Article

Cryo-EM Structure and Assembly of an Extracellular

Contractile Injection System

Graphical Abstract

Highlights

d Cryo-EM structure of an intact extracellular contractile

injection system (eCIS)

d Six heterodimers of wedge proteins constitute the hexagonal

baseplate

d A hexameric cap terminates and stabilizes the eCIS with six

stretching arms

d An assembly model for the biogenesis of the eCIS is

proposed

Jiang et al., 2019, Cell 177, 370–383April 4, 2019 ª 2019 Elsevier Inc.https://doi.org/10.1016/j.cell.2019.02.020

Authors

Feng Jiang, Ningning Li, Xia Wang, ...,

Yi-Ping Wang, Qi Jin, Ning Gao

Correspondencejinqi@ipbcams.ac.cn (Q.J.),gaon@pku.edu.cn (N.G.)

In Brief

Structures of a bacterial extracellular

contractile injection system, the

Photorhabdus virulence cassette (PVC),

reveal its assembly pathway and unique

features compared to other phage tail-

like complexes

Article

Cryo-EM Structure and Assemblyof an Extracellular Contractile Injection SystemFeng Jiang,1,6 Ningning Li,2,6 Xia Wang,1,6 Jiaxuan Cheng,2,3,6 Yaoguang Huang,4 Yun Yang,5 Jianguo Yang,5 Bin Cai,2

Yi-Ping Wang,5 Qi Jin,1,* and Ning Gao2,7,*1NHCKey Laboratory of SystemsBiology of Pathogens, Institute of PathogenBiology, Chinese AcademyofMedical Sciences & PekingUnion

Medical College, Beijing, PRC2State Key Laboratory of Membrane Biology, Peking-Tsinghua Center for Life Sciences, School of Life Sciences, Peking University,

Beijing, PRC3Tsinghua-Peking Center for Life Sciences, School of Life Sciences, Tsinghua University, Beijing, PRC4Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, University of Chinese Academy of Sciences,Shanghai, PRC5State Key Laboratory of Protein and Plant Gene Research, School of Life Sciences, Peking University, Beijing, PRC6These authors contributed equally7Lead Contact*Correspondence: jinqi@ipbcams.ac.cn (Q.J.), gaon@pku.edu.cn (N.G.)

https://doi.org/10.1016/j.cell.2019.02.020

SUMMARY

Contractile injection systems (CISs) are cell-punc-turing nanodevices that share ancestry with con-tractile tail bacteriophages. Photorhabdus virulencecassette (PVC) represents one group of extracellularCISs that are present in both bacteria and archaea.Here, we report the cryo-EM structure of an intactPVC from P. asymbiotica. This over 10-MDa deviceresembles a simplified T4 phage tail, containinga hexagonal baseplate complex with six fibers anda capped 117-nanometer sheath-tube trunk. Onedistinct feature of the PVC is the presence of threevariants for both tube and sheath proteins, indicatinga functional specialization of them during evolution.The terminal hexameric cap docks onto the topmostlayer of the inner tube and locks the outer sheath inpre-contraction state with six stretching arms. Ourresults on the PVC provide a framework for under-standing the general mechanism of widespreadCISs and pave the way for using them as deliverytools in biological or therapeutic applications.

INTRODUCTION

Contractile injection systems (CISs) are a collection of diverse,

but evolutionarily related, macromolecular devices that make

use of contractile sheath-tube assembly for delivering nucleic

acid and protein substrates (Taylor et al., 2018). Typical CISs,

such as those contractile tails of bacteriophage T4, P2, and

Mu, have been studied intensively for several decades to inves-

tigate their structure, assembly, and mechanism (Buttner et al.,

2016; Leiman and Shneider, 2012). In addition to contractile

phages, phage-tail-like CISs are also universally present in bac-

teria to mediate inter-cell communications and to exert cellular

defense (Cascales, 2017; Taylor et al., 2018). One such example

370 Cell 177, 370–383, April 4, 2019 ª 2019 Elsevier Inc.

is the well-studied type VI secretion system (T6SS), which spans

both the inner and outer membrane of Gram-negative bacteria

and injects effectors from the cytoplasm (Basler, 2015; Basler

and Mekalanos, 2012; Brackmann et al., 2017; Chassaing and

Cascales, 2018; Cianfanelli et al., 2015; Garcıa-Bayona and

Comstock, 2018; Hachani et al., 2016). T6SSs have a similar

structure with the contractile tail of the T4 bacteriophage and

could target both bacterial and eukaryotic cells for cytotoxicity.

Another example, mechanistically distinct from T6SS, is the

extracellular CIS (eCIS), which is released outside and attacks

target cells from there. The eCISs include the bacterial tailocin

and pyocin (Ge et al., 2015; Ghequire and De Mot, 2015; Na-

kayama et al., 2000; Scholl, 2017), and a variety of less charac-

terized but widely distributed systems in both prokaryotes and

archaea (Figures S1A and S1B) (Sarris et al., 2014), such as

the Photorhabdus virulence cassette (PVC) (Yang et al., 2006),

the antifeeding prophage (Afp) (Heymann et al., 2013; Hurst

et al., 2004; Jank et al., 2015), and the metamorphosis-associ-

ated contractile structure (MAC) (Shikuma et al., 2014). These

eCISs share many common features with contractile phages

but have evolved to possess diverse functions. For instance,

the R-type pyocins of Pseudomonas aeruginosa, which recog-

nize specific bacterial cells for killings, are genetically related

to the P2 phage (Ge et al., 2015; Nakayama et al., 2000).

Although these eCISs are widely distributed, due to the

complexity in their structures and the diversity in their physiolog-

ical functions, a full description of their structures and a complete

understanding of their mechanisms remain to be explored.

The Photorhabdus genus is generally considered to be insect

pathogens (Gatsogiannis et al., 2016; Meusch et al., 2014;

Sheets and Aktories, 2017); however, P. asymbiotica has also

been isolated from clinical specimens (Hapeshi and Waterfield,

2017; Jan�ca�rıkova et al., 2017), and cases of human infection

have been reported in the United States and Australia (Wilkinson

et al., 2009). Multiple pvc clusters are present in P. asymbiotica

genome: some of these genes encode homologous proteins

of known CIS complexes (Yang et al., 2006), but equivalent

genes for the T6SS membrane complex were not found (Durand

Figure 1. Overall Structure of the PVC Particle in the Extended State

(A) Genomic organization of pvc genes.

(B) Cryo-EM structure of the intact PVC syringe. PVC subunits are color coded and labeled. L1–-L24 denotes layers of sheath-tube proteins.

(C) Cutaway view of the distal end of the syringe (denoted by a green line in B), which consists of a trunk of the sheath-tube and a terminal cap.

(D) Cutaway view of the baseplate region of the syringe (denoted by a red line in B). Variants of the sheath and tube proteins are color coded. The fiber docking site

of Pvc3 is labeled.

(E) Top view of the distal end of the syringe.

(legend continued on next page)

Cell 177, 370–383, April 4, 2019 371

et al., 2015). Additionally, one ormore genes of putative effectors

exist downstream the pvc clusters. Phylogenetic evidence has

shown that the structural components of the PVC share a com-

mon ancestor with the T6SS and R-type pyocins, indicating a

potentially similar architecture among them (Sarris et al., 2014).

Distinct from T4 phage or R-type pyocins, which were proved

to target prokaryotic cells exclusively (Leiman and Shneider,

2012), the PVC was capable of targeting eukaryotic cells as it

could translocate toxins into insect hemocytes for actin conden-

sation (Yang et al., 2006), paralleling the widespread T6SS in its

function against eukaryotes. Moreover, the PVC was proposed

to be released outside bacterial cells for actions, which would

ease its biochemical and functional characterization. Therefore,

this PVC apparatus might be an ideal model system to study the

assembly and function of typical eCISs.

In this study, we present a near atomic cryoelectron

microscopy (cryo-EM) structure of the PVC particle from

P. asymbiotica, which enables a comparison of the PVC with

other CISs in great details. In general, the PVC is a phage-tail-

like structure comprising a baseplate complex and a cylindrical

body, but with a much simplified wedge composition. At the

distal end of the particle, a capping hexamer was revealed to

terminate and stabilize the sheath and tube. In addition, our

genetic and biochemical data suggest an assembly pathway

for this gigantic contractile device. In summary, our results

provide insights into the structure and mode of action for the

widespread phage-tail-like contractile nanodevices.

RESULTS

Overall Structure of the Complete PVC ParticleWecloned one of the pvc loci fromP. asymbiotica and expressed

it in Escherichia coli (Figure 1A). Protein gel and mass spectrom-

etry (MS) analysis confirmed the composition of purified PVC

syringes (Figure S1C). Notably, three subunits, Pvc6, Pvc14,

and Pvc15, were present at very low levels in the sample. Nega-

tive-staining electron microscopy (NS-EM) revealed the intact

nanomachines in both extended and contracted states (Fig-

ure S1D). Next, we employed cryo-EM to solve the structure of

the PVC syringe (Figures S2 and S3; Table S1). A typical syringe

in extended state is about 117 nm in length, but a certain length

variation was also observed (Figure S1E). 3D reconstruction was

performed with the 117-nm complete PVC particles (6-fold sym-

metry applied), resulting in a 6.2-A map (Figure 1B), from which

structural modules of the PVC syringe could be clearly identified.

Similar as other injection systems (Leiman and Shneider,

2012), there is a symmetry mismatch among its major parts, the

central spike (C1+C3), the baseplate (C3+C6), the sheath-tube

(C6), and the cap (C6). Therefore, both helical reconstruction

and masked-based single-particle reconstruction were used to

improve density maps of respective regions. Specifically, for the

central spike-baseplate and cap modules, particles were re-ex-

tracted to only include these local regions and refined. The final

(F) Horizontal cutaway view of the fiber region of the syringe. The protrusion dom

indicated by a box.

(G) Horizontal cutaway view of the wedge hexamer in the baseplate. The view de

See also Figures S1, S2, S3, S6, and S7 and Tables S1 and S2.

372 Cell 177, 370–383, April 4, 2019

density maps for the central spike-baseplate and the cap were

solved at 3.5 and 3.8 A, respectively (Figure S2). The trunk of

sheath-tube in pre-contraction state was solved using helical

reconstruction (n = 6, helical rise 39.3 A, twist 19.9�) at 2.9-Aresolution, and the structure of the sheath in post-contraction

state (n = 6, helical rise 17 A, twist 31.4�) was similarly obtained

at 3.7-A resolution (Figure S3). With these maps, out of the

16open reading frames (ORFs),wewereable to locateall 13abun-

dant subunits and build atomic models for 11 of them. Pvc10 and

Pvc13 were not sufficiently resolved for atomic modeling. Three

low-abundance subunits, Pvc6, Pvc14, and Pvc15, could be

localized in the map and were not modeled. Pvc14 and Pvc15,

with putative functions as tape measure protein and ATPase,

are likely not present in the mature PVC syringes.

With these models, we could assemble a composite structure

for a complete PVC particle, which contains 328 polypeptide

chains with a total molecular weight of 10.7 MDa (Figures 1B–

1G;TableS2).Overall, thePVCparticledisplaysasimplifiedstruc-

ture of the bacterial phage. Despite its characteristics resembling

T4 phage tail, it acquires certain components that are absent in

phages but present in T6SS, such as the ATPase and toxin pro-

teins (Bock et al., 2017; Russell et al., 2014; Yang et al., 2006).

Subunit Organization of theCentral Spike andBaseplateModulesA simplified architecture of T4 phage baseplate lies in the PVC

syringe: Pvc5, Pvc7, Pvc8, and Pvc10 form a continuous central

spike extending from the inner tube; Pvc11, Pvc12, and Pvc9

form the peripheral wedges (Figure 2A). Pvc8, in the form of

trimer, constitutes the main body of the spike. Although Pvc10

(the homolog of T4 gp5.4) was not resolved at atomic resolution

in our map, it forms the sharp conical tip on the Pvc8 spike (Fig-

ures 1D and 2A). The stoichiometry of Pvc11 and Pvc12 in the

wedges is 1:1, which is distinct from that in other CIS baseplates

(2:1) (Taylor et al., 2018), but is consistent with that of Mup47-48

in phage Mu (Buttner et al., 2016).

In the assembled wedges, six copies of Pvc11-Pvc12 hetero-

dimers form a hexagonal ring through the dimerization between

the domain V of Pvc11 and the domain III of Pvc12 from a neigh-

boring heterodimer (Figure 2B). Similar to T4 phage (Taylor et al.,

2016), a Pvc11-Pvc12 dimer can be divided into a ‘‘core bundle’’

(Figures 2C and 2D) and a ‘‘trifurcation unit’’ (Figure 2B). Twoma-

jor a helices from Pvc11 (domain I) and four major a helices from

Pvc12 (domains I and IV) make up the core bundle (Figures 2D,

3A, and 3D). The trifurcation unit has three extrusions: two are

used for the interactions with adjacent domains of Pvc11 or

Pvc12, and the third is for the tail fiber attachment (Figure 2B).

The association between the wedges and the central hub

relies on two contacts: the first is the interaction between

Pvc11 and Pvc8, and the second between the core bundle of

the Pvc11-Pvc12 dimer and Pvc9-Pvc7 (Figures 2A, 2C, S4A,

and S4B). These interfaces are presumably critical for the as-

sembly and structural stabilization of the baseplate. For the first

ains of Pvc3 for fiber docking are shown, and the fiber-sheath contact site is

pths of (E)–(G) are indicated by dashed boxes in (B).

Figure 2. Atomic Model of the Sheath-

Tube-Baseplate Complex

(A) Overview of the atomic model of the sheath-

tube-baseplate complex. The first three layers

of the sheath and tube proteins are shown,

highlighting the composition of sheath and tube

initiator proteins. The gp6-like and gp7-like do-

mains of Pvc12 are highlighted in cyan and pink,

respectively.

(B) The baseplate dodecamer formed by Pvc11-V

and Pvc12-III interactions in Pvc11-Pvc12 heter-

odimers. The trifurcation unit, denoted by a

red triangle, is created by domain IV of Pvc11

(Pvc11-IV) and two domains of Pvc12 (Pvc12-II

and Pvc12-V). Three extrusions of the trifurcation

unit (Pvc11-V, Pvc12-III, and Pvc12-VI/VII) are

denoted by red rectangles.

(C) A zoom-in view of the interactions between

the core bundle of Pvc11-Pvc12 heterodimer and

the sheath-tube (Pvc9 and Pvc7-LysM). Subunits

and individual domains of subunits are similarly

color coded as in (A). Residues 10–60 of Pvc9 are

highlighted in mesh representation.

(D) A zoom-in view of the Pvc11-Pvc12 core

bundle. For clarification, a cylinder representation

is used.

See also Figures S2, S3, S4, and S7.

interface, six copies of domain II from Pvc11 encircle the central

spike (Pvc8) to form the inner ring of the baseplate (Figure S4A).

Due to the symmetrymismatch between Pvc8 and Pvc11, the six

copies of domain II–III of Pvc11 (residues 116–510) can be

divided into two conformers, which contact two different sur-

faces of the Pvc8 trimer (Figures S4D–S4G). The two conformers

differ mainly in a rotational position of domain II–III relatively to

Pvc11 domains I, IV, and V (Figure S4H). For the second inter-

face, the core bundle of Pvc11-Pvc12 dimer is stabilized by

Pvc9 and the LysM domain of Pvc7, highlighting an apparent

role of the residues 10–60 of Pvc9 in organizing the core bundle

of wedge proteins (Figure 2C).

A distinct feature of the PVC is that many subunits are fusion

proteins from equivalent T4 subunits. Pvc8 is a fusion protein

of T4 gp5 and gp27 homologs, and similar fusion event also

occurred in T6SS as VgrG is also a trimeric spike (Leiman

et al., 2009). Additionally, both Pvc7 and Pvc12 appear to be

fusion proteins. Pvc7 is made of a tube protein and an additional

LysM domain (Figures S5A–S5C). The equivalents of these two

parts in T4 phage are gp48 and gp53, respectively (Table S2; Fig-

ures S5B and S5C). But the LysM domain in Pvc7 only contains

the most conserved portion of gp53 (Figures S5B and S5C). In

contrast to Pvc11 (a predicted T4 gp6 homolog) (Figures 3B

and 3C), the evolutionary relationship between Pvc12 and known

wedge proteins is not apparent because

of the low sequence conservation. As to

the composition of the wedges, the CIS

baseplates were traditionally thought to

be conserved in the form of (gp6)2-gp7

trimer (Taylor et al., 2018). In the PVC

syringe, the core bundle of the Pvc11-

Pvc12 dimer contains six helices, four of which in Pvc12 are

equivalent to the ones seen in the gp6-gp7 dimer (Figures 2C,

2D, S4B, and S4C) (Taylor et al., 2016). Therefore, Pvc12 is highly

likely a fusion protein of prototypical gp6 and gp7 (Figures

3D–3G and S4C).

Pvc13 Forms the Tail FiberAs to the fiber, a limited sequence and structural comparability of

Pvc13 to T4 short tail fiber gp12 could be found. Based on the

sequence analysis, the C-terminal one-third of Pvc13 is closely

related to gp10/gp12 in T4 phage, but its N-terminal and

middle sequence show little homology to known proteins. The

N terminus of Pvc13 contains three predicted helices (Fig-

ure S6A). Although the fiber was not sufficiently resolved for

atomic modeling, a clear symmetrical (3-fold) arrangement of

six helices could be detected, suggesting that the fiber is

composed of three Pvc13 proteins (Figures S6B–S6D). Interest-

ingly, at least ten repetitive b strand motifs (17 amino acids in

length) are found in the middle region, which reminds of the

structure of fiber shaft in adenovirus type 2 (Figure S6E) (van

Raaij et al., 1999). Furthermore, it could be observed that the

fiber directly docks onto the domain VII of Pvc12 (Figure S6F).

This is in contrast to T4 phage, in which the gp12-gp7 interaction

is mediated by a gp10 trimer (Taylor et al., 2016).

Cell 177, 370–383, April 4, 2019 373

Figure 3. Domain Organization of Pvc11 and Pvc12

(A) The polypeptide chain of Pvc11 can be divided into threemajor parts comprising five domains. The NTD (domain I) forms one unit of the core bundle of Pvc11-

Pvc12. The MD comprises two domains (domain II and III), and domain II is involved in interaction with Pvc8. The CTD has two major domains: domain IV forms

one part of the trifurcation unit and domain V takes part in contacting Pvc12.

(B) The cryo-EM density map of Pvc11 superimposed with the atomic model. Individual domains are color coded as in (A). Part of domain III was not modeled.

(C) Structural superimposition of Pvc11 (color coded) with T4 gp6 (black). The alignment was done using domain IV and V of Pvc11 as reference.

(D) Schematic diagram of Pvc12 domains in its primary sequence. The protein can be divided into two parts: gp6-like and gp7-like parts. Each part consists of

three or four domains. Domains I and IV form two helical units of the core bundle of Pvc11-Pvc12. Domains II and V form two extrusions of the trifurcation unit.

Domain III interacts with domain V of Pvc11. Domain VII is mainly involved in tail fiber attachment.

(E–G) The cryo-EM density map of Pvc12 superimposed with the atomic model shown in three different views. Part of domain VI-VII is not modeled. The gp6-like

and gp7-like part of Pvc12 is separated by a dash line in (E).

See also Figures S4 and S6.

The Sheath in Pre- and Post-contraction StatesThe sheath in the pre-contraction state is composed of 23

stacked hexameric rings of sheath proteins, Pvc4, Pvc3, and

Pvc2, in a pattern of 4-(2-3)5(2)12 (Figure 1B). The three sheath

proteins are in general highly similar, consisting of two major do-

mains (domain I and II) (Figures 4A–4C). Among the three, Pvc2

has the simplest structure, which closely relates to the R-type

pyocin sheath protein (Figures S7A–S7C); Pvc4 is slightly larger

and forms the first layer of the sheath (Figures 1B, 4B, and S5F);

Pvc3 contains an extra protrusion domain (residues 64–91, 202–

246) for the docking of the fibers (Figures 1F, 4C, S5F, and S6B).

In the pre-contraction state, the sheath proteins interact with the

374 Cell 177, 370–383, April 4, 2019

tube mostly through their domain I. Pvc9 (structurally similar to

domain I of sheath proteins) encircles Pvc7, acting as a sheath

initiator (Figure 2A). Analogously, Pvc4 encircles Pvc5 and forms

the first layer of the sheath. The rest of sheath comprises alter-

nating Pvc2 and Pvc3 subunits, which both interact with Pvc1

(Figures 1B and 1D). The sheath-tube interactions from these

variants appear to be dictated by electrostatic interactions (Fig-

ures S7E–S7I). Unique distribution of positively and negatively

charged patches lies in these interfaces. Nevertheless, the

assembled tube (Pvc1) appears to have limited selection on

Pvc3 and Pvc2. As shown in Figures 1B and S6B, the assembly

of the fibers presumably contributes largely to the patterning of

Figure 4. Structure of the PVC Sheaths in the Extended and Contracted States(A–C) Structures of sheath protein variants Pvc2 (A), Pvc4 (B), and Pvc3 (C). Atomic models are superimposed with cryo-EM density maps. Major structural

differences among them are highlighted by colors. Two major domains of Pvc2 are shown in (A).

(D–F) Side and top views of the Pvc2 sheath in the extended (D) and contracted forms (E and F). The inner and outer diameters of the contracted form are 100 and

220 A, respectively.

(G and H) Ribbon representation of Pvc2 monomer in the extended (G) and contracted states (H).

See also Figures S5 and S7.

Pvc2 and Pvc3 on tube polymer, because only Pvc3 has a fiber

docking domain.

The mechanism of sheath contraction is generally conserved

among the contractile systems (Clemens et al., 2015; Ge et al.,

2015; Kudryashev et al., 2015; Taylor et al., 2016). PVC sheath

undergoes similar conformational transitions upon contraction.

The diameter of the sheath increases from 17 to 22 nm, and

the pore size expands to 10 nm (Figures 4D–4F), which enables

the detachment of the tube from the sheath. Furthermore, the

contracted sheath is compressed vertically when compared to

the extended form, with a larger helical twist of 31.4�and a

smaller helical rise of 17 A. Comparison of the sheath proteins

in the extended and contracted states indicates that during

the contraction, each subunit of the sheath mainly undergoes

rigid-body rotation, but the terminal loops and strands are

dramatically rearranged (Figures 4G, 4H, and S7D).

Structure of the Inner TubeThe outer diameter of the inner tube is about 8 nm in the extended

state (Figure 1C), comparable to those of T4, T6SS, and

R-type pyocins (Brackmann et al., 2017;Wang et al., 2017; Zheng

et al., 2017b). The PVC tube consists of three variants of tube pro-

teins, such that a complete syringe in a typical length contains

24 stacked hexameric rings of tube proteins, including two layers

of tube initiators (Pvc7 and Pvc5, gp48 and gp54 homologs,

respectively) and 22 layers of main tube proteins (Pvc1, gp19 ho-

molog) (Figures 1B–1D; Table S2). These three variants are struc-

turally similar in general, especially for Pvc1 and Pvc5 (Figures

S5D and S5E). The first layer formed by Pvc7 hexamer docks

onto the b-barrel ring (pseudo-6-fold) of Pvc8 (Figure 2A). The

next layer of Pvc5 hexamer analogously stacks onto the Pvc7

ring. Notably, opposite surface charges are found on the two

sides of these hexameric rings, including Pvc8, Pvc7, Pvc5,

and Pvc1 (predominately negative charges on the needle and

positive charges on the cap sides) (Figures S7J–S7M), indicating

that electrostatic attraction accounts for the assembly of rings

into the inner tube. Furthermore, the inner surface of Pvc1 tube

is remarkably negatively charged, manifesting a preference of

the PVC tube for its cargos (Figure S7N). This feature was also

observed in R-type pyocins from P. aeruginosa, but not in other

closely related contractile systems such as T6SS (neutral), bacte-

riophage l, and PS17 (positively charged) (Ge et al., 2015). Thus,

The PVC and R-type pyocins might preserve some common fea-

tures in their ancestors for analogous functions.

Cell 177, 370–383, April 4, 2019 375

Figure 5. Atomic Model of the Distal End of the PVC Particle

(A) Side view of the PVC distal end. Pvc16 hexamer caps on the topmost sheath-tube complex. Pvc1 (Layer 24, L24), Pvc1 (L23), and Pvc16 are colored green,

forest green, and blue, respectively. Pvc2 (L23) is colored orange and red.

(B) A close-up view of a Pvc16 monomer and its interaction with Pvc2.

(C and D) Top (C) and bottom (D) view of the distal end of the PVC syringe.

(E) Same as in (A), with sheath proteins omitted to highlight the spatial relationship between the Pvc16 hexamer and the topmost Pvc1 layer.

(F) Specific interactions between the NTDof one Pvc16monomer and three copies of Pvc1. The N terminus of Pvc16 ismarked by a dashed red circle and labeled.

(G) Conformational difference of the topmost layer of inner tube (Pvc1, L24) compared with other layers of inner tube (Pvc1, L3–23).

The Terminator Cap at the Distal EndThe elongation of the sheath and tube in PVC particles is termi-

nated by a Pvc16 hexamer, which possesses a central core and

six arms (Figures 5A–5D). Six helices from the Pvc16 hexamer

completely seal the central channel of the tube, leaving a narrow

pore with a diameter of 7 A (Figures 5C and 5D). Each Pvc16

monomer exhibits a dumbbell-like structure. The N-terminal

domain (NTD) and C-terminal domain (CTD) is connected by a

middle linker (MD) (Figure 5B). The structural domains and their

context in the PVC syringe suggest multiple roles for Pvc16.

First, the Pvc16 hexamer embraces the topmost layer of the

sheath (Pvc2-L23) with its six stretching arms (MD and CTD)

(Figures 5A–5C). Each Pvc16 monomer interacts with two adja-

cent sheath proteins: Pvc16-MD parallels with domain I of one

Pvc2, while its CTD makes a 90� turn and interacts with an adja-

cent Pvc2 (Figures 5A and 5B). This clearly demonstrates a role

in stabilizing the sheath in its pre-contraction state. Second, the

inner tube (Pvc1-L24) is capped by the central core of the Pvc16

hexamer (Figure 5E), underlining the main function of Pvc16 as a

tube terminator. In fact, each Pvc16-NTD interacts with three

copies of Pvc1 (Figure 5F). Particularly, a long intervening loop

376 Cell 177, 370–383, April 4, 2019

between two b strands of the NTD is deeply inserted into a bind-

ing groove formed by two neighboring Pvc1 proteins, and the

N terminus of Pvc16 is seen to interact with the N-terminal resi-

dues of Pvc1 (Figure 5F). Because of these interactions with

Pvc16-NTD, the N-terminal end of Pvc1-L24, in fact, exhibits a

different conformation (Figure 5G).

Next, we sought to examine specific functions of individual do-

mains of Pvc16. In the absence of Pvc16 (DPvc16), the baseplate

and tube could still form, but not the sheath, and the length of the

tube appears to be much larger (Figure 7A). A similar phenotype

was also reported for an Afp16 deletion (Pvc16 homolog) mutant

of Serratia entomophila Afp (Rybakova et al., 2013). DUF4255 at

NTD is awidespread domain with unknown functions (Figures 6A

and 6B). DUF4255 domain alone (Pvc16_179) is able to produce

PVC particles with normal length but without outer sheath (Fig-

ures 6C–6E), indicating a main function of the N-terminal

DUF4255 in terminating the tube growth. In contrast, a construct

containing both DUF4255 and MD (Pvc16_192) is sufficient to

generate PVC particles with both sheath and tube (Figures

6C–6E). This clearly reveals a pivotal role for the MD in assem-

bling and stabilizing the sheath on PVC particles. It has to be

(legend on next page)

Cell 177, 370–383, April 4, 2019 377

noted that Pvc16_192 construct could not restore thematuration

of PVC particles in 100% efficiency (Figure 6D), suggesting a mi-

nor role of Pvc16-CTD in stabilizing the sheath-tube complex at

the capping end.

Assembly of the PVC ParticlesTo further determine the order of subunit assembly, we gener-

ated a collection of PVC ORF deletion mutants and analyzed

their effects in the syringe assembly. As summarized in Figure 7A

and Table S3, single deletions of genes for the subunits in the

baseplate (Pvc8, Pvc11, and Pvc12), for tube proteins (Pvc1,

Pvc5, and Pvc7), or for the sheath initiators (Pvc4 and Pvc9) all

abolished the production of syringe-like particles, suggesting

that the assembly the PVC syringes starts from the baseplate

end. In contrast, deletion of the main sheath protein Pvc2 re-

sulted in sheath-free particles but had little effect on the assem-

bly of the baseplate and tube. Similar to the phenotype of

DPvc16, Pvc6, or Pvc14 deletions resulted in a large variation

in the length of PVC particles (Figure 7A; Table S4). Indeed,

Pvc14 is a homolog of Afp14 inSerratiaAfp, whichwas proposed

to act as a tape measure protein (Rybakova et al., 2015). Pvc6 is

the shortest ORF in the PVC gene clusters, and we did not find

any density that could be attributed to Pvc6. Given the abnormal

length of DPvc6 particles (Table S4), Pvc6 possibly functions

together with Pvc14 in determining the optimal length of PVC

particles. The deletion of Pvc10, Pvc13, or Pvc15 seemed to pro-

duce similar PVC particles as the wild-type.

Four antibodies targeting the central spike-baseplate (Pvc8),

the fiber (Pvc13), the cap (Pvc16), and the tube (Pvc1) were

used to confirm the composition of each mutant PVC particles.

Consistent with the NS-EM observations, Pvc1, Pvc8, Pvc13,

and Pvc16 cannot be detected in PVC mutants deficient in sub-

units for the baseplate (Pvc8, Pvc9, Pvc11, Pvc12) and the

sheath-tube initiation (Pvc1, Pvc3, Pvc4, Pvc5, Pvc7) (Figure 7B),

suggesting that mutual stabilization of subunits in the baseplate

region is essential for the syringe assembly and tube growth.

Although Pvc2 deletion shows no visible outer sheath, it contains

the capping protein Pvc16 (Figure 7B). This suggests that the

binding of Pvc16 onto the PVC complex might not require the

help of outer sheath. The capping of Pvc16 on the distal Pvc1

ring might set the signal to initiate the sheath loading.

With thesedata,weproposeapossible assemblypathway (Fig-

ure 7C) for the PVC syringe in the framework of the previously es-

tablished T4 phage model (Arisaka et al., 2016; Yap et al., 2016;

Zoued et al., 2016). First, Pvc11 and Pvc12 form the wedge unit,

which encircles the central hub (assembled by Pvc8 and Pvc10

independently) to generate the baseplate. Subsequently, Pvc7

Figure 6. Functional Analysis of Individual Domains of Pvc16

(A) Sequence alignment of Pvc16 and its homologs. B. rhizoxinica, Burkhold

P. temperata, Photorhabdus temperata NC19; S. entomophila, Serratia entomop

(B) The presence of DUF4255 domains in 2,246 proteins from prokaryotes and arc

‘‘Others’’ group comprises Acidobacteria, Fibrobacter, Nitrospirae, Rubrivirga, D

(C) Schematic illustration of constructed Pvc16 mutants.

(D) Negative-staining electron microscopy of the PVC particles from DPvc16

Pvc16_179 in theDPvc16 cells produced PVC particles with normal length but with

sheath. Note that that a small number of PVC particles without outer sheath can al

a role of Pvc16 CTD in stabilizing the particles. Scale bar, 100 nm.

(E) Western blot detection of Pvc16 proteins in the samples shown in (D).

378 Cell 177, 370–383, April 4, 2019

and Pvc5 dock onto the top of the central hub to stabilize the

baseplate (through LysM domain of Pvc7) and to initiate Pvc1

polymerization. Pvc9 andPvc4 attach to the initiator tubeproteins

to further reinforce the baseplate. Pvc13 fibers might also bind to

the baseplate at this stage. After the tube reaches optimal length

(likely controlled by the tapemeasure protein Pvc14), Pvc16 inter-

acts with the topmost inner tube layer to terminate the tube elon-

gation. Last, Pvc2 and Pvc3 sheath proteins start to assemble

along the inner tube for the maturation of PVC particles.

In summary, our data show that the baseplate assembly initi-

ates the construction of the PVC particle, and the terminal cap is

especially crucial for the assembly of the sheath in pre-contrac-

tion state. These data are consistent with the assembly model of

T4 phages (Arisaka et al., 2016; Ferguson and Coombs, 2000;

King, 1968) but deviates from the T6SS assembly model where

the cap proteins were reported to remain on the distal end of

the tube during its growth (Zoued et al., 2016).

DISCUSSION

CISs, such as T4 bacteriophage and T6SS have been extensively

investigated, and many aspects of the structure and mechanism

for general contractile injection devices have been derived from

these studies (Arisaka et al., 2016; Clemens et al., 2015; Durand

et al., 2015; Fokine et al., 2013; Kudryashev et al., 2015; Nazarov

et al., 2018; Taylor et al., 2016;Wang et al., 2017; Yap et al., 2016;

Zoued et al., 2016). As to the eCISs, the extended and contracted

structures of the tube-sheath trunk of R-type pyocins have been

reported in high resolution (Ge et al., 2015), providing a general

contraction model for eCISs. However, high-resolution informa-

tion regarding a few essential parts of these well-studied CISs,

such as the baseplate complexes and terminator caps of T6SS

and R-type pyocins, are still not complete. Although the PVC

was considered to be an evolutionary intermediate between

phages and T6SS (Buttner et al., 2016), detailed compositional

andstructural data of thePVCpresent herewould largely facilitate

our understanding of the structure and function of eCISs, and

allow the dissection of general mechanisms for all types of CISs.

First, with the divergent evolution of the sheath and tube pro-

teins among species, the organization of a contractile tail is still

quite simple and highly similar. Therefore, the general mecha-

nism governing the sheath contraction of the PVC should be

nearly identical as those reported for T6SS, R-type pyocins,

and T4 phage (Ge et al., 2015; Taylor et al., 2016; Wang et al.,

2017). The inner tube of known CISs may be all constructed in

the same way: hexameric tube rings stack one by one with a

twist to form a helical structure (Wang et al., 2017). The PVC

eria rhizoxinica HKI454; P. luminescens, Photorhabdus luminescens TTO1;

hila A1MO2; Y. ruckeri, Yersinia ruckeri ATCC29473.

haea. Sequences were obtained from UniProt and classified by taxonomy. The

einococcus, and unclassified bacteria.

strains complemented with different Pvc16 mutants. Complementation of

out sheath, while complementation of Pvc16_192 recovered assembly of outer

so be found in Pvc16_192 complementation sample (white arrows), suggesting

(legend on next page)

Cell 177, 370–383, April 4, 2019 379

preserves this general feature. Pvc7 and Pvc5 form the first two

initiator rings in the baseplate end of the PVC tube, and the main

body of the tube is by continuous stacking of Pvc1 hexamers.

All these tube proteins have a comparable structure with their

counterparts in other CISs (gp19 of T4, Hcp of T6SS, or

PA0623 of R-type pyocin) (Ge et al., 2015; Wang et al., 2017),

except that a LysM domain found on T4 gp53 is fused to the

CTD of Pvc7. This suggests that the indispensable LysM domain

exists in a variety of forms by fusion with different components in

the baseplate (e.g., gp53 in phage T4, gpX in phage P2 and

PA0627 in R-type pyocin) (Maxwell et al., 2013; Taylor et al.,

2018; Yap et al., 2016). Interestingly, even though gp53 homolog

is not discovered in the T6SS, a large protein product (PA5265)

encoded downstream T6SS VgrG gene in P. aeruginosa was

predicted to have a LysM domain (Barret et al., 2011).

The sheath subunits from different CISs consist of varying

number of proteins (1 or 2) and usually possess species-specific

sequence or domain insertions at different positions. But the

general fold of their core structures is similar, with two domains

(Brackmann et al., 2017). It is interesting to note that the PVC has

three sheath variants. The PVC sheath body is predominantly

made of Pvc2 hexamers. The major difference of the three

sheath variants lies in the outer surface of domain II. We have

noticed that a protrusion domain of Pvc3, which is used for tail

fiber docking, is in a comparable position of domain III in the

T6SS sheath (Figures 4C and S7C) (Kudryashev et al., 2015).

However, the domain III of T6SS sheath subunit is much larger

and not used for fiber docking. Instead, it is recognized by the

ATPase ClpV, which disassembles the contracted sheath for

subunit recycling (Basler and Mekalanos, 2012; Kudryashev

et al., 2015). PVC also has an ATPase protein (Pvc15) that is ab-

sent in CISs like phage T4 or R-type pyocins (Table S2). Whether

or not this ATPase of PVC play a similar function as in T6SS re-

mains to be investigated. The extra domain of Pvc4, which is

smaller than the protrusion domain of Pvc3, lies right below the

tail fiber, but no direct interaction was observed. The function

of this small protrusion of Pvc4 also remains to be elucidated.

Second, the central spike-baseplate is the most conserved

structure in CISs. The stoichiometry of baseplate proteins is

considered to be the most conserved feature (Taylor et al.,

2018). For examples, the T4 baseplate wedge comprises one

copy of gp7, one copy of gp25, and two copies of gp6 (Taylor

et al., 2016); the T6SS baseplate components TssE (gp25 homo-

log), TssF (gp6 homolog), and TssG (gp7 homolog) have also

been suggested to form a wedge subunit in a 1:2:1 stoichiometry

(Cherrak et al., 2018; Nazarov et al., 2018; Park et al., 2018). As for

the PVC baseplate, the stoichiometry of them is 1:1:1. Six Pvc11-

Pvc12 heterodimers, instead of (gp6)2-gp7 heterotrimer, interact

Figure 7. Characterization of the Particle Formation in Different PVC M

(A) Negative-staining electron microscopy analysis of PVC particles purified from

Pvc15 was still able to produce intact PVC particles. Deletion of Pvc2 or Pvc16 p

(B) Western blot examination of the samples from different PVC mutants with an

(C) Proposed assembly model of the PVC. Pvc11 and Pvc12 bind together to form

form the baseplate. Pvc7 and Pvc5 bind to the baseplate and to stabilize the adjac

to the initiator tubes to further stabilize the baseplate. Pvc13 tail fibers attach to Pv

and other sheath proteins (Pvc2 and Pvc3) start to load onto the tube to comple

See also Tables S3 and S4.

380 Cell 177, 370–383, April 4, 2019

with each other to form a hexameric baseplate. Pvc12 likely plays

the roles of both gp6 and gp7 in constructing the baseplate (Fig-

ures 2B, S4B, and S4C), suggesting a possible fusion event dur-

ing evolution. Fusion or separation events were also observed for

central spike module. For T4 phages, three genetic products are

required to form the central spike: gp5 for the spike, gp5.4 for the

spike tip, and gp27 for the hub. By contrast, the spike and hub is

formed by a single polypeptide VgrG in a trimeric form in the

T6SS, whereas in R-type pyocin, the spike and tip is formed by

a single protein PA0616 (Taylor et al., 2018). The PVC central

spike resembles that of T6SS. Three Pvc8 proteins, each ofwhich

is created by a fusion of the gp27 and gp5 homologs, give rise to

the spike-hubcomplex; the piercing tip is formedby amonomeric

Pvc10 (a PAAR-repeat protein homolog). These data suggest that

despite the evolutionary reshuffling of functional domains among

the baseplate proteins, the general principle of the baseplate

construction is highly conserved.

Third, tail fibers constitute the most diverse components of

CISs. T6SS, which lacks the tail fibers, is anchored to the bacte-

rial membrane from the cytosolic side by a membrane complex

comprising TssJ, TssL, and TssM (Durand et al., 2015). The

fibers identified in the baseplates of CISs, such as PVC, R-type

pyocins, Afp, and MAC, vary largely in protein sequences (Buth

et al., 2018; Heymann et al., 2013; Michel-Briand and Baysse,

2002; Shikuma et al., 2014). The PVC fiber protein Pvc13

contains at least 10 repeated motifs resembling the adenovirus

fiber and a gp10/gp12 domain, which is probably derived from

T4 short tail fiber (Taylor et al., 2016; van Raaij et al., 1999).

Therefore, it is tempting to speculate that the Pvc13 is another

fusion protein derived from the T4 and adenovirus fibers, which

may have enabled its recognition of eukaryotic cells.

Despite the high diversity of fiber sequences, the host surface

attachment of the fibers and membrane penetrating of the

central spike in the PVC might be comparable to those of the

T4 phage (Hu et al., 2015). This might be due to the similarity in

the central spike and the baseplate construction between PVC

and bacteriophages. Analogous to the T4 model (Hu et al.,

2015; Taylor et al., 2016), it is likely that upon the release of

PVC fibers from the docking sites and the recognition of recep-

tors on the cell surface, the Pvc11-Pvc12-Pvc13 complex might

rotate as an integral unit. This probably triggers the baseplate

transition from resting to contraction and consequently disrupts

the interactions among the core bundle of Pvc11-Pvc12, LysM

of Pvc7, and Pvc9. Ultimately, the energy stored in the sheath

polymer are released to force the passage of the tube-needle

complex through the pore created by baseplate expansion.

Last, the PVC is terminated by a hexameric Pvc16 cap, which

is also a conserved feature for other CISs. The NTD of Pvc16

utants and Proposed Assembly Model of the PVC

different PVC mutants. Note that deletion of Pvc6, Pvc10, Pvc13, Pvc14, or

roduced PVC particles without outer sheath. Scale bar, 100 nm.

tibodies against Pvc1 (tube), Pvc8 (baseplate), Pvc13 (fiber), and Pvc16 (cap).

the wedge. Six wedges assemble around the central spike (Pvc8 and Pvc10) to

ent wedges. Pvc1 starts to polymerize for tube growth, and Pvc9 and Pvc4 bind

c12 during this process. Pvc16 caps on the tube to terminate the polymerization

te the assembly.

(DUF4255domain) oligomerizes to formacentral core, functioning

as a terminator of the inner tube. The MD and CTD of Pvc16 both

interactwith the final layer of sheath proteins, highlighting their po-

tential role in stabilizing the sheath in high-energy pre-contraction

state. Similar hexameric terminator structures could be found in

other related systems. The gpU and gp15 (together with gp3) ter-

minates the assembly of the tail tube in l and T4 phages, respec-

tively (Fokine et al., 2013; Pell et al., 2009), resembling the role of

Pvc16central core in terminating thegrowthofPVC tube. Thehex-

americ Afp16 in Serratia Afp was also proposed to terminate and

stabilize the sheath-tube polymer (Rybakova et al., 2013). These

examples of cap proteins with an analogous mode of action in

capping the distal end of the tail and in stabilizing the sheath-

tube complex suggest that the mechanism of Pvc16-like proteins

might be conserved for eCISs. T6SS also possesses a cap struc-

tureat thedistal endof the tail, but thecapsubunit TssAappears to

functiondifferently. InE. coliT6SS, TssAwas toproposed toprime

andcoordinate the sheath-tubebiogenesis and it formsadodeca-

meric cap (two stacked hexamerswith six extendingarms) and re-

mains bound at the distal end of the assembling sheath (Zoued

et al., 2016). A recent study further showed that TssA-like proteins

of T6SS can be divided into four sub-cladeswith varying structure

and function (Dix et al., 2018).

Taken together, our work provide rich structural details for un-

derstanding the general mechanism and assembly of eCISs, and

this PVC syringe, as a simple eukaryote-targeting CIS, may have

the potential to be further converted into delivery tools for biolog-

ical and therapeutic purposes (Sunderland et al., 2017; Young

and Gill, 2015).

STAR+METHODS

Detailed methods are provided in the online version of this paper

and include the following:

d KEY RESOURCE TABLE

d CONTACT FOR REAGENT AND RESOURCE SHARING

d EXPERIMENTAL MODEL AND SUBJECT DETAILS

d METHOD DETAILS

B Plasmids construction

B Protein complex purification

B PVC ORFs mutagenesis

B PAGE, Mass Spectrometry and western blot analysis

B Electron Microscopy

B Image Processing

B Model building

B Bioinformatics analysis

d QUANTIFICATION AND STATISTICAL ANALYSIS

d DATA AND SOFTWARE AVAILABILITY

SUPPLEMENTAL INFORMATION

Supplemental Information can be found with this article online at https://doi.

org/10.1016/j.cell.2019.02.020.

ACKNOWLEDGMENTS

We thank the Tsinghua University Branch of the China National Center for Pro-

tein Sciences (Beijing) for cryo-EM data collection, and the Core Facilities at

School of Life Sciences, Peking University for assistance with the NS-EM

work. The computation was supported by High-performance Computing Plat-

form of Peking University. The project was funded by the Ministry of Science

and Technology of China (2016YFA0500700 to N.G.); the CAMS Innovation

Fund for Medical Sciences (CIFMS) 2016-I2M-1-013; the Non-profit Central

Institute Fund of Chinese Academy of Medical Sciences (2017PT31049,

2018PT51009, and 2018PT31012); the National Natural Science Foundation

of China (NSFC) (31725007 and 31630087 to N.G.; 31700655 to N.L.;

31870108 and 31500115 to F.J.); and the Beijing Natural Science Foundation

(5192019 to F.J.). N.L. is supported by Young Elite Scientists Sponsorship Pro-

gram by CAST and a postdoctoral fellowship from the Peking-Tsinghua Center

for Life Sciences.

AUTHOR CONTRIBUTIONS

F.J., Q.J., and N.G. conceived the project; F.J., N.L., X.W., J.C., Y.Y., and J.Y.

performed the sample preparation and characterization; N.L., J.C., Y.H., and

B.C. processed the cryo-EM data and reconstructed the cryo-EM map; N.L.

and N.G. built and refined the structure model; F.J., N.L., X.W., Y.W., Q.J.,

and N.G. analyzed the data; F.J., N.L., Q.J., and N.G. wrote the manuscript;

all authors discussed and commented on the results and the manuscript.

DECLARATION OF INTERESTS

The authors declare no competing interests.

Received: October 1, 2018

Revised: January 11, 2019

Accepted: February 13, 2019

Published: March 21, 2019

REFERENCES

Adams, P.D., Afonine, P.V., Bunkoczi, G., Chen, V.B., Davis, I.W., Echols, N.,

Headd, J.J., Hung, L.W., Kapral, G.J., Grosse-Kunstleve, R.W., et al. (2010).

PHENIX: a comprehensive Python-based system for macromolecular struc-

ture solution. Acta Crystallogr. D Biol. Crystallogr. 66, 213–221.

Arisaka, F., Yap, M.L., Kanamaru, S., and Rossmann, M.G. (2016). Molecular

assembly and structure of the bacteriophage T4 tail. Biophys. Rev. 8, 385–396.

Barret, M., Egan, F., Fargier, E., Morrissey, J.P., and O’Gara, F. (2011).

Genomic analysis of the type VI secretion systems in Pseudomonas spp.:

novel clusters and putative effectors uncovered. Microbiology 157, 1726–

1739.

Basler, M. (2015). Type VI secretion system: secretion by a contractile nano-

machine. Philos. Trans. R. Soc. Lond. B Biol. Sci. Published online October

5, 2015. https://doi.org/10.1098/rstb.2015.0021.

Basler, M., and Mekalanos, J.J. (2012). Type 6 secretion dynamics within and

between bacterial cells. Science 337, 815.

Bock, D., Medeiros, J.M., Tsao, H.F., Penz, T., Weiss, G.L., Aistleitner, K.,

Horn, M., and Pilhofer, M. (2017). In situ architecture, function, and evolution

of a contractile injection system. Science 357, 713–717.

Brackmann, M., Nazarov, S., Wang, J., and Basler, M. (2017). Using Force to

Punch Holes: Mechanics of Contractile Nanomachines. Trends Cell Biol. 27,

623–632.

Buchan, D.W., Minneci, F., Nugent, T.C., Bryson, K., and Jones, D.T. (2013).

Scalable web services for the PSIPRED Protein Analysis Workbench. Nucleic

Acids Res. 41, W349–W357.

Buth, S.A., Shneider, M.M., Scholl, D., and Leiman, P.G. (2018). Structure and

Analysis of R1 and R2 Pyocin Receptor-Binding Fibers. Viruses. Published

online August 14, 2018. https://doi.org/10.3390/v10080427.

Buttner, C.R., Wu, Y., Maxwell, K.L., and Davidson, A.R. (2016). Baseplate

assembly of phage Mu: Defining the conserved core components of contrac-

tile-tailed phages and related bacterial systems. Proc. Natl. Acad. Sci. USA

113, 10174–10179.

Cell 177, 370–383, April 4, 2019 381

Cascales, E. (2017). Microbiology: And Amoebophilus Invented the Machine

Gun!. Curr. Biol. 27, R1170–R1173.

Chassaing, B., and Cascales, E. (2018). Antibacterial Weapons: Targeted

Destruction in the Microbiota. Trends Microbiol. 26, 329–338.

Chen, V.B., Arendall, W.B., 3rd, Headd, J.J., Keedy, D.A., Immormino, R.M.,

Kapral, G.J., Murray, L.W., Richardson, J.S., and Richardson, D.C. (2010).

MolProbity: all-atom structure validation for macromolecular crystallography.

Acta Crystallogr. D Biol. Crystallogr. 66, 12–21.

Cherrak, Y., Rapisarda, C., Pellarin, R., Bouvier, G., Bardiaux, B., Allain, F.,

Malosse, C., Rey, M., Chamot-Rooke, J., Cascales, E., et al. (2018).

Biogenesis and structure of a type VI secretion baseplate. Nat. Microbiol. 3,

1404–1416.

Cianfanelli, F.R., Monlezun, L., and Coulthurst, S.J. (2015). Aim, Load, Fire:

The Type VI Secretion System, a Bacterial Nanoweapon. Trends Microbiol.

24, 51–62.

Clemens, D.L., Ge, P., Lee, B.Y., Horwitz, M.A., and Zhou, Z.H. (2015). Atomic

structure of T6SS reveals interlaced array essential to function. Cell 160,

940–951.

Dix, S.R., Owen, H.J., Sun, R., Ahmad, A., Shastri, S., Spiewak, H.L., Mosby,

D.J., Harris, M.J., Batters, S.L., Brooker, T.A., et al. (2018). Structural insights

into the function of type VI secretion system TssA subunits. Nat. Commun.

9, 4765.

Durand, E., Nguyen, V.S., Zoued, A., Logger, L., Pehau-Arnaudet, G.,

Aschtgen, M.S., Spinelli, S., Desmyter, A., Bardiaux, B., Dujeancourt, A.,

et al. (2015). Biogenesis and structure of a type VI secretion membrane core

complex. Nature 523, 555–560.

Emsley, P., Lohkamp, B., Scott, W.G., and Cowtan, K. (2010). Features and

development of Coot. Acta Crystallogr. D Biol. Crystallogr. 66, 486–501.

Ferguson, P.L., and Coombs, D.H. (2000). Pulse-chase analysis of the in vivo

assembly of the bacteriophage T4 tail. J. Mol. Biol. 297, 99–117.

Fokine, A., Zhang, Z., Kanamaru, S., Bowman, V.D., Aksyuk, A.A., Arisaka, F.,

Rao, V.B., and Rossmann, M.G. (2013). The molecular architecture of the

bacteriophage T4 neck. J. Mol. Biol. 425, 1731–1744.

Garcıa-Bayona, L., and Comstock, L.E. (2018). Bacterial antagonism in host-

associated microbial communities. Science 361, 361.

Gatsogiannis, C., Merino, F., Prumbaum, D., Roderer, D., Leidreiter, F.,

Meusch, D., and Raunser, S. (2016). Membrane insertion of a Tc toxin in

near-atomic detail. Nat. Struct. Mol. Biol. 23, 884–890.

Ge, P., Scholl, D., Leiman, P.G., Yu, X., Miller, J.F., and Zhou, Z.H. (2015).

Atomic structures of a bactericidal contractile nanotube in its pre- and post-

contraction states. Nat. Struct. Mol. Biol. 22, 377–382.

Ghequire, M.G.K., and De Mot, R. (2015). The Tailocin Tale: Peeling off Phage

Tails. Trends Microbiol. 23, 587–590.

Hachani, A., Wood, T.E., and Filloux, A. (2016). Type VI secretion and anti-host

effectors. Curr. Opin. Microbiol. 29, 81–93.

Hapeshi, A., and Waterfield, N.R. (2017). Photorhabdus asymbiotica as an

Insect and Human Pathogen. Curr. Top. Microbiol. Immunol. 402, 159–177.

He, S., and Scheres, S.H.W. (2017). Helical reconstruction in RELION.

J. Struct. Biol. 198, 163–176.

He, Z., Zhang, H., Gao, S., Lercher, M.J., Chen, W.H., and Hu, S. (2016).

Evolview v2: an online visualization and management tool for customized

and annotated phylogenetic trees. Nucleic Acids Res. 44, W236–W241.

Heymann, J.B., Bartho, J.D., Rybakova, D., Venugopal, H.P., Winkler, D.C.,

Sen, A., Hurst, M.R., and Mitra, A.K. (2013). Three-dimensional structure

of the toxin-delivery particle antifeeding prophage of Serratia entomophila.

J. Biol. Chem. 288, 25276–25284.

Hu, B., Margolin, W., Molineux, I.J., and Liu, J. (2015). Structural remodeling of

bacteriophage T4 and host membranes during infection initiation. Proc. Natl.

Acad. Sci. USA 112, E4919–E4928.

Hurst, M.R., Glare, T.R., and Jackson, T.A. (2004). Cloning Serratia entomo-

phila antifeeding genes–a putative defective prophage active against the grass

grub Costelytra zealandica. J. Bacteriol. 186, 5116–5128.

382 Cell 177, 370–383, April 4, 2019

Jan�ca�rıkova, G., Houser, J., Dobe�s, P., Demo, G., Hyr�sl, P., and Wimmerova,

M. (2017). Characterization of novel bangle lectin from Photorhabdus asym-

biotica with dual sugar-binding specificity and its effect on host immunity.

PLoS Pathog. 13, e1006564.

Jank, T., Eckerle, S., Steinemann, M., Trillhaase, C., Schimpl, M., Wiese, S.,

van Aalten, D.M., Driever, W., and Aktories, K. (2015). Tyrosine glycosylation

of Rho by Yersinia toxin impairs blastomere cell behaviour in zebrafish em-

bryos. Nat. Commun. 6, 7807.

Jiang, W., Zhao, X., Gabrieli, T., Lou, C., Ebenstein, Y., and Zhu, T.F. (2015).

Cas9-Assisted Targeting of CHromosome segments CATCH enables one-

step targeted cloning of large gene clusters. Nat. Commun. 6, 8101.

Kimanius, D., Forsberg, B.O., Scheres, S.H.W., and Lindahl, E. (2016). Accel-

erated cryo-EM structure determination with parallelisation using GPUs in

RELION-2. eLife. Published online November 15, 2016. https://doi.org/10.

7554/eLife.18722.

King, J. (1968). Assembly of the tail of bacteriophage T4. J. Mol. Biol. 32,

231–262.

Kovach, M.E., Elzer, P.H., Hill, D.S., Robertson, G.T., Farris, M.A., Roop, R.M.,

2nd, and Peterson, K.M. (1995). Four new derivatives of the broad-host-range

cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes.

Gene 166, 175–176.

Kucukelbir, A., Sigworth, F.J., and Tagare, H.D. (2014). Quantifying the local

resolution of cryo-EM density maps. Nat. Methods 11, 63–65.

Kudryashev, M., Wang, R.Y., Brackmann, M., Scherer, S., Maier, T., Baker, D.,

DiMaio, F., Stahlberg, H., Egelman, E.H., and Basler, M. (2015). Structure of

the type VI secretion system contractile sheath. Cell 160, 952–962.

Kumar, S., Stecher, G., and Tamura, K. (2016). MEGA7: Molecular Evolu-

tionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol.

33, 1870–1874.

Leiman, P.G., and Shneider, M.M. (2012). Contractile tail machines of bacterio-

phages. Adv. Exp. Med. Biol. 726, 93–114.

Leiman, P.G., Basler, M., Ramagopal, U.A., Bonanno, J.B., Sauder, J.M.,

Pukatzki, S., Burley, S.K., Almo, S.C., and Mekalanos, J.J. (2009). Type VI

secretion apparatus and phage tail-associated protein complexes share a

common evolutionary origin. Proc. Natl. Acad. Sci. USA 106, 4154–4159.

Maxwell, K.L., Fatehi Hassanabad, M., Chang, T., Paul, V.D., Pirani, N., Bona,

D., Edwards, A.M., and Davidson, A.R. (2013). Structural and functional

studies of gpX of Escherichia coli phage P2 reveal a widespread role for

LysM domains in the baseplates of contractile-tailed phages. J. Bacteriol.

195, 5461–5468.

Meusch, D., Gatsogiannis, C., Efremov, R.G., Lang, A.E., Hofnagel, O., Vetter,

I.R., Aktories, K., and Raunser, S. (2014). Mechanism of Tc toxin action re-

vealed in molecular detail. Nature 508, 61–65.

Michel-Briand, Y., and Baysse, C. (2002). The pyocins of Pseudomonas aeru-

ginosa. Biochimie 84, 499–510.

Nakayama, K., Takashima, K., Ishihara, H., Shinomiya, T., Kageyama, M.,

Kanaya, S., Ohnishi, M., Murata, T., Mori, H., and Hayashi, T. (2000). The

R-type pyocin of Pseudomonas aeruginosa is related to P2 phage, and the

F-type is related to lambda phage. Mol. Microbiol. 38, 213–231.

Nazarov, S., Schneider, J.P., Brackmann, M., Goldie, K.N., Stahlberg, H., and

Basler, M. (2018). Cryo-EM reconstruction of Type VI secretion system base-

plate and sheath distal end. EMBO J. 37, 37.

Park, Y.J., Lacourse, K.D., Cambillau, C., DiMaio, F., Mougous, J.D., and

Veesler, D. (2018). Structure of the type VI secretion system TssK-TssF-

TssG baseplate subcomplex revealed by cryo-electron microscopy. Nat.

Commun. 9, 5385.

Pell, L.G., Liu, A., Edmonds, L., Donaldson, L.W., Howell, P.L., and Davidson,

A.R. (2009). The X-ray crystal structure of the phage lambda tail terminator pro-

tein reveals the biologically relevant hexameric ring structure and demon-

strates a conserved mechanism of tail termination among diverse long-tailed

phages. J. Mol. Biol. 389, 938–951.

Pettersen, E.F., Goddard, T.D., Huang, C.C., Couch, G.S., Greenblatt, D.M.,

Meng, E.C., and Ferrin, T.E. (2004). UCSF Chimera–a visualization system

for exploratory research and analysis. J. Comput. Chem. 25, 1605–1612.

Rohou, A., and Grigorieff, N. (2015). CTFFIND4: Fast and accurate defocus

estimation from electron micrographs. J. Struct. Biol. 192, 216–221.

Russell, A.B., Wexler, A.G., Harding, B.N., Whitney, J.C., Bohn, A.J., Goo,

Y.A., Tran, B.Q., Barry, N.A., Zheng, H., Peterson, S.B., et al. (2014). A type

VI secretion-related pathway in Bacteroidetes mediates interbacterial antago-

nism. Cell Host Microbe 16, 227–236.

Rybakova, D., Radjainia, M., Turner, A., Sen, A., Mitra, A.K., and Hurst, M.R.

(2013). Role of antifeeding prophage (Afp) protein Afp16 in terminating the

length of the Afp tailocin and stabilizing its sheath. Mol. Microbiol. 89, 702–714.

Rybakova, D., Schramm, P., Mitra, A.K., and Hurst, M.R. (2015). Afp14 is

involved in regulating the length of Anti-feeding prophage (Afp). Mol. Microbiol.

96, 815–826.

Sarris, P.F., Ladoukakis, E.D., Panopoulos, N.J., and Scoulica, E.V. (2014). A

phage tail-derived element with wide distribution among both prokaryotic

domains: a comparative genomic and phylogenetic study. Genome Biol.

Evol. 6, 1739–1747.

Scholl, D. (2017). Phage Tail-Like Bacteriocins. Annu. Rev. Virol. 4, 453–467.

Scott, H.N., Laible, P.D., and Hanson, D.K. (2003). Sequences of versatile

broad-host-range vectors of the RK2 family. Plasmid 50, 74–79.

Sheets, J., and Aktories, K. (2017). Insecticidal Toxin Complexes from Photo-

rhabdus luminescens. Curr. Top. Microbiol. Immunol. 402, 3–23.

Shikuma, N.J., Pilhofer, M., Weiss, G.L., Hadfield, M.G., Jensen, G.J., and

Newman, D.K. (2014). Marine tubeworm metamorphosis induced by arrays

of bacterial phage tail-like structures. Science 343, 529–533.

Sievers, F., Wilm, A., Dineen, D., Gibson, T.J., Karplus, K., Li, W., Lopez, R.,

McWilliam, H., Remmert, M., Soding, J., et al. (2011). Fast, scalable generation

of high-quality protein multiple sequence alignments using Clustal Omega.

Mol. Syst. Biol. 7, 539.

Sunderland, K.S., Yang, M., and Mao, C. (2017). Phage-Enabled Nanomedi-

cine: From Probes to Therapeutics in Precision Medicine. Angew. Chem. Int.

Ed. Engl. 56, 1964–1992.

Taylor, N.M., Prokhorov, N.S., Guerrero-Ferreira, R.C., Shneider, M.M.,

Browning, C., Goldie, K.N., Stahlberg, H., and Leiman, P.G. (2016). Structure

of the T4 baseplate and its function in triggering sheath contraction. Nature

533, 346–352.

Taylor, N.M.I., van Raaij, M.J., and Leiman, P.G. (2018). Contractile injection

systems of bacteriophages and related systems. Mol. Microbiol. 108, 6–15.

van Raaij, M.J., Mitraki, A., Lavigne, G., and Cusack, S. (1999). A triple beta-

spiral in the adenovirus fibre shaft reveals a new structural motif for a fibrous

protein. Nature 401, 935–938.

Wang, J., Brackmann, M., Castano-Dıez, D., Kudryashev, M., Goldie, K.N.,

Maier, T., Stahlberg, H., and Basler, M. (2017). Cryo-EM structure of the

extended type VI secretion system sheath-tube complex. Nat. Microbiol. 2,

1507–1512.

Waterhouse, A., Bertoni, M., Bienert, S., Studer, G., Tauriello, G., Gumienny,

R., Heer, F.T., de Beer, T.A.P., Rempfer, C., Bordoli, L., et al. (2018). SWISS-

MODEL: homology modelling of protein structures and complexes. Nucleic

Acids Res. 46, W296–W303.

Wilkinson, P., Waterfield, N.R., Crossman, L., Corton, C., Sanchez-Contreras,

M., Vlisidou, I., Barron, A., Bignell, A., Clark, L., Ormond, D., et al. (2009).

Comparative genomics of the emerging human pathogen Photorhabdus

asymbiotica with the insect pathogen Photorhabdus luminescens. BMC

Genomics 10, 302.

Yang, G., Dowling, A.J., Gerike, U., ffrench-Constant, R.H., and Waterfield,

N.R. (2006). Photorhabdus virulence cassettes confer injectable insecticidal

activity against the wax moth. J. Bacteriol. 188, 2254–2261.

Yap, M.L., Klose, T., Arisaka, F., Speir, J.A., Veesler, D., Fokine, A., and Ross-

mann, M.G. (2016). Role of bacteriophage T4 baseplate in regulating assembly

and infection. Proc. Natl. Acad. Sci. USA 113, 2654–2659.

Young, R., and Gill, J.J. (2015). MICROBIOLOGY. Phage therapy redux–What

is to be done? Science 350, 1163–1164.

Zhang, K. (2016). Gctf: Real-time CTF determination and correction. J. Struct.

Biol. 193, 1–12.

Zhang, C., Mortuza, S.M., He, B., Wang, Y., and Zhang, Y. (2018). Template-

based and free modeling of I-TASSER and QUARK pipelines using predicted

contact maps in CASP12. Proteins 86 (Suppl 1 ), 136–151.

Zheng, S.Q., Palovcak, E., Armache, J.P., Verba, K.A., Cheng, Y., and Agard,

D.A. (2017a). MotionCor2: anisotropic correction of beam-induced motion for

improved cryo-electron microscopy. Nat. Methods 14, 331–332.

Zheng,W.,Wang, F., Taylor, N.M.I., Guerrero-Ferreira, R.C., Leiman, P.G., and

Egelman, E.H. (2017b). Refined Cryo-EM Structure of the T4 Tail Tube:

Exploring the Lowest Dose Limit. Structure 25, 1436–1441.

Zoued, A., Durand, E., Brunet, Y.R., Spinelli, S., Douzi, B., Guzzo, M., Flaug-

natti, N., Legrand, P., Journet, L., Fronzes, R., et al. (2016). Priming and poly-

merization of a bacterial contractile tail structure. Nature 531, 59–63.

Cell 177, 370–383, April 4, 2019 383

STAR+METHODS

KEY RESOURCE TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies

Rabbit polyclonal anti-Pvc1 This study N/A

Rabbit polyclonal anti-Pvc8 This study N/A

Rabbit polyclonal anti-Pvc13 This study N/A

Rabbit polyclonal anti-Pvc16 This study N/A

Bacterial and Virus Strains

Photorhabdus asymbiotica ATCC ATCC43949

Escherichia coli EPI300 Lucigen EC300110

Escherichia coli EC100 Lucigen EC10010

Chemicals, Peptides, and Recombinant Proteins

Cas9 protein Jiang et al., 2015 N/A

EKKDITISLTNDAG Genscript Pvc1

LWARLGKPYASHES Genscript Pvc8

QTLSNPKAVGPDID Genscript Pvc13

EDLQLRSAESRGFD Genscript Pvc16

Critical Commercial Assays

GELase Agarose Gel-Digesting Preparation Kit Lucigen G09200

EZ-Tn < KAN-2 > Insertion Kit Lucigen EZI982K

Gibson Assembly Master Mix New England Biolabs E2611S

Deposited Data

Baseplate reconstructed in C6 symmetry cryo-EM map This study EMDB: EMD-9765

Baseplate reconstructed in C3 symmetry cryo-EM map This study EMDB: EMD-9764

Cap cryo-EM map This study EMDB: EMD-9763

Sheath-tube complex in the extended state cryo-EM map This study EMDB: EMD-9760

Sheath complex in the contracted state cryo-EM map This study EMDB: EMD-9761

Full length PVC cryo-EM map This study EMDB: EMD-9762

Baseplate atom model This study PDB: 6J0N

Central spike atom model This study PDB: 6J0M

Cap atom model This study PDB: 6J0F

Sheath-tube complex in the extended state atom model This study PDB: 6J0B

Sheath complex in the contracted state atom model This study PDB: 6J0C

Oligonucleotides

sgRNA_L: ataattacatcttcatcatt This study CNM3_sgL

sgRNA_R: gcgaattatttgagaatgaa This study CNM3_sgR

Recombinant DNA

pRK404 Scott et al., 2003 N/A

pCNM3 This study N/A

pBR-Reg This study N/A

pBR322 New England Biolabs N3033S

pBBR1MCS5 Kovach et al., 1995 N/A

pBBR-Pvc16 This study N/A

pBBR-Pvc16_179 This study N/A

pBBR-Pvc16_192 This study N/A

(Continued on next page)

e1 Cell 177, 370–383.e1–e5, April 4, 2019

Continued

REAGENT or RESOURCE SOURCE IDENTIFIER

pCNM3-DPvc1 This study N/A

pCNM3-DPvc2 This study N/A

pCNM3-DPvc3 This study N/A

pCNM3-DPvc4 This study N/A

pCNM3-DPvc5 This study N/A

pCNM3-DPvc6 This study N/A

pCNM3-DPvc7 This study N/A

pCNM3-DPvc8 This study N/A

pCNM3-DPvc9 This study N/A

pCNM3-DPvc10 This study N/A

pCNM3-DPvc11 This study N/A

pCNM3-DPvc12 This study N/A

pCNM3-DPvc13 This study N/A

pCNM3-DPvc14 This study N/A

pCNM3-DPvc15 This study N/A

pCNM3-DPvc16 This study N/A

Software and Algorithms

AutoEMation2 J. Lei, Tsinghua University N/A

MotionCor2 Zheng et al., 2017a http://msg.ucsf.edu/em/software/motioncor2.html

CTFFIND4 Rohou and Grigorieff, 2015 http://grigoriefflab.janelia.org/ctffind4

RELION2.0 Kimanius et al., 2016 https://www2.mrc-lmb.cam.ac.uk/relion/

index.php?title=Main_Page

Gctf Zhang, 2016 https://www.mrc-lmb.cam.ac.uk/kzhang/

ResMap Kucukelbir et al., 2014 http://resmap.sourceforge.net/

UCSF Chimera Pettersen et al., 2004 https://www.cgl.ucsf.edu/chimera/

SWISS-MODEL Waterhouse et al., 2018 https://swissmodel.expasy.org/

I-TASSER Zhang et al., 2018 https://zhanglab.ccmb.med.umich.edu/I-TASSER/

Coot Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/personal/

pemsley/coot/

PSIPRED Buchan et al., 2013 http://bioinf.cs.ucl.ac.uk/psipred/

Phenix.real_space_refine Adams et al., 2010 https://www.phenix-online.org/documentation/

reference/real_space_refine.html

MolProbity Chen et al., 2010 https://www.phenix-online.org/documentation/

reference/molprobity_tool.html

Clustal Omega Sievers et al., 2011 https://www.ebi.ac.uk/Tools/msa/clustalo/

MEGA7 Kumar et al., 2016 https://www.megasoftware.net/

Evolview v2.6 He et al., 2016 http://www.evolgenius.info/evolview/#login

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Ning Gao

(gaon@pku.edu.cn).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

P. asymbiotica and E. coli strains were cultured in LB broth at 30�C and 37�C, respectively. Both E. coli EPI300 and EC100were used

for DNAmanipulation, and E. coli EPI300was used for protein purification. Antibiotics were used as following: ampicillin, 100 mgmL-1;

tetracycline, 10 mg mL-1; kanamycin, 25 mg mL-1; gentamycin, 10 mg mL-1.

Cell 177, 370–383.e1–e5, April 4, 2019 e2

METHOD DETAILS

Plasmids constructionPVC-expressing plasmid pCNM3 (PAU_03353 to PAU_03338) was constructed following the Cas9-Assisted Targeting of Chromo-

some Segments (CATCH) method as described by Jiang et al. (2015). Briefly, the overnight P. asymbiotica cultures were diluted and

embedded in agarose gel plugs at a concentration of 23 108 cells mL-1. The plugs were treated with proteinase K and lysozyme, and

washed excessively with buffer according to the CHEF Bacterial Genomic DNA Plug Kit (Bio-Rad). 1 mM phenylmethyl sulphonyl

fluoride was then used to inactivate the residual proteinase K. For the Cas9-guided cleavage, the plug was first equilibrated in

cleavage buffer (20 mMHEPES, pH 7.5, 150mMKCl, 10mMMgCl2, 0.5 mMDTT and 0.1 mMEDTA) for 30min at room temperature,

and then transferred into new cleavage buffer containing Cas9 protein (0.1 mg mL-1) and the sgRNA pair for 2 h incubation at 37�C.After the cleavage, the gel plug wasmelted and digested by agarase according to the GELase Agarose Gel-Digesting Preparation Kit

(Epicenter). The resulting DNA was precipitated by ethanol and resuspended in nuclease-free water. To ligate the DNA segment into

the expressing plasmid, the Gibson Assembly Master Mix (NEB) was applied. The broad-host-range plasmid pRK404 was PCR

amplified using primers that have a template priming sequence and an overlap sequence for subsequent assembly, followed by

DpnI digestion. After purification, 1 mL plasmid vector and 4 mL target DNA were mixed with Gibson reagent and incubated for 1 h

at 50�C. 1 mL mixture was then electroporated into TransforMax EPI300 E. coli cells (Epicenter). The positive clones were verified

by PCR using primers at two junction sites. Further verifications were applied by enzyme digestion (BamHI+NheI+XbaI) of the

extracted plasmids.

For the plasmid pBR-Reg expressing the operon containing PAU_RS16570, PAU_RS16565 and PAU_RS16560, PCR fragments

including all these three genes were amplified from the P. asymbiotica genome and cloned into the pBR322 plasmid by BamHI/SalI

double digestion. To produce the full length and truncated Pvc16 proteins (Pvc16, Pvc16_179 and Pvc16_192), PCR products were

amplified respectively and cloned into broad-host-vector pBBR1MCS5.

Protein complex purificationThe pBR-Reg expressing potential regulator genes was transformed into E. coli EPI300 strain harboring plasmid pCNM3, which

expresses PVC structural genes. Cells were grown overnight and inoculated into 400 mL LB broth for another 24 h growth at

30�C. Bacterial cells were collected and lysed in 30mL buffer P (25mMTris, pH 7.4, 140mMNaCl, 3 mMKCl, 200 mgmL-1 lysozyme,

50 mg mL-1 DNase I, 0.5% Triton X-100, 5 mM MgCl2, 1 3 protease inhibitor (MCE)) for 30 min at 37�C. After centrifugation of cell

lysate (16,000 3 g, 10 min), the supernatant was applied for ultracentrifuge at 250,000 3 g for 60 min at 4�C. The supernatant

was then discarded and the pellet was suspended gently in 1 mL PBS. After another centrifugation at 16,000 3 g for 10 min at

4�C, the supernatant was ultracentrifuged for the second time at 250,000 3 g for 60 min at 4�C to pellet the protein complex. The

pellet was again resuspended in 200 mL ice-cold PBS and centrifuged at 14,000 rpm for 5 min at 4�C. The supernatant containing

the PVC particles were stored at �80�C until usage.

PVC ORFs mutagenesisTo inactivate each of the 16 ORFs in the PVC cluster, a Tn5 transposon insertion kit (Lucigen) was applied. Briefly, the expressing

plasmid pCNM3was treated according to the manufacturer’s manual and then electroporated into the electrocompetent E. coli cells

(TransforMax EC100, Lucigen). The mutated transformants on the kanamycin plates for each ORF were selected by colony-PCR

verification using primers flanking the target gene. Finally, the transposon insertion clones were sequenced for further analysis.

The resulting plasmids were subsequently used for mutant PVC particle production.

PAGE, Mass Spectrometry and western blot analysisThe purified PVC wild-type or mutant particles were heated at 70�C for 10 minutes with 13 NuPAGETM LDS (lithium dodecyl sulfate)

sample buffer. The samples were then loaded on the Bolt 4%–12% Bis-Tris Plus gel for separation. The protein bands were excised

from the gels for Mass Spectrometry identifications (Beijing Biotech-Pack Scientific). Raw MS files were searched against the

P. asymbiotica ATCC43949 protein database (UniProt). Only proteins with at least two unique peptides were included for analysis.

For blotting, the gels were transferred to PVDF membrane (Millipore) using a Bio-rad semi-dry blotter. Standard protocol for

membrane probing was applied to detect the protein bands of interest. The polyclonal primary antibodies were generated from

rabbit using synthesized polypeptides (Genscript). The peptide sequence for each PVC ORF was: Pvc1, EKKDITISLTNDAG;

Pvc8, LWARLGKPYASHES; Pvc13, QTLSNPKAVGPDID; Pvc16, EDLQLRSAESRGFD. The detection was performed by using

goat anti-rabbit secondary antibody, HRP and ECL Plus western blotting substrate (Thermo Fisher Scientific), and then visualized

by Tanon 5200 (Tanon).

Electron MicroscopyFor negative staining, aliquots of 2-4 mL PVC samples were added onto copper grids coated with continuous carbon, washed and

stained with 2% uranyl acetate. The negative-stained grids were dried in room temperature and checked on an FEI Tecnai T12 elec-

tron microscope operated at 120 kV. The cryo-grids preparation was performed with an FEI Vitrobot Mark IV at a temperature of 4�Cand a humidity of 100%. 4 mL aliquots of samples were applied onto glow-discharged holey-carbon copper grids (Quantifoil, R2/2,

e3 Cell 177, 370–383.e1–e5, April 4, 2019

300mesh). The cryo-grids screening and data acquisition were performed using a Cs-corrector equipped FEI Titan Kriosmicroscope

operated at 300 kV. Images were recorded using an FEI Falcon II camera at a nominal magnification of 59000x, corresponding to a

calibrated pixel size of 1.121 A at object scale. Micrographs were collected automatically using AutoEMation2 (developed by J. Lei)

with a defocus ranging from 1.0-2.0 mm, and at themovie mode, with a dose rate of 28.8 e�A�2 s�1 and a total exposure time of 1.6 s,

yielding a movie stack of 26 frames for each micrograph.

Image Processing2,631 movie stacks were collected for the PVC particles. Drift correction and dose weighting were applied on movie stacks using

MotionCor2 (Zheng et al., 2017a) excluding the first two and the last frames, generating summed images with or without dose

weighting. The parameters of contrast transfer function (CTF) of each micrograph were evaluated using CTFFIND4 (Rohou and Gri-

gorieff, 2015) based on summed images without dose weighting. Micrographs were manually screened using RELION2.0 (Kimanius

et al., 2016) based on the presence of ice contamination and CTF fitting.

For the extended PVC particles, particle picking was performed manually using RELION2.0 to label the start (central spike-base-

plate)-end (cap) coordinate pairs of each PVC particle (Figure S2A). Particle extraction using RELION2.0 was operated in the ‘‘Extract

helical segments’’ mode to extract helical segments of each PVC particle based on the manually labeled start-end coordinate pairs

with a step size of 78 A. All the first segments from the start position (86K segments) of each PVC particle, corresponding to the base-

plate region, were pooled to refine the structure of the baseplate (Figure S2B), while all the last segments (86K segments) were pooled

to refine the structure of the sheath-tube terminator (Figure S2C). The segments in the middle excluding the first and last ones (966K

segments) were used to refine the structure of the sheath (Pvc2) and tube (Pvc1) (Figure S3A).

For the central spike-baseplate region, the corresponding segments were subjected to three rounds of 2-dimensional (2D) classi-

fication usingRELION2.0 to exclude non-baseplate or other unqualified segments. To determine the correct initial model and improve

the performance of 3-dimensional (3D) classification, a round 3D refinement was applied to the 67K selected segments after 2D

classification, with a density cylinder as the initial model. After 3D classification, 63K selected segments were re-centered, re-

extracted with a box size of 600x600 (the intact Pvc13 would be included in), and subjected to 3D refinement with C6 symmetry

imposed. To further improve the resolution of the baseplate, the center of the 3D volume was adjusted and the segments were re-

extracted with a box size of 360x360 pixels. After substitution of dose weighted particles and local defocus values (calculated by

Gctf [Zhang, 2016]), the final resolution of the baseplatewas improved to 3.5 A. The symmetry of the central spikePvc7 isC3. To locally

improve the density map of Pvc8, all the segments were copied 5 times (6 copied in total) with the command ‘‘relion_particle_

symmetry_expand–C6,’’ and classified into 6 groups, with the option ‘‘–skip alignment,’’ and with a mask only containing Pvc8 and

Pvc10 applied. The structure of one group (�40% segments) showed perfect C3 symmetry and more high-resolution features. The

segments from that group were subjected to 3D reconstruction (C3 symmetry applied) using the command ‘‘relion_reconstruct’’

applying the alignment information from the global refinement. The following the B-factor correction was through ‘‘relion_image_

handler,’’ yielding a final density map including enough high-resolution features to build the atom model of Pvc8 (Figure S2B).

The cap segments were similarly processed (Figure S2C). Several rounds of 2D and 3D classification were applied to discard bad

segments. After the first round of 3D classification, four groups (53K segments) were selected. Since the centers of the four density

maps were not identical, the coordinates and box size of the segments were adjusted prior to further 3D classification. After the sec-

ond rounds of 3D classification, 53K segments were subjected to 3D refinement, rendering a final density map at a resolution of 3.8 A.

The lengths of wild-type PVC particles were calculated by measuring the lengths of the intact particles in 3D space. The start-end

positions of each particle define a pair of X and Y coordinates, and the remaining pair of Z coordinates was determined by local-

defocus values of start-end segments. The coordinate information were extracted from the alignment information of 3D refinement

of central spike-baseplate segments and related cap segments, and rounded in the unit of angstrom. Length distribution was based

on 32,800 intact PVC particles, showing a predominate length of �117 nm (Figure S1E). Subsequently, 7,914 intact PVC particles of

116-118 nm were extracted and subjected to 3D refinement, rendering an intact PVC structure at 6.2 A.

To plot the length distributions of mutant PVC particles with Pvc6 or Pvc14 or Pvc16 deleted, samples were negatively stained as

described above, and 32 images were acquired for eachmutant samples using a FEI Tecnai T20 electron microscope operated at an

accelerating voltage of 120 kV and a nominal magnification of 25000 3. 964, 1816, and 921 particles (with start-end coordinates

labeled) were manually picked using RELION2.0, for the DPvc6, DPvc14 and DPvc16, respectively. Lengths of the mutant particles

were calculated by start-end coordinates (Table S4).

As to the reconstruction of middle sheath-tube segments, the start and end segments of each PVC particles were discarded. After

two rounds of 2D classification, two rounds of 3D classification were applied on the selected 920K segments with C6 symmetry

imposed to discard segments containing residual density for the baseplate, fiber, Pvc3 or the cap. 551K qualified segments after

3D classification were subjected to 3D refinement imposing helical symmetry using helical reconstruction in RELION (He and

Scheres, 2017), with the final resolution improved to 2.9 A. The refined helical twist is 19.9�, and the refined helical rise is 39.3 A

(Figure S3A).

For the contracted particles, 3,284 start-end coordinate pairs were manually labeled using RELION2.0, and 42K helical segments

were extracted with a step size of 34 A. After 2D and 3D classification, 36K segments were finally refined to 3.7-A with helical sym-

metry imposed. The refined helical twist is 31.4� and the refined helical rise is 17.0 A (Figure S3B).

Cell 177, 370–383.e1–e5, April 4, 2019 e4

All the resolution estimations were based on the gold-standard FSC at a criterion of 0.143 (Figures S2D and S3C), after correction

of the mask effect. The density maps were sharpened with auto-estimated B-factors using RELION2.0. The local resolution maps

(Figures S2E and S2F) were calculated using ResMap (Kucukelbir et al., 2014) and examined using UCSF Chimera (Pettersen

et al., 2004).

Model buildingFor Pvc1, Pvc2, Pvc3, Pvc4, Pvc5, Pvc8, Pvc9 and Pvc11, SWISS-MODEL (Waterhouse et al., 2018) or I-TASSER (Zhang et al., 2018)

were used to search the templates and to build the initial models.. Initial models of Pvc1, Pvc2, Pvc9 and Pvc11 were built based on

PDB: 4TV4, 3J9Q, 2IA7, 5HX2, respectively. The initial model of Pvc8 was built on templates of PDB: 4UHV, 4S37, 4PEU. These initial

models were docked into the density map by rigid-body fitting, followed by manually rebuilding in Coot (Emsley et al., 2010). Sec-

ondary structures were predicted using PSIPRED (Buchan et al., 2013) to aid the chain tracing and model building. For Pvc3,

Pvc4 and Pvc5, initial models were built based on the atomic model of Pvc1 or Pvc2, and manually adjusted in Coot.

Models of Pvc7, Pvc12, Pvc16 and domain III of Pvc11 were built de novo in Coot based on the information of density maps and

secondary structures.

The models were refined against the corresponding maps using Phenix.real_space_refine (Adams et al., 2010) with geometry

restraints and secondary structure restraints applied. The final models were evaluated using MolProbity (Chen et al., 2010).

Bioinformatics analysisMultiple sequence alignments were performed using Clustal Omega and MEGA7 (Kumar et al., 2016; Sievers et al., 2011). Phyloge-

netic tree was generated by Neighbor-joining methods and annotated by Evolview version 2.6 (He et al., 2016). All sequences were

obtained from UniProt database.

QUANTIFICATION AND STATISTICAL ANALYSIS

The protein concentration was examined by Bradford reagent (Sigma) and calculated against a standard curve created using BSA

(Amresco). DNA concentration was determined using Nanodrop spectrophotometer (Thermo-Fisher).

DATA AND SOFTWARE AVAILABILITY

The accession number for the cryo-EM density maps of the baseplate reconstructed in C6 symmetry, in C3 symmetry, the cap, the

sheath-tube complex in extended state, the sheath complex in contracted state, and the full length PVC reported in this paper are

EMDB: EMD-9765, EMD-9764, EMD-9763, EMD-9760, EMD-9761, EMD-9762 respectively. The accession number for the corre-

sponding atom models reported in this paper are PDB: 6J0N, 6J0M, 6J0F, 6J0B, 6J0C. The raw pictures of western blot and gel

staining are provided at: https://data.mendeley.com/datasets/nmvkfzj9m4/draft?a=3f5f3e3f-adc8-4ca3-9a17-32bcf256f51c

e5 Cell 177, 370–383.e1–e5, April 4, 2019

Supplemental Figures

(legend on next page)

Figure S1. Clusters of PVC-like Genes Identified in the Genomes of Prokaryotes and Archaea and Characterization of the Intact PVC Par-

ticles, Related to Figure 1

(A) Phylogenetic tree of PVC clusters in bacteria and archaea based on the unique DUF4255-containing proteins. The alignments of 2246 sequences distributed

across all taxonomic groups were performed using the Clustal Omega and the phylogenetic tree was built using the Neighbor-joining method without distance

corrections. Five distinct clades can be detected. The major phyla in each clade are: Clade 1, Cyanobacteria; Clade 2, Archaea and Firmicutes; Clade 3,

Bacteroidetes and Cholroflexi; Clade 4, Bacteroidetes and Cyanobacteria; Clade 5, Cholroflexi, Cyanobacteria and Deinococcus. Proteobacteria and Actino-

bacteria can be found in almost all the clades.

(B) PVC clusters in the genomes of a few representative species. The locus tags of the first and last ORF are labeled. The homologous genes are colored ac-

cording to the coloring scheme in the bottom. TmP, tape measure protein.

(C) LDS-PAGE andMS analysis of purified PVC particles. The PVC protein bands identified byMS analysis in the gel slices are labeled. Note that all 16 PVCORFs

in the pvc locus are identified in the MS data.

(D) A representative micrograph of the nail-like PVC particles by negative staining electron microscopy. Representative extended and contracted particles are

indicated by arrows.

(E) Length variation of PVC particles. A total of 32,800 particles were measured. The predominant length of the PVC particles is 117 nm.

(legend on next page)

Figure S2. Cryo-EM Data Processing of the Baseplate and the Cap Regions in PVC Particles, Related to Figures 1 and 2

(A) Representative raw cryo-EM images of PVC particles.

(B and C) Data processing of the baseplate (B) and cap (C) segments, including manual particle-picking, rounds of 2D and 3D classification, structural refinement

and masked based refinement and 3D classification.

(D) FSC curves from the final refinements of the baseplate segment, the cap segment, and the intact PVC particles. The resolution was determined at a criterion of

gold-standard FSC 0.143.

(E and F) Local resolution maps of the baseplate (E) and cap (F) density maps.

Figure S3. Cryo-EM Data Processing of the Sheath-Tube Complex in the Extended and Contracted States, Related to Figures 1 and 2

(A and B) Data processing of sheath-tube complex in extended (A) and contracted (B) states. The processing includes manually start-end coordinates labeling

(shown in Figure S2A), rounds of 2D and 3D classification and helical refinement.

(C) FSC curves from the final round of structural refinements. The resolution was determined at a criterion of gold-standard FSC 0.143.

Figure S4. Interactions between the Central Hub and Wedge Proteins, Related to Figures 2 and 3

(A) Bottom view of the interaction between Pvc11 and the central hub. Due to the symmetry mismatch, Domain II of Pvc11 protein (red and blue) interacts with

different surface of the Pvc8 trimer. To highlight a single Pvc11-Pvc12 unit, one Pvc11-Pvc12 dimer is superimposed with the density map (Pvc11 in blue and

Pvc12 in cyan).

(B) Atomic model of one Pvc11-Pvc12 heterodimer.

(C) Superimposition of the core bundle of Pvc12 with that of a T4 gp6-gp7 heterodimer.

(D and F) Side views of two interfaces between Pvc11 and Pvc8. Note that part of domain III of Pvc11 was not modeled.

(E and G) The interaction sites in (D) and (F) are highlighted by dashed black ovals.

(H) Superimposition of State I (D and E) and State II (F and G). The alignment was done using the first two layers of tube and shealth proteins as reference. As

shown, domains I, IV and V of Pvc11 are nearly unchanged, while domains II-III display a rigid-body rotation in one state.

Figure S5. Sequence Alignments and Structural Comparisons of the Tube and Sheath Proteins, Related to Figures 2 and 4

(A) Sequence alignment of three tube proteins. The extra LysM motif in Pvc7 is labeled.

(B) Schematic diagram of the sequences of Pvc1, Pvc5, Pvc7, and gp53 with LysM motif highlighted.

(C) Sequence alignment of LysM motifs from Pvc7 and gp53. The conserved residues of LysM (Maxwell et al., 2013) are indicated by arrows.

(D) Structural comparison of the tube protein variants, Pvc7 and Pvc1. Structures were aligned using their b-barrel domains. Structural differences are seen

between Pvc7 and Pvc1, in addition to the extra LysM domain in Pvc7. Major structural differences are denoted by asterisks.

(E) Structural comparison of the tube protein variants, Pvc5 and Pvc1. Major structural differences are denoted by asterisks.

(F) Sequence alignment of the three sheath proteins. The sequences of the protrusion structures in Pvc3 or Pvc4 (see also Figures 4A–4C) compared to Pvc2 are

highlighted in red and cyan boxes, respectively.

Figure S6. Sequence and Structure of the Pvc13 Fiber, Related to Figures 1, 3, and 4

(A) Schematic diagram of Pvc13 sequence features in its primary sequence. Three major domains can be identified.

(B) Density map of tail fiber reconstructed by mask-based 3D classification. Three Pvc3 protrusions (fiber docking domain) are also shown.

(C and D) Zoomed-in views of the boxed region in (B) with pseudo atommodel superimposed. Six a helices were identified, indicating the trimeric composition of

a fiber.

(E) Sequence alignment of the 10 repeats (17 amino acids in length) in themiddle region of Pvc13. Conserved residues involved in forming b strands are boxed and

indicated with the symbols of b. The pattern of conserved b sheet repeats is highly similar to the repeats in the adenovirus type 2 shaft (van Raaij et al., 1999).

(F) Segmented density maps showing the docking site of the Pvc13 tail fiber on Pvc12. The docking is mainly mediated by domain VII of Pvc12 (colored black).

(legend on next page)

Figure S7. Structural Comparisons of the Sheath Proteins and Electrostatic Diagram of the Sheath-Tube or Tube-Tube Interfaces and the

Lumen Surface, Related to Figures 1, 2, and 4

(A–D) Comparisons of Pvc2 in the extended state with sheath structure in R-type pyocin (A), T4 phage (B), T6SS (C) and Pvc2 in the contracted state (D),

respectively. Pvc2 in the extended state is colored in blue and the others in red.

(E) Ribbon diagram in the initiation region of the tube-sheath complex, highlighting the paired interactions between sheath variants and respective tube variants.

For clarification, only domain I of the sheath protein is shown.

(F–I) Surface charge distributions of the sheath-tube interfaces are shown. The interaction sites are indicated by dashed black ovals.

(J–M) Surface charge distributions of the inter-ring interfaces on tube hexamers. Negative charge is in red, positive in blue and neutral in white. The interaction

sites are indicated by dashed black ovals. Upper panels, top surfaces; lower panels, bottom surfaces.

(N) Electrostatic diagram of the lumen surface of the tube.