

Mosmann, T., 1983. Rapid colorimetric assay for cellular growth and survival:application to proliferation and cytotoxicity assays. J. Immunol. Methods 65, 55–63.

Mylona, E., Alexandrou, P., Mpakali, A., Giannopoulou, I., Liapis, G., Markaki, S.,Keramopoulos, A., Nakopoulou, L., 2007. Clinicopathological and prognosticsignificance of vascular endothelial growth factors (VEGF)-C and -D and VEGFreceptor 3 in invasive breast carcinoma. Eur. J. Surg. Oncol. 33, 294–300.

Nakshatri, H., Bhat-Nakshatri, P., Martin, D.A., Goulet Jr., R.J., Sledge Jr., G.W., 1997.Constitutive activation of NF-kappaB during progression of breast cancer tohormone-independent growth. Mol. Cell Biol. 17, 3629–3639.

Pandey, M.K., Sung, B., Kunnumakkara, A.B., Sethi, G., Chaturvedi, M.M., Aggarwal, B.B.,2008. Berberine modifies cysteine 179 of IkappaBalpha kinase, suppresses nuclearfactor-kappaB-regulated antiapoptotic gene products, and potentiates apoptosis.Cancer Res. 68, 5370–5379.

Pignatelli, M., Stamp, G., 1995. Integrins in tumour development and spread. CancerSurv. 24, 113–127.

Rhode, J., Fogoros, S., Zick, S., Wahl, H., Griffith, K.A., Huang, J., Liu, J.R., 2007. Gingerinhibits cell growth and modulates angiogenic factors in ovarian cancer cells. BMCComplement Altern. Med. 7, 44.

Rosette, C., Roth, R.B., Oeth, P., Braun, A., Kammerer, S., Ekblom, J., Denissenko, M.F.,2005. Role of ICAM1 in invasion of human breast cancer cells. Carcinogenesis 26,943–950.

Schmid, B.C., Rudas, M., Rezniczek, G.A., Leodolter, S., Zeillinger, R., 2004. CXCR4 isexpressed in ductal carcinoma in situ of the breast and in atypical ductalhyperplasia. Breast Cancer Res. Treat. 84, 247–250.

Sharma, R.A., Euden, S.A., Platton, S.L., Cooke, D.N., Shafayat, A., Hewitt, H.R., Marczylo,T.H., Morgan, B., Hemingway, D., Plummer, S.M., Pirmohamed, M., Gescher, A.J.,

Steward, W.P., 2004. Phase I clinical trial of oral curcumin: biomarkers of systemicactivity and compliance. Clin. Cancer Res. 10, 6847–6854.

Sharma, C., Kaur, J., Shishodia, S., Aggarwal, B.B., Ralhan, R., 2006. Curcumin downregulates smokeless tobacco-induced NF-kappaB activation and COX-2 expressionin human oral premalignant and cancer cells. Toxicology 228, 1–15.

Simon, A., Allais, D.P., Duroux, J.L., Basly, J.P., Durand-Fontanier, S., Delage, C., 1998.Inhibitory effect of curcuminoids on MCF-7 cell proliferation and structure–activityrelationships. Cancer Lett. 129, 111–116.

Sliva, D., Rizzo, M.T., English, D., 2002. Phosphatidylinositol 3-kinase and NF-kappaBregulate motility of invasive MDA-MB-231 human breast cancer cells by thesecretion of urokinase-type plasminogen activator. J. Biol. Chem. 277, 3150–3157.

Sung, B., Pandey, M.K., Ahn, K.S., Yi, T., Chaturvedi, M.M., Liu, M., Aggarwal, B.B., 2008.Anacardic acid (6-nonadecyl salicylic acid), an inhibitor of histone acetyltransferase,suppresses expression of nuclear factor-kappaB-regulated gene products involved incell survival, proliferation, invasion, and inflammation through inhibition of theinhibitory subunit of nuclear factor-kappaBalpha kinase, leading to potentiation ofapoptosis. Blood 111, 4880–4891.

Suzuki, M., Nakamura, T., Iyoki, S., Fujiwara, A., Watanabe, Y., Mohri, K., Isobe, K., Ono,K., Yano, S., 2005. Elucidation of anti-allergic activities of curcumin-relatedcompounds with a special reference to their anti-oxidative activities. Biol. Pharm.Bull. 28, 1438–1443.

Tang, C.H., Wei, Y., 2008. The urokinase receptor and integrins in cancer progression.Cell. Mol. Life Sci. 65, 1916–1932.

Wang, Y.J., Pan, M.H., Cheng, A.L., Lin, L.I., Ho, Y.S., Hsieh, C.Y., Lin, J.K., 1997. Stability ofcurcumin in buffer solutions and characterization of its degradation products.J. Pharm. Biomed. Anal. 15, 1867–1876.

Yasuda, M., Tanaka, Y., Tamura, M., Fujii, K., Sugaya, M., So, T., Takenoyama, M., Yasumoto,K., 2001. Stimulation of beta1 integrin down-regulates ICAM-1 expression and ICAM-1-dependent adhesion of lung cancer cells through focal adhesion kinase. Cancer Res.61, 2022–2030.

Yodkeeree, S., Garbisa, S., Limtrakul, P., 2008. Tetrahydrocurcumin inhibits HT1080 cellmigration and invasion via downregulation of MMPs and uPA. Acta Pharmacol. Sin.29, 853–860.

Yodkeeree, S., Chaiwangyen, W., Garbisa, S., Limtrakul, P., 2009. Curcumin, demethox-ycurcumin and bisdemethoxycurcumin differentially inhibit cancer cell invasionthrough the down-regulation of MMPs and uPA. J. Nutr. Biochem. 20, 87–95.

Zhang, J.S., Guan, J., Yang, F.Q., Liu, H.G., Cheng, X.J., Li, S.P., 2008a. Qualitative andquantitative analysis of four species of Curcuma rhizomes using twice developmentthin layer chromatography. J. Pharm. Biomed. Anal. 48, 1024–1028.

Zhang, L.J., Wu, C.F., Meng, X.L., Yuan, D., Cai, X.D., Wang, Q.L., Yang, J.Y., 2008b.Comparison of inhibitory potency of three different curcuminoid pigments on nitricoxide and tumor necrosis factor production of rat primary microglia induced bylipopolysaccharide. Neurosci. Lett. 447, 48–53.