Cloning, Expression, Purification and Refoldingof Microtubule Affinity-Regulating Kinase 4 Expressedin Escherichia coli

Farha Naz & Mohd Asad & Pawan Malhotra &

Asimul Islam & Faizan Ahmad & Md Imtaiyaz Hassan

Received: 27 September 2013 /Accepted: 7 January 2014# Springer Science+Business Media New York 2014

Abstract Microtubule-associated protein/microtubule affinity-regulating kinase 4 (MARK4)is a member of the family Ser/Thr kinase and involved in numerous biological functionsincluding microtubule bundle formation, nervous system development, positive regulation ofprogrammed cell death, cell cycle control, cell polarity determination, cell shape alterations,cell division etc. For various biophysical and structural studies, we need this protein inadequate quantity. In this paper, we report a novel cloning strategy for MARK4. We havecloned MARK4 catalytic domain including 59 N-terminal extra residues with unknownfunction and catalytic domain alone in PQE30 vector. The recombinant MARK4 wasexpressed in the inclusion bodies in M15 cells. The inclusion bodies were solubilizedeffectively with 1.5 % N-lauroylsarcosine in alkaline buffer and subsequently purified usingNi–NTA affinity chromatography in a single step with high purity and good concentration.Purity of protein was checked on sodium dodecyl sulphate–polyacrylamide gel electrophoresisand identified by using mass spectrometry immunoblotting. Refolding of the recombinantprotein was validated by ATPase assay. Our purification procedure is quick, simple andproduces adequate quantity of proteins with high purity in a limited step.

Keywords Microtubule affinity-regulating kinase . Microtubule dynamics . Alzheimer’sdisease . Cloning . Protein expression and purification . Refolding

Introduction

The microtubule-associated protein (MAP)/microtubule affinity-regulating kinase (MARK)family has four related proteins: MARK1, MARK2 (EMK1), MARK3 (C-TAK1) and

Appl Biochem BiotechnolDOI 10.1007/s12010-014-0733-5

F. Naz : A. Islam : F. Ahmad :M. I. Hassan (*)Centre for Interdisciplinary Research in Basic Sciences, Jamia Millia Islamia, Jamia Nagar, NewDelhi 110025, Indiae-mail: mihassan@jmi.ac.in

M. Asad : P. MalhotraInternational Centre for Genetic Engineering and Biotechnology, Aruna asaf Marg, NewDelhi 110067, India

MARK4 (MARKL-1) [1]. MARK4 gene exists in two alternatively spliced isoforms L and Sof 752 and 688 amino acid residues long, respectively. Both isoforms have catalytic domain,ubiquitin-associated domain and kinase-associated domain. Residues 65–73 are considered asATP-binding domain and Lys88 act as ATP-binding site. Asp181 has been proposed to be anactive site residue that is activated by phosphorylation of the side chain of Thr214. We areworking on MARK4 L gene that has 1 to 59 N-terminal header, Ser/Thr protein kinasecatalytic domain [S_TKc (59–310)], membrane-targeting motif (T-region) (314–322), [UBA(331–368)], least-conserved spacer region (369–649 residues) and [KA1 (649–752)] [2]. Thekinase-associated domain of MARK4S has no homology with any known structures, butcorresponding domain in MARK4L is present in all MARKs [3–5]. The isoform MARK4S ishighly expressed in the normal brain and is involved in neuronal differentiation, whereasMARK4L is involved in cell cycle and is upregulated in hepatocarcinoma cells and gliomas[6]. The MARK4 protein regulates programmed cell death, and its overexpression leads todecrease in cell viability [6].

MARK4 phosphorylates the MAPs on their serine motif in the tubulin-bindingdomains, causing their detachment from the microtubules as it phosphorylates Tau incase of Alzheimer’s disease at Ser262, thereby increasing microtubule dynamics andcell shape alterations and leads to the regulation of centrosomal activities such asamplification and positioning of centrosomes [7]. It also regulates microtubule-dependent transport of CCV during endocytosis [8]. MARK4 itself gets phosphory-lated at Thr214 (functionally active) and Ser218 (functionally inactive) [6]. It is foundto be associated with microtubules, centrosomes and neurite-like processes of neuro-blastoma cells [7]. MARK4 has its functional importance in cancerous cells andglioblastoma cell lines [9–11]. Upregulated MARK4 in the early stages of an ischemicevent increases the probability of neuronal death [6]. MARK4 have a role in cellproliferation as well [4, 12]. It directly interacts with many proteins to performrespective functions, including cytoskeleton remodelling and it shows proteasomaldegradation [13, 14].

All these studies reflect that MARK4 is involved in large number of diseases;therefore, it is important to know about its structure to develop drugs against diseases.Hence, we need plenty of recombinant protein with high purity. Expression andpurification of MARK4 have already been done in the mammalian cell line [7]. Thedescribed method is tedious, time-consuming and yielded insufficient protein inpurified form. For conducting structural and biophysical studies, we need plenty ofprotein with high purity. Hence, we need to express MARK4 in the bacterial system.Here we expressed MARK4 efficiently in Escherichia coli. However, high-levelexpressed recombinant proteins get aggregated and accumulated in the inclusionbodies (IBs). These IBs must be solubilized with detergents or denaturants and shouldbe refolded to its natural bioactive form after purification. Many strategies have beendescribed to get pure proteins from their IBs. There is still many proteins that showaggregation, and their activity does not regain after removal of denaturating agentsfrom the protein solution [15–18].

In this paper, we have shown cloning, expression and purification of MARK4kinase domain with 59 N-terminal extra residues (one to 310 amino acids long;MARK4a) and kinase domain alone (59 to 310 amino acids long; MARK4b) fromits inclusion bodies in E. coli. These IBs were solubilized in alkaline buffer contain-ing N-lauroylsarcosine detergent. The purification was done with nickel–nitrilotriaceticacid (Ni–NTA) column in the denatured form. Recombinant protein was subsequentlyrefolded using dialysis for 48 h.

Appl Biochem Biotechnol

Materials and Methods

Strains and Plasmids

T-easy vector was purchased from Promega (Madison, WI, USA). Plasmid pQE30, E. colistrain M15, were obtained from Qiagen, and DH5α was obtained from INVITROGEN.FastDigest Restriction enzymes were purchased from Thermo Scientific. The pQE30 vectoris placed with a small 6× histidine (6× His) tag coding sequence at the N-terminal of thedesired protein. Plasmid isolation, restriction enzyme digestion, ligation and competent cellpreparation were carried out following standard procedures [19].

Cloning

Human MARK4 gene was purchased from PlasmID Harvard Medical School (http://plasmid.med.harvard.edu/PLASMID). The primers of 5′gcccatgggatccatgtcttcgcggacggt3′ and 5′gtcgacctcgagatagccgatgttgatccatttg 3′ were used to amplify the MARK4 kinase domain plus59 N-terminal extra residues havingNcoI, BamHI, SalI and XhoI restriction endonuclease sites.The kinase domain was amplified with the primers of 5′ gcggatccatgggcaactaccgcctgctgagg 3′and 5′ gtcgacctcgagatagccgatgttgatccatttg 3′. This contained NcoI, BamHI, SalI and XhoIrestriction endonuclease sites. PCR products were ligated into T-easy vector, transformedinto competent DH5α strain and were amplified. These clonings were confirmed throughcolony PCR and restriction digestion with BamHI and SalI endonucleases. Both desiredgenes were digested with BamHI and SalI endonucleases and purified by electrophoresison low-melting agarose (QIAquick Gel Extraction Kit, Qiagen). These genes were ligatedinto pQE30 expression vector, and cloning was again checked by colony PCR andrestriction endonuclease digestion. These plasmids were transformed into E. coli M15competent cell.

Expression

Transformed M15 cells were cultured overnight at 37 °C with vigorous shaking at 150 rpm inLuria–Bertani broth medium. Secondary cultures of these cells were grown by adding 1 % ofprimary cultures. When their absorbance was reached to 0.6, 1 mM isopropyl-1-thio-β-D-galactopyranoside (IPTG) was added to induce expression of recombinant proteins at 16 °C for12 h. These cultures were centrifuged at 3,000×g for 20 min at 4 °C. Pellets were dissolved inbuffer (50 mMTris, 20 mMEDTA, 0.1 mM PMSF and 1 % of Triton 100), and sonication wascarried out on ice using ultra-sonicator (Cole-Parmer Instrument) for 20 min (7 s off, 7 s on).After the sonication, pellets were collected through centrifugation and resuspended in 50 mMTris and 20 mM EDTA. Sonication and centrifugation were repeated twice. Pellets werecollected and washed with milliQ water twice. Finally inclusion bodies were dissolved in1 ml of milliQ and stored at 4 °C.

Purification and Refolding

IBs were solubilized in lysis buffer (1.5 % of N-lauroylsarcosine and 50 mM3-(cyclohexylamino)-1-propanesulphonic acid (CAPS) buffer pH 11.0) by keeping them onrocker for 1 h at room temperature followed by centrifugation at 10,000×g for 15 min.Supernatant was collected and loaded into Ni–NTA resin. Column was washed with lysisbuffer and washing buffer (10 mM imidazole, 1.5 % of N-lauroylsarcosine and 50 mM CAPS

Appl Biochem Biotechnol

buffer pH 11.0). The desired protein was eluted with increasing imidazole concentration inelution buffer (0.3 % N-lauroylsarcosine and 50 mM CAPS buffer pH 11.0). The elutedfractions were analysed by sodium dodecyl sulphate–polyacrylamide gel electrophoresis(SDS–PAGE) and scanned by Beckman DU-650 spectrophotometer to determine the purityof proteins. Purified proteins were dialyzed for 48 h in 50 mM phosphate buffer, pH 7.4 withseven changes to get refolded protein. The protein concentration was measured before andafter dialysis to determine the protein yield. Protein concentration was measured usingBradford method [20].

Western Blotting

To identify proteins, we performed Western blotting using standard protocol [21]. Proteinbands of SDS–PAGE were transferred onto nitrocellulose membranes. The membranes wereblocked with 5 % skimmed milk in phosphate-buffered saline for 2 h followed by washingwith phosphate-buffered saline. Conjugate Anti-His–HRP (Penta-His, Qiagen) was incubatedwith membranes for 2 h and subsequently washed with phosphate-buffered saline. Blots weredeveloped by incubating the membrane for 2 min with 3,30-diaminobenzidine reagents(Zhongshan Biotech, Beijing, China) and 200 μl of hydrogen peroxide.

Mass Spectrometry

To identify proteins, we have performed mass spectrometry using standard protocol with slightmodifications described elsewhere [22, 23]. Purified proteins were applied to SDS–PAGE. Thebands were excised from the gel and washed with water and 100 mM NH4HCO3/acetonitrile1+1 (v/v). After repeating this process many times, acetonitrile was removed and gel particleswere dried down in a vacuum centrifuge. The gel particles were soaked in freshly prepared10 mM dithiothreitol (DTT) in 100 mM NH4HCO3 and incubated for 45 min at 56 °C. Excessliquid was removed and freshly prepared chilled 55 mM iodoacetamide in 100 mMNH4HCO3

was added and incubated for 30 min at room temperature in dark. All iodoacetamide solutionwas removed, and gel particles were washed with 100 mM NH4HCO3 and acetonitrile (1+1,v/v). Subsequently acetonitrile was removed and gel particles were dried down in a vacuumcentrifuge. The gel was subjected to in-gel trypsin digestion using the mass grade trypsin(Sigma chemicals, T6567) at a concentration of 200 ng/μl. Enough 25 mM NH4HCO3

(approximately 2–3 μl) were added and incubated at 37 °C overnight. The supernatant wascollected in a fresh microfuge tube. Ten microlitres of 1 % TFA and 10 μl of acetonitrile wereadded to the gel followed by sonication for 20 min. The supernatant was dried and resus-pended in 8 μl 0.1 % TFA and 2 μl of acetonitrile. One microliter of this solution was used forthe analysis of matrix-assisted laser desorption/ionisation time-of-flight (MALDI-TOF) massspectrometry with an autoflex™ speed MALDI-TOF mass spectrometer (Bruker Daltonics).The resulting peptide mass fingerprinting was used to identify both proteins using Mascot 2.0search engine with fragment mass tolerance of ±0.5 Da.

ATPase Assay

ATPase assay was done by measuring the formation of 32P from [γ-32P] ATP catalyzed byMARK4 proteins. This ATP hydrolysis is done in a buffer (20 mM Tris–HCl, pH 8.0, 8 mMDTT, 1.0 mMMgCl2, 20 mM KCl and 16 mg/ml BSA) containing purified refolded MARK4protein, mixture of [γ-32P] ATP (17 nM) and 1 mM cold ATP. ATPase reaction was carried outfor 1 h at 37 °C. For the separation of these products, thin layer chromatography was done. For

Appl Biochem Biotechnol

autoradiography, these plates were exposed to the hyper-film and scanned on phosphoimager.IMAGE j/geldoc (http://rsbweb.nih.gov/ij/) software was used for their quantification.Different concentrations of both proteins were used for analysis of concentration curve. Fortime course analysis, fixed concentration of both the proteins was used with different timeintervals (15 to 90 min). Percentage of ATP hydrolysis was also plotted as a bar diagram.

Results

Identification of Recombinant MARK4 Plasmid

MARK4 cDNAwas inserted in the PQE30 vector which was confirmed through sequencing.Correct insertion of both genes in recombinant plasmids was also confirmed by colony PCRand restriction endonuclease digestions.

Expression of MARK4

Supernatant and pellet were analysed with different IPTG concentrations showingintense bands at 35 and 27 kDa in the IBs of pellet on SDS–PAGE (Fig. 1a, b).Prepared pellets were further sonicated twice on ice using ultra-sonicator (Cole-ParmerInstrument) for 20 min (7 s off, 7 s on) at 42 amplitude. Two sonications wereneeded in order to completely solubilized IBs. To remove maximum impurity fromthem, two additional washings were done. All steps were analysed by SDS–PAGEindicating over-expression of MARK4 in the pellet (Fig. 2a, b).

a bSupernatant Pellet Pellet

M M

25

35

40

55

70

100

130 170

15

35 27

Supernatant

Fig. 1 Expression of recombinant proteins aMARK4a and bMARK4b in E. coliM15 cells harbouring PQE30/MARK4 gene was induced by increasing concentration of IPTG (0.05 to 1.0 mM). Whole cell lysates wereseparated by SDS–PAGE and visualized by Coomassie brilliant blue staining. Molecular mass markers areshown as M, and their respective molecular masses are indicated. An arrowhead indicates the 35- and 27-kDaproteins induced by IPTG in M15 cells harbouring PQE30/MARK4 gene

Appl Biochem Biotechnol

Purification

IBs of MARK4 proteins were solubilized in an alkalinized lysis buffer containing1.5 % N-lauroylsarcosine, and purification was done under denaturing condition usingNi–NTA resin. The eluted products by different imidazole concentrations wereanalysed by SDS–PAGE clearly indicating the purity of proteins (Fig. 3a, b). The

a bM 1 2 3 4 M 1 2 3 4

25

35

40

55

70

100

130 170

25

35

40

55

70

100

130

170

Fig. 2 Expression of recombinant proteins a MARK4a and b MARK4b in E. coli M15 cells harbouring PQE30/MARK4 gene was induced by IPTG. The pellet was sonicated twice and washed with water. SDS–PAGE ofsupernatant obtained after first and second sonication are shown in lane 1 and lane 2, respectively. Lane 3 representsupernatant obtained after washing. Lane 4 represents purified IBs. Molecular mass markers are shown as M

a b

25

35

40

55

70

130

170

100

25

35

40

55

70

130

170

100

M 1 2 3 4 5 6 7 8M 1 2 3 4 5 6 7 8

Fig. 3 Inclusion bodies obtained for aMARK4a and bMARK4b were solubilized in denaturating buffer (1.5 %of N-lauroylsarcosine and 50 mM CAPS buffer pH 11.0) and subjected to Ni–NTA affinity chromatography.Bound proteins were eluted with increasing concentrations of imidazole with elution buffer (0.3 % N-lauroylsarcosine and 50 mM CAPS buffer pH 11.0) and fractionated at 2 ml/tube. Aliquots of proteins of therepresentative fractions were separated by SDS–PAGE followed by Coomassie brilliant blue staining. Lanes areindicated as M marker, 1 flow through, 2 wash with lysis buffer, 3 wash with washing buffer, 4 elution with10 mM imidazole, 5 elution with 20 mM imidazole, 6 elution with 50 mM imidazole, 7 elution with 200 mMimidazole and 8 elution with 400 mM imidazole

Appl Biochem Biotechnol

fractions eluted with different imidazole concentrations were pooled, and the yield ofcombined purified protein was over 75 % (Table 2). The purified fractions weredialyzed to remove the detergent N-lauroylsarcosine gradually. After extensive dialy-sis, protein got refolded that was confirmed by ATPase assay. The concentration ofprotein was diluted enough prior to dialysis to reduce the aggregation process.Western blot analyses have further confirmed the MARK4 (Fig. 4).

Mass Spectrometry

A peptide mass fingerprints of MARK4 indicating the occurrence of 11 fragments after trypticdigestion with their molecular mass range from 695 to 2,273 Da (Table 1). Each fragment wasfurther analysed, and mascot search revealed that both proteins are MARK4 with their primaryaccession no. gi|119577736. A very high Mascot score (90) indicates no ambiguity inidentification of MARK4.

ATPase Assay

In order to confirm proper refolding of proteins, we have performed ATPase assay. Figure 5shows that MARK4 proteins are able to hydrolyze ATP in a concentration-dependent manner(Fig. 5a, b). Percentage of ATP hydrolysis was also plotted as a bar diagram (Fig. 5c, d). Wealso measured their ATPase activities at a constant concentration with different time intervals(Fig. 6a, b), and their percent hydrolysis with respect to time is illustrated in a bar diagram(Fig. 6c, d). All these results indicate that protein got actively folded after extensive dialysisand can further be used for various studies.

M 1 2

25

35

405570

15

Fig. 4 Western blotting analysisof MARK4a and MARK4b wasapplied to detect the presence ofthe amino-terminal region in aprotein of Mr 35 and 27 kDa withanti-6× His tag antibodies

Appl Biochem Biotechnol

Discussion

Although MARK4 is highly expressed in testis and brain, purification of this protein fromhuman subject is a highly complicated process. Although MARK4 has been expressed inmammalian and insect cell lines [7], in low yield and purity is a regular problem. MARK4mediates the pathological phosphorylation of tau in Alzheimer disease, and it is also related

Table 1 Peptide mass fingerprints of MARK4a

S. No. Start–end Observed Nominal mass(expected)

Nominal mass(calculated)

ppm Peptide

1. 78–83 696.4844 695.4771 695.4079 99.6 R.HILTGR.E

2. 227–241 1,632.8969 1,631.8896 1,631.7831 65.3 K.IADFGFSNEFTLGSK.L

3. 211–226 1,770.0745 1,769.0672 1,768.9570 62.3 R.DLKAENLLLDAEANIK.I

4. 192–205 1,773.0404 1,772.0331 1,771.8940 78.5 K.FRQIVSAVHYCHQK.N

5. 44–60 1,958.0646 1,957.0573 1,956.8748 93.2 R.NSIASCPEEQPHVGNYR.L

6. 242–260 2,098.1498 2,097.1425 2,096.9877 73.8 K.LDTFCGSPPYAAPELFQGK.K

7. 42–60 2,274.1935 2,273.1862 2,273.0066 79.0 R.CRNSIASCPEEQPHVGNYR.L

0

2

4

6

8

10

12

14

16

18

20

1 2 3

0

2

4

6

8

10

12

14

16

18

20

1 2 3

a c

b d

Pi

ATP

Pi

ATP

1 2 3 4

1 2 3 4

1 gµ

µ

µ µ

µ

µ

3 g

6 g

0.8

1.5

g

g 3.3 g

Fig. 5 a ATPase activity concentration curve (90 min) of refolded MARK4a. Position of Pi and ATP spots isindicated. Lanes 1, 2, 3 and 4 are indicated as control, 1, 3 and 6 μg of protein, respectively. b ATPase activityconcentration curve (90 min) of refolded MARK4b. Lanes 1, 2, 3 and 4 are indicated as control, 0.8, 1.5 and3.3 μg of protein, respectively. Percent hydrolysis with respect to the concentration of MARK4 is shown in a bardiagram for c MARK4a and d MARK4b

Appl Biochem Biotechnol

with many diseases like cancer and neurodegenerative diseases [2]. Hence, there is a need toinvestigate its structure and function to understand the mechanism of action and designing apotent inhibitor for drug discovery. To achieve these aims, a prerequisite is to prepare therecombinant pure protein in high concentration.

We have purified MARK4 proteins and analysed its purification protocol. We have tried toclone two variants of MARK4 in pET-28b vectors and expressed in BL21 cell line. We did notobserve a prominent expression in the BL21 cell line. We further cloned MARK4 gene in thePQE30 vector and expressed them in M15 cell line. Expression of these proteins in M15 cellline is showing very high yield (Fig. 2). Although protein was expressed in IBs, therefore we

0

5

10

15

20

25

1 2 3 4

02468

101214161820

1 2 3 4

a b

c d

Pi

ATP

Pi

ATP

1 2 3 4 5

1 2 3 4 5

15min30min

60min 90min

15min30min

60min

90min

Fig. 6 Time-dependent ATPase assay of refolded at 3 μg concentration of aMARK4a and bMARK4b. Positionof Pi and ATP spots is indicated. Lanes 1, 2, 3, 4 and 5 are indicated as control, 15, 30, 60 and 90 min,respectively. Percent hydrolysis with respect to time for MARK4 is shown in a bar diagram c MARK4a and dMARK4b

Table 2 Purification and refolding efficiency of both proteins at different levels of purification

Proteinname

Total proteinin IBs (mg)

Desired proteinin IBs (mg)

Purified protein withNi–NTA (mg)

Refoldedprotein (mg)

Refolding rate (%)

FromIBs

Frompurification

MARK4a 6.8 5.2 3.9 3.7 71.2 94.9

MARK4b 7.4 5.6 4.2 4.0 71.4 95.2

Protein concentration was measured using Bradford method

Appl Biochem Biotechnol

need to get this protein either in soluble fraction or IBs should be solubilized and proteinshould be refolded again. Since urea is a commonly used denaturants [15, 16, 24], we havetried to dissolve IBs in the urea buffer (8 M urea, 20 mM Tris and 250 mM Nacl) andsubsequently refolded with refolding buffer (100 mM Tris, 20 % glycerol, 250 mM arginine,1 mM EDTA, 0.5 mM oxidized glutathione and 1 mM reduced glutathione). But we wereunable to elute them with different concentration of imidazole in good concentration (data notshown). It is reported that N-lauroylsarcosine interacts with hydrophobic residues to reducehydrophobicity without impairing protein purification. Therefore, we used N-lauroylsarcosinewhich can be easily removed by dialysis [25].

Ni–NTA affinity chromatography can be done in the presence of a varieties of ionic andnonionic detergents [26]. Since the expressed proteins have 6× His tag in N-terminus, thereforethese proteins were purified by Ni–NTA resin [24, 27]. IBs were resuspended in the lysisbuffer (1.5 % of N-lauroylsarcosine and 50 mM CAPS buffer pH 11.0) and subjected to Ni–NTA affinity chromatography. Bound proteins were eluted with increasing concentrations ofimidazole with elution buffer (0.3 % N-lauroylsarcosine and 50 mM CAPS buffer pH 11.0).We obtained a single band after eluting protein from the Ni–NTA column (Fig. 3), indicatingthat MARK4 protein was purified in a single step with high yield. Protein concentrations weremeasured by using Bradford method, and yield of the proteins was quantified by IMAGEj/geldoc (http://rsbweb.nih.gov/ij/) software (Table 2).

It has been observed that there is a problem with the refolding process as protein from non-specific aggregation due to the interaction among exposed hydrophobic patches and formationof incorrect intramolecular disulphide links [15–18, 28–31]. But these purified proteins wereefficiently refolded through simple dialysis. To determine if the protein is fully renatured, theATPase assay was done (Fig. 5). It had shown that the proteins were fully active as when wehave increased their concentration, the % hydrolysis of ATP also got enhanced (Fig. 6).

We have successfully cloned, expressed and purified MARK4 catalytic domain plus 59extra residues and its catalytic domain in E. coli from their inclusion bodies in a single stepwith high purity and concentration. This will help us in further studies on MARK4.

Acknowledgments FN acknowledges the Council of Scientific and Industrial Research for the award offellowship. We sincerely thank Harvard Medical School for providing MARK4 cDNA. FA andMIH are thankfulto the Department of Science and Technology for funding.

References

1. Espinosa, L., & Navarro, E. (1998). Cytogenetics and Cell Genetics, 81(3–4), 278–82.2. Naz, F., Anjum, F., Islam, A., et al. (2013). Cell Biochemistry and Biophysics, 67(2), 485–99.3. Marx, A., Nugoor, C., Panneerselvam, S., et al. (2010). The FASEB Journal, 24(6), 1637–48.4. Kato, T., Satoh, S., Okabe, H., et al. (2001). Neoplasia, 3(1), 4–9.5. Moroni, R. F., De Biasi, S., Colapietro, P., et al. (2006). Neuroscience, 143(1), 83–94.6. Schneider, A., Laage, R., von Ahsen, O., et al. (2004). Journal of Neurochemistry, 88(5), 1114–26.7. Trinczek, B., Brajenovic, M., Ebneth, A., et al. (2004). The Journal of Biological Chemistry, 279(7), 5915–

23.8. Schmitt-Ulms, G., Matenia, D., Drewes, G., et al. (2009). Cell Motility and the Cytoskeleton, 66(8), 661–72.9. Magnani, I., Novielli, C., Bellini, M., et al. (2009). Cellular Oncology, 31(5), 357–70.10. Roversi, G., Pfundt, R., Moroni, R. F., et al. (2006). Oncogene, 25(10), 1571–83.11. Magnani, I., Moroni, R. F., Roversi, G., et al. (2005). Cancer Genetics and Cytogenetics, 161(2), 140–5.12. Beghini, A., Magnani, I., Roversi, G., et al. (2003). Oncogene, 22(17), 2581–91.

Appl Biochem Biotechnol

13. Brajenovic, M., Joberty, G., Kuster, B., et al. (2004). The Journal of Biological Chemistry,279(13), 12804–11.

14. Wojcik, E., Basto, R., Serr, M., et al. (2001). Nature Cell Biology, 3(11), 1001–7.15. Lilie, H., Schwarz, E., & Rudolph, R. (1998). Current Opinion in Biotechnology, 9(5), 497–501.16. Vallejo, L. F., Brokelmann, M., Marten, S., et al. (2002). Journal of Biotechnology, 94(2), 185–94.17. Roder, H., & Shastry, M. R. (1999). Current Opinion in Structural Biology, 9(5), 620–6.18. Clark, E. D. B. (1998). Current Opinion in Biotechnology, 9(2), 157–63.19. Sambrook, D. W., Jr. (2001). Molecular cloning: a laboratory manual (3rd ed.). Cold Spring Harbor: Cold

Spring Harbor Laboratory.20. Bradford, M. M. (1976). Analytical Biochemistry, 72, 248–54.21. Blancher, C., & Jones, A. (2001). Methods in Molecular Medicine, 57, 145–62.22. Hassan, M. I., Kumar, V., Kashav, T., et al. (2007). Journal of Separation Science, 30(12), 1979–88.23. Hassan, M. I., Kumar, V., Singh, T. P., et al. (2008). Journal of Separation Science, 31(12), 2318–24.24. Kim, S. H. (2003). Protein Expression and Purification, 27(1), 85–9.25. Kurucz, I., Titus, J. A., Jost, C. R., et al. (1995). Molecular Immunology, 32(17–18), 1443–52.26. Grisshammer, R., & Tucker, J. (1997). Protein Expression and Purification, 11(1), 53–60.27. Chu, X., & Li, D. (2003). Protein Expression and Purification, 27(1), 165–70.28. Carrio, M. M., & Villaverde, A. (2002). Journal of Biotechnology, 96(1), 3–12.29. Babu, K. R., Swaminathan, S., Marten, S., et al. (2000). Applied Microbiology and Biotechnology, 53(6),

655–60.30. Misawa, S., & Kumagai, I. (1999). Biopolymers, 51(4), 297–307.31. Shan, J., Baguinon, M., Zheng, L., et al. (2003). Protein Expression and Purification, 27(1), 143–9.

Appl Biochem Biotechnol