This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

Author's personal copy

Comparative analysis of secreted enzymes between theanthropophilic–zoophilic sister species Trichophytontonsurans and Trichophyton equinum

Barry L. PREUETTa, Eric SCHUENEMANNa, Jacob T. BROWNa, Michelle E. KOVACa,Sandeep K. KRISHNANa, Susan M. ABDEL-RAHMANa,b,*aDivision of Clinical Pharmacology and Medical Toxicology, The Children’s Mercy Hospitals and Clinics, Kansas City,

MO 64108, United StatesbDepartment of Pediatrics, University of Missouri-Kansas City, School of Medicine, Kansas City, MO 64108, United States

a r t i c l e i n f o

Article history:

Received 20 November 2009

Received in revised form

26 February 2010

Accepted 4 March 2010

Available online 10 March 2010

Corresponding Editor: Michael Lorenz

Keywords:

Dermatophyte

Protease

Secreted

Transcript

Trichophyton

a b s t r a c t

Trichophyton tonsurans (TT) and Trichophyton equinum (TE) are two closely related dermato-

phytes with very different host preferences. This study was designed to examine the ge-

netic and transcript level variations of secreted enzymes between TT and TE. Thirty-one

genes representing 10 gene families were selected for comparison and complete genomic

and cDNA sequences were elucidated. Sequence analyses of the selected genes identified

104 polymorphisms between the two dermatophytes, 37 of which are expected to encode

changes in their polypeptide sequence. Quantitative RT-PCR was used to examine the

differences in levels of transcript between TT and TE grown over 14 d in aqueous keratin

medium. Differences in transcript expression between TT and TE were gene specific and

ranged from 1.1-fold to 33-fold. Intra-specific variability across all genes ranged from

41 % to 250 %. Despite their overall genetic similarity, TT and TE exhibit a moderate degree

of variability in the genomic make-up of their secreted enzymes and the extent to which

they are transcribed when grown in an aqueous keratin medium. Such differences may

contribute to how these genetically similar organisms have adapted to infect divergent

host organisms.

ª 2010 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Introduction

The ability to breach the epidermal barrier and cause infection

in otherwise healthy hosts is a characteristic trait shared by

the zoophilic and anthropophilic dermatophytes (Weitzman

& Summerbell 1995). Facilitating the infection process is

a complement of secreted enzymes that function collectively

to provide a pathway for fungal invasion and liberate nutri-

ents from the keratin-rich structures that comprise the outer

integument of the animals that they infect (Apodaca &

McKerrow 1989a, b; Weitzman & Summerbell 1995; Monod

et al. 2002, 2005; Jousson et al. 2004b; Kano et al. 2005; Giddey

et al. 2007a; Vermout et al. 2008; Zaugg et al. 2009). While these

enzymes appear to be conserved among the dermatophytes

examined to date (Apodaca & McKerrow 1989a; Mignon et al.

1998; Brouta et al. 2001, 2002; Descamps et al. 2002; Jousson

et al. 2004a, b; Bhathena et al. 2005; Kano et al. 2005; Monod

et al. 2005; Moallaei et al. 2006; Giddey et al. 2007a, b;

* Corresponding author. Division of Clinical Pharmacology and Medical Toxicology, Children’s Mercy Hospitals and Clinics, 2401 GillhamRd., Kansas City, MO 64108, United States. Tel.: þ1 816 234 3059; fax: þ1 816 855 1958.

E-mail address: srahman@cmh.edu

journa l homepage : www.e lsev ier . com/ l oca te / funb i o

f u n g a l b i o l o g y 1 1 4 ( 2 0 1 0 ) 4 2 9 – 4 3 7

1878-6146/$ – see front matter ª 2010 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.doi:10.1016/j.funbio.2010.03.004

Author's personal copy

Vermout et al. 2008), the manner in which they are expressed

appears to be relatively species-specific (Giddey et al. 2007a).

Notably, this holds for dermatophytes that are genetically

very closely related (Graser et al. 1999; Summerbell et al.

1999). Such specificity suggests that unique dermatophyte–

host relationships may select, or be selected for, based on

the expression patterns of these putative pathogenicity fac-

tors. A more thorough characterization of these genes and

their expression profiles may offer insight into how dermato-

phytes adapt not only to a unique host niche but to distinct

micro-environments within a single host.

The closely related anthropophilic Trichophyton tonsurans

and zoophilic Trichophyton equinum are among the most

recently diverged dermatophyte sister species. As such, they

offer a unique opportunity to examine differences in the

secreted enzyme expression profiles of two dermatophytes

with a high degree of genetic similarity but clear phenetic

distinctions (e.g. host preference, biochemical profile, physiol-

ogy) (Graser et al. 1999; Abdel-Rahman et al. 2007, 2010; Giddey

et al. 2007a). It is plausible that their predilection for divergent

host environments (i.e. human vs. horse) is facilitated, in part,

by the unique profile of enzymes secreted during infection.

This investigation was initiated to examine the genomic orga-

nization of 31 secreted proteolytic and lipolytic genes from

both species as well as compare their levels of transcription

when grown in a medium containing keratin as the sole

nutrient source.

Materials and methods

Genomic characterization

SpecimensTrichophyton tonsurans isolates (n ¼ 12) were derived from

previously acquired clinical specimens (Abdel-Rahman et al.

2006). Trichophyton equinum isolates (n ¼ 2) were purchased

from the Centraalbureau voor Schimmelcultures (CBS127.97,

Utrecht, Netherlands) and the American Type Culture Collec-

tion (ATCC 22443, Manassas, Virginia). Specimens were main-

tained in the laboratory on desiccated and sterilized 12–28

mesh silica particles (Fisher Scientific, Pittsburgh, PA) stored

at 4 �C. Representative strains for T. tonsurans isolates have

been deposited in the Fungal Genomics Stock Center (FGSC,

University of Missouri, Kansas City).

Nucleic acid isolationSabouraud’s agar plates with chloramphenicol and cyclohex-

imide (Northeast Laboratory Services, Winslow, ME) were

inoculated from silica stocks and cultured for 2–3 weeks at

25 �C. Genomic DNA (gDNA) was isolated using the DNeasy

Plant Mini Kit (Qiagen Inc., Valencia, CA) as previously

described (Gaedigk et al. 2003). Total RNA was isolated from

cultures grown in aqueous keratin media as previously

described (Bhathena et al. 2005). RNA quality was assessed

via micro-fluidic chip analysis on the Experion platform

(BioRad, Hercules, CA) and quantified on a NanoDrop 1000

spectrophotometer. Generation of cDNA was performed using

the OmniScript RT kit (Qiagen).

Gene isolationPrimers for the initial amplification of target genes from

Trichophyton tonsurans and Trichophyton equinum were designed

against the published Trichophyton rubrum sequences depos-

ited in GenBank.

Genes were amplified from approximately 10–15 ng of gDNA

using the Platinum Taq HiFi PCR system (Invitrogen, Carlsbad,

CA). The reaction mixtures were incubated at 94 �C for 3 min,

followed by 35–40 cycles of 94 �C for 30 s, 57–63 �C for 30 s,

68 �C for 2 min 30 s, with a final hold at 4 �C. Purity was verified

bygel electrophoresis. PCR productswere eithercolumnpurified

(Stratagene, La Jolla, CA), or directly treated with Exosap-it (USB,

Swampscott, MA). PCR reactions that had contaminating non-

specific bands were separated by gel electrophoresis on 1.5 %

agarose gels andthe main target bandexcisedand purified using

the MinElute gel purification system (Qiagen).

Rapid Amplification of cDNA Ends (RACE)The 50 untranslated region (UTR) for each gene was captured

using the 50RACE system (Invitrogen). The 30 UTR was captured

with a custom designed oligo-dT nucleotide primer (50 AGA

CAT AGA TGA ATC GAG TCG ACA TCG AGT TTT TTT TTT

TTT TTT T 30) and used to generate a cDNA pool using the

OmniScript Reverse Transcriptase kit (Qiagen). Approximately

5–10 ng of cDNA was added to Platinum Taq HiFi (Stratagene)

in a 25 ml PCR reaction with gene specific forward primers, and

an adapter primer nested to the tail of the oligo-dT primer

(50 ACA TAG ATG AAT CGA GTC GAC AT). The reaction mixture

was incubated at 94 �C for 2 min, followed by 35–40 cycles of

94 �C for 30 s, 60 �C for 30 s, 68 �C for 1 min, with a final hold

at 4 �C. Primary PCR products were diluted 1:100 in sterile wa-

ter and 0.5–1.0 ml of the dilution used as template in a second-

ary PCR reaction containing a nested gene specific 50

oligonucleotide primer and a 30 oligonucleotide primer nested

to the adapter primer (50 TGA ATC GAG TCG ACA TCG AG). The

reaction mixture was incubated at 94 �C for 2 min, followed by

35–40 cycles of 94 �C for 30 s, 60 �C for 30 s, 68 �C for 1 min,

with a final hold at 4 �C. PCR products were analyzed for qual-

ity by gel electrophoresis and purified as described above.

SequencingPurified gDNA and cDNA were cycle sequenced using the DYE-

namic ET dye terminator system (Amersham Biosciences,

Pittsburgh, PA). Sequencing reaction products were cleaned

with the CleanSEQ magnetic bead system (Agencourt, Beverly,

MA) and injected on a MegaBACE 500 capillary sequencer.

Sequence data were automatically base called with the

Sequence Analyzer software platform (Amersham Biosci-

ences) and confirmed by manual inspection with Sequencher

DNA analysis software (Gene Codes Corp., Ann Arbor, MI).

Newly generated gDNA and cDNA sequence for Trichophyton

tonsurans and Trichophyton equinum was used to design addi-

tional sequencing oligonucleotide primers and the initial

genomic PCR products re-sequenced to a minimum of 2� cov-

erage. Gene sequences from both species were aligned on the

CLCBio (Cambridge, MS) and Sequencher software platforms

to examine genomic organization, identify sequence varia-

tions and annotate intron/exon boundaries.

Near the completion of this study, the sequencing of

T. equinum was completed by the Broad Institute and relevant

430 B. L. Preuett et al.

Author's personal copy

gene sequences that could not be amplified in this investiga-

tion were obtained from the Dermatophyte Comparative

Genomics Database (www.broad.harvard.edu/annotation/

genome/microsporum_gypseum/MultiHome.html accessed

September 15, 2009).

Transcript expression

SpecimensFive Trichophyton tonsurans isolates were used to examine pro-

tease transcript expression profiles (obtained under an earlier

investigation; Abdel-Rahman et al. 2010). All specimens dem-

onstrated a distinct genetic profile according to our previously

published typing strategy and, where possible, were selected

from different countries of origin to ensure that the maximum

degree of intra-specific variability in transcript expression

could be observed (i.e. Japan, India, the Netherlands, Mexico

and the United States). Trichophyton equinum isolates (n ¼ 4)

originated from Finland and England and were purchased

from Centraalbureau voor Schimmelcultures (CBS127.97,

CBS933.73, CBS112189, and CBS112196).

Thirty-six milligrams of silica particles were inoculated into

5 ml of aqueous keratin medium and each isolate was grown in

duplicate for 4, 7, 10, 12, and 14 d. Isolates were maintained in

an orbital shaker at 32 �C with constant agitation at 110 rpm.

On the day of isolation, cultures were harvested and the pellets

snap frozen for RNA isolation as described above.

Quantitative RT-PCRQuantitative RT-PCR reactions were performed in triplicate

using the QuantiTect SYBR Green RT-PCR kit (Qiagen). With

the exception of sialidase and Lip4 which contained no introns,

intron-spanning primers were used for transcript analysis

(Table 1). Each reaction contained a mixture of 6 ml SYBR green

mastermix, 1.2 ml of each primer (2.5–5 mM), 0.12 ml of RT/PCR

enzyme mix, 3 ml of total RNA (5 ng ml�1), and 0.48 ml of RNase

free water. Reactions were incubated at 50 �C for 30 min fol-

lowed by 95 �C for 15 min, then cycled 40–45 times in a reaction

profile of 95 �C for 20 s, 57–63 �C for 20 s, 72 �C for 20 s, fol-

lowed by 80 �C for 8 s. All samples were analyzed in triplicate

on a Bio-Rad Opticon Monitor 2 or an Eppendorf Realplex4

Mastercycler (Westbury, NY) and relative fluorescence units

averaged for each sample.

Absolute transcript copy number was determined against

a standard curve prepared for each gene ranging from 107 to

101 molecules. Standards were prepared by amplifying the

qPCR gene product from cDNA (confirmed to be the correct

band by agarose gel electrophoresis). The amplified product

was quantified using the Quant-iT dsDNA quantification kit

(Invitrogen) and diluted to 109 molecules which served as

the stock solution. Serial dilutions were prepared immediately

prior to each assay and included, in triplicate, on each plate

along with a water control. Actin expression was quantified

in the same manner as the genes of interest and used to nor-

malize gene expression.

Data analysisAbsolute transcript copy number for each gene was normal-

ized to 1000 copies of actin and this ratio used for all compar-

isons. Average transcript copy number for each gene was

calculated by taking the average absolute copy number from

each strain across all time points. Differences were deter-

mined using an unpaired t-test. Differences between species

in the rate of change in transcript expression over the study

interval were examined by comparing the 95 % confidence

Table 1 – Oligonucleotides used for quantitative RT-PCR

Gene qPCR oligonucleotides

AmPP 50 CACCGGTTGACACGACC

50 CTGAAGTATCTGCCGTCCGTAG

Carb2 50 ATGGTGGCCTACCGCTTC

50 TGAAGCCCTCCATGGTCTC

CarbM14 50 ATGATGCATGAGGATCTCGG

50 TGCCCCAAATGTGAAGG

CarbS10 50 TGGGAAGCTTCAGTGGCAG

50 TCGGTGGTTTCACATATGTCG

CarbY 50 GATTCGGAATGGGATCATGTC

50 AGAACCAGTAGAACAAGTGC

CarbY0 50 CGCAAGTCTGATGACAAGTGG

50 ATTCGAAGAACCAGAAGAAAAGGTG

Ceramidase 50 ATGCCACCACGTACGGG

50 TACAACCGGCCCGGTAACATC

DppIV 50 TAGTCCAGCATGAAGCTCCTC

50 AGGATCAATGCTCCATCGTC

DppV 50 ATTCACCCCAGAGGACTTCATC

50 TAACGTAGACGATCTTGGTGCC

Lap1 50 CAGGATCTTCGACAGCGAGG

50 GTCATCCTGAGTGACCATAG

Lap2 50 CTGCTTGCCATAGTCAGACTTGT

50 TTAAGCAGAAGGGCCAAG

Lip1 50 CTAGAATGGGGCTATACGGTTG

50 GCGATGAATGCCTTATTGAAG

Lip3 50 GTATTGCACCACAGAGGCTC

50 AATGTGGCCCGCGAGAGTTC

Lip4 50 ATGCTCGGAAGAACATACGG

50 TAGCGTGCAGATTGACGTTG

Mep1 50 CTGTCGACCTGAATGAGTTCCG

50 TTGCCAACGTTGACGTTGAAG

Mep2 50 AGATGGTGCACTCCTTCTCCTAC

50 GCCATCACGTCCGATGTTGAC

Mep3 50 GTACATGGACAGTGATGCCG

50 AACTCGAAAGACTCCTTGCC

Mep4 50 ACCGATTTCAATGTTAACATTGG

50 GCTTCGCCTTGACATTCTCAGG

Mep5 50 TCTTTGCCAATTTGACGTTG

50 TGAAGCTCAAACAACCCG

PaP 50 ACTACTCAAACCCGTCTTCTGC

50 GTCAAGGAGAAGGATCTGGAACC

Phospholipase 50 GACAGTACTATCGCGGAACTGC

50 ATGCTCTACCCCAGATATCAGTGATAG

Sialidase 50 ACCATAAATGGTGGAACGGG

50 CTGAATACTCCACCAAGGGCTTC

Sub1 50 ACTGTTCCCCACTCATACATTGTC

50 ACATAACCTTGGGGTCCCTTG

Sub2 50 AGGAAGGCCTCACCTCTGC

50 ATTTGACGTATGGGTTGCGG

Sub3 50 ACATCGTTGTCATGAAGGACG

50 AGTTGACCTTGTCATCGTTGAGG

Sub4 50 AATCGACCTTGGAGTCATTGAG

50 TACATCGTCGTCATGAAGGATG

Sub5 50 CGTGGTCATGAAAGACGATACC

50 AGGCAACCTTTGGATCGTTTG

Sub6 50 AGGGAGGTTTCCGACGAG

50 TGTAGTCGACATCATCGTGGC

Sub7 50 TTGTCATGAACGATGGAATGAG

50 GTATTTGACATCAGCGCGCTTG

Comparative analysis of secreted enzymes between the anthropophilic–zoophilic sister species 431

Author's personal copy

interval for the slope of the regression estimates. All p-values

were two-sided with those less than 0.05 considered to

indicate statistical significance. All statistical analyses were

performed using SPSS version 12 (SPSS, Chicago, IL).

Nucleotide sequence accession numbers

The nucleic acid sequences for the genes examined in this

study have been deposited in GenBank under the accession

numbers provided in Table 2.

Results

Genomic organization

Of the genes initially selected for this study, Lip2 and CarbS1

failed to amplify from either species despite repeated

attempts with various reaction conditions and primer sets.

Additionally, phospholipase and Lip1 could not be amplified

from Trichophyton equinum. With a few exceptions, the in-

tron–exon structures of the secreted enzymes were consistent

with those previously reported for T. rubrum (Woodfolk et al.

1998; Descamps et al. 2002; Jousson et al. 2004a, b; Kano et al.

2005; Kaufman et al. 2005; Monod et al. 2005; Vermout

et al. 2008). Disparities included a single intron in DppIV that

was not reported in T. rubrum (Monod et al. 2005), along with

additional introns in AmPP, Lip1 and phospholipase that were

previously unreported. We also observed an additional exon

in PaP which disrupts the fifth intron, resulting in the presence

of an additional intron and exon in both Trichophyton tonsurans

and T. equinum as compared with the reported T. rubrum

sequence. The intron/exon junctions for Carb2 and CarbM14

had not been previously delineated for the dermatophyte

and thus, were not available for comparison.

Sequence variations

Alignments of the coding regions from Trichophyton tonsurans

and Trichophyton equinum revealed 99.5 % or greater similarity

for all genes examined with two genes, Mep4 and Sub6, exhib-

iting identical sequences. A total of 104 sequence variations

were identified between T. tonsurans and T. equinum ranging

from 0 to 9 per gene. Thirty-five percent (n ¼ 37) of the

observed variations were predicted to code for non-

synonymous single nucleotide polymorphisms (SNPs) which

were observed in 22 of the 29 genes examined (Table 2). One

of the sequence variations in Lap2 (g.756A > G) results in the

generation of premature stop codon in T. tonsurans that is

not present in T. equinum. An additional putative stop codon

930 bp downstream of the start codon was found in CarbY0 of

both species. Mini- and micro-satellites were also identified

in the UTRs of two subtilisin-like proteases (Sub2 and Sub6). Al-

lele frequencies for the identified sequence and size variations

have been reported previously (Abdel-Rahman et al. 2010).

Transcript copy number

Differences in average transcript copy number over 14 d

between Trichophyton tonsurans and Trichophyton equinum are

detailed in Fig 1. Three metalloproteases (Meps 1, 2 and 5),

two subtilisin-like proteases (Subs 6 and 7), Carb2 and cerami-

dase were all expressed to a significantly greater extent in

T. tonsurans as compared with T. equinum (Fig 1). Conversely,

a singular metalloprotease (Mep4), two subtilisin-like prote-

ases (Subs 1 and 5), phospholipase and sialidase were expressed

to a greater extent in T. equinum (Fig 1).

The magnitude of intra-specific variation in transcript

expression varied widely in both species. However, for the

slight majority of genes (n ¼ 18) a greater degree of inter-

strain variability was observed in T. tonsurans as compared

with T. equinum (Fig 1). Among the Subs, the coefficient of var-

iation (CV) in T. tonsurans exceeded 100 % for each gene and,

with the exception of Subs 4 and 6, the extent of variability

was similar in T. equinum. Among the Meps, there was far

less inter-strain variability in T. equinum (CV 45–153 %) as com-

pared with T. tonsurans (CV 92–211 %). With the exception of

Mep1, the CV for all of the genes in this family exceeded

100 % while only Mep3 demonstrated a comparable magnitude

of variability in T. equinum. Among the Carbs, the extent of

variability observed for CarbY (CV 177–186 %) and CarbM14

(CV 149–160 %) markedly exceeded that of the other members

of this gene family. A lesser degree of variability was observed

among the aminopeptidases of both species (CV 57–68 %).

Similarly, the enzymes involved with lipid or glycolipid cleav-

age (except sialidase) demonstrated only a moderate degree of

inter-strain variability (CV 41–144 %).

For gene families with multiple members, the rank order of

absolute transcript expression demonstrated little by way of

variation between the two species (Fig 1, right panel). Expres-

sion of genes in the metalloprotease, dipeptidylpeptidase and

leucine aminopeptidase gene families demonstrated a compa-

rable rank order in both T. tonsurans and T. equinum. Similarly,

carboxypeptidase rank order was comparable in both species

with CarbY0 below the level of quantification at all time points

in all replicates and strains examined. In contrast, members of

subtilisin-like protease gene family differed more markedly.

Although Sub1 transcript represented the most abundant

gene in both species, Subs 6 and 7 ranked among the most

abundant transcripts in T. tonsurans and lowest in T. equinum

whereas Subs 3 and 5 were among the highest in T. equinum

and the lowest in T. tonsurans.

Discussion

As with many microorganisms, the ability of dermatophytes to

invade live or shed tissues is facilitated by enzymes secreted

into their micro-environment. These proteolytic and lipolytic

enzymes facilitate nutrient acquisition (Apodaca & McKerrow

1989a, b) and, in live hosts, play a significant role in host spec-

ificity, immunogenicity and virulence (Fischer & Kane 1971;

Kane & Fischer 1971; Grappel & Blank 1972; Collins et al. 1973;

Wagner & Sohnle 1995; Mahmoud et al. 1996; Nissen et al.

1998; Mari et al. 2003; Giddey et al. 2007a). Given their impor-

tance in the pathogenesis of infections, an understanding of

the differences in these genes at the structural and functional

levels may help to elucidate how two, otherwise very closely re-

lated, organisms (e.g. Trichophyton tonsurans and Trichophyton

equinum) can demonstrate very different host niches.

432 B. L. Preuett et al.

Author's personal copy

Table 2 – Genes and their representative accession numbers. Genetic similarity is provided as a percentage for each gene.Synonymous and non-synonymous SNPs are denoted by their distance from the ATG start site and reflect the observednucleotide in T. tonsurans > T. equinum. Sequence information represented by the accession numbers reflects theconsensus information generated from the eight strains of T. tonsurans and the two strains of T. equinum respectively.

Gene T. tonsuransaccession number

T. equinumaccession number

% Identity SynonymousSNPs

Non-synonymousSNPs

Ampp EU069830 EU069831 99.96 g.1324C > T

Carb2 FJ267689 FJ348244 99.78 g.350G > A g.915T > C

g.1460C > T

g.1555C > T

CarbM14 FJ267688 FJ348245 99.81 g.994A > G g.1537G > A

g.1168T > Cc

g.1449T > C

CarbS10 FJ267690 EU076570 99.66 g.1252T > C g.2001T > C

g.1504T > C g.2010C > T

g.2023 del > CTT

CarbY EF490685a FJ348246 99.76 g.30T > C g.786A > G

g.111T > C g.1119A > G

CarbY0 N/A N/A g.355 del > GTTA g.178A > G

g.958G > A g.1196T > G

g.1022C > del

g.1610A > G

Ceramidase FJ348243 FJ356718 99.88 g.75C > T

g.617C > Tc

g.707T > C

g.941T > C

DppIV FJ267691 EU076573 99.88 g.32G > A g.1541T > A

g.1572C > Tc g.599T > C

DppV FJ267692 EU076569 99.96 g.1055G > C

Lap1 EU072468 EU072467 99.49 g.48C > T g.275A > G

g.63C > T

g.131T > Gc

g.244C > T

g.320A > C

g.626 del > TT

g.1618C > T

g.1633T > C

Lap2 FJ267693 EU072469 99.82 g.196G > A g.322A > Gc

g.756A > G

Lip1 FJ267694 N/A 99.74 g.33T > C

g.589A > G

g.980A > G

g.1324C > A

Lip3 FJ267695 FJ356717 99.56 g.314 del > CTC

g.345 del > TTT

g.630C > T

g.1075T > C

Lip4 N/A N/A 99.73 g.1287T > C g.680T > C

g.170T > C

g.1378G > A

g.1448C > A

Mep1 FJ348242 EU076574 99.59 g.45C > T g.148A > G

g.886AAAA > del g.519G > A

g.1810C > T g.594A > G

Mep2 FJ267696 EU076576 99.7 g.488C > T g.1564C > T

g.1616C > T g.1597C > A

g.1640C > G

g.1655C > G

(continued on next page)

Comparative analysis of secreted enzymes between the anthropophilic–zoophilic sister species 433

Author's personal copy

The genomic organization of the enzymes examined in this

study is consistent with those reported for other dermato-

phytes albeit with a few exceptions (Descamps et al. 2002;

Jousson et al. 2004a, b; Monod et al. 2005). We observed introns

in Lip1, phospholipase, and AmPP that were annotated as exons

in the deposited sequence from T. rubrum. These sequences

failed to produce hits to known expressed sequence tags

(ESTs) in the T. rubrum Expression Database (TrED) in contrast

to flanking exonic sequences from the same genes. We also

observed an intron in DppIV that was not reported in the

deposited T. rubrum sequence. However, T. rubrum sequence

from the Dermatophyte Comparative Genomics Database

confirmed the presence of this intron which shares 99 % ho-

mology with the intron in T. tonsurans and T. equinum. Finally,

we identified an additional exon in PaP which was reported to

be intronic sequence in T. rubrum. This sequence did produce

a hit in TrED and revealed substantial homology to a prolyl

peptidase, indicating that this small exon may have been

overlooked in the reported PaP sequence from T. rubrum. The

failure to PCR amplify phospholipase and Lip1 from T. equinum,

along with Lip2 and CarbS1 from both species, was likely

methodologic, as orthologous sequences for all four genes

were identified from sequence searches of the Dermatophyte

Comparative Genomics Database.

For selected genes (e.g. Lap2 which contains a premature

stop codon in the anthropophilic species) the consequence

of the observed sequence variations is apparent. For the

majority, however, functional studies are required to confirm

the impact of these variations on protein function. Despite

their genetic differences, T. tonsurans and T. equinum retain

99.5 % or greater genetic identity among the genes examined

in this study. Given this high degree of similarity, it would

not be anticipated that coding region polymorphisms alone

would account for specialization on divergent hosts. Conse-

quently, the extent to which these genes are expressed likely

plays some role in the phenetic differences observed between

the species.

Transcript analyses revealed that the extent to which some

genes were expressed varied widely between T. tonsurans and

T. equinum (Fig 1). Though the rank order of gene expression

was comparable between species, the extent to which some

of these genes were expressed differed by a full order of

Table 2 – (continued)

Gene T. tonsuransaccession number

T. equinumaccession number

% Identity SynonymousSNPs

Non-synonymousSNPs

Mep3 FJ349344 FJ348247 99.82 g.899A > G g.278T > C

g.932C > T

g.2245T > C

Mep4 FJ267697 FJ356719 100.0

Mep5 EF490686a EU076575 99.68 g.9C > T g.235G > A

g.12C > T g.1345C > Tc

g.986C > Tc

g.1025C > T

g.1478C > A

g.2128A > C

PaP FJ348233 FJ356720 99.89 g.799T > C

g.1752C > A

Phospholipase FJ348234 N/A 99.71 g.71C > T g.155A > T

g.828A > G

g1876C > T

g.2041A > G

g.2044G > A

Sialidase FJ348233 FJ356721 99.81 g.921C > T g.200C > T

Sub1 FJ348236 FJ356722 99.94 g.795C > A

Sub2 FJ348237 FJ356723 99.87 g.1114G > A g.924T > C

g.299A > Gc

Sub3 FJ348238 FJ356724 99.79 g.141A > G g.792T > C

g.211G > A

Sub4 FJ348239 EU076571 99.93 g.717G > A

Sub5 FJ348240 FJ356725 99.86 g.153C > T g.217T > Gc

g.800T > C

Sub6 AY910749b FJ356726 100.0

Sub7 FJ348241 EU076572 99.93 g.609C > T

N/A: genes where sequence information was not fully resolved or was not obtained in our experiments.

a Previously reported in reference Abdel-Rahman et al. (2007).

b Previously reported in reference Bhathena et al. (2005).

c Both SNPs are observed in T. tonsurans.

434 B. L. Preuett et al.

Author's personal copy

magnitude. Data on the relative affinity of these genes for sub-

strates that constitute integumentary structures will clarify

how differences in the magnitude of gene expression translate

into functionally different infection profiles, especially for

genes whose expression differs only a few-fold.

For selected genes, genetic variations occurring in the

UTR’s may explain the degree of transcript variability ob-

served within and between species. In T. tonsurans, for exam-

ple, the magnitude of Sub6 expression appeared to correlate

with the copy number of a 16-bp minisatellite element in

the 50 UTR (Bhathena et al. 2005). The observations in the cur-

rent study corroborate those earlier findings (data not shown).

These results are not surprising given that a relationship

between the number of regulatory repeat elements and tran-

script copy number has been well described for other genes

(Sgourou et al. 2004; Lee et al. 2008; Akhtar et al. 2009). A similar

correlation between Sub2 transcript copy number and micro-

satellite copy number in the 30 UTR appears to be present,

however, all copy-number variations were not represented

among the isolates studied and thus the association cannot

be confirmed.

The relationship between transcript and/or protein levels

observed in vitro and infection competence in vivo is not fully

understood. Presumably, genes and gene families wherein

Fig 1 – Left panel: the ratio of the total average copy number in Trichophyton tonsurans compared with Trichophyton equinum.

The symbol represented in the key reflects intra-strain variability for each species that equals 100 %. Distortion of the symbol

along the X-axis represents deviation from a coefficient of variation (CV) of 100 % in T. tonsurans. Distortion of the symbol

along the Y-axis represents deviation from a CV of 100 % in T. equinum. Genes for which there is a significant difference in

expression between the two species are denoted with an asterisk ( p < 0.05). Right panel: absolute magnitude of transcript

expression for each gene in both species averaged across all time points. T. tonsurans is denoted with closed circles,

T. equinum is denoted with open circles.

Comparative analysis of secreted enzymes between the anthropophilic–zoophilic sister species 435

Author's personal copy

the degree of expression was not significant between the two

species reflect gene products with conserved functionality. By

contrast, genes with higher expression levels in one species as

compared to a related sister-species signal those gene prod-

ucts which may offer a selective advantage on unique host or-

ganisms be it enhanced virulence, reduced immunogenicity or

both.

Interestingly, the two gene families (Meps, Subs) wherein

expression of the majority of members differed between T.

tonsurans and T. equinum represent the gene families believed

to have arisen in dermatophytes from gene duplications

(Monod et al. 1991, 1993; Jousson et al. 2004b; Kano et al.

2005). These gene products are demonstrated to cleave integ-

umentary proteins that are relatively resistant to hydrolysis

(Goddard & Michaelis 1934; Lorincz & Stoughton 1958) and

several posses the ability to activate mammalian immune sys-

tems (Slunt et al. 1996; Woodfolk et al. 1998, 2000; Brouta et al.

2003; Descamps et al. 2003; Vermout et al. 2004). Thus, the con-

stitutive expression of the collective protease profile likely

represents a ‘‘proper’’ balance of proteases that will permit

penetration of host structures in a unique micro-environment

with insufficient antigenicity to sensitize the host.

Apart from the putative functional redundancy permitted

by multi-member gene families, selected genes may perform

supplementary roles during the process of infection. In addi-

tion to the keratinolytic properties of Sub3 (Mignon et al.

1998; Descamps et al. 2002), this protein from M. canis has

been demonstrated to facilitate adherence of arthroconidia

to feline corneocytes (Baldo et al. 2008). Interestingly, expres-

sion levels of Sub3 in T. tonsurans and T. equinum are not signif-

icantly different which could support a similar role in

T. tonsurans and T. equinum.

At the outset, this study was designed to characterize the

extremes of expression that might be observed within strains

that are genetically and/or geographically distinct. Conse-

quently, it was not surprising to identify a large degree of

intra-specific variability in transcript expression for a substan-

tial number of genes that were examined. However, all isolates

examined in this investigation derived from clinical infections

suggesting that irrespective of the degree to which the individ-

ual genes are expressed in a single strain, the complementary

expression of all genes in that strain was adequate to permit

infection on their host. Similar comparisons on isolates

acquired from infections where the extent and severity of

disease have been documented are required to understand

whether these differences alter the degree of virulence within

each species (e.g. whether expression is constitutively upregu-

lated to facilitate infection on different host sites or downregu-

lated to limit immunogenicity and host clearance). By

contrast, genes with a lower degree of intra-specific variability

may be more tightly regulated at the transcriptional level. Sim-

ilar levels of transcript expression between strains may indi-

cate the relative importance of these genes during the initial

phases of infection. Alternatively it might suggest that these

genes have a limited role in nutrient scavenging from keratin

(in vitro, in vivo or both) or any significant role relating to the

pathogenic mechanisms utilized during infection.

While the list of genes examined by this study is certainly

not exhaustive, the identification of sequence variations and

the observation of differences in transcript copy number

between T. tonsurans and T. equinum during growth in keratin

provide additional information that expands our understand-

ing of the factors which may have allowed these two dermato-

phytes to select for such divergent hosts. Both species appear

to possess a similar complement of genes coding for secreted

enzymes; however, the extent to which some are expressed is

markedly different. Subsequent studies may confirm whether

the differences in the genetic constitution and/or levels of ex-

pression of these genes facilitate niche selection, or whether

these differences arose to enhance adaptation on a host

with which a relationship had already been established.

Acknowledgements

This study was supported by a grant from the Kenneth L. and

Eva S. Smith foundation.

r e f e r e n c e s

Abdel-Rahman S, Sugita T, Gonzalez G, Ellis D, Arabatzis M, Vella-Zahra L, Viguie-Vallanet C, Hiruma M, Leeder J, Preuett B, 2010.Divergence among an international population of Trichophytontonsurans isolates. Mycopathologia 169: 1–13.

Abdel-Rahman SM, Preuett B, Gaedigk A, 2007. Multilocus geno-typing identifies infections by multiple strains of Trichophytontonsurans. Journal of Clinical Microbiology 45: 1949–1953.

Abdel-Rahman SM, Simon S, Wright KJ, Ndjountche L, Gaedigk A,2006. Tracking Trichophyton tonsurans through a large urbanchild care center: defining infection prevalence and trans-mission patterns by molecular strain typing. Pediatrics 118:2365–2373.

Akhtar P, Singh S, Bifani P, Kaur S, Srivastava BS, Srivastava R, 2009.Variable-number tandem repeat 3690 polymorphism in Indianclinical isolates of Mycobacterium tuberculosis and its influenceon transcription. Journal of Medical Microbiology 58: 798–805.

Apodaca G, McKerrow JH, 1989a. Purification and characterizationof a 27,000-Mr extracellular proteinase from Trichophytonrubrum. Infection and Immunity 57: 3072–3080.

Apodaca G, McKerrow JH, 1989b. Regulation of Trichophyton rubrumproteolytic activity. Infection and Immunity 57: 3081–3090.

Baldo A, Tabart J, Vermout S, Mathy A, Collard A, Losson B,Mignon B, 2008. Secreted subtilisins of Microsporum canis areinvolved in adherence of arthroconidia to feline corneocytes.Journal of Medical Microbiology 57: 1152–1156.

Bhathena A, Gaedigk R, Abdel-Rahman SM, 2005. Characteriza-tion of the ALP1 gene locus of Trichophyton tonsurans.Mycopathologia 160: 265–272.

Brouta F, Descamps F, Fett T, Losson B, Gerday C, Mignon B, 2001.Purification and characterization of a 43.5 kDa keratinolyticmetalloprotease from Microsporum canis. Medical Mycology 39:269–275.

Brouta F, Descamps F, Monod M, Vermout S, Losson B, Mignon B,2002. Secreted metalloprotease gene family of Microsporumcanis. Infection and Immunity 70: 5676–5683.

Brouta F, Descamps F, Vermout S, Monod M, Losson B, Mignon B,2003. Humoral and cellular immune response to a Microsporumcanis recombinant keratinolytic metalloprotease (r-MEP3) inexperimentally infected guinea pigs. Medical Mycology 41:495–501.

Collins JP, Grappel SF, Blank F, 1973. Role of keratinases in der-matophytosis. II. Fluorescent antibody studies with keratinaseII of Trichophyton mentagrophytes. Dermatologica 146: 95–100.

436 B. L. Preuett et al.

Author's personal copy

Descamps F, Brouta F, Monod M, Zaugg C, Baar D, Losson B,Mignon B, 2002. Isolation of a Microsporum canis gene familyencoding three subtilisin-like proteases expressed in vivo. TheJournal of Investigative Dermatology 119: 830–835.

DescampsF,Brouta F,VermoutS,MonodM,LossonB,MignonB,2003.Recombinant expression and antigenic properties of a 31.5-kDakeratinolytic subtilisin-like serine protease from Microsporumcanis. FEMS Immunology and Medical Microbiology 38: 29–34.

Fischer JB, Kane J, 1971. The detection of contamination inTrichophyton rubrum and Trichophyton mentagrophytes. Mycopa-thologia et Mycologia Applicata 43: 169–180.

Gaedigk A, Gaedigk R, Abdel-Rahman SM, 2003. Genetic hetero-geneity in the rRNA gene locus of Trichophyton tonsurans.Journal of Clinical Microbiology 41: 5478–5487.

Giddey K, Favre B, Quadroni M, Monod M, 2007a. Closely relateddermatophyte species produce different patterns of secretedproteins. FEMS Microbiology Letters 267: 95–101.

Giddey K, Monod M, Barblan J, Potts A, Waridel P, Zaugg C,Quadroni M, 2007b. Comprehensive analysis of proteinssecreted by Trichophyton rubrum and Trichophyton violaceumunder in vitro conditions. Journal of Proteome Research 6:3081–3092.

Goddard DR, Michaelis L, 1934. A study on Keratin. Journal ofBiological Chemistry 106: 605–614.

Grappel SF, Blank F, 1972. Role of keratinases in dermatophytosis.I. Immune responses of guinea pigs infected with Trichophytonmentagrophytes and guinea pigs immunized with keratinases.Dermatologica 145: 245–255.

Graser Y, Kuijpers AF, Presber W, De Hoog GS, 1999. Moleculartaxonomy of Trichophyton mentagrophytes and T. tonsurans.Medical Mycology 37: 315–330.

Jousson O, Lechenne B, Bontems O, Capoccia S, Mignon B,Barblan J, Quadroni M, Monod M, 2004a. Multiplication of anancestral gene encoding secreted fungalysin preceded speciesdifferentiation in the dermatophytes Trichophyton andMicrosporum. Microbiology 150: 301–310.

Jousson O, Lechenne B, Bontems O, Mignon B, Reichard U,Barblan J, Quadroni M, Monod M, 2004b. Secreted subtilisingene family in Trichophyton rubrum. Gene 339: 79–88.

Kane J, Fischer JB, 1971. The differentiation of Trichophyton rubrumand T. mentagrophytes by use of Christensen’s urea broth.Canadian Journal of Microbiology 17: 911–913.

Kano R, Yamada T, Makimura K, Yamaguchi H, Watanabe S,Hasegawa A, 2005. Metalloprotease gene of Arthrodermagypseum. Japanese Journal Infectious Diseases 58: 214–217.

Kaufman G, Berdicevsky I, Woodfolk JA, Horwitz BA, 2005.Markers for host-induced gene expression in Trichophytondermatophytosis. Infection and Immunity 73: 6584–6590.

Lee LT, Lam IP, Chow BK, 2008. A functional variable number oftandem repeats is located at the 50 flanking region of the hu-man secretin gene plays a downregulatory role in expression.Journal of Molecular Neuroscience 36: 125–131.

Lorincz AL, Stoughton RB, 1958. Specific metabolic processes ofskin. Physiological Reviews 38: 481–502.

Mahmoud AL, El-Shanawany AA, Omar SA, 1996. Factors affect-ing growth and urease production by Trichophyton spp.Mycopathologia 135: 109–113.

Mari A, Schneider P, Wally V, Breitenbach M, Simon-Nobbe B,2003. Sensitization to fungi: epidemiology, comparative skintests, and IgE reactivity of fungal extracts. Clinical andExperimental Allergy 33: 1429–1438.

Mignon B, Swinnen M, Bouchara JP, Hofinger M, Nikkels A,Pierard G, Gerday C, Losson B, 1998. Purification and

characterization of a 315 kDa keratinolytic subtilisin-like ser-ine protease from Microsporum canis and evidence of its se-cretion in naturally infected cats. Medical Mycology 36: 395–404.

Moallaei H, Zaini F, Larcher G, Beucher B, Bouchara JP, 2006.Partial purification and characterization of a 37 kDa extracel-lular proteinase from Trichophyton vanbreuseghemii. Mycopa-thologia 161: 369–375.

Monod M, Capoccia S, Lechenne B, Zaugg C, Holdom M,Jousson O, 2002. Secreted proteases from pathogenic fungi.International Journal of Medical Microbiology 292: 405–419.

Monod M, Lechenne B, Jousson O, Grand D, Zaugg C, Stocklin R,Grouzmann E, 2005. Aminopeptidases and dipeptidyl-peptidases secreted by the dermatophyte Trichophyton rubrum.Microbiology 151: 145–155.

Monod M, Paris S, Sanglard D, Jaton-Ogay K, Bille J, Latge JP, 1993.Isolation and characterization of a secreted metalloprotease ofAspergillus fumigatus. Infection and Immunity 61: 4099–4104.

Monod M, Togni G, Rahalison L, Frenk E, 1991. Isolation andcharacterisation of an extracellular alkaline protease ofAspergillus fumigatus. Journal of Medical Microbiology 35: 23–28.

Nissen D, Petersen LJ, Esch R, Svejgaard E, Skov PS, Poulsen LK,Nolte H, 1998. IgE-sensitization to cellular and culture filtratesof fungal extracts in patients with atopic dermatitis. Annals ofAllergy, Asthma and Immunology 81: 247–255.

Sgourou A, Routledge S, Antoniou M, Papachatzopoulou A,Psiouri L, Athanassiadou A, 2004. Thalassaemia mutationswithin the 50UTR of the human beta-globin gene disrupttranscription. British Journal of Haematology 124: 828–835.

Slunt JB, Taketomi EA, Woodfolk JA, Hayden ML, Platts-Mills TA,1996. The immune response to Trichophyton tonsurans: distinctT cell cytokine profiles to a single protein among subjects withimmediate and delayed hypersensitivity. Journal of Immunology157: 5192–5197.

Summerbell RC, Haugland RA, Li A, Gupta AK, 1999. rRNA geneinternal transcribed spacer 1 and 2 sequences of asexual,anthropophilic dermatophytes related to Trichophyton rubrum.Journal of Clinical Microbiology 37: 4005–4011.

Vermout S, Baldo A, Tabart J, Losson B, Mignon B, 2008. Secreteddipeptidyl peptidases as potential virulence factors for Micro-sporum canis. FEMS Immunology and Medical Microbiology 54:299–308.

Vermout SM, Brouta FD, Descamps FF, Losson BJ, Mignon BR,2004. Evaluation of immunogenicity and protective efficacy ofa Microsporum canis metalloprotease subunit vaccine in guineapigs. FEMS Immunology and Medical Microbiology 40: 75–80.

Wagner DK, Sohnle PG, 1995. Cutaneous defenses againstdermatophytes and yeasts. Clinical Microbiology Reviews 8:317–335.

Weitzman I, Summerbell RC, 1995. The dermatophytes. ClinicalMicrobiology Reviews 8: 240–259.

Woodfolk JA, Sung SS, Benjamin DC, Lee JK, Platts-Mills TA, 2000.Distinct human T cell repertoires mediate immediate anddelayed-type hypersensitivity to the Trichophyton antigen, Trir 2. Journal of Immunology 165: 4379–4387.

Woodfolk JA, Wheatley LM, Piyasena RV, Benjamin DC, Platts-Mills TA, 1998. Trichophyton antigens associated with IgEantibodies and delayed type hypersensitivity. Sequencehomology to two families of serine proteinases. Journal ofBiological Chemistry 273: 29489–29496.

Zaugg C, Monod M, Weber J, Harshman K, Pradervand S,Thomas J, Bueno M, Giddey K, Staib P, 2009. Gene expressionprofiling in the human pathogenic dermatophyte Trichophytonrubrum during growth on proteins. Eukaryotic Cell 8: 241–250.

Comparative analysis of secreted enzymes between the anthropophilic–zoophilic sister species 437