Characterizing the Bcl-2 Associated Athanogene 5 ...

Characterizing the Bcl-2 Associated Athanogene 5 Interactome in the Context of Parkinson’s Disease

by

Erik Loewen Friesen

A thesis submitted in conformity with the requirements for the degree of Master of Science

Department of Laboratory Medicine & Pathobiology University of Toronto

© Copyright by Erik Loewen Friesen 2018

ii

Characterizing the Bcl-2 Associated Athanogene 5 Interactome in

the Context of Parkinson’s Disease

Erik Loewen Friesen

Master of Science

Department of Laboratory Medicine & Pathobiology University of Toronto

2018

Abstract

Aberrant alpha-synuclein aggregation is associated with the onset and progression of Parkinson’s

disease (PD). This has made molecular chaperones, a class of proteins responsible for

maintaining proteostasis, an enticing therapeutic target. BAG5 is a co-chaperone protein that

inhibits the chaperone, Hsp70, and promotes PD-like alpha-synuclein aggregation and

neurodegeneration. The mechanisms of how BAG5 impairs proteostasis and promotes apoptosis

are unclear. The purpose of this project was to characterize the BAG5 interactome to guide

further studies of its role in physiological and disease states. A novel interaction between BAG5

and the autophagy adaptor protein, p62, was discovered and investigated, as it pointed to a

potential mechanism by which BAG5 could modify alpha-synuclein aggregation. p62 reduced

and BAG5 enhanced alpha-synuclein self-association in vitro. BAG5 also promoted p62

stability, suggesting a function of the interaction on other p62-dependent proteostasis pathways.

iii

Acknowledgments

I would like to thank all of the members of the Kalia and Lozano labs for their continuous

support throughout this process. This has been a tremendous learning experience that was made

very positive by the team members that have helped me along the way. A special thanks goes to

Hien Chau for teaching me virtually every basic science technique needed to complete this

thesis, and being a great mentor to me for over three years. Thanks also goes to my fellow

graduate students, Mitch, Greg, Krystal, Shirley, Stanley and Kevin, for all the support and good

times we have had throughout my time in the lab. I would also like to acknowledge the entire

group of graduate students and postdocs on the 8th floor of Krembil, who continuously made this

process fun and worthwhile. A special thanks also goes to Mitch De Snoo for his extensive

technical assistance and helping me get through the thick and thin of laboratory research.

The continuous support from both Suneil and Lorraine Kalia has been instrumental to my

success in this program. Thank you for having the trust and patience to allow me to

independently explore new ideas and providing guidance when needed. Thanks also to the

members of the Schmitt-Ulms lab, namely Gerold, Louisa, and Declan, for the time and effort

you put into taking my proteomics data to the next level.

Lastly, I would like to thank the people who supported me on the home front throughout

this process. Thank you Katrina for putting up with my ramblings about obscure topics in

neuroscience research, and understanding when I had to put in long hours at the lab. Thanks to

my parents, Brad, Shelagh, Louise and Peter for your continuous support on multiple fronts.

iv

Table of Contents

Acknowledgments .......................................................................................................................... iii

Table of Contents ........................................................................................................................... iv

List of Abbreviations .................................................................................................................... vii

List of Tables ............................................................................................................................... viii

List of Figures ................................................................................................................................ ix

List of Appendices ......................................................................................................................... xi

Introduction .....................................................................................................................1Chapter 1

Parkinson’s Disease .............................................................................................................11.1

1.1.1 Overview ..................................................................................................................1

1.1.2 Familial PD ..............................................................................................................2

1.1.3 Alpha-synuclein and Proteostasis in PD ..................................................................5

1.1.4 Mitochondrial Dysfunction in PD ............................................................................8

Molecular Chaperones in PD .............................................................................................101.2

1.2.1 The Nature and Function of Molecular Chaperones ..............................................10

1.2.2 Molecular Chaperones and Alpha-Synuclein Pathology .......................................15

1.2.3 Molecular Chaperones and Mitochondrial Dysfunction ........................................17

1.2.4 BAG Family Co-chaperones ..................................................................................18

1.2.5 BAG5 .....................................................................................................................21

Summary and Research Objectives ...................................................................................231.3

Characterizing the BAG5 Interactome ..........................................................................25Chapter 2

Introduction ........................................................................................................................252.1

Materials & Methods .........................................................................................................312.2

2.2.1 Antibodies & Reagents ..........................................................................................31

2.2.2 Cell Culture ............................................................................................................32

v

2.2.3 Western Blotting ....................................................................................................32

2.2.4 Generation of the H4 Stable Cell Lines .................................................................32

2.2.5 Immunoprecipitation and Mass Spectrometry: H4 Cells .......................................33

2.2.6 Generation of the SH-SY5Y Stable Cell Lines ......................................................33

2.2.7 Immunoprecipitation and Mass Spectrometry: SH-SY5Y Cells ...........................34

2.2.8 Bioinformatic Analysis ..........................................................................................35

Results ................................................................................................................................362.3

2.3.1 Characterization of the BAG5 Interactome: H4 Cells ...........................................36

2.3.2 Characterization of the BAG5 Interactome: SH-SY5Y Cells ................................41

Discussion ..........................................................................................................................442.4

Validating the Interaction Between BAG5 and p62 ......................................................48Chapter 3

Introduction ........................................................................................................................483.1



3.2.2 Cell Culture ............................................................................................................53


3.2.4 GST Pull-down Assay ...........................................................................................53

3.2.5 Immunoprecipitation ..............................................................................................54

3.2.6 Immunohistochemistry ..........................................................................................55

Results ................................................................................................................................553.3

3.3.1 Validation and Visualization of the BAG5-p62 Interaction ..................................55

3.3.2 p62 Interacts with BAG5 via its C-terminal Domains ...........................................56

Discussion ..........................................................................................................................613.4

Investigating the BAG5-p62 Interaction in the Context of Alpha-synuclein Chapter 4aggregation ................................................................................................................................63

Introduction ........................................................................................................................634.1

vi



4.2.2 Cell Culture ............................................................................................................66


4.2.4 Alpha-synuclein Protein Complementation Assay ................................................66

Results ................................................................................................................................674.3

4.3.1 p62 reduces the presence of soluble alpha-synuclein and oligomers ....................67

4.3.2 BAG5 KD reduces alpha-synuclein oligomerization but does not impact p62 .....69

4.3.3 BAG5 Stabilizes Endogenous p62 .........................................................................73

4.3.4 Discussion ..............................................................................................................75

General Discussion & Future Directions ......................................................................78Chapter 5

Summary ............................................................................................................................785.1

Study Limitations ...............................................................................................................795.2

Future Directions: BAG5, p62 and Proteostasis ................................................................835.3

Future Directions: BAG5 and Cell Death ..........................................................................855.4

Conclusion .........................................................................................................................885.5

References ......................................................................................................................................89

Appendices ...................................................................................................................................103

Copyright Acknowledgements .....................................................................................................120

vii

List of Abbreviations

AAV:adeno-associatedvirusAD:Alzheimer’sdiseaseADP:adenosinediphosphateALP:autophagylysosomesystemALS:amyotrophiclateralsclerosisATP:adenosinetriphosphateBAG:bcl-2associatedathanogeneBAG5:bcl-2associatedathanogene5Bcl-2:B-celllymphoma2CHIP:C-terminalHsp70interactingproteinCMA:chaperonemediatedautophagyCMV:cytomegalovirusDAPI:4',6-diamidino-2-phenylindole,dihydrochlorideDJ-1:proteindeglycaseDJ-1DSB:doublestandbreakEDTA:ethylenediaminetetraaceticacidEIF4G1:eukaryotictranslationinitiationfactor4gamma1GFP:greenfluorescentproteinGO:geneontologygRNA:guideRNAGST:glutathioneS-transferaseHD:Huntington’sdiseaseHsc70:heatshockcognate70kDaHSF-1:heatshockfactor1HSP:heatshockproteiniTRAQ:isobarictagsforrelativeandabsolutequantificationKD:knockdownKeap1:kelch-likeECH-associatedprotein1KIR:Keap1interactingregionKO:knockoutLAMP2A:lysosome-associatedmembraneprotein2ALB:LewybodyLC3:lightchain3LIR:LC3interactingregion

LN:LewyneuriteLRRK2:leucinerichrepeatkinase2Mcl-1:inducedmyeloidleukemiacelldifferentiationproteinMcl-1miRNA:microRNAMPTP:1-methyl-4-phenyl-1,2,3,6-tetrahydropyridineNBR1:neighborofBRCA1gene1NLS:nuclearlocalizationsignalp62/SQSTM1:sequestosome-1PB1:phoxandbem1PCA:proteincomplementationassayPCR:polymerasechainreactionPD:Parkinson’sdiseasePINK1:PTEN-inducedkinase1ROS:reactiveoxygenspeciesrtTA:reversetransactivatorSBD:substratebindingdomainSDS-PAGE:sodiumdodecylsulfatepolyacrylamidegelelectrophoresissiRNA:smallinterferingRNASN:substantianigraSNCA:alpha-synucleinSNpc:substantianigraparscompactaTALEN:transcriptionactivator-likeeffectornucleasesTDP-43:transactiveresponseDNAbindingprotein43kDaTOM20:translocaseofoutermembrane20TOM22:translocaseofoutermembrane22TPR:tetratricopeptiderepeatTRAP1:TNFreceptorassociatedprotein1TRE:tetracyclineresponseelementUBA:ubiquitinassociateddomainUPS:ubiquitinproteasomesystemZFN:zincfingernuclease

viii

List of Tables

Table 1 Genes Associated with Familial PD .................................................................................. 3

Table 2 Top 10 BAG5 and BAG5+BAG5DARA Interacting Proteins ............................................ 38

ix

List of Figures

Figure 1 Proposed role of molecular and small molecule chaperones in proteostasis. ................. 14

Figure 2 Schematic diagram of the six BAG family members. .................................................... 20

Figure 3 Generation of SH-SY5Y stable cell lines. ...................................................................... 28

Figure 4 Expression of GFP-tagged constructs in H4 cells. ......................................................... 39

Figure 5 Bioinformatic analysis of the BAG5 interactome in H4 Cells. ...................................... 40

Figure 6 Inducible expression of the GFP transgenes in SH-SY5Y cells. .................................... 42

Figure 7 iTRAQ mass spectrometry strategy allows for the visualization of BAG5 vs. BAG5DARA

binding preference. ....................................................................................................................... 43

Figure 8 Bioinformatic analysis of the BAG5 interactome in SH-SY5Y Cells. .......................... 44

Figure 9 p62 facilitates the aggregation and degradation of protein aggregates. ......................... 51

Figure 10 Domain structure of p62 and the deletion constructs generated to map its interaction

with BAG5. ................................................................................................................................... 52

Figure 11 Confirmation of the interactions between BAG5 and DNAJC13/p62 by GST pull-

down. ............................................................................................................................................. 57

Figure 12 Confirmation of the BAG5-p62 interaction via co-immunoprecipitation. ................... 58

Figure 13 BAG5 and p62 co-localize within perinuclear puncta. ................................................ 59

Figure 14 p62 associates with BAG5 independently of its N-terminal PB1 domain. .................. 60

Figure 15 p62 and BAG5 have complex effects on protein aggregation and degradation

pathways. ...................................................................................................................................... 65

Figure 16 Alpha-synuclein protein complementation assay (PCA) proof of concept. ................. 68

Figure 17 p62 reduces the presence of both soluble and oligomeric alpha-synuclein. ................. 70

x

Figure 18 p62 requires both its C-terminal PB1 domain and N-terminal LIR+UBA domains to

influence alpha-synuclein oligomerization. .................................................................................. 71

Figure 19 p62 and BAG5 have independent effects on synuclein oligomerization. .................... 72

Figure 20 BAG5 stabilizes endogenous levels of p62. ................................................................. 74

xi

List of Appendices

Appendix 1 BAG5 Interactome: H4 ........................................................................................... 103

Appendix 2 BAG5 Interactome: SH-SY5Y ................................................................................ 113

Appendix 3 Contributions ........................................................................................................... 119

1

Chapter 1Introduction

Parkinson’s Disease 1.1

1.1.1 Overview

Parkinson’s disease (PD) is a neurodegenerative disorder characterized by the progressive

loss of dopamine neurons in the substantia nigra pars compacta (SNpc). The loss of these

neurons results in the dysfunction of a motor circuit in the basal ganglia involved in fine-tuning

controlled movements (Kalia and Lang 2015, Friesen et al. 2017). In turn, this overtly manifests

as the classic parkinsonian motor deficits including resting tremor, rigidity, akinesia and

postural/gait impairments, as well as non-motor deficits such as cognitive impairments and

psychiatric symptoms. Treatment options for patients with PD include dopamine replacement

therapies, such as levodopa administration, and surgical interventions that modulate activity

within the basal ganglia circuitry using deep brain stimulation (DBS) (Kalia and Lang 2015,

Lozano, Hutchison, and Kalia 2017). Unfortunately, both interventions only address the

symptoms of PD but do not alter the disease progression. Therefore, there is a need for

treatments that address the underlying causes of the disease (Friesen et al. 2017).

A neuropathological hallmark of PD is the presence of intracellular neuronal protein

aggregates called Lewy pathology. Lewy pathology can form in either the soma (Lewy bodies

[LBs]) or dendrites (Lewy neurites [LNs]) of neurons and presents in various brain regions,

including the SNpc (Kalia et al. 2013, Spillantini et al. 1997). The most abundant constituent of

LBs/LNs is misfolded alpha-synuclein, which has lead to a significant amount of research into

the relationship between alpha-synuclein aggregation and PD (Kalia et al. 2013). However, while

2

a correlation between alpha-synuclein aggregation and PD exists, the precise nature of the

relationship between the two remains elusive.

In terms of etiology, most cases of PD do not follow an observable inheritance pattern,

and are classified as “sporadic”. This, combined with the association of PD with exposure to

environmental toxins such as rotenone and paraquat, led many to consider PD a disease brought

about by environmental factors (Tanner et al. 2011). However, in 1997, it was found that a

mutation to the SNCA gene encoding alpha-synuclein could cause PD (Polymeropoulos et al.

1997). Subsequent research lead to the discovery of other PD-causing alpha-synuclein mutations

(currently A30P, E46K, H50Q, G51D, A53T & A53E (Rosborough, Patel, and Kalia 2017)), as

well as a host of other genes that, when mutated, could cause PD in either an autosomal

dominant or recessive manner (Deng, Wang, and Jankovic 2017). In light of this research, the

focus of PD research shifted to include both genetic and environmental etiologies. Now, 5-10%

of PD patients are considered to have hereditary forms of PD also known as “familial PD”, and

harbor PD-associated genetic mutations (Rosborough, Patel, and Kalia 2017, Lesage and Brice

2009).

1.1.2 Familial PD

Investigations into PD-causing genes and genetic loci are ongoing, and, relatively

speaking, the notion of PD as a heritable disease is in its infancy. Therefore, there is still much

debate surrounding which genes are actually disease causing. However, a recent review citing

the HUGO Gene Nomenclature Committee (HGNC) indicates that there are currently 23 known

PD-causing genetic loci (Table 1), of which 19 have designated gene names (Deng, Wang, and

Jankovic 2017). Five of these genes have been well replicated in clinical populations (Koprich,

Kalia, and Brotchie 2017). These include the genes encoding alpha-synuclein (PARK1/PARK4)

3

Table 1 Genes Associated with Familial PD (Adapted from Deng et al. (2017))

Locus Gene Name Protein Name Inheritance Pattern

PARK1 SNCA alpha-synuclein AD PARK2 PRKN parkin AR PARK3 PARK3

AD

PARK4 SNCA alpha-synuclein AD PARK5 UCHL1 ubiquitin C-terminal hydrolase L1 AD PARK6 PINK1 PTEN induced putative kinase 1 AR PARK7 PARK7 parkinsonism associated deglycase (DJ-1) AR PARK8 LRRK2 leucine rich repeat kinase 2 AD PARK9 ATP13A2 ATPase 13A2 AR

PARK10 PARK10

unclear PARK11 GAGYF2 GRB10 interacting GYF protein 2 AD PARK12 PARK12

X-linked

PARK13 HTRA2 HtrA serine peptidase 2 AD PARK14 PLA2G6 Phospholipase A2 group VI AR PARK15 FBXO7 F-box protein 7 AR PARK16 PARK16

unclear

PARK17 VPS35 vacuolar protein sorting 35 AD PARK18 EIF4G1 eukaryotic translation initiation factor 4 gamma 1 AD PARK19 DNAJC6 DNAJC6 (Hsp40 family) AR PARK20 SYNJ1 synaptoganin 1 AR PARK21 DNAJC13 DNAJC13 (Hsp40 family member) AD PARK22 CHCHD2 coiled-coil-helix-coiled-coil-helix domain containing 2 AD PARK23 VPS13C vacuolar protein sorting 13C AR

and leucine rich repeat kinase 2 (LRRK2, PARK8), which cause autosomal dominant PD, as well

as parkin (PARK2), PTEN-induced putative kinase (PINK1, PARK6), and DJ-1 (PARK7), which

cause autosomal recessive PD (Lesage and Brice 2009, Deng, Wang, and Jankovic 2017). While

there are similarities in the clinical phenotype brought about by mutations in these genes, there

are also differences. For example, most patients with PD-associated parkin mutations and some

with LRRK2 mutations do not demonstrate Lewy pathology (Schneider and Alcalay 2017, Kalia

4

et al. 2015). Age of onset also varies significantly between the different PD-causing mutations

(Deng, Wang, and Jankovic 2017).

Since their discovery, the properties of familial PD-associated proteins have been

extensively characterized. This has revealed that they tend to converge within several common

cellular processes (Kumaran and Cookson 2015, Kalia and Lang 2015). Indeed, almost all of

these proteins interact with the proteins and pathways responsible for managing cellular protein

homeostasis (proteostasis), including molecular chaperones, the ubiquitin proteasome system

(UPS) and the autophagy lysosome pathway (ALP) (Friesen et al. 2017). Many of them also play

a role in the maintenance of health and homeostasis within the mitochondrial network. For

example, PINK1 and parkin function in a common pathway, termed ‘mitophagy’, that facilitates

the autophagic degradation of damaged mitochondria (Narendra et al. 2008). These familial PD-

associated proteins also converge onto other processes, such as vesicle trafficking within the

golgi apparatus and endolysosomal system (Kett and Dauer 2016), however, these functions are

not immediately relevant to this thesis and will not be discussed in further detail.

Because of their function in protein and mitochondrial homeostasis pathways, it is not

surprising that disease-causing mutations in PD-associated proteins often results in the loss of

proteostasis and/or mitochondrial health. Interestingly, this parallels the deficits observed in

sporadic PD. For example, the pesticide rotenone, the herbicide paraquat, and the synthetic

compound 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), which cause PD in the human

population and are used as a model of dopaminergic neurodegeneration in laboratory settings,

exert their toxic effect by disrupting the mitochondrial electron transport chain (Langston et al.

1983, Tanner et al. 2011). Moreover, a PD-associated loss of proteostasis had long been evident

due to the presence of Lewy pathology. Therefore, it has become clear that there is a significant

5

overlap in the pathobiology of both sporadic and familial PD. Today, many of the proteins

associated with familial PD, such as LRRK2, parkin, PINK1 and alpha-synuclein, are also

considered to be important to the onset and progression of sporadic PD (Beilina et al. 2014). This

is encouraging from a clinical perspective, as therapies targeting these proteins and pathways

could benefit a larger proportion of PD patients.

1.1.3 Alpha-synuclein and Proteostasis in PD

The protein aggregation phenotype observed in PD is not unique. Many other

neurodegenerative diseases, such as Alzheimer’s disease (AD), Huntington’s disease (HD) and

Amyotrophic Lateral Sclerosis (ALS), are also characterized by the presence of abnormal protein

aggregates. In turn, these neurological disorders have become referred to as ‘proteinopathies’

(Kalia et al. 2013). The protein aggregates in each of these neurodegenerative proteinopathies are

composed of a heterogeneous set of constituents, however, each disease typically has a particular

protein that is specific to its aberrant inclusions. Examples include amyloid-beta and tau in AD,

huntingtin in HD, TDP-43 in ALS and alpha-synuclein in PD. Therefore, neurodegenerative

proteinopathies are further subdivided by the type of protein aggregate they are associated with.

Due to the presence of synuclein-rich aggregates in PD, dementia with Lewy bodies (DLB) and

multiple system atrophy (MSA), these diseases are referred to as synucleinopathies (Kalia et al.

2013, Wong and Krainc 2017).

Alpha-synuclein is a 14kDa protein that lacks a stable three-dimensional structure, and is

therefore considered ‘disordered’ (Wang et al. 2016). Alpha-synuclein composes 1% of total

cytosolic protein in the nervous system (Stefanis 2012), predominantly localizes to pre-synaptic

terminals, and plays a role in vesicle dynamics and neurotransmitter release (Bendor, Logan, and

6

Edwards 2013, Iwai et al. 1995). However, despite two decades of research, there is still much

uncertainty about its physiological function.

Alpha-synuclein can exist as a monomer, or associate into larger assemblies, such as

tetramers or oligomeric species. Oligomers can further associate into fibrillar structures with a β-

pleated sheet conformation (‘fibrils’), and then into the large aggregates observed by

neuropathologists (Kalia et al. 2013). In PD, alpha-synuclein has an increased propensity to form

larger assemblies, including oligomers, fibrils and insoluble aggregates, which has solidified the

notion that alpha-synuclein aggregation contributes to the pathogenesis of PD (Kalia et al. 2013).

Indeed, PD-causing mutations and multiplications of the SNCA gene typically promote alpha-

synuclein oligomerization and aggregation (Lazaro et al. 2014). Furthermore, mutations in other

genes associated with PD, such as LRRK2, also promote alpha-synuclein aggregation (Xiong et

al. 2017). Due to the stereotypical presence of Lewy pathology, it was originally hypothesized

that large aggregates underpinned the dopaminergic neurodegeneration observed in the SNpc.

However, as we have gained a better understanding of alpha-synuclein, this hypothesis has

become increasingly challenged (Friesen et al. 2017, Kalia et al. 2013).

Many investigators have now demonstrated that the smaller oligomeric forms of alpha-

synuclein confer more toxicity than the larger aggregates. Indeed, a synthetic E57K alpha-

synuclein mutation, which increases oligomer formation, enhanced dopaminergic

neurodegeneration in the rat SN relative to synuclein variants that more quickly associate into

fibrils (Winner et al. 2011). In addition, the introduction of A53T mutant alpha-synuclein, which

more rapidly forms oligomers and fibrils than wild-type synuclein, enhanced mitochondrial

dysfunction and cell death in rat primary cortical neurons, neurite defects in C elegans, and

dopaminergic neurodegeneration in Drosophila (Karpinar et al. 2009). These effects were even

7

more pronounced with another alpha-synuclein mutant (A30P/A56P/A76P), which readily forms

oligomers but is impaired in transitioning into larger fibrils (Karpinar et al. 2009).

The toxicity of alpha-synuclein oligomers is further illustrated by their capacity to

propagate between neurons in a prion-like fashion (Chu and Kordower 2015). For example,

following the introduction of synthetic alpha-synuclein fibrils or Lewy body fractions from PD

patients into rodent brains, Lewy pathology develops within the endogenous pool of alpha-

synuclein (Jones et al. 2015, Karampetsou et al. 2017). Moreover, in human clinical trials that

have aimed to enhance dopamine tone by introducing fetal dopaminergic neurons into the

striatum of PD patients, Lewy pathology is seen to spread from the host to the grafted cells (Li et

al. 2008). However, there is some controversy surrounding this finding as many patients did not

demonstrate Lewy pathology in grafted cells, and for those that did, LB like inclusions were

often found in a small subset of the grafted cells (Cooper et al. 2009). Extracellular alpha-

synuclein oligomers can also form pores in the plasma membrane of neurons (Volles et al. 2001),

which may indicate a mechanism by which they propagate between neurons or confer neuronal

toxicity. Interestingly, the notion that alpha-synuclein pathology can self-propagate within the

nervous system supports the plausibility of Braak’s hypothesis, which postulates that PD starts in

the gut and moves up to the brain via the vagus nerve (Visanji et al. 2013).

Despite these advances in understanding, the movement of alpha-synuclein between

different aggregation states is a complicated and nuanced process that is not yet fully understood.

Moreover, while it is clear that different alpha-synuclein species have unique physiological

functions and toxicities, there is still much to be learned about what these are. Alpha-synuclein

may have variable importance to the pathobiology of different types of PD, which is evidenced

by the fact that some patients do not demonstrate Lewy pathology post mortem (Schneider and

8

Alcalay 2017, Kalia et al. 2015). It is also possible that alpha-synuclein oligomerization and

aggregation is not itself disease causing, but rather the byproduct of an already dysfunctional

cellular environment. It will be important to better understand these dynamics as we move

towards disease-modifying therapies that target alpha-synuclein.

1.1.4 Mitochondrial Dysfunction in PD

As mentioned above, mitochondrial dysfunction is another common theme in the

pathobiology of both sporadic and familial PD. The hypothesis that mitochondrial dysfunction

contributes to disease onset was originally brought about by the observation that PD-associated

environmental toxins often impair complex I of the electron transport chain (Tanner et al. 2011,

Schapira et al. 1990). This hypothesis was further supported by recent investigations into the

familial PD-associated proteins, PINK1 and parkin, which have important roles in maintaining

health within the mitochondrial network.

As mentioned above, PINK1 and parkin promote the clearance of damaged mitochondria

via the lysosomes through a process termed mitophagy (Pickrell and Youle 2015). Briefly, at

baseline conditions, PINK1, a serine/threonine kinase, is constitutively imported into the

mitochondrial inner membrane, where it is cleaved and subsequently degraded. When the

mitochondrial membrane potential becomes compromised, PINK1 is stabilized on the surface of

the mitochondria where it phosphorylates a number of targets, notably including ubiquitin and

parkin. These phosphorylation events trigger the recruitment of parkin to the outer mitochondrial

membrane (OMM), where it ubiquitinates numerous OMM proteins. Autophagy ‘adaptor’

proteins, such as p62/SQSTM1 (hereafter p62), NBR1, and optineurin are then recruited to the

OMM, along with additional autophagy machinery. This results in the formation of a lipid

9

bilayer (autophagosome) around the mitochondria, and it is subsequently moved to the

lysosomes for degradation. This process was recently reviewed by (Pickrell and Youle 2015).

PD-causing loss-of-function mutations in both PINK1 and parkin impair their function in

this pathway, suggesting that the process of clearing damaged mitochondria is important in

preventing against dopaminergic neurodegeneration (Pickrell and Youle 2015). This is not

altogether surprising, as damaged mitochondria can be highly toxic, releasing reactive oxygen

species (ROS) and apoptotic stimuli (ex. cytochrome C) into the intracellular environment. This,

in turn, promotes DNA damage, a loss of proteostasis and ultimately, cell death. The oxidative

stress caused by damaged mitochondria has been suggested to provide a mechanistic explanation

of how mitochondrial dysfunction contributes to PD (Al Shahrani et al. 2017, Jenner et al. 1992).

Dopaminergic neurons are at an increased risk of oxidative stress, as dopamine metabolism itself

can generate ROS and impair the electron transport chain (Chen et al. 2008). The combination of

mitochondrial dysfunction with the increased oxidative load of dopaminergic neurons may

exceed the cell’s antioxidant capacity, and explain why we observe a selective degeneration of

dopamine neurons in PD.

The notion that mitochondrial dysfunction contributes to the pathogenesis of PD is not

altogether separate from alpha-synuclein aggregation and proteostasis dysfunction. For example,

Devi and colleagues demonstrated that alpha-synuclein is targeted to and imported into the

mitochondrial inner membrane, where it impairs complex I activity and enhances the generation

of ROS (Devi et al. 2008). This cytotoxic activity of alpha-synuclein was enhanced by the A53T

mutation. A more recent study demonstrated that alpha-synuclein impairs the import of

mitochondrial proteins by disrupting the association of translocase of the outer membrane 20

10

(TOM20) with its co-receptor TOM22 (Di Maio et al. 2016). This also resulted in the increased

production of ROS and a loss of the mitochondrial membrane potential.

The crosstalk between synuclein pathology and mitochondrial dysfunction illustrates that

PD is likely not caused by a single toxic cellular event or pathway, but rather by a combination

of several interrelated dysfunctional processes. This complex nature of PD pathobiology makes it

challenging to design disease-modifying therapies, as targeted therapies may fail to address all of

the factors contributing to disease progression. It appears, then, that disease-modifying

therapeutic strategies may require the simultaneous use of multiple interventions. An alternative

strategy would be to identify proteins or pathways that sit at ‘connection points’ between the

dysfunctional processes observed in PD. Such proteins likely represent the most efficient and

effective therapeutic targets for PD, as multiple disease-contributing pathways could be modified

using a single targeted therapy. One class of proteins that stands at the intersection between

proteostasis, mitochondrial health and cell death are molecular chaperones. In turn, they have

become regarded as a potentially powerful therapeutic target for PD (Friesen et al. 2017, K

Kalia, V Kalia, and J McLean 2010).

Molecular Chaperones in PD 1.2

1.2.1 The Nature and Function of Molecular Chaperones

Note: the following section is an excerpt from Friesen et al. (2017)

Molecular chaperones are highly conserved proteins that function to maintain proteostasis

by directing the folding of nascent polypeptide chains, refolding misfolded proteins, and

targeting misfolded proteins for degradation. Molecular chaperones are also termed ‘heat shock

proteins’ (HSPs), as initial studies found them to be upregulated in response to high

temperatures. In eukaryotes, HSPs are a large and heterogeneous group of proteins that have

11

been classified into families based on their molecular weight: Hsp40, Hsp60, Hsp70, Hsp90,

Hsp100, and the small HSPs (Kampinga and Bergink 2016). The activity of HSP family

members is modulated by another class of proteins termed ‘co-chaperones’ which can be

subdivided based on the presence of a Bcl-2 Associated Athanogene (BAG) domain, a

tetratricopeptide (TPR) domain, or a J domain. Each of the families of chaperones and co-

chaperones are composed of multiple proteins, which, despite having similar functions and

domain compositions, often vary significantly in terms of their expression pattern and subcellular

localization (Kampinga and Bergink 2016).

Due to the number and heterogeneity of chaperone and co-chaperone proteins, the

nomenclature has become complex, with some chaperones receiving multiple names. As such, a

new nomenclature was developed where DNAJ, HSPD, HSPA, HSPC, HSPH, and HSPB are the

preferred prefix terms for the Hsp40, Hsp60, Hsp70, Hsp90, Hsp100, and small Hsp family

members, respectively (Kampinga et al. 2009). For the purposes of this thesis, ‘Hsp’ will be used

when referring to an entire family of Hsp chaperones and the new nomenclature will be used

when referring to specific members within a family.

The two main chaperone machines in eukaryotes are Hsp70 and Hsp90, which together

account for at least half of the molecular chaperones present in eukaryotic cells (Ciechanover and

Kwon 2017). The Hsp70 family members are the most studied molecular chaperones and have

received significant attention in PD due to their abundance in Lewy bodies and their

neuroprotective effect in pre-clinical models of the disease (K Kalia, V Kalia, and J McLean

2010). A subset of Hsp70 chaperones, namely HSPA1A, HSPA1B, and HSPA6, show stress-

induced expression patterns, whereas the other Hsp70 family members, such as HSPA8 (often

12

referred to as Hsc70), are expressed constitutively at baseline conditions (Kampinga and Bergink

2016).

A signaling pathway involving the transcriptional activator, heat shock factor 1 (HSF-1),

regulates the expression of inducible Hsp70 family members following stressful stimuli (Figure

1). At baseline conditions, HSF-1 is bound by Hsp90, maintaining HSF-1 in an inactive

monomeric form (Zou et al. 1998). Following proteotoxic stress, HSF-1 dissociates from Hsp90

and translocates to the nucleus where it upregulates transcription of its target genes (Morimoto

1998). Once proteostasis is re-established, Hsp90 again sequesters HSF-1 into its inactive

monomeric form, suppressing inducible Hsp70 expression. This crosstalk between chaperones

and the presence of both constitutively active and stress-inducible chaperones on a negative

feedback loop allows for the cell to execute continuous ‘house-keeping’ tasks in proteostasis, as

well as respond to potentially devastating proteotoxic stress.

The primary role of Hsp70 is to ensure proper protein folding. Hsp70 accomplishes this

by binding exposed hydrophobic domains on misfolded proteins (‘clients’) via its C-terminal

substrate binding domain (SBD) and then undergoing multiple ATP hydrolysis cycles at the N-

terminal ATPase domain (Rüdiger et al. 1997, Bukau and Horwich 1998). Hydrolysis of ATP to

ADP stabilizes the Hsp70-client complex, which allows for Hsp70 to hold the client protein and

increases the likelihood of spontaneous refolding (Ciechanover and Kwon 2017). Subsequent

ADP-ATP exchange reduces the stability of the Hsp70-client complex, allowing for client

dissociation or subsequent ATP hydrolysis cycles. While there are multiple models of the

mechanism by which Hsp70 mediates protein refolding, the cycling between ATP and ADP

bound states is necessary for this function (Goloubinoff and De Los Rios 2007).

13

The ATP hydrolysis cycle on Hsp70 is modulated by Hsp40, HSPH2 (Hsp110), the TPR

domain-containing Hsp70 interacting protein (Hip), and BAG family co-chaperone proteins.

Hsp40s are important for both client selection and facilitating ATP hydrolysis (Kelley 1999), and

Hip stabilizes the ADP bound state of Hsp70 (Höhfeld and Jentsch 1997). Both BAG family

members and HSPH2 act as nucleotide exchange factors (NEFs), promoting the release of ADP

from the ATPase domain (Höhfeld and Jentsch 1997, Arakawa et al. 2010, Rampelt et al. 2012).

As such, Hsp40 and Hip promote Hsp70-client stability, whereas BAG family proteins and

HSPH2 destabilize the interaction. Therefore, the relative abundance of co-chaperone proteins

play an important role in the dynamics of Hsp70 refolding activity. A complex interplay between

the nature of the client protein, the Hsp70 family member, and the co-chaperone proteins present

likely determines the efficacy and the mechanism by which a protein becomes refolded.

Outside of their primary function of protein refolding, molecular chaperones also play

important roles in cellular processes such as guiding misfolded proteins for degradation through

the UPS or ALP, disaggregating protein aggregates, suppressing cell death pathways, and

promoting mitochondrial health (Figure 1). Hsp70-mediated protein degradation via the UPS is

largely regulated by co-chaperone proteins, namely the C-terminal Hsp70 interacting protein

(CHIP), which is both an Hsp70 co-chaperone and an E3 ubiquitin ligase, thus providing a

mechanistic link between the chaperone system and the UPS (Meacham et al. 2001, Murata et al.

2001). HSPA8 (Hsc70), in conjunction with lysosomal-associated membrane protein 2A

(LAMP2A) and multiple co-chaperones, can also facilitate protein degradation via the ALP

through a process termed chaperone-mediated autophagy (CMA) (Figure 1) (Xilouri, Brekk, and

Stefanis 2016, Cuervo et al. 2004). Moreover, a chaperone machine composed of Hsp70, HSPH2

(Hsp110), and Hsp40 has a demonstrated ‘disaggregase’ activity by which it can remove

14

misfolded proteins from already formed aggregates (Gao et al. 2015, Nillegoda and Bukau

2015).

Figure 1

*Figure from Friesen et al. (2017)

Figure 1 Proposed role of molecular and small molecule chaperones in proteostasis. At baseline, Hsp90 is

bound to HSF-1, maintaining its inactive state. In the presence of proteotoxic stress, or the addition of Hsp90

inhibitors (i.e., geldanamycin, 17-AAG, SNX compounds), active HSF-1 dissociates from Hsp90 and translocates

into the nucleus where it induces Hsp70 expression. Inducible Hsp70 family members direct proteasomal

degradation through a pathway mediated by CHIP, Parkin, and other E3 Ligases. This process is inhibited by BAG

family members and promoted by small molecule HSF-1 activators including celastrol and carbenoxolone. In

response to proteotoxic stress, chaperones also direct misfolded proteins for degradation via the autophagy lysosome

system, through interactions with various co-chaperones (chaperone-mediated autophagy). Chaperone/co-chaperone

complexes can also function to disaggregate already formed protein aggregates. The pharmacological chaperones,

ambroxol and isofagomine, increase glucocerebrosidase (GCase) activity in the lysosome to further promote the

process of chaperone-mediated autophagy. Chaperone functions within the endoplasmic reticulum and mitochondria

are regulated by the specific members of the Hsp70 family, HSPA5 and HSPA9, respectively.

HSF-1 Hsp90

HSF-1

InducibleHsp70

MisfoldedProtein ProteinAggrega>on

HSPA9(Mortalin)

HSPA5(GRP78,BIP)

EndoplasmicRe/culum

MitochondriaTargetGenes

ProteotoxicStress

ProteasomalDegrada/on

CHIPParkinOtherE3Ligases

BAGFamilyMembers

Disaggrega>on

LysosomalDegrada/on(Chaperone-MediatedAutophagy)

HSPA8LAMP2ACo-chaperones

HSPA8HSPH2DNAJB1

Nucleus

CelastrolArimoclomolCarbenoxolone

Geldanamycin17-AAG

SNXCompounds

GCase

AmbroxolIsofagomine

Lysosome

15

1.2.2 Molecular Chaperones and Alpha-Synuclein Pathology

Note: the following section is an excerpt from Friesen et al. (2017)

Early evidence implicating molecular chaperones in the pathobiology of PD stemmed

from the observation that Hsp70 overexpression attenuated alpha-synuclein mediated

dopaminergic neurodegeneration in a Drosophila model (Auluck et al. 2002). This suggested that

Hsp70 may play a neuroprotective role in PD. Subsequently, McLean and colleagues illustrated

that multiple chaperone proteins co-localize with Lewy bodies and that the overexpression of

several Hsp40 and Hsp70 family members antagonize the formation of alpha-synuclein

aggregates in vitro (McLean et al. 2002).

Molecular chaperones were further implicated in the pathobiology of PD through the

observation that polymorphisms within the promoter region upstream of both constitutively

expressed and inducible Hsp70 family members increases the risk of PD in a patient population

(Wu et al. 2004). Furthermore, mutations in the mitochondrial Hsp70, HSPA9 (mortalin), were

recently suggested to promote the development of PD; however, other groups suggest mutations

in HSPA9 are not a frequent cause of early-onset PD as they are also found in patient controls

(De Mena et al. 2009, Wadhwa et al. 2015, Burbulla et al. 2010, Freimann et al. 2013).

Since these initial studies, the capacity of Hsp70 overexpression to ameliorate alpha-

synuclein aggregation and toxicity has been well characterized. Independent groups have shown

that Hsp70 overexpression can attenuate alpha-synuclein-mediated cell death in yeast (Flower et

al. 2005) and reduce high molecular weight aggregates and toxicity in rodent models of PD

(Moloney et al. 2014, Klucken, Shin, Masliah, et al. 2004). Hsp70 overexpression was shown to

be protective against cell death mediated by the mitochondrial complex I inhibitor, MPTP, both

in vitro (Quigney, Gorman, and Samali 2003) and in vivo (Dong et al. 2005). Although alpha-

16

synuclein aggregation is not a feature of this toxin model, alpha-synuclein is required for MPTP-

induced cell death as demonstrated by the resistance of alpha-synuclein null mice to MPTP-

induced neurotoxicity (Dauer et al. 2002).

In parallel with the Hsp70 overexpression results, recent studies have demonstrated that

microRNA (miRNA) mediated translational repression of Hsp70 exacerbates alpha-synuclein

aggregation and toxicity in vitro (Zhang and Cheng 2014) and that miRNAs targeting Hsp70 are

upregulated in brain regions with Lewy pathology (Alvarez-Erviti et al. 2013). Furthermore, the

Hsp70 family members HSPA8 (Hsc70) and HSPA9 (mortalin) have lower expression in the SN

(HSPA8/9) (Alvarez-Erviti et al. 2010), and leukocytes (HSPA8) (Papagiannakis et al. 2015,

Sala et al. 2014) of PD patients relative to healthy controls, suggesting that chaperone levels and

function may have a role in the pathogenesis of PD.

The mechanism by which Hsp70 attenuates alpha-synuclein aggregation and toxicity

seems to be dependent on both its refolding activity and its function in protein degradation via

the UPS and ALP. Mutations that alter the ATPase function of Hsp70 (K71S) abolish its

protective effect on alpha-synuclein toxicity, indicating that Hsp70 folding activity is necessary

for its protective function (Klucken, Shin, Hyman, et al. 2004). Hsp70/co-chaperone complexes

also mitigate alpha-synuclein mediated toxicity by promoting the degradation of misfolded

alpha-synuclein via either the UPS or ALP. Several studies have suggested that CMA may be

playing an important role in mitigating alpha-synuclein toxicity and aggregation (Cuervo et al.

2004, Mak et al. 2010, Xilouri and Stefanis 2015). Enhanced alpha-synuclein expression in both

transgenic and paraquat models of PD results in a concurrent enhancement of LAMP2A and

HSPA8 expression, and a greater movement of alpha-synuclein into the lysosomes (Mak et al.

2010). Moreover, both LAMP2A and HSPA8 have lower expression in the SN of PD patients

17

(Alvarez-Erviti et al. 2010), and a recent study demonstrated a correlation between the loss of

LAMP2A and alpha-synuclein aggregation in post-mortem PD brains (Murphy et al. 2015).

Interestingly, the observed decrease in LAMP2A and HSPA8 expression anatomically overlaps

with an increase in miRNAs capable of translationally repressing both LAMP2A and HSPA8

(Alvarez-Erviti et al. 2013), further implicating miRNAs in PD-associated chaperone

dysregulation.

Outside of CMA, the Hsp70 co-chaperone, CHIP, plays an important dual function in

alpha-synuclein degradation, as it can target alpha-synuclein for degradation by either the

proteasome or lysosome via its TPR domain or U-box domain, respectively (Shin et al. 2005).

CHIP may mediate this through ubiquitination of alpha-synuclein and suppression of oligomer

formation (Kalia et al. 2011). However, not all Hsp70 co-chaperones promote alpha-synuclein

degradation. In contrast, overexpression of the BAG family member, BAG5, antagonizes CHIP-

mediated alpha-synuclein ubiquitination, which prevents the ability of CHIP to suppress

oligomer formation and also enhances alpha-synuclein-mediated toxicity (Kalia et al. 2011).

Therefore, the balance between multiple co-chaperones may assist Hsp70 in triaging whether to

refold or degrade a client substrate, and a disruption in the relative abundance or activity of co-

chaperones may compromise the chaperone system and subsequently proteostasis.

1.2.3 Molecular Chaperones and Mitochondrial Dysfunction

The potential role of chaperones in the pathobiology of PD is broadened by their capacity

to regulate the stability and function of PD-relevant proteins other than alpha-synuclein,

particularly those that relate to mitochondrial dysfunction. For example, Hsp70 and Hsp90

family members regulate the stability of PINK1 and Parkin. Hsp90 regulates the processing and

stability of PINK1, and the Hsp90 family member HSPC5, commonly known as TNF Receptor

18

Associated Protein 1 (TRAP1), promotes mitochondrial health and compensates for the

mitochondrial dysfunction caused by PD-associated PINK1 mutations (Zhang et al. 2013).

Moreover, the Hsp70 family member HSPA1L and the co-chaperones BAG2 and BAG4 have all

been shown to modulate PINK1-Parkin mediated mitophagy by effecting the translocation of

Parkin to damaged mitochondria (Hasson et al. 2013, Qu et al. 2015). Hsp70 supports Parkin by

preventing it from being sequestered and by acting in concert with CHIP to promote its E3

ubiquitin ligase activity following proteotoxic stress (Imai et al. 2002). In contrast, the co-

chaperone BAG5 inhibits Parkin E3 activity, which may provide a mechanistic explanation as to

how BAG5 enhances dopaminergic neurodegeneration (Kalia et al. 2004b) (discussed below).

Taken together, the capacity of Hsp70 and its co-chaperones to manage toxic alpha-

synuclein species and mitochondrial homeostasis pathways, indicates that molecular chaperones

have a central and multi-faceted role in the pathobiology of PD. Moreover, since multiple

chaperones are downregulated, sequestered into protein aggregates, or face age-related loss-of-

function in the brains of PD patients, it seems likely that the depletion and dysfunction of

molecular chaperones contributes to the progression of PD. As such, this class of proteins is

regarded as being a potentially powerful therapeutic target for disease-modifying therapies in PD

and other proteinopathies. Unfortunately, the chaperone network is a large and complex group of

proteins, demonstrating context dependent changes in expression and function that are far from

being completely understood. Therefore, much work remains to be done in understand how this

network can be therapeutically targeted to restore proteostasis in disease.

1.2.4 BAG Family Co-chaperones

The BAG family of Hsp70 co-chaperone proteins are a particularly enticing therapeutic

target within the chaperone system as they have not only been shown to play important roles in

19

the management of proteostasis and mitochondrial dynamics, but also in cell survival and death

pathways. There are six members of the bcl-2 associated athanogene (BAG) family, named

BAG1-6 based on the order in which they were discovered (Kabbage and Dickman 2008a). The

first member of this family, BAG1, was identified in 1995 during a screen for bcl-2 interactors,

and was shown to promote cell survival due to its synergistic relationship with the oncogene bcl-

2 (Takayama et al. 1995). Shortly thereafter, BAG1 was deemed a co-chaperone protein, as it

was found to interact with and modulate the function of Hsp70 (Takayama et al. 1997).

BAG family members are characterized by the presence of a 110-124 amino acid BAG

domain at their C-terminus (Figure 2). The BAG domain consists of three anti-parallel

amphipathic alpha helices and mediates an interaction with a multitude of proteins including

ATPase domain of Hsp70 (Kabbage and Dickman 2008b). This interaction allows BAG proteins

to modulate the activity of Hsp70 by promoting ADP/ATP exchange, as discussed in section

1.2.1. In terms of cell death, most studies have demonstrated that BAG family members promote

cell survival. Indeed, many studies have implicated BAG family members in tumorigenesis, due

to their potent anti-apoptotic effect, and, in some cases, their support of gain-of-function p53

mutants (Behl 2016, Yue et al. 2016). However, there are some context dependent exceptions to

this phenotype. An increasing body of evidence demonstrates that BAG family members, namely

BAG2 (Qu et al. 2015) and BAG5 (Kalia et al. 2004a), can promote cell death in certain

contexts.

The notion that BAG family members can promote cell survival in some contexts and

death in others has introduced some confusion surrounding their function in cell death pathways

and other homeostatic cellular processes. Rather than definitively promoting cell death or

survival, it is emerging that BAG family members may exert context-dependent or modulatory

20

FIGURE 2

Figure 2 Schematic diagram of the six BAG family members. Adapted from Kabbage et al. (2008). Each BAG

family member contains the prototypical C-terminal BAG domain that facilitates their interactions with Hsp70.

BAG5 is unique in that it contains five BAG domains rather than one. BAG1 has three isoforms that differ in their

length and are therefore termed BAG1S, BAG1M and BAG1L. BAG1 and BAG6 contain an N-terminal ubiquitin-

like domain (UBL).

effects on apoptosis (De Snoo et al. in preparation). Therefore, as is the case with the chaperone

network as a whole, there is need to better understand the mechanistic nuances of BAG family

members in order to understand if and how they can be manipulated to restore cellular health and

proteostasis in disease. There is an interesting dynamic at play in the BAG protein literature, as

21

cancer researchers are trying to understand how these proteins can be targeted to promote cell

death, while neurodegenerative disease researchers are aiming for the opposite effect.

1.2.5 BAG5

BAG5 is a unique member of the BAG family in that it contains five BAG domains rather

than one, however, it is still the C-terminal BAG domain that mediates its association with

Hsp70 (Arakawa et al. 2010). BAG5 is of particular interest because it has been implicated in the

pathobiology of PD. In the first characterization of BAG5, Kalia and colleagues found that it

inhibits the protein folding capacity of Hsp70, impairs the E3 ubiquitin ligase function of parkin,

and enhances dopaminergic neurodegeneration in a rodent model of PD (Kalia et al. 2004a).

Additional unpublished work by our lab suggests that BAG5 may enhance cell death by

promoting pro-death kinase signaling pathways. These results have made BAG5 an enticing

therapeutic target for PD, as reducing its levels or activity would foreseeably stimulate the anti-

apoptotic functions of Hsp70 and parkin, suppress cell-death pathways and, ultimately, promote

neuronal survival.

Several other lines of evidence have implicated BAG5 in the pathobiology of PD. First,

BAG5 enhances alpha-synuclein oligomerization by inhibiting the E3 ligase activity CHIP,

which normally ubiquitinates alpha-synuclein to promote its proteasomal degradation (Kalia et

al. 2011). Second, BAG5 interacts with PINK1, which, in conjunction with its inhibitory effect

on parkin, suggests that BAG5 may play a role in the maintenance of mitochondrial homeostasis

via mitophagy (Wang et al. 2014). Indeed, preliminary evidence from our lab suggests that

BAG5, like BAG2 and BAG4, does modulate the ability of parkin to translocate to damaged

mitochondria (De Snoo et al. in preparation). Third, BAG5 promotes autophagy dysfunction on a

22

larger scale, as it forms a complex with LRRK2 that promotes the clearance of the trans-golgi

network: an activity that reduces the functional capacity of the ALP (Beilina et al. 2014).

The fact that BAG5 plays a modulatory role in the ALP, UPS, chaperone system and cell

death pathways has solidified the notion that it is likely a valid therapeutic target for PD.

However, despite this potential, the functional characteristics of BAG5 are far from being fully

characterized. Like the other BAG family members, while initial evidence demonstrated that

BAG5 promotes cell death, recent studies have shown that BAG5 can promote cell survival in a

number of in vitro contexts (Bi et al. 2016b, Bruchmann, Roller, Walther, Schäfer, et al. 2013,

Guo et al. 2015b, Gupta et al. 2016, Ma et al. 2012, Wang et al. 2014). Therefore, some work

remains to be done in determining the precise function of BAG5 in both wild type and

pathological settings before moving forward with the development of a BAG5-targeted therapy.

One option to better understand the function of BAG5 is to characterize its interactome.

This sort of proteomic screen provides insights into the pathways and processes that a protein

interacts with, which can stimulate new hypotheses about its function and relevance to certain

disease states. Interactome studies can also serve to uncover new protein interactions that,

through additional investigation, lead to the generation of more fine-tuned mechanistic insights

of a protein’s function. As such, interactome studies are recognized as a powerful tool in

understanding the nuances and relationships within the chaperone network, including those of

BAG5. Several studies have already used such proteomic screens to investigate the ‘chaperome’

(Hadizadeh Esfahani et al. 2018, Taldone et al. 2014). For example, Chen and colleagues

characterized the BAG3 interactome, which allowed them to uncover a novel function of BAG3

in modulating proteasome activity (Chen et al. 2013). Therefore, characterizing the BAG5

23

interactome appears to be an appropriate next step in understanding its function both within and

outside of the context of PD.

Summary and Research Objectives 1.3

Due to their engagement with multiple cellular processes relevant to the pathobiology of

neurodegenerative proteinopathies, molecular chaperones have arisen as a potentially powerful

therapeutic target. The feasibility of chaperone-based therapies is complicated by the fact that

molecular chaperones exist in a complex and changing proteomic network, making them a

difficult target to manipulate pharmaceutically. As such, there is an emerging need to

characterize the nuances of the chaperone network in order to best understand how therapies can

be tailored to restore proteostasis. While there has been significant progress made in

understanding chaperone proteomics, there still remains much work to be done.

BAG5 exemplifies the characteristics of the larger chaperone network in

that its effect on proteostasis and cell death changes with different contexts, likely due to its

transient and changing interactions with proteins both within and outside of the chaperone

network. While BAG5 has been hypothesized to be important to the pathobiology of PD,

conflicting results surrounding its role in cell death have confused its suitability as a therapeutic

target. As such, as is the case with the molecular chaperone network as a whole, it is imperative

to understand the regulatory proteomic network that surrounds BAG5 in order to understand if

and how it can be targeted by disease-modifying therapies.

In order to address this need, the primary aim of this thesis is to characterize the BAG5

interactome to get a better sense of the proteins and pathways that BAG5 associates with. We

hypothesized that by characterizing the BAG5 interactome we would uncover novel interactions

relevant to the regulation of proteostasis in PD. Such interactions would have the potential to

24

extend the role of BAG5 in proteostasis beyond what is currently known, and, in turn, provide

insights into the molecular function of BAG5 in both physiological and pathological contexts.

Therefore, the secondary and tertiary aims of this project were to identify novel and interesting

BAG5 interactions and explore the function(s) of these interactions in the context of PD.

This manifested into the following three specific research aims that will be discussed

over the next three chapters:

1. Characterize the BAG5 interactome in H4 and SH-SY5Y cells

2. Validate a novel interaction identified between BAG5 and p62

3. Understand the function of the BAG5-p62 interaction in the context of alpha-

synuclein aggregation

25

Chapter 2Characterizing the BAG5 Interactome

Introduction 2.1

As discussed in the introductory chapter, interactome analyses can serve as an important

starting point for understanding a protein’s function. Because there is a lack of clarity

surrounding the function of BAG5 in both wild type and pathological settings, the primary goal

of this thesis was to characterize the BAG5 interactome. We opted to first investigate the BAG5

interactome in the H4 neuroglioma cell line, as we, and others, have previously used this cell line

to interrogate molecular pathways relevant to PD (Kalia et al. 2011, McLean et al. 2002, McLean

et al. 2004). H4 cells lines were stably transfected with GFP or GFP-BAG5, and BAG5

interacting proteins were analyzed by immunoprecipitating the GFP transgenes and identifying

co-immunoprecipitated proteins via mass spectrometry.

Because BAG5 strongly associates with Hsp70, we foresaw that assessing the BAG5

interactome would be challenging, as it would be difficult to discern whether identified proteins

were true interactors, or transient, non-specific cargo of the Hsp70 machinery. As such, we

generated an additional cell line stably expressing GFP-BAG5DARA, a previously described

BAG5 mutant incapable of binding to Hsp70 (Kalia et al. 2004a), to gauge whether or not

interactions were dependent on the presence of Hsp70. The DARA mutant has key aspartate and

arginine residues in four of the BAG domains mutated to alanine to effectively disrupt its

interaction with Hsp70.

Following the characterization of the BAG5 interactome in H4 cells, we aimed to solidify

the data and understand whether the results could be generalized to other cell types. In

collaboration with the Schmitt-Ulms Lab, we carried out a second analysis of the BAG5

26

interactome in SH-SY5Y cells. This dopaminergic neuroblastoma cell line was chosen because it

is considered to be a better in vitro model of dopaminergic neurons than other popular

immortalized cell lines (HEK293, HeLa, etc.) and more conducive to genetic manipulation than

primary neuronal cultures.

SH-SY5Y cell lines stably expressing inducible GFP, GFP-BAG5 and GFP-BAG5DARA

were generated by inserting the GFP transgenes into the AAVS1 safe harbor. This insertion

strategy was used to account for the effects of random genomic integration of the transgene,

which may have confounded the results observed in the H4 interactome. Like the H4

interactome, the GFP-tagged proteins were immunoprecipitated and co-immunopreicpitated

proteins were gauged using mass spectrometry. However, unlike the H4 interactome, the SH-

SY5Y mass spectrometry analysis made use of isobaric tags for absolute and relative

quantification (iTRAQ) in order to gauge differences in a protein’s binding preference for either

BAG5 or BAG5DARA. The iTRAQ 8-plex reagents allow for peptides from 8 different samples to

be covalently linked to 8 unique tags that can be detected by the mass spectrometer. In turn, for

every identified protein, the relative abundance of the iTRAQ tags serves as a surrogate measure

of the relative abundance of that protein across the eight samples.

The generation of the SH-SY5Y cell lines used for this screen required the use of elegant

genetic editing techniques, represented a significant portion of the work for this thesis, and

resulted in the production of a sophisticated tool for future in vitro assays used in our lab. As

such, a more detailed description of the transgene insertion strategy and rationale is discussed

here before moving on to the results of the proteomic screens. The theoretical approach used to

insert the transgenes was entirely developed by the lab of Dr. Schmitt-Ulms, with a significant

amount of the work done by Xinzhu (Louisa) Wang.

27

Outline of the GFP transgene Insertion Strategy (see Figure 3)

1. Stablyintroducelox71andlox2272intointron1oftheAAVS1safeharborofSH-SY5Y

cellsusingCRISPR-Cas9

2. GenerateareplacementplasmidcontaininginducibleGFP,GFP-BAG5orGFP-BAG5DARA

flankedbylox66andlox2272

3. StablyinsertGFP,GFP-BAG5orGFP-BAG5DARAintointron1oftheAAVS1safeharborof

SH-SY5YcellsusingLE/REcre-recombination

1. Stably introduce lox71 and lox2272 into intron 1 of the AAVS1 safe harbor of SH-SY5Y

cells using CRISPR-Cas9

Selection of the AAVS1 Safe Harbour

In order to minimize the unknown effects of random genomic integration, researchers

have made use of genomic safe-harbours. Here, a transgene is inserted into a known genomic

location where the effect on endogenous cellular function is minimized. While there is some

controversy as to what constitutes a genomic safe harbor (ie. within housekeeping genes,

intragenic, extragenic, etc.), there are three safe harbours commonly used in human cell lines:

CCR5 (chromosome 3p21.31), ROSA26 (chromosome 3p25.3) and AAVS1 (chromosome

19q13.42) (Sadelain, Papapetrou, and Bushman 2011).

A transgene can be inserted into these regions by capitalizing on DNA repair machinery

that introduces new genetic material (from a replacement plasmid) following a double-strand

break (DSB) mediated by endonucleases such as zinc-finger nucleases (ZFNs), transcription

activator-like effector nucleases (TALENs), or more recently, Cas9 (Sadelain, Papapetrou, and

Bushman 2011). Considering that several studies have successfully used CRISPR-Cas9 to insert

28

FIGURE 3

Figure 3 Generation of SH-SY5Y stable cell lines. Schematic of the strategy used to insert the GFP, GFP-BAG5,

and GFP-BAG5DARA transgenes into the AAVS1 safe harbour of SH-SY5Y cells. Briefly, lox71, lox2272 and a

Kanamycin selection marker (KanR) were inserted into the intron 1 of the AAVS1 safe harbour using CRISPR-Cas9

homology directed repair with two 800 base pair homology regions. The GFP transgenes (with tetracycline-

responsive element (TRE) promoter), along with the genetic machinery necessary to allow for tetracycline inducible

expression (rtTA3 with cytomegalovirus (CMV) promoter) and a Puromycin selection marker (PuroR), were flanked

with lox66 and lox2272 to allow for them to be swapped into the safe harbour in the presence of cre recombinase.

The recombination of lox71 & lox66 creates a non-functional lox site, which is referred to as a left element/right

element (LE/RE) strategy, and prevents the transgenes from being swapped out of the safe harbour by

residual cre recombinase.

29

transgenes into intron 1 of the AAVS1 locus without toxic or gene silencing effects (Oceguera-

Yanez et al. 2016), this site was selected by the Schmitt-Ulms lab to insert the transgene. The

AAVS1 locus encodes the ‘protein phosphatase 1 regulatory subunit 12C’ (PPP1R12C), which

currently has no known function.

Use of CRISPR-Cas9 to edit the AAVS1 locus

The parent cell line that we used to generate the inducible GFP, GFP-BAG5 and GFP-

BAG5DARA cell lines were edited with CRISPR-Cas9 by X. Wang of the Scmitt-Ulms lab. A

paired nickase strategy to insert two lox sites (lox71 and lox2272, discussed in more detail

below) into the AAVS1 locus (Ran et al. 2013). In order to achieve this, two pairs of gRNAs that

are known to have little off-target effect were used to generate a double strand break in intron 1

of the AAVS1 locus, and a repair plasmid was inserted into the locus via homology-directed

repair.

2. Generate a replacement plasmid containing inducible GFP, GFP-BAG5 or GFP-

BAG5DARA flanked by lox66 and lox2272

Creating an Inducible Transgene using the TetON System

The TetON system is a genetic strategy used to control gene expression through the use

of tetracycline or tetracycline analogs, such as doxycycline. There are two genetic features

required to allow for inducible transgene expression: (1) a gene driven by a Tet-responsive

element (TRE) promoter, and (2) a transcription regulator protein that interacts with the TRE

promoter in the presence of tetracycline/doxycycline (Das, Tenenbaum, and Berkhout 2016). In

the presence of tetracycline, the transcription regulator protein, called ‘reverse transactivator

30

(rtTA)’, undergoes a conformational change that allows it to associate with the TRE promoter.

This interaction subsequently drives the expression of the gene downstream of the TRE.

Since the initial development of the TetON system, there has been a substantial

improvement in the functional capacity of the system through the introduction of new TREs and

rtTAs (Das, Tenenbaum, and Berkhout 2016). As such, these cell lines use the upgraded

‘TREtight’, which reduces the leakiness of the TRE promoter by 4.4X, and rtTA3, which is 25X

more sensitive to tetracycline/doxycycline than the original rtTA.

Features of the EGFP-BAG5 replacement plasmid

In order to pursue the LE/RE cre-recombination strategy (discussed below), the entire

transgene to be inserted into the AAVS1 locus had to be flanked by lox66 and lox2272. The

transgene contained a puromycin resistance gene PuroR for the selection of stable lines.

Downstream and in antisense of the PuroR gene were the GFP transgenes, i.e., GFP, GFP-BAG5,

or GFP-BAG5DARA, as well as the tetON components TREtight and rtTA3 (CMV driven). GFP-

BAG5 and GFP-BAG5DARA both had GFP fused to their N-terminus, in order to minimize any

effect on the C-terminal BAG domain, which is known to mediate the association between

BAG5 and Hsp70.

3. Stably insert GFP, GFP-BAG5 or GFP-BAG5DARA into intron 1 of the AAVS1 safe

harbor of SH-SY5Y cells using cre recombination

Cre-recombinase can be used for a number of different functions depending on the nature

of the lox sites present (Sauer 2002). Lox sites are 34 base pair (bp) genetic elements that have

two Cre-binding sites separated by an 8 bp spacer. If the appropriate lox sites flank two genes,

for example one gene in the genome and one on a plasmid, cre-recombinase has the capacity to

31

exchange the two genes so that a transgene on the plasmid can be effectively swapped into the

genome (Sauer 2002).

One problem with cre-recombination events between the genome and a plasmid is the

possibility of gene reversion, where the gene that was swapped into the genome is moved back

into the plasmid by cre-recombinase. This is especially common when the same pairs of lox sites

are used on both the plasmid and genome. The left-element/right-element (LE/RE) strategy can

be used to minimize gene reversion (Araki, Araki, and Yamamura 2002). Here, lox66 and lox71

are used as the first (downstream) lox sites on the replacement plasmid and genome,

respectively, and a common lox site, lox2272, is used as the second (upstream) lox site. Lox66

and lox71 contain mutations to their right and left Cre-binding sites, respectively. Therefore,

prior to gene swapping, both lox66/lox71 have one functional and one non-functional cre-

binding site, which allows for them to still act as functional lox sites. However, after the swap,

one lox66/71 site will have doubly mutated cre-binding sites, lowering the possibility of gene

reversion.

Materials & Methods 2.2

2.2.1 Antibodies & Reagents

Antibodies: Anti-Actin (A2066) was obtained from Sigma-Aldrich. Anti-GFP (A11122)

was obtained from Invitrogen. Horseradish Peroxidase Linked ECL Anti-Rabbit and Anti-Mouse

secondary antibodies were obtained from GE Healthcare. Reagents: Geneticin (G418, 1013027)

was obtained from Gibco. Puromycin hydrochloride (PUR555) was obtained from Bioshop.

Doxycycline hydrochloride (DB0889) was obtained from Biobasic.

32

2.2.2 Cell Culture

SH-SY5Y and H4 cells wereculturedinDulbecco’sModifiedEagleMedium(DMEM,

Gibco)supplementedwith10%fetalbovineserum(FBS,Gibco),1%antibiotic/antimycotic

(Gibco),andincubatedat37°Cwith5%CO2.SH-SY5YandH4cellswereexclusivelygrown

oncell+plates(Sarstedt).SH-SY5Y cells were transfected using Lipofectamine 2000 (Thermo

Fisher), and H4 cells were transfected using theSuperFectTransfectionReagent(Qiagen),as

perthemanufacturer’sprotocol.

2.2.3 Western Blotting

H4 and SH-SY5Y cells were lysed with Triton X-100 based radioimmunoprecipitation

assay (RIPA) buffer containing 50 mM Tris, 150 mM NaCl, 0.5% sodium deoxycholate, 1%

Triton X-100 and 1X protease inhibitor cocktail (cOmplete, Roche). Protein concentration was

quantified using the DC (Bradford) protein assay (BioRad). 20µg of protein lysate was loaded

into each lane of a 4-15% acrylamide gels (BioRad) and transferred onto

a polyvinylidine fluoride (PVDF) membrane. Blots were blocked with 5% skim milk diluted in

tris-buffered saline + 0.01% Tween-20 (TBS-T) for 30 minutes prior to incubation with primary

antibody for either 1 hour at 21°C or overnight at 4°C. Blots were subsequently washed three

times in TBS-T (10 minutes per wash), incubated in species specific secondary antibody for 1

hour at 21°C, washed again, and then developed using ECL plus western blotting substrate

(Pierce) and visualized on HyBlot CL autoradiographic film (Denville Scientific).

2.2.4 Generation of the H4 Stable Cell Lines

Wild-type H4 neuroglioma cells were stably transfected with GFP, GFP-BAG5 or GFP-

BAG5DARA plasmids, all of which were originally derived from the pEGFP-C1 plasmid

(Clontech, Accession #: U55763). Transfected cells were transferred to selection media

33

containing 700µg/mL G418 (Geneticin) 24 hours after transfection, and were retained in

selection media for 14 days. Colonies that reached the size of 100-200 cells were assessed for

GFP-transgene incorporation using fluorescence microscopy. Colonies stably expressing the

transgene were transferred to a 96-well plate and grown up to 10cm plates for characterization.

2.2.5 Immunoprecipitation and Mass Spectrometry: H4 Cells

H4 stable lines containing GFP, GFP-BAG5 and GFP-BAG5DARA were assessed for

transgene expression with western blot and similarly expressing clones were chosen to move

forward with mass spectrometry. The selected cell lines were lysed with RIPA buffer and 1mg of

cell lysate was combined with 25uL GFP-trap bead slurry (Chromotek) and rotated at 4°C for 90

minutes. Beads were washed three times with 1mL of a buffer composed of 10mM Tris Hcl (pH

7.5), 150mM NaCl and 0.5mM EDTA. Beads were immediately frozen at -20°C and transported

to the SPARC Biocenter at the Hospital for Sick Children. Protein was trypsin-digested directly

off of the beads and analyzed by liquid chromatography and mass spectrometry (LC-MS/MS) on

an OrbiTrap Elite.

2.2.6 Generation of the SH-SY5Y Stable Cell Lines

CRISPR-Cas9 edited parent SH-SY5Y cell lines were generously provided to us by the

laboratory of Dr. Schmitt-Ulms. Genomic PCR and sequencing analysis done by the Schmitt-

Ulms lab revealed that the parent line was heterozygous for the KanR gene flanked by lox71/2722

sites. The laboratory of Dr. Schmitt-Ulms also provided us with the SH-SY5Y negative control

cell line containing doxycycline inducible GFP.

We derived our GFP-BAG5 vectors from a GFP-Tau plasmid that was also provided to

us by the laboratory of Dr. Schmitt-Ulms. The plasmid initially contained (1) C-terminal GFP-

Tau with a tetracycline responsive element (TREtight) promoter, (2) rtTA3 with a CMVmini

34

promoter, and (3) a eukaryotic puromycin resistance gene (PuroR), all flanked by lox66 and

lox2722. GFP-Tau was excised from the plasmid using the endonucleases BbvCI and AflII

(NEB), as per the manufacturer’s protocol. N-terminal GFP-tagged BAG5 and BAG5DARA inserts

were generated via PCR from the N-terminal GFP-BAG5 and GFP-BAG5DARA vectors used to

generate the H4 cell lines (originally derived from the pEGFP-C1 vector, Clontech, Accession #:

U55763). The inserts were ligated into the replacement plasmid using the In-Fusion HD Cloning

Kit (Clontech), as per the manufacturer’s protocol. Proper insertion of the transgenes was

verified by sequencing (ACGT Corp., Toronto, ON).

The inducible GFP-BAG5 and GFP-BAG5DARA replacement plasmids were transfected

into the SH-SY5Y parental cell line alongside a plasmid containing the improved Cre-

recombinase (iCre) gene. The ratio of transgene plasmid to iCre plasmid was 2:1. Transfected

cells were transferred into selection media containing 1.2µg/mL puromycin 24 hours post-

transfection. Stable lines were incubated in selection media for 7 days, and then transferred back

into regular media for an additional 7 days to allow for colonies to grow to 100-200 cells.

Successful incorporation of the inducible transgene was assessed by adding 2ug/mL doxycycline

to the media for 6 hours and assessing green colonies with fluorescence microscopy. Colonies

stably expressing the transgene were transferred into a 96-well plate and grown up to 10cm

plates for characterization.

2.2.7 Immunoprecipitation and Mass Spectrometry: SH-SY5Y Cells

SH-SY5Y inducible cell lines (GFP, GFP-BAG5 and GFP-BAG5DARA) were treated with

2μg/mL dox for 18h prior to lysis in a digitonin lysis buffer containing 50μg/ml digitonin, 150

mM Tris-HCl (pH 7.5), 4 μg/ml aprotinin, 5 mM EDTA, 1 mM EGTA, 10 mM NaF, 1 mM Na

orthovanadate, 1 mM PMSF, protease inhibitor cocktail (cOmplete, Roche), and phosphatase

35

inhibitor cocktail (PhosSTOP, Roche). 3mg cell lysate was combined with 50uL GFP-trap bead

slurry (Chromotek) and rotated at 4°C for 90 minutes. Beads were washed four times with 2mL

of a buffer consisting of 150 mM Tris-HCl and 10% glycerol, once with 2mL of 25mM HEPES

and once with 2mL of 10mM HEPES. Protein was eluted from the beads using a buffer

composed of 20% acetonitrile and 1% trifluoroacetic acid (pH 1.9).

All MS sample preparation and experimentation was done by either X. Wang or D.

Williams of the Scmitt-Ulms lab. Briefly, eluted proteins from 3 GFP-BAG5 IP replicates, 3

GFP-BAG5DARA IP replicates and 3 GFP IP replicates were prepared for mass spectrometry

through reduction and alkylation of di-sulfide bonds, trypsin digestion, and labeling with 8-plex

iTRAQ reagents (Sigma-Aldrich). Peptides and relative iTRAQ label abundance was

subsequently identified by OrbiTrap LC-MS/MS/MS (third MS run required for the

identification of the iTRAQ label). Protein content in each sample was normalized to overall

abundance of GFP in order to perform relative quantification using the iTRAQ labels. Relative

iTRAQ peptide quantification was performed using label 118 as the reference sample.

2.2.8 Bioinformatic Analysis

For the H4 interactome, UniProt IDs from all proteins binding to GFP-BAG5, GFP-

BAG5DARA, or both (total: 402) were converted into UniProt gene names using the UniProt

Retrieve/ID mapping tool (https://www.uniprot.org/uploadlists/). Gene names were subsequently

run through the GeneAnalytics software hosted by the GeneCards website

(http://geneanalytics.genecards.org), which calculated Gene Ontology and SuperPath

enrichments in addition to several other bioinformatic outputs. The GeneAnalytics software also

produced FDR-adjusted p-values demonstrating the significance of each enrichment term.

36

For the SH-SY5Y interactome, the raw interactome list was filtered to exclude proteins

that did not have iTRAQ quantification in all eight channels, those that had an abundance ratio of

>0.7 in channels 119 and 121 (GFP negative controls), and those that did not have a “High” FDR

confidence (Exp. q value > 0.01,). The remaining 217 proteins (219 total, BAG5 and BAG5DARA

were excluded) were processed using the GeneAnalytics software in the same way as the H4

interactome.

Results 2.3

2.3.1 Characterization of the BAG5 Interactome: H4 Cells

The stable incorporation of the GFP, GFP-BAG5 and GFP-BAG5DARA transgenes into the

H4 genome was confirmed by western blot (Figure 4). Due to random integration of the

transgenes into the host genome, there was variability in transgene expression between clones.

Clones with similar expression of GFP, GFP-BAG5 and GFP-BAG5DARA, relative to the loading

control, were selected to move forward with the mass spectrometry analysis of the BAG5

interactome (Figure 4).

The interactome identified 402 BAG5 interacting proteins, of which 173 specifically

bound to GFP-BAG5, 92 to GFP-BAG5DARA , and 137 to both (Figure 5, top). Of the 137

binding to both BAG5 and BAG5DARA, 13 had a 50% lower affinity for BAG5DARA, by total

spectrum counts, and were re-classified as BAG5 interacting proteins (Appendix 1). The top ten

proteins binding to BAG5, as well as those binding to both BAG5 and BAG5DARA are listed in

Table 2. The former are considered to be dependent on the association between BAG5 and

Hsp70, and the latter are not. The complete list of BAG5 and BAG5DARA interacting proteins are

listed in Appendix 1.

37

Consistent with the notion that the DARA mutation effectively disrupts the association

between BAG5 and Hsp70, BAG5, but not BAG5DARA, was shown to interact with both Hsp70

(Table 2) and the C-terminal Hsp70 interacting protein (CHIP; Appendix 1). BAG5 interacted

with 5 proteins associated with familial PD, namely UCH-L1 (PARK5), DJ-1 (PARK7), EIF4G1

(PARK18), DNAJC13 (PARK21) and VPS13C (PARK23). Several of these interactions had

already been suggested on protein interaction databases. Indeed, our interactome had a 15%

overlap with the BAG5 interacting proteins listed on the GeneCards database, and a 20% overlap

with those listed on the STRING database.

Consistent with the previous knowledge of BAG5 function, Gene Ontology and Pathway

analysis of the interactome showed an enrichment of terms relating to protein folding,

autophagy, modulation of UPS function, and regulation of apoptosis (Figure 5). A novel theme

that surfaced in this analysis pointed to a role of BAG5 in nuclear functions such as mRNA

splicing.

38

Table 2 Top 10 BAG5 and BAG5+BAG5DARA Interacting Proteins

Spectrum Counts

GeneName Identified Proteins GFP GFP-BAG5 GFP-DARA

BAG5 Interacting

Proteins

DNAJC13 DnaJ homolog subfamily C member 13 0 83 0

BAG5 Isoform 2 of BAG family molecular chaperone 5 regulator 5 0 66 0

TUBB2A Tubulin beta-2A chain 0 49 0

CRYBG3 Very large A-kinase anchor protein 0 31 0

MAP1A Isoform 2 of Microtubule-associated protein 1A 0 30 0

HSPH1 Isoform Beta of Heat shock protein 105 kDa 0 29 0

HSPA1L Heat shock 70 kDa protein 1-like 0 29 0

BAG3 BAG family molecular chaperone regulator 3 0 27 0

SEC16A Isoform 5 of Protein transport protein Sec16A 0 25 0

AHR Aryl hydrocarbon receptor 0 22 0

HSPA6 Heat shock 70 kDa protein 6 0 22 0

BAG5 & BAG5DARA Interacting

Proteins

TUBB3 Tubulin beta-3 chain 0 38 30

TUBB6 Tubulin beta-6 chain 0 34 20

SQSTM1 p62/Sequestosome-1 0 26 14

SLC25A5 ADP/ATP translocase 2 0 19 13

TUFM Elongation factor Tu, mitochondrial 0 19 10

LUZP1 Leucine zipper protein 1 0 16 8

TUBA1C Tubulin alpha-1C chain 0 15 26

HLA-A HLA class I histocompatibility antigen, A-3 alpha chain 0 15 11

PABPC1 Isoform 2 of Polyadenylate-binding protein 1 0 9 13

RPN1 Dolichyl-diphosphooligosaccharide--protein

glycosyltransferase subunit 1 0 9 13

39

FIGURE 4

Figure 4 Expression of GFP-tagged constructs in H4 cells. Western blots of H4 stable cell line clones expressing

GFP (A, right), GFP-BAG5 (A, left) and GFP-BAG5DARA (B). Protein expression measured by probing the blots

with anti-GFP antibody. Blots were also probed with anti-GAPDH (A) or anti-Actin (B) antibodies as a loading

control. Red boxes outline the clones that were chosen for the H4 interactome analysis.

40

FIGURE 5

Figure 5 Bioinformatic analysis of the BAG5 interactome in H4 Cells. Top: venn diagram illustrating the overlap

between BAG5 and BAG5DARA interacting proteins in H4 cells. Middle/bottom: Selection of Gene Ontology (GO):

Biological Process and SuperPath terms enriched in the H4 BAG5 interactome. Dark grey bars refer to the % of

proteins associated with each GO term in the reference dataset. Light grey bars refer to the % of proteins associated

with each GO term in the BAG5 interactome dataset. GO/SuperPath term enrichment and FDR adjusted P-values

calculated by the GeneAnalytics software.

41

2.3.2 Characterization of the BAG5 Interactome: SH-SY5Y Cells

The results from the H4 interactome pointed to an association of BAG5 with a number of

novel proteins and pathways. Therefore, we proceeded with our second analysis of the BAG5

interactome in SH-SY5Y neuroblastoma cells using the iTRAQ mass spectrometry strategy. The

GFP, GFP-BAG5 and GFP-BAG5DARA transgenes were successfully inserted into the AAVS1

safe harbor of SH-SY5Y cells using CRISPR-Cas9 and cre recombination, and the expression of

each of the three transgenes was comparably induced by doxycycline treatment (Figure 6).

Biological triplicates of GFP-BAG5 and GFP-BAG5DARA immunoprecipitations, along

with a duplicated GFP negative control, were labeled with the iTRAQ 8-plex reagents and

combined into a single mass spectrometry run (Figure 7A). As discussed in this chapter’s

introduction, the use of this iTRAQ strategy allowed for us to gauge whether an identified

interacting protein preferentially bound to either GFP-BAG5 or GFP-BAG5DARA. For example,

Figure 7B-D demonstrates that the iTRAQ output can illustrate whether an identified protein has

a stronger (B, Hsc70), equal (C, alpha-synuclein), or weaker (D, p62) association with BAG5

relative to BAG5DARA. In agreement with the H4 interactome, HSPA8/Hsc70 had a significantly

higher binding affinity for GFP-BAG5 relative to GFP-BAG5DARA (Figure 7B).

For the bioinformatic analysis of the SH-SY5Y BAG5 interactome, proteins that bound

to the GFP negative control and those not labeled by all 8 iTRAQ reagents were removed,

leaving a final set of 217 high false discovery rate (FDR) confidence BAG5 interacting proteins

(Appendix 2). The same bioinformatic analysis tool used for the H4 interactome was employed

to analyze the SH-SY5Y interactome. There were many common bioinformatic themes between

the two interactomes. Like the H4 interactome, GO-term and pathway analysis revealed an

enrichment of terms relating to protein folding, UPS function, cell death and mRNA splicing

42

(Figure 8). The SH-SY5Y interactome also validated our previous finding that BAG5 interacts

with alpha-synuclein (Figure 7C), and illustrated an enrichment of the GO-term “Negative

Regulation of Inclusion Body Assembly” (FDR Adjusted P-value: 4.16x10-5, Figure 8), which

aligns with the known role of BAG5 in PD-associated alpha-synuclein aggregation.

FIGURE 6

Figure 6 Inducible expression of the GFP transgenes in SH-SY5Y cells. Western blot illustrating the induction of

GFP, GFP-BAG5 and GFP-BAG5DARA in the SH-SY5Y stable cell lines following treatment with doxycycline for

the specified amount of time. Blot sequentially probed with anti-GFP then anti-Actin antibodies.

43

FIGURE 7

Figure 7 iTRAQ mass spectrometry strategy allows for the visualization of BAG5 vs. BAG5DARA binding

preference. (A) The interactome analysis makes use of an 8plex iTRAQ mass spectrometry workflow, where 8

independent immunoprecipitation (IP) samples are included in a single mass spectrometry run. The numbers 113-

121 indicate the iTRAQ label assigned to each sample. 'DARA' refers to triplicate GFP-BAG5DARA IP samples, and

‘BAG5’ triplicate GFP-BAG5 IP samples. Two GFP IPs are also included as a negative control for the

downstream iTRAQ analysis. The 8 samples are combined into a single mixture that is analyzed with liquid

chromatography (LC) and mass spectrometry (MS). Three mass spectrometry runs are required to identify the

peptide and iTRAQ abundance (MS3). (B-D) Examples of the quantitative output generated by the iTRAQ strategy.

Histogram illustrates the relative abundance of HSPA8/Hsc70 (B), alpha-synuclein (C) and p62 (D) in the 8 iTRAQ

samples grouped into GFP-BAG5 (3 samples), GFP-DARA (3 samples) and GFP (2 samples). Individual points

representing the value of each of the 8 iTRAQ samples relative to one of the BAG5 IP replicates. Bar represents

mean +/- standard error (SE). Significant differences in iTRAQ abundance measured by 1-way ANOVA with

Bonferroni post-hoc testing. ** = p<0.01.

44

FIGURE 8

Figure 8 Bioinformatic analysis of the BAG5 interactome in SH-SY5Y Cells. Selection of Gene Ontology (GO):

Biological Process and SuperPath terms enriched in the BAG5 interactome. Dark grey bars refer to the % of proteins

associated with each GO term in the reference dataset. Light grey bars refer to the % of proteins associated with

each GO term in the BAG5 interactome dataset. GO/SuperPath term enrichment and FDR adjusted P-values

calculated by the GeneAnalytics software.

Discussion 2.4

To our knowledge, this is the first characterization of the BAG5 interactome. In line with

previous knowledge of its co-chaperone activity (Kalia et al. 2004a), BAG5 was shown to be a

part of a rich network of chaperone and co-chaperone proteins in both the H4 and SH-SY5Y

interactomes. This included many Hsp40 and Hsp70 family members, including the PD-relevant

45

Hsp40 family member DNAJC13 (PARK21, Table 2). In addition to DNAJC13, BAG5 was

found to interact with eleven proteins relevant to familial PD across the two interactomes. This

notably included the interaction between BAG5 and alpha-synuclein, which had been previously

identified by our lab (Kalia et al. 2011).

The experiments presented in this chapter are associated with several limitations, such as

the use of immortalized cell lines that likely deviate from the proteomic reality of in vivo

dopaminergic neurons and the issue of false negatives and false positives in proteomic screens.

An in depth analysis of these, and other, limitations can be found in Chapter 5.

Our bioinformatic analysis of the interactome revealed that BAG5 associates with a

number of previously unexplored pathways and compartments, such as nuclear mRNA splicing

and nucleosome assembly. The association of BAG5 with these nuclear proteins and pathways

could be relevant to its role in both cancer and neurodegenerative disease: aberrant splicing

activity is a well-known contributor to both tumorigenesis and neurodegeneration. For example,

the BCL2L1 gene is alternatively spliced into either BCLXL or BCLXS. The former promotes cell

survival while the latter promotes cell death. Several cancers demonstrate a preferential

formation of BCLXL, which contributes to disease progression (Chen and Weiss 2015). In PD,

shorter splice variants of alpha-synuclein decrease its aggregation propensity (La Cognata et al.

2015), and a splice variant of the alpha-synuclein interacting protein ‘synphilin-1’, synphilin-1A,

promotes the formation of alpha-synuclein aggregates and neuron death in vitro (Eyal et al.

2006). Moreover, ALS-associated TDP-43 mutations result in aberrant mRNA splicing patterns

(Arnold et al. 2013), and a splice variant of TDP-43 itself was shown to enhance the formation of

cytoplasmic inclusions and neuron death in vitro (Xiao et al. 2015). Therefore, understanding

46

how BAG5 interacts with splicing machinery could shed light on how it contributes to the

pathogenesis of multiple diseases.

Another dominant theme in the bioinformatic analysis was the association of BAG5 with

proteins relevant to the ubiquitin proteasome system (UPS) and autophagy lysosome pathway

(ALP). As discussed in chapter one, these two processes maintain cellular proteostasis by

managing the degradation of ubiquitinated proteins and protein aggregates, respectively. BAG5

is already known to play a modulatory function within the UPS, as it inhibits the activity to the

two PD-relevant E3 ubiquitin ligases, parkin and CHIP (Kalia et al. 2004a, Kalia et al. 2011).

However, little is currently known about the role of BAG5 in the ALP, despite other BAG family

proteins being implicated in this pathway (Gamerdinger et al. 2009, Qu et al. 2015, Behl 2016).

As such, understanding the association of BAG5 with proteins functioning within the ALP is an

important avenue of future study, as it may extend the role of BAG5 in cellular proteostasis

mechanisms beyond the UPS and provide further insights into its relevance to the pathobiology

of PD.

For this reason, the novel interaction discovered between BAG5 and the autophagy

adaptor protein, p62, was of particular interest. p62 was the 3rd most abundant protein binding to

both BAG5 and BAG5DARA in the H4 interactome, and was found to bind to BAG5DARA in the

SH-SY5Y interactome. The fact that p62 bound to BAG5DARA in both interactomes suggests that

this interaction is not a false positive brought about by a non-specific interaction between p62

and Hsp70. p62 has important and extensively characterized roles in autophagy. Indeed, p62

plays a critical role in the formation and subsequent lysosomal degradation of protein aggregates,

including the alpha-synuclein aggregates found in PD (Bitto et al. 2014). Interestingly, another

BAG family member, BAG3, has already been shown to impact ALP-mediated proteostasis by

47

interacting with and stabilizing p62 (Gamerdinger et al. 2009). Therefore, the interaction

between p62 and BAG5 could be relevant to the maintenance of proteostasis in physiological

and/or pathological contexts and merits further investigation.

48

Chapter 3Validating the Interaction Between BAG5 and p62

Introduction 3.1

Our analysis of the BAG5 interactome illustrated that BAG5 interacts with a wide variety

of proteins and pathways both within and outside of the chaperone network. A dominant theme

was the association of BAG5 with proteins that mediate proteostasis via the UPS and ALP. This

included many chaperones and co-chaperones known to function within these pathways, but also

included proteins outside of the chaperone network, notably p62. The novelty of the interaction

between BAG5 and p62, as well as the importance of p62 in the management of proteostasis, led

us to investigate this interaction in more detail.

p62 is a multifaceted protein that has been studied in multiple contexts, but has been most

extensively characterized as an ‘adaptor protein’ in the ALP (Bitto et al. 2014). The term

‘adaptor protein’ is given to a set of proteins functioning within the ALP that are able to bind to

both ubiquitinated proteins and the autophagosome coating protein, ‘light chain 3’ (LC3, Figure

9). As such, these proteins provide a molecular ‘bridge’ between ubiquitinated cargo and the

autophagy machinery responsible for directing the cargo to the lysosomes. Due to the presence

of several redundant adaptor proteins, such as NBR1 and optineurin, p62 is not essential for all

autophagy processes (Bitto et al. 2014). However, age-related losses of p62 function are

associated with numerous cellular disturbances, such as defective protein degradation via the

ALP (Liu et al. 2017).

Structurally, p62 is composed of many unique domains, which has lead to it being

referred to as a ‘swiss army knife’ within the proteome (Liu et al. 2017). The domain

composition of p62 is outlined in Figure 10 and notably includes an N-terminal ‘Phox and Bem1

49

(PB1)’ domain and a C-terminal ‘ubiquitin associated (UBA)’ domain. Also found at the C-

terminal is the LC3 interacting region (LIR), which, together with the UBA domain, forms the

autophagy adaptor portion of p62. Between the LIR and UBA domains is the ‘Kelch-like ECH-

associated protein 1 (Keap1)’ interacting region (KIR). This domain allows p62 to have a

regulatory role in the Keap1-Nrf2 pathway, an important pathway involved in the cellular

response to oxidative stress (Figure 9, discussed in more detail in chapter five) (Jiang et al.

2015). Interspersed between the C-terminal PB1 and N-terminal LIR/UBA domains are a

number of other domains, including a ZZ-type zinc finger domain, that play important roles in a

diverse set of cellular processes that are beyond the scope of this thesis.

As an adaptor protein within the ALP, p62 plays an integral role in the clearance of

protein aggregates and damaged organelles. In order to clear proteins via the ALP, p62 can either

form de novo aggregates of proteins containing K27 or K63-linked ubiquitin chains or associate

with pre-formed aggregates via its C-terminal UBA domain (Bitto et al. 2014). Phosphorylation

of p62 at serine 403 within its UBA domain greatly enhances its capacity to form de novo p62-

rich aggregates, which are commonly referred to as ‘sequestosomes’ (Figure 9) (Matsumoto et

al. 2011). Interestingly, p62-mediated protein aggregate formation requires p62 itself to

oligomerize via self-associations at its PB1 domain (Katsuragi, Ichimura, and Komatsu 2015).

Following the formation of the sequestosome, the LIR domain on p62 recruits LC3, which

allows for autophagosome formation and subsequent lysosomal degradation of the aggregate

(Figure 9). Therefore, the function of p62 in autophagy requires both the C-terminal PB1 and N-

terminal LIR/UBA domains, with the former being more important for the formation of

aggregates and the latter being more important for their degradation.

50

We hypothesized that BAG5 impairs the function of p62 in forming and degrading alpha-

synuclein aggregates via autophagy. BAG5 and p62 have both been shown to modulate alpha-

synuclein aggregation (discussed in greater detail in Chapter 4), indicating that they may

function in a common pathway to exert these effects. Both BAG5 and p62 are also known

constituents of alpha-synuclein rich LBs (Kalia et al. 2004a, Zatloukal et al. 2002). Moreover,

the notion that BAG5 may influence proteostasis by modulating the function of p62 is not an

unprecedented hypothesis. Gamerdinger and colleagues have already illustrated that another

BAG family member, BAG3, stabilizes p62, which promotes an increase in autophagy that

protects against the loss of proteostasis that occurs as cell age (Gamerdinger et al. 2009).

Therefore, in order to characterize the BAG5-p62 interaction, the purpose of this chapter is to

confirm and investigate the interaction itself, and the following chapter will move on to

investigate potential functional consequences.

51

FIGURE 9

Figure 9 p62 facilitates the aggregation and degradation of protein aggregates. Schematic illustrating some of

the known functions of p62 in proteostasis. Phosphorylation of p62 stimulates p62-mediated aggregation of

ubiquitinated proteins into “sequestosomes”. p62 subsequently recruits light chain 3 (LC3), which triggers the

formation of an autophagosome around the sequestosome. The autophagosome, containing p62 and the protein

aggregate, is then shuttled to the lysosomes for degradation. Top left: p62 also plays a role in the Kelch-like ECH-

associated protein 1 (Keap1)/nuclear factor (erythroid-derived-2)-like 2 (Nrf2) pathway, by promoting the autophgic

degradation of Keap1, which allows Nrf2 to translocate to the nucleus where it acts as a transcription factor.

52

FIGURE 10

Figure 10 Domain structure of p62 and the deletion constructs generated to map its interaction with BAG5.

PB1: Phox and Bem1p, ZZ: ZZ-type zinc finger, TB: TRAF6 binding, LIR: LC3-interacting region, KIR: keap1-

interacting region & UBA: ubiquitin-associated. p62-N-HA & p62-C-HA generated using site directed mutagenesis

to separate the N-terminal PB1 domain from the C-terminal domains. All constructs have a CMV promoter and a C-

terminal hemagglutinin (HA) tag.



Antibodies: anti-p62/SQSTM1 (610833) was obtained from BD biosciences. Anti-Actin

(A2066) and anti-flag (M2, F1804) were obtained from Sigma-Aldrich. Anti-BAG5 (CSB-

PA890743ESR1HU) was obtained from Cusabio. Anti-HA (11867423001) was obtained from

Roche. Anti-Hsp70/72 (ADI-SPA-810) was obtained from Enzo Life Sciences. Anti-DNAJC13

(ABN1657) was obtained from EMD Millipore. Horseradish Peroxidase Linked ECL Anti-

Rabbit and Anti-Mouse secondary antibodies were obtained from GE Healthcare. Alexa Fluor

53

488 (anti-Rabbit) and 555 (anti-mouse) were obtained from Thermo Fisher. Reagents: 0.1%

Ponceau S in 5% acetic acid was purchased from BioShop.

3.2.2 Cell Culture

H4 cells were cultured in DMEM (Gibco) supplemented with 10% FBS (Gibco), 1%

antibiotic/antimycotic (Gibco), and incubated at 37°C with 5% CO2. H4 cells were exclusively

grown on cell+ plates (Sarstedt). H4 cells were transfected using the SuperFect Transfection

Reagent (Qiagen), as per the manufacturer’s protocol.


Western blotting was performed in the same way as described in Chapter 2.

3.2.4 GST Pull-down Assay

GST and GST-BAG5/BAG5DARA recombinant proteins were generated in Escherichia

coli using pGEX and pDEST-15-BAG5/BAG5DARA (Gateway cloning system, Thermo Fisher)

plasmids, respectively. Recombinant proteins were conjugated to Gluthionine Sepharose 4B (GE

Healthcare) beads by rotating recombinant protein with bead slurry overnight at 4°C in

Dulbecco’s phosphate-buffered saline (PBS) without calcium or magnesium.

In order to characterize proteins binding to the GST fusion proteins, 500µg of cell lysate,

topped up to a final volume 500µL with PBS, was incubated with 10µg of GST-fusion protein

beads overnight at 4°C with rotation. Beads were subsequently washed three times with 1mL of

RIPA buffer, and the proteins were recovered from the bead slurry by adding 50uL SDS-PAGE

sample buffer (with beta-mercaptoethanol) and heat denaturing the sample at 95°C for 10min.

For GST pulldown assays that included exogenous p62-HA, p62-N-HA or p62-C-HA, the

plasmids were transfected into H4 cells 24 hours prior to cell lysis.

54

p62-HA deletion constructs (p62-N-HA & p62-C-HA) were generated using the Q5 Site-

Directed Mutagenesis Kit (NEB) as per the manufacturer’s protocol. p62-HA was a gift from

Qing Zhong (Addgene plasmid #28027). p62-HA was split into two complimentary portions: (1)

‘p62-N-HA’ (aa1-102 including PB1 domain) and (2) ‘p62-C-HA’ (aa103-440 including LIR

and UBA domains). All the HA-p62 constructs contain a CMV promoter and a C-terminal HA-

tag. The following primers were used to generate the deletion constructs:

p62-N-HA

Forward: TTTCTCTTTAATGTAGATTCGGAAGATGTCATCC

Reverse: TACCCATACGATGTTCCAGATTACGC

p62-C-HA

Forward: CATAGAATTCCACCACACTGGACTAG

Reverse: AAAGAGTGCCGGCGGG

3.2.5 Immunoprecipitation

H4 cells were transfected with flag-BAG5, p62-HA or both. 24 hours post transfection

cells were lysed with RIPA buffer and 500µg of whole cell lysate, topped up to 500µL with PBS,

was incubated with 1µg of anti-flag antibody and rotated at 4°C overnight. 50µL of pre-washed

sepharose A (GE Healthcare) beads were then added to the protein+antibody mixture and rotated

for an additional 4 hours at 4°C. Beads were washed three times with 1mL RIPA buffer

containing 0.01% weight/volume sodium dodecyl sulfate (SDS). Immunopreicpitated flag-

BAG5, including co-immunoprecipitated proteins, were then competed off of the beads by

adding 100µL of 0.25mg/mL flag peptide diluted in TBS. 50µL SDS-PAGE sample buffer (with

55

beta-mercaptoethanol) was then added, and the samples were boiled at 95°C for 10 minutes prior

to analyzing them via western blot.

3.2.6 Immunohistochemistry

Wild-type H4 cells were plated at 70-80% confluency in 24 well plates containing poly-D

lysine treated glass cover slips. 24 hours after plating, cells were washed once with PBS and

treated with 4% paraformaldehyde (PFA) for 15 minutes at room temperature. The PFA was

washed off with three sequential 5 minute PBS washes and the cells were subsequently treated

with 0.2% triton X-100 diluted in PBS for 15 minutes at room temperature. Cells were then

washed another three times in PBS and blocked with 5% w/v bovine serum albumin (BSA)

diluted in PBS for 45 minutes. The BAG5 and p62 antibodies were then diluted 1:1000 in 5%

BSA and incubated with the cells overnight at 4°C with gentle rocking. The next day, cells were

washed in PBS, incubated in species specific Alexa Fluor 488 and 555, and washed again in PBS

containing 4',6-Diamidino-2-Phenylindole, Dihydrochloride (DAPI). Finally, the coverslips were

mounted onto slides using Dako mounting media.

Results 3.3

3.3.1 Validation and Visualization of the BAG5-p62 Interaction

We first validated the interaction between BAG5 and p62 using a GST pull-down assay.

Consistent with the results obtained from the interactome analysis, p62-HA transiently

transfected into wild type H4 cells was pulled down by both GST-BAG5 and GST-BAG5DARA

(Figure 11B). p62-HA did not associate with the GST negative control. Endogenous Hsp70 was

only pulled down by GST-BAG5, confirming the efficacy of the DARA mutation in this assay

(Figure 11A+B). In order to confirm the validity of the GST pull-down assay, we chose to

validate another novel top hit BAG5 interacting protein from the interactome, DNAJC13 (Table

56

2), that was shown to specifically bind to BAG5 and not BAG5DARA (Table 1). In line with the

results obtained in the interactome analysis, endogenous DNAJC13 was pulled down by GST-

BAG5 and not GST or GST-BAG5DARA (Figure 11A). The interaction between BAG5 and p62

was further validated by immunoprecipitation, where we observed that p62-HA co-

immunopreicpitates with flag-BAG5, when the two proteins are simultaneously expressed in H4

cells using transient transfection (Figure 12).

In order to assess the association between BAG5 and p62 in a more physiological

context, we visualized endogenous p62 and BAG5 in H4 cells (Figure 13). p62 staining

demonstrated large intracellular puncta that were located in the perinuclear region, and as such,

fit the known characteristics of sequestosomes (Bjorkoy, Lamark, and Johansen 2006). p62 was

largely, but not completely, excluded from the nucleus in H4 cells. Endogenous BAG5 had a

more diffuse staining pattern and was predominantly localized in the nucleus. Importantly,

BAG5 immunoreactivity demonstrated a co-localization and enrichment within the perinuclear

p62 puncta (Figure 13).

3.3.2 p62 Interacts with BAG5 via its C-terminal Domains

As discussed in this chapter’s introduction, p62 is composed of multiple domains that

have a variety of roles in cell signaling pathways. Importantly, p62 assists in the formation and

subsequent degradation of protein aggregates, with the former function being more dependent on

its N-terminal PB1 domain, and the latter function being more dependent on its C-terminal LIR

and UBA domains. Therefore, in order to perform further mapping of the BAG5-p62 interaction,

p62 deletion constructs were generated to dissociate the N-terminal PB1 domain (p62-N-HA)

from the remainder of the C-terminus (p62-C-HA), containing both the LIR and UBA domains

(Figure 10). Using the GST pull down assay, we found that GST-BAG5 was able to pull down

57

p62-HA and p62-C-HA, but not p62-N-HA (Figure 14), indicating the p62 associates with

BAG5 independently of its N-terminal PB1 domain.

FIGURE 11

Figure 11 Confirmation of the interactions between BAG5 and DNAJC13/p62 by GST pull-down. (A+B)

Western blot of GST pulldown assays performed to validate the interaction between BAG5 and either endogenous

DNAJC13 (A) or exogenous p62-HA transfected into wildtype H4 cells (B). Far left lane illustrates 10% of the total

protein input for the GST pulldown assay. Ponceau S staining was used to visualize the presence of the GST

constructs in the pulldown conditions. Blots were probed with anti-DNAJC13 (A) or anti-p62 (B), as well as anti-

Hsp70/72 to ensure that BAG5DARA does not bind to Hsp70. Blots are representative of three independent studies.

58

FIGURE 12

Figure 12 Confirmation of the BAG5-p62 interaction via co-immunoprecipitation. Western blot of a flag

immunoprecipitation (IP) of flag-BAG5. Flag-BAG5 and/or p62-HA were transiently transfected into wildtype H4

cells prior to cell lysis and IP. Top panel illustrates the IP input and bottom two panels illustrate the IP conditions. *

indicates the heavy chain of the IP antibody. Blots probed with anti-flag and/or anti-p62 antibody.

59

FIGURE 13

Figure 13 BAG5 and p62 co-localize within perinuclear puncta. Wildtype H4 cells stained for endogenous

BAG5 and p62 using fluorescent secondary antibodies to allow for visualization. 4',6-Diamidino-2-Phenylindole

(DAPI) used to visualize nuclei. BAG5 demonstrated a highly nuclear staining, while p62 was largely excluded

from the nucleus and clustered into small puncta in the perinuclear space. BAG5 co-localized with most, but not all,

of these puncta. Scale bar represents 20µm. Representative of three independent experiments.

60

FIGURE 14

Figure 14 p62 associates with BAG5 independently of its N-terminal PB1 domain. GST pulldown assay

mapping the BAG5-p62 interaction to the C-terminal domains of p62. Left panel illustrates the GST pulldown assay

input, which includes p62-HA, p62-N-HA & p62-C-HA (see Figure 10) transiently transfected into H4 cells. Right

panels illustrate the GST pulldown conditions, Ponceau S staining was used to visualize the presence of the GST

constructs in the pulldown conditions. Blot probed with anti-HA antibody to detect p62 constructs. Representative of

three independent studies.

61

Discussion 3.4

By using a variety of different techniques, the results from this chapter confirm the newly

identified interaction between BAG5 and p62. The interaction was demonstrated to likely be

independent of the interaction between BAG5 and Hsp70, as p62 was able to interact with

BAG5DARA. The physiological plausibility of the interaction was supported by the co-localization

of BAG5 and p62 in H4 cells. Importantly, BAG5 was co-enriched in perinuclear p62

sequestosomes, suggesting that BAG5 may impact p62 in either the formation or degradation of

these structures. The observation that BAG5 binds to the C-terminal region of p62, which

contains the LIR and UBA domains important for protein aggregate degradation, suggests that it

may be the latter of the two.

By interacting with the LIR and UBA domains, BAG5 could impact several functions of

p62, such as the recruitment of LC3 during autophagosome formation, or the movement of

protein aggregates to the lysosomes. However, the limited nature of our interaction mapping

does not indicate which specific domain on the C-terminus of p62 mediates its interaction with

BAG5. It will be important to clarify this through further mapping, which could provide

additional insight into the function of the interaction. It remains possible that the interaction is

not relevant to protein aggregation or degradation, but rather to one of the many other known

functions of p62, such as its role in the Keap1-Nrf2 pathway (Bitto et al. 2014, Jiang et al. 2015,

Katsuragi, Ichimura, and Komatsu 2015). However, the strong co-localization of BAG5 with p62

sequestosomes suggests that the interaction likely does have a function in cellular proteostasis.

Due to technical challenges, we were unable to demonstrate an interaction of the two

endogenous proteins in either H4 cells as well as rat brain lysate using co-immunoprecipitation.

This could be explained by the low affinity of our antibodies for endogenous p62 and BAG5 or

62

that the interaction is more transient and lost during the immunoprecipitation wash steps. Future

experiments will therefore merit an optimization of the antibodies and immunoprecipitation

conditions used. Another explanation of our difficulty visualizing the endogenous interaction is

that the interaction may exclusively exist in insoluble protein aggregates that are lost during our

cell lysis procedure. This is supported by the co-enrichment of BAG5 and p62 into perinuclear

sequestosomes. As such, future experiments will also benefit from a more stringent isolation of

intracellular protein that preserves these larger aggregates.

Finally, the nuclear localization of endogenous BAG5 observed in H4 cells is particularly

interesting because our bioinformatic analysis of the interactome suggested that BAG5 associates

with many nuclear proteins and processes such as mRNA splicing. An analysis of the BAG5

peptide sequence using a nuclear localization sequence (NLS) prediction software (http://nls-

mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi) identified two bi-partite NLSs on the N-

terminal of BAG5 (data not shown), validating that endogenous BAG5 can translocate into the

nucleus. Combined, these results suggest that investigating the function of BAG5 in the nucleus

will likely be an important consideration for future study. Notably, this notion is not irrelevant to

the BAG5-p62 interaction, as p62 is able to translocate into the nucleus where it is involved a

number of processes, including the maintenance of nuclear proteostasis (Pankiv et al. 2010).

63

Chapter 4Investigating the BAG5-p62 Interaction in the Context of Alpha-

synuclein aggregation

Introduction 4.1

Both BAG5 and p62 have been implicated in PD-associated alpha-synuclein aggregation

and degradation, which is outlined schematically in Figure 15. The effect of BAG5 in this regard

has been discussed in previous chapters. Briefly, BAG5 is known to suppress alpha-synuclein

degradation by inhibiting CHIP (Kalia et al. 2011), and this effect of BAG5 could be exacerbated

by its inhibition of parkin, which is also known to effect alpha-synuclein stability (Lonskaya et

al. 2013) (Figure 15). BAG5 may also indirectly promote alpha-synuclein aggregation by

inhibiting Hsp70, which antagonizes this process (see Chapter 1) (Figure 15).

The association between p62 and alpha-synuclein aggregation is largely brought about by

the fact that p62 is a dominant constituent of alpha-synuclein rich LBs (Zatloukal et al. 2002).

Indeed, many neuropathologists now stain for p62, rather than alpha-synuclein, when visualizing

LBs in human tissue. The association of p62 with disease-related protein aggregates is not

restricted to PD but extends to other neurodegenerative diseases such as AD, HD and ALS

(Zatloukal et al. 2002). The presence of p62 within LBs and other disease-related protein

aggregates is not surprising considering that p62 is known to promote the aggregation of

ubiquitinated proteins (Komatsu et al. 2007). Therefore, it may be plausible that p62 promotes

alpha-synuclein aggregation (Figure 15), however, this has not yet been proven.

Despite the physical association of p62 with alpha-synuclein aggregates, only two studies

have directly assessed the effect of p62 on alpha-synuclein aggregation and degradation.

64

Watanabe and colleagues first demonstrated that p62 facilitates the autophagic degradation of

alpha-synuclein aggregates in vitro (Watanabe et al. 2012), and Tanji and colleagues later found

that p62 KO enhanced the number of alpha-synuclein inclusions in an in vivo model of Lewy

body disease (Tanji et al. 2015). Therefore, it seems as though p62 facilitates the autophagic

degradation of alpha-synuclein aggregates (Figure 15). However, much work remains to be done

in understanding how p62 impacts alpha-synuclein pathology, and the factors that regulate p62 in

this regard.

Considering that p62 is known to form large, de novo aggregates from soluble

ubiquitinated proteins, we hypothesized that p62 promotes the movement of alpha-synuclein from

soluble oligomers into insoluble aggregates that are subsequently degraded by autophagy. In

Chapter 3, we suggested that BAG5 impairs the function of p62 in forming and degrading alpha-

synuclein aggregates via autophagy. Combining these two ideas, we hypothesized that BAG5

promotes the presence of alpha-synuclein oligomers by suppressing the capacity of p62 to

sequester alpha-synuclein oligomers into large aggregates that are subsequently degraded by

autophagy. These hypotheses align with the previously known function of p62 to promote the

formation and degradation of protein aggregates, and the previous finding that BAG5 indirectly

enhances alpha-synuclein aggregation.

65

FIGURE 15

Figure 15 p62 and BAG5 have complex effects on protein aggregation and degradation pathways. Schematic

illustrating the known and predicted effects of BAG5 and p62 on protein degradation pathways. BAG5 inhibits the

activity of ‘Heat shock protein 70’ (Hsp70) which is known to antagonize the formation of pathogenic alpha-

synuclein aggregates. BAG5 also inhibits the activity of the ubiquitin E3 ligases ‘C-terminal of Hsp70 Interacting

protein’ (CHIP) and parkin, which promote the degradation of alpha-synuclein. P62 is known to facilitate the

formation of neurodegenerative disease-related protein aggregates as well as the degradation of alpha-synuclein via

the autophagy lysosome pathway. The effect of BAG5 on p62 in these pathways has yet to be elucidated, as

illustrated by a ‘?’.

66



Antibodies: anti-alpha-synuclein (610786) and anti-p62/SQSTM1 (610833) were

obtained from BD biosciences. Anti-Actin (A2066) was obtained from Sigma-Aldrich. Anti-

BAG5 (CSB-PA890743ESR1HU) was obtained from Cusabio. Reagents: Coelenterazine (303-

5) was obtained from NanoLight Technology.

4.2.2 Cell Culture

H4 and HEK293 cells were cultured in DMEM (Gibco) supplemented with 10% FBS

(Gibco), 1% antibiotic/antimycotic (Gibco), and incubated at 37°C with 5% CO2. H4 cells were

exclusively grown on cell+ plates (Sarstedt). H4 cells were transfected using the SuperFect

Transfection Reagent (Qiagen) and HEK293 cells were transfected using lipofectamine 200

(Thermo Fisher), as per the manufacturer’s protocol. Small interfering RNA (siRNA) mediated

BAG5 knockdown (KD), was achieved by transfecting either an siRNA targeting BAG5

(siBAG5, Ambion, #s18285), or non-targeting control (siNTC, Ambion) into either H4 or

HEK293 cells using Lipofectamine RNAiMAX (Thermo Fisher) according to manufacturer’s

protocol.


Western blotting was carried out in the way as Chapter 2.

4.2.4 Alpha-synuclein Protein Complementation Assay

Alpha-synuclein luciferase constructs were generated as previously described (Kalia et al.

2011). syn-N, syn-C and p62-HA/p62-C-HA/p62-N-HA constructs were transfected into

HEK293 cells at a 1:1:0.5 ratio. Empty pcDNA3.1 vector was added as necessary so that all

transfection conditions contained the same total DNA concentration. In the case of siRNA

67

mediated BAG5 KD, the siRNA transfection was performed 24 hours prior to transfecting in the

overexpression plasmids. 24 hours post-transfection of the alpha-synulclein constructs, cells

were scraped in 600μL cold PBS and 100uL of cells were transferred in triplicate to an opaque

flat-bottomed 96-well plate (Grenier). The other 300μL of cells were saved for western blot

analyses. The plate was then analyzed on a CLARIOstar plate-reader (BMG Labtech), which

injected 100μL of 40μM coelenterazine (Nanolight Technology) into each well and shook the

plate for 2 seconds prior to reading the bioluminescent signal generated by the Gaussia princeps

luciferase.

Results 4.3

4.3.1 p62 reduces the presence of soluble alpha-synuclein and oligomers

We first tested the effect of p62 on alpha-synuclein aggregation. To do so we used a

previously described luciferase reporter protein complementation assay (PCA) that allows for the

analysis of alpha-synuclein oligomerization in vitro (Kalia et al. 2011, Outeiro et al. 2008,

Putcha et al. 2010, Remy and Michnick 2006). This model makes use of two alpha-synuclein

constructs that each contain full-length alpha-synuclein fused to either the C-terminal or N-

terminal half of Gaussia princeps luciferase (termed syn-N and syn-C, respectively, Figure 16A).

When the two constructs associate, luciferase is reconstituted and can generate a bioluminescent

signal in the presence of the appropriate substrate (Figure 16A-C). As such, measurable

bioluminescence can be used as a surrogate measure for alpha-synuclein oligomers.

68

FIGURE 16

Figure 16 Alpha-synuclein protein complementation assay (PCA) proof of concept. (A) Schematic illustration

of the two synuclein constructs used in the PCA. Each construct contains full-length synuclein fused to either the N-

terminal (syn-N) or C-terminal half (syn-C) of Gaussia princeps luciferase. When the two constructs associate with

each other, luciferase is reconstituted and can generate a bioluminescent signal when exposed to the appropriate

substrate (in this case coelenterazine) (B) Western blot demonstrating the presence of syn-N and syn-C for the PCA

results presented in (C), probed with anti-alpha-synuclein and anti-actin antibodies. Representative of three

independent studies. (C) PCA illustrating that a luminescent signal is only generated when both syn-N and syn-C are

present. Data is normalized to the “syn-N + syn-C” condition. Data generated from three independent studies

measured in triplicate. Bars illustrate mean +/- SE. Statistical significance calculated using independent samples t-

test, ** p<0.01.

69

Using this model, we found that exogenous p62 reduced luciferase activity by 68.8% (SE

= 1.2%, p<0.0001, Figure 17A+B), relative to pcDNA control, and also served to lower the

presence of soluble syn-N & syn-C constructs by 34.5% (SE = 6.9%, p<0.001, Figure 17A+C).

This effect of p62 was dependent on both its PB1 domain and N terminal LIR and UBA

domains, as the two p62 deletion constructs (p62-N-HA & p62-C-HA) failed to have any effect

on luciferase activity relative to control (Figure 18).

4.3.2 BAG5 KD reduces alpha-synuclein oligomerization but does not impact p62

In order to interrogate the effect of BAG5 on this p62 phenotype, we used small

interfering RNA (siRNA) mediated BAG5 knockdown (KD). In the presence of p62-HA, BAG5

KD trended towards further reducing luciferase activity, however; this result failed to reach

significance (p62-HA + control siRNA = 37.2% +/- 4.6%; p62-HA + BAG5 siRNA = 23.8% +/-

3.4%; p = 0.12, Figure 19A+B). Similarly, flag-BAG5 overexpression also failed to exert any

effect on the p62-mediated reduction in luciferase activity (data not shown). Nonetheless, in the

absence of exogenous p62, BAG5 KD reduced the luciferase signal by 31.1% +/- 4.7% relative

to control (Figure 19A+B), without lowering the levels of soluble alpha-synuclein (Figure 19A).

70

FIGURE 17

Figure 17 p62 reduces the presence of both soluble and oligomeric alpha-synuclein. (A) Western blot

illustrating the levels of p62-HA and syn-N/syn-C for the PCA presented in (B). Probed with anti-p62, anti-alpha-

synulcein and anti-actin antobodies. Representative of three independent studies. (B) PCA from HEK293 cells

transfected with syn-N+syn-C and either p62-HA or pcDNA negative control. Data generated from three

independent studies measured in triplicate, and normalized to the pcDNA condition. Statistical significance

calculated using independent samples t-test, **** = p<0.0001. (C) Quantification of the combined syn-N+syn-C

band intensity depicted in (A). Data obtained from four independent studies. Synuclein construct intensity in both

the pcDNA and p62-HA conditions were normalized to actin intensity and the p62-HA condition was subsequently

normalized to the pcDNA condition. Statistical significance calculated using independent samples t-test, ***

p<0.001.

71

FIGURE 18

Figure 18 p62 requires both its C-terminal PB1 domain and N-terminal LIR+UBA domains to influence

alpha-synuclein oligomerization. Top: schematic representation of WT p62-HA and the two deletion constructs

(outlined in Figure 10). Bottom: PCA results from HEK293 cells transfected with the two synuclein luciferase

constructs (syn-N + syn-C) and either p62-HA, p62-N-HA or p62-C-HA. Data representative of three independent

studies performed in triplicate, normalized to the pcDNA condition (lane 1). Bars represent mean +/- SE. Statistical

significance calculated using 1-way ANOVA with Bonferroni post hoc test, * p<0.01, ** p<0.01.

72

FIGURE 19

Figure 19 p62 and BAG5 have independent effects on synuclein oligomerization. (A) Western blot of the PCA

presented in (B), probed with anti-p62, anti-BAG5, anti-alpha-synuclein and anti-actin antibodies. Top panel is a

longer exposure of the p62 probe presented below it. Representative of three independent studies. * indicates a non-

specific band. (B) PCA from HEK293 illustrating the effect of siRNA-mediated BAG5 KD on luciferase activity in

the presence or absence of exogenous p62-HA. Data generated from three independent studies measured in

triplicate, and normalized to the siRNA alone condition (lane 1). Bars represent mean +/- SE. Statistical significance

calculated using 1-way ANOVA with Bonferroni post hoc test, ** p<0.01, **** p<0.0001.

73

4.3.3 BAG5 Stabilizes Endogenous p62

BAG3 has been previously shown to associate with p62 and increase its expression in

ageing cells (Gamerdinger et al. 2009). Stable levels of p62 are important for its function in

protein aggregation and degradation, as the loss of endogenous p62 results in a suppression of

both inclusion body formation (Komatsu et al. 2007) and degradation (Tanji et al. 2015). Our

working hypothesis was that BAG5 impairs these activities of p62, which lead us to further

hypothesize that BAG5 reduces the expression of p62. Therefore, while conducting the PCA, we

additionally analyzed the effect of BAG5 KD on p62 expression.

BAG5 KD did not have an effect on exogenous p62 transfected into HEK293 cells

(Figure 19A [low exp.]). However, BAG5 KD markedly reduced levels of endogenous p62

(Figure 19A [high exp.]). This result contradicted our hypothesis, and mirrored the known

function of BAG3 in supporting p62 expression. Gamerdinger and colleagues reported that this

effect of BAG3 on p62 was specific to particular cellular environments, namely ageing cells that

were facing a loss of proteostasis (Gamerdinger et al. 2009). Therefore, we wanted to assess

whether the observed effect of BAG5 on p62 expression was specific to HEK293 cells

transfected with exogenous alpha-synuclein, or could be generalized to other cellular

environments. Using wild-type H4 cells, BAG5 KD reduced endogenous p62 levels by 71.8%

(SE = 7.4%) relative to the siRNA control condition (p<0.001) (Figure 20A+B), indicating that

BAG5 supports p62 stability across multiple cell types.

74

FIGURE 20

Figure 20 BAG5 stabilizes endogenous levels of p62. (A) Western blot illustrating the changes in endogenous

p62 stimulated by siRNA-mediated BAG5 KD, probed with anti-p62, anti-BAG5 and anti-actin antibodies. Each

lane demonstrates an independent study. * indicates a non-specific band. (B) Quantification of the intensity of p62 in

the western blot presented in (A). p62 band intensity was normalized to Actin intensity in both the si-NTC and si-

BAG5 conditions and values were then subsequently normalized to the si-NTC condition. Statistical significance

measure with independent samples t-test: *** p<0.001.

75

4.3.4 Discussion

The results from this chapter illustrate that BAG5 enhances and p62 reduces alpha-

synuclein oligomer levels, as both BAG5 KD and p62 overexpression decreased luciferase

activity as measured by the PCA. p62 overexpression also resulted in a significant reduction of

soluble alpha-synuclein. These effects of p62 on alpha-synuclein are significant because they

support the findings of the two previous studies that demonstrate that p62 facilitates the

clearance of alpha-synuclein aggregates (Tanji et al. 2015, Watanabe et al. 2012). Moreover,

these results align with our hypothesis that p62 promotes the movement of alpha-synuclein from

soluble oligomers into insoluble aggregates that are subsequently degraded by autophagy. The

use of autophagy-lysosome inhibitors, such as Bafilomycin-A1, in future PCA experiments will

help to confirm this conclusion.

While this makes p62 appear an enticing therapeutic target for PD, there are many

outstanding questions that remain. For example, the finding the p62 KO enhances Lewy body

presence by (Tanji et al. 2015) seems to contrast the seminal finding by (Komatsu et al. 2007)

that p62 KO attenuates the formation of insoluble protein aggregates in autophagy deficient

mice. In addition, due to the limitations of the PCA, our observation that p62 reduces soluble

alpha-synuclein oligomer presence may represent a p62-stimulated movement of alpha-synuclein

into larger insoluble aggregates, rather than a clearance of the protein. As such, it is necessary to

gain a more sophisticated mechanistic understanding of how p62 impacts alpha-synuclein

oligomerization, aggregation and degradation, before considering how it can be therapeutically

manipulated to treat synucleinopathies.

We also hypothesized that BAG5 promotes the presence of alpha-synuclein oligomers by

suppressing the capacity of p62 to transition alpha-synuclein oligomers into large aggregates that

76

are subsequently degraded by autophagy. If this were correct, BAG5 KD would be expected to

further reduce luciferase activity in the presence of exogenous p62. BAG5 KD did do this,

however, the change failed to meet statistical significance. Therefore, it is possible that our

hypothesis is incorrect and BAG5 and p62 operate in parallel pathways to impact alpha-

synuclein aggregation. Another possibility is that the robust effect of exogenous p62 in the PCA

masked additional, subtler effects of BAG5. As such, future interrogations of this interaction will

benefit from more nuanced oligomerization assays, as well as assays that interrogate other

aspects of proteostasis to which this interaction may be more relevant. This concept is discussed

in more detail in Chapter 5.

While we did not establish a clear functional consequence of the BAG5-p62 interaction

in this assay, BAG5 KD did reduce alpha-synuclein oligomer formation as measured by the

PCA. This parallels the previous finding that BAG5 indirectly enhances alpha-synuclein

oligomerization via its inhibition of CHIP (Kalia et al. 2011) and solidifies a role of BAG5 in

promoting alpha-synuclein aggregation. BAG5 also stabilized endogenous levels of p62 in two

cell lines. Because p62 is an important regulator of protein aggregation and degradation via the

ALP and UPS, we hypothesize that BAG5 could modulate proteostasis by impacting homeostatic

levels of p62. Indeed, BAG3-mediated p62 stabilization was shown to be important for the

maintenance of proteostsis by enhancing autophagy in ageing cells (Gamerdinger et al. 2009).

Therefore, while BAG5 may not have a clear effect on the p62-mediated clearance of alpha-

synuclein oligomers, the observed effect of BAG5 on p62 levels suggests that this interaction

could be relevant to other functions of p62 in proteostasis.

From a mechanistic standpoint, parkin was recently shown to promote the proteasomal

degradation of p62 (Song et al. 2016). BAG5 is known to modulate parkin function (Kalia et al.

77

2004a), and the pathway “Proteolysis Role of Parkin in the UPS” was enriched in both the H4

and SH-SY5Y interactomes (FDR Adjusted P-value: 4.18x10-13 and 3.33x10-16, respectively,

Figure 9). Therefore, it could be hypothesized that the effect of BAG5 on p62 stability may be

mediated by the interaction between BAG5 and parkin.

78

Chapter 5General Discussion & Future Directions

Summary 5.1

To summarize, this thesis represents the first characterization of the BAG5 interactome.

Many known BAG5 interactions were confirmed, and many novel interactions were uncovered.

In line with the known function of BAG5 as an Hsp70 co-chaperone, BAG5 was found to

interact with many Hsp70 family members and a host of other chaperone and co-chaperone

proteins. BAG5 also interacted with many proteins outside of the chaperone network, as

illustrated through the use of BAG5DARA in the interactome analyses. Furthermore, BAG5

associated with numerous proteins relevant to PD, both within and outside of the chaperone

network, notably including alpha-synuclein.

The bioinformatic analysis pointed to an involvement of BAG5 in the ubiquitin

proteasome system and autophagy, which aligns with previous investigations of BAG5 in these

proteostasis pathways. A novel interaction discovered between BAG5 and p62 exemplified the

observed association between BAG5, the UPS, and autophagy, as p62 has important functions in

these pathways. Further in vitro experimentation confirmed the BAG5-p62 interaction and

elucidated that p62 binds to BAG5 via its C-terminus, which includes the LIR and UBA domains

that allow it to facilitate the degradation of protein aggregates. Endogenous BAG5 and p62 also

co-localized in sequestosomes located in the perinuclear region of H4 cells, further implicating

BAG5 in p62-mediated protein aggregate formation and/or degradation.

Both p62 and BAG5 have been shown to modulate alpha-synuclein aggregation and

degradation. We demonstrate that p62 reduced both soluble levels and oligomers of alpha-

synuclein, whereas BAG5 enhanced alpha-synuclein oligomer formation. Knocking down BAG5

79

enhanced the capacity of p62 to reduce alpha-synuclein oligomers, but this result did not achieve

statistical significance. This suggested that the two proteins may act in independent pathways to

modulate alpha-synuclein oligomerization. Nonetheless, BAG5 KD did result in the reduction of

endogenous p62 in two cell lines, indicating that BAG5 may impact p62 function by modifying

its cellular abundance.

Study Limitations 5.2

In terms of the interactome analysis, proteomic screens, such as the one conducted here,

can generate false positives that cannot be recapitulated in future screens or experiments. This

effect may be compounded in our study by the fact that BAG5 predominantly associates with

Hsp70, and Hsp70 can non-specifically interact with a myriad of misfolded proteins. We

attempted to address this issue by carrying out the interactome analysis in two independent cell

lines and using the BAG5DARA mutant, which should theoretically indicate which proteins can

bind to BAG5 in the absence of Hsp70 (Kalia et al. 2004a). However, the fact that we used two

significantly different methodologies between the H4 and SH-SY5Y interactomes makes it

difficult to compare the two interactome lists. Indeed, while it would be enticing to suggest that

proteins not identified in both lists are not true interactors (i.e., false positives), this is not

necessarily the case. For example, we have previously validated and published the interaction

between BAG5 and alpha-synuclein (Kalia et al. 2011), but this interaction was exclusively

identified in the SH-SY5Y screen. Therefore, as has been the case with other proteomic screens,

rigorous replication and the use of additional methodologies to verify individual interactions are

necessary before assuming any interaction is real.

It should also be noted that the non-physiological nature of the DARA mutation may

disrupt or modify BAG5’s association with proteins other than Hsp70. BAG5DARA does retain

80

some of the functions of wild-type BAG5. For example, like wild-type BAG5, BAG5DARA retains

the capacity to dimerize with either itself or wild-type BAG5, suggesting that the DARA

mutation does not significantly alter protein conformation (Kalia et al. 2004a). Moreover,

BAG5DARA also retains the capacity to interact with and inhibit the E3 ubiquitin ligase activity of

parkin (Kalia et al. 2004a). Nevertheless, caution should be taken in interpreting the

physiological meaning of proteins that either were or were not found to bind to BAG5DARA. An

additional method that could be used to determine if an interaction is dependent on the presence

of Hsp70 would be to conduct a pull-down or immunoprecipitation assay using recombinant

proteins rather than whole cell lysate. Recombinant Hsp70 could then be added or removed to

assess whether the interaction is dependent on its presence.

Another limitation of our interactome analysis was the use of immortal cell lines that do

not represent the proteomic reality of dopaminergic neurons in vivo. As such, it is difficult to

conclude that the observed interactions in these screens are relevant to the in vivo setting. We

accept this limitation, as the purpose of this project was to get a preliminary BAG5 interactome

to guide further investigations of its function. Nonetheless, it will be important to confirm

interactions of interest in more relevant cellular environments. This can be accomplished for

individual interactions by performing co-immunoprecipitation studies of endogenous proteins

from in vivo samples. Or, the same approach can be used on the scale of the entire BAG5

interactome by immunoprecipitating endogenous BAG5 from a relevant biological sample, such

as rodent or human SNpc homogenate, and identifying co-immunoprecipitated proteins by mass

spectrometry.

In this study, we have demonstrated that the interaction between p62 and BAG5 is

independent of the N-terminal PB1 domain on p62. However, there are still many possible

81

domains on the C-terminus of p62 that may mediate its interaction with BAG5 (see Figure 10).

Our mapping studies also did not illustrate which BAG domain on BAG5 interacts with p62.

Therefore, future analyses of the BAG5-p62 interaction will also benefit from a more fine-tuned

mapping of the interaction. Understanding which domain/region of p62 specifically facilitates its

interaction with BAG5 may provide some insight into the function of the interaction. For

example, if the Keap1 interacting region (KIR) on p62 mediates the interaction, it may be more

likely that BAG5 impacts the function of p62 in the Keap1-Nrf2 response to oxidative stress than

in proteostasis or autophagy.

The PCA analysis of the effect of BAG5 and p62 on alpha-synuclein oligomer formation

is also associated with several limitations. One limitation is that alpha-synuclein ‘aggregates’ can

exist in several forms, as they build from misfolded protein, to small oligomeric species, to larger

fibrils and finally insoluble aggregates (see Chapter 1). While it has been hypothesized that the

luciferase readout of this assay corresponds to the presence of soluble alpha-synulcein oligomers

(Kalia et al. 2011), without visualizing the intracellular aggregates, it is not entirely clear what

type of alpha-synuclein species are being observed. Therefore, while BAG5 and p62 both

modulate the luciferase output, it is difficult to know how this should be interpreted. For

example, the p62-mediated reduction of soluble alpha-synuclein oligomers could be interpreted

as (1) p62 facilitating the aggregation of alpha-synuclein into large insoluble aggregates, (2) p62

facilitating the degradation of these aggregates, or, (3) both, as would most likely be the case

based on the p62 literature. Therefore, other approaches are necessary in order to get a more

precise understanding of how BAG5 and p62 are impacting alpha-synuclein pathology.

The most logical next step would be to visualize alpha-synuclein aggregates using

immunohistochemistry and assess the effect of modulating BAG5 and/or p62 levels. One option

82

would be to generate PCA constructs where alpha-synuclein is fused the N/C-terminal halves of

GFP rather than luciferase. Such constructs could then be used to visualize alpha-synuclein

oligomers in cells and assess how p62 and BAG5 modulate their presence, morphology or

localization. The effect of BAG5 and p62 on the formation of larger alpha-synuclein aggregates

could also be assessed using techniques such as size-exclusion chromatography or analyzing the

levels of alpha-synuclein in detergent insoluble cell lysate fractions.

Another important consideration is that the unique alpha-synuclein species (oligomers,

fibrils and aggregates) are associated with different physiological effects and toxicities (see

Chapter 1). As discussed in the introduction, the current hypothesis is that small oligomers

confer more toxicity than the large aggregates, but there is still debate surrounding this issue

(Kalia et al. 2013, Kalia and Lang 2015, Rosborough, Patel, and Kalia 2017). Therefore, just

because BAG5 and p62 modulate alpha-synuclein aggregation patterns in our PCA model does

not mean they have any relevant or predictable effect on synuclein-mediated toxicity. In future

experiments, it will be important to not only assess how BAG5 and p62 modulate alpha-

synuclein aggregation, but also understand how these effects relate to cell death. Outside of

rudimentary in vitro cell death assays (Annexin V, propidium iodide, MTT, etc.), one way in

which this could be accomplished would be to stereotactically introduce alpha-synuclein fibrils

or a plasmid packaged into an adeno-associated virus (AAV) into the substantia nigra of rats or

mice (Koprich et al. 2010). Levels of p62 and BAG5 could then be manipulated through the use

of transgenic knockout mice or viral plasmid delivery to test their effect on synuclein pathology

and dopaminergic neurodegeneration relative to the appropriate controls.

Lastly, we observed BAG5 to promote p62 stability. While this result could be

recapitulated in multiple cell lines, our results do not clarify how BAG5 exerts this effect or why

83

it is physiologically relevant. Because p62 is an aggregation prone protein, as demonstrated by

the formation of perinuclear puncta in H4 cells, it is possible that BAG5 KD is not causing a loss

of endogenous p62, but rather promoting its movement into insoluble aggregates. This could be

clarified via western blot by analyzing the effect of BAG5 KD on the presence of p62 in

detergent insoluble cell lysate fractions. It will also be important to confirm that the observed

reduction of p62 levels is not an off-target effect of the siRNA-mediated BAG5 KD procedure.

This can be done by using multiple BAG5 siRNAs, or by rescuing p62 levels through the use of

autophagy or proteasome inhibitors (ex. Bafilomycin-A1 or MG132).

Future Directions: BAG5, p62 and Proteostasis 5.3

As has been discussed in the previous chapters, one of the most dominant themes in the

interactome analysis was the association of BAG5 with UPS- and ALP-mediated proteostasis

pathways. BAG5 is already known to modulate proteostasis via its association with Hsp70

(Arakawa et al. 2010), parkin (Kalia et al. 2004a), and CHIP (Kalia et al. 2011), which facilitate

protein degradation via the UPS, and to a certain extent, the ALP. p62 also has important

functions in maintaining proteostasis through similar pathways as BAG5 (see Figure 15).

Therefore, we chose to investigate the BAG5-p62 interaction that was discovered in the

interactome analysis and hypothesized that BAG5 inhibits the capacity of p62 to form and

degrade alpha-synuclein aggregates via autophagy.

Unfortunately, we were unable to establish a clear functional interaction in the context of

alpha-synuclein aggregation. However, it led to the observation that BAG5 stabilizes p62. This

may indicate that interaction is relevant to some aspect of proteostasis, even if not alpha-

synuclein aggregation, as homeostatic levels of p62 are known to be important for the

management of protein aggregation/degradation dynamics in a number of different contexts

84

(Bitto et al. 2014, Komatsu et al. 2007). Therefore, assessing the effect of BAG5 on other

proteostatic functions of p62, such as the regulation of autophagic flux (Bjorkoy, Lamark, and

Johansen 2006), the degradation of the 26S proteasome (Cohen-Kaplan et al. 2016), or its effect

on the aggregation and degradation of proteins other than alpha-synuclein, such as Tau (Babu,

Geetha, and Wooten 2005) or TDP-43 (Brady et al. 2011), will be important avenues of future

study.

Outside of p62, the interactome uncovered many other BAG5 interactions relevant to

proteostasis. BAG5 was shown to interact with a wide variety of Hsp70 chaperones and co-

chaperone proteins with well-known roles in protein folding and degradation pathways. The

interaction between BAG5 and DNAJC13, an Hsp40 family co-chaperone, stands out, as

mutations to the DNAJC13 gene (PARK21) were recently identified to be a cause of PD in a

Canadian family (Vilariño-Güell et al. 2014). Therefore, it was exciting to recapitulate this

interaction using the GST pull-down assay in H4 cells. Little is currently known about

DNAJC13 function; however, several studies have demonstrated that it plays an important role in

trafficking clathrin-coated endocytic vesicles (Chang, Hull, and Mellman 2004, Freeman,

Hesketh, and Seaman 2014, Girard et al. 2005, Girard and McPherson 2008, Shi et al. 2009). As

such, it was interesting to observe that BAG5 bound to clathrin heavy chain 1 in both the SH-

SY5Y and H4 interactomes (Appendix 1+2). This places BAG5 in the vicinity of DNAJC13

function, and suggests that this interaction may be relevant to endosomal trafficking.

Considering that the endosome system is closely related to the lysosomes, and by

extension, autophagy, it is enticing to hypothesize that this interaction may represent another

way in which BAG5 modulates proteostasis by effecting the function of the ALP. A recent study

by (Yoshida et al. 2018) demonstrated that the PD-causing N855S mutation to DNAJC13

85

resulted in dysfunctional endosome management, which in turn increased alpha-synuclein

aggregation and neurodegeneration in a Drosophila model. Therefore, the interaction between

BAG5 and DNAJC13 presents another potential mechanism by which BAG5 impacts alpha-

synuclein aggregation and toxicity, and merits future investigation.

Outside of the specific interaction with DNAJC13, the numerous interactions between

BAG5 and chaperone network have broader scale implications for our understanding of the

‘chaperome’. As mentioned in the introduction, the feasibility of chaperone-based therapies is

limited by the fact that molecular chaperones exist in a complex and changing proteomic

network, making them a difficult target to manipulate pharmaceutically. In turn, there is an

emerging need to characterize the nuances of the chaperone network in order to best understand

how therapies can be tailored to restore proteostasis. By characterizing the BAG5 interactome,

we have contributed to an understanding of the complex interaction networks that exist between

chaperone and co-chaperone proteins. This work may facilitate the capacity to therapeutically

harness molecular chaperones to restore disease-related perturbations of proteostasis.

Future Directions: BAG5 and Cell Death 5.4

Another dominant theme revealed by our bioinformatic analyses was the association

between BAG5 and proteins functioning within apoptosis pathways. This is not surprising, as

BAG5 has been shown to modulate cell death in several different contexts. Indeed, in the

primary characterization of BAG5, BAG5 was found to enhance dopaminergic

neurodegeneration in the SN of rats exposed to MPTP (Kalia et al. 2004a). Moreover, the BAG

family was initially discovered due to its association with the Bcl-2, a prototypical anti-apoptotic

protein (Takayama et al. 1995). However, recent studies have challenged the cytotoxic role of

BAG5, illustrating that it can promote cell survival in some in vitro contexts (Bi et al. 2016a,

86

Bruchmann, Roller, Walther, Schafer, et al. 2013, Guo et al. 2015a, Gupta et al. 2016, Ma et al.

2012, Wang et al. 2014). In order to follow up on our interactome analysis and clarify the role of

BAG5 in cell death, we carried out a comprehensive investigation of the effect of BAG5 on cell

death elicited by a number of different toxins. Using the SH-SY5Y stable cell lines, we found

that GFP-BAG5 enhanced cell death mediated by mitochondrial damaging agents and oxidative

stress, relative to the GFP control (De Snoo et al, in preparation). We hypothesized that this

effect of BAG5 could be mediated by its interaction with the E3 ubiquitin ligase parkin.

As discussed in the introduction, parkin is an E3 ubiquitin ligase that is mutated to cause

familial PD. Parkin has generally been considered to be a neuroprotective factor, given that loss-

of-function mutations to parkin result in neurodegeneration and ineffective clearance of damaged

mitochondria (Narendra et al. 2008). However, a growing body of literature indicates that, in the

case of severe mitochondrial damage, parkin switches to promote apoptosis by enhancing the

proteasomal degradation of the anti-apoptotic Bcl-2 family member, Mcl-1, rather than

promoting mitophagy (Carroll, Hollville, and Martin 2014, Zhang et al. 2014). This has

generated an emerging hypothesis that parkin can switch between cytoprotective (mitophagy)

and cytotoxic (Mcl-1 degradation) states depending on the degree of mitochondrial damage it is

faced with. The factors that direct parkin to switch between these states are not yet elucidated.

Parkin is a known BAG5 interacting protein (Kalia et al. 2004a). Moreover, the

bioinformatic analysis of the BAG5 interactome demonstrated that the Gene Ontology:

Biological Process term “Proteolysis Role of Parkin in the Ubiquitin-Proteasomal Pathway” was

significantly enriched in both the H4 and SH-SY5Y interactomes, solidifying the notion that

BAG5 modulates parkin activity, as has been previously described (Kalia et al. 2004a).

Therefore, we hypothesized that BAG5 enhanced apoptosis in the context of mitochondrial

87

damage by promoting parkin-mediated Mcl-1 degradation. To confirm this hypothesis, we used

the GFP and GFP-BAG5 SH-SY5Y stable cell lines to demonstrate that the pro-apoptotic effect

of BAG5 in the presence of a mitochondrial damaging agent is, in fact, accompanied by a

significant reduction in Mcl-1 (De Snoo et al. in preparation). This appears to be a promising

avenue of investigation to gain a mechanistic understanding of how BAG5 modulates cell

survival and death pathways, and was largely guided by the knowledge that we gained from the

interactome.

Interestingly, the interaction between BAG5 and p62 may also be relevant in this context.

Like parkin, p62 has been also been implicated in cell death triggered by mitochondrial damage,

as it promotes cell survival by up-regulating the Keap1-Nrf2 pathway (Park, Kang, and Bae

2015). This pathway has been well characterized to protect against the toxic effects of oxidative

stress. At baseline conditions Keap1 binds to Nrf2, a transcription factor, and prevents its

translocation into the nucleus. Following an increase in oxidative load, Keap1 is selectively

degraded, allowing Nrf2 to translocate into the nucleus and up-regulate the transcription of

numerous genes with antioxidant and cytoprotective function (Jiang et al. 2015). Park and

colleagues demonstrated that p62 is necessary for oxidative stress-induced Keap1 degradation

and that p62 KO enhances mitochondrial-damage induced neuronal death by suppressing the

Keap1-Nrf2 pathway (Park, Kang, and Bae 2015). As such, p62 is critical in combatting the

cytotoxic effects of oxidative stress that accompany mitochondrial damage.

Considering that we observed BAG5 to enhance cell death in the context of both

mitochondrial damage and increased oxidative load, we hypothesized that BAG5 inhibits the

cellular response to oxidative stress by suppressing function of p62 in the Keap1-Nrf2 pathway.

88

This is represents a novel mechanism by which BAG5-p62 interaction could be relevant outside

of proteostatic pathways discussed throughout this thesis.

Conclusion 5.5

After mapping the interactome of BAG5, we chose to focus on the interaction between

BAG5 and p62 because of its novelty, and the potential to extend our knowledge of BAG5 in

PD-relevant proteostasis pathways. This lead to the findings that BAG5 and p62 co-localize at

perinuclear sequestosomes and that BAG5 supports p62 stability, suggesting that the interaction

is relevant to cellular proteostasis. We also confirmed our hypothesis that p62 reduces the

presence of alpha-synuclein oligomers and illustrated that BAG5 has the opposite effect. Many

other novel BAG5 interactions were identified that could be relevant to its role in proteostasis,

such as the interaction with DNAJC13. It will be important to investigate these interactions in

more detail moving forward, as they will likely provide important insights into the role of BAG5

within the chaperone network, and may inform the design of novel therapeutics for a variety of

proteinopathies, including Parkinson’s disease.

89

References

Al Shahrani, M., S. Heales, I. Hargreaves, and M. Orford. 2017. "Oxidative Stress: Mechanistic Insights into Inherited Mitochondrial Disorders and Parkinson's Disease." J Clin Med 6 (11). doi: 10.3390/jcm6110100.

Alvarez-Erviti, Lydia, Maria C Rodriguez-Oroz, J Mark Cooper, Cristina Caballero, Isidro Ferrer, Jose A Obeso, and Anthony HV Schapira. 2010. "Chaperone-mediated autophagy markers in Parkinson disease brains." Archives of neurology 67 (12):1464-1472.

Alvarez-Erviti, Lydia, Y Seow, A HV Schapira, María Cruz Rodriguez-Oroz, José A Obeso, and JM Cooper. 2013. "Influence of microRNA deregulation on chaperone-mediated autophagy and α-synuclein pathology in Parkinson's disease." Cell death & disease 4 (3):e545.

Arakawa, Akihiko, Noriko Handa, Noboru Ohsawa, Meiri Shida, Takanori Kigawa, Fumiaki Hayashi, Mikako Shirouzu, and Shigeyuki Yokoyama. 2010. "The C-terminal BAG domain of BAG5 induces conformational changes of the Hsp70 nucleotide-binding domain for ADP-ATP exchange." Structure 18 (3):309-319.

Araki, K., M. Araki, and K. Yamamura. 2002. "Site-directed integration of the cre gene mediated by Cre recombinase using a combination of mutant lox sites." Nucleic Acids Res 30 (19):e103.

Arnold, E. S., S. C. Ling, S. C. Huelga, C. Lagier-Tourenne, M. Polymenidou, D. Ditsworth, H. B. Kordasiewicz, M. McAlonis-Downes, O. Platoshyn, P. A. Parone, S. Da Cruz, K. M. Clutario, D. Swing, L. Tessarollo, M. Marsala, C. E. Shaw, G. W. Yeo, and D. W. Cleveland. 2013. "ALS-linked TDP-43 mutations produce aberrant RNA splicing and adult-onset motor neuron disease without aggregation or loss of nuclear TDP-43." Proc Natl Acad Sci U S A 110 (8):E736-45. doi: 10.1073/pnas.1222809110.

Auluck, P. K., H. Y. Chan, J. Q. Trojanowski, V. M. Lee, and N. M. Bonini. 2002. "Chaperone suppression of alpha-synuclein toxicity in a Drosophila model for Parkinson's disease." Science 295 (5556):865-8. doi: 10.1126/science.1067389.

Babu, J. R., T. Geetha, and M. W. Wooten. 2005. "Sequestosome 1/p62 shuttles polyubiquitinated tau for proteasomal degradation." J Neurochem 94 (1):192-203. doi: 10.1111/j.1471-4159.2005.03181.x.

Behl, C. 2016. "Breaking BAG: The Co-Chaperone BAG3 in Health and Disease." Trends Pharmacol Sci 37 (8):672-88. doi: 10.1016/j.tips.2016.04.007.

Beilina, A., I. N. Rudenko, A. Kaganovich, L. Civiero, H. Chau, S. K. Kalia, L. V. Kalia, E. Lobbestael, R. Chia, K. Ndukwe, J. Ding, M. A. Nalls, M. Olszewski, D. N. Hauser, R. Kumaran, A. M. Lozano, V. Baekelandt, L. E. Greene, J. M. Taymans, E. Greggio, and M. R. Cookson. 2014. "Unbiased screen for interactors of leucine-rich repeat kinase 2 supports a common pathway for sporadic and familial Parkinson disease." Proc Natl Acad Sci U S A 111 (7):2626-31. doi: 10.1073/pnas.1318306111.

90

Bendor, J. T., T. P. Logan, and R. H. Edwards. 2013. "The function of alpha-synuclein." Neuron 79 (6):1044-66. doi: 10.1016/j.neuron.2013.09.004.

Bi, L., Q. Yang, J. Yuan, Q. Miao, L. Duan, F. Li, and S. Wang. 2016a. "MicroRNA-127-3p acts as a tumor suppressor in epithelial ovarian cancer by regulating the BAG5 gene." Oncol Rep 36 (5):2563-2570. doi: 10.3892/or.2016.5055.

Bi, Linlin, Qian Yang, Jiani Yuan, Qing Miao, Linrui Duan, Feng Li, and Siwang Wang. 2016b. "MicroRNA-127-3p acts as a tumor suppressor in epithelial ovarian cancer by regulating the BAG5 gene." Oncology reports 36 (5):2563-2570.

Bitto, A., C. A. Lerner, T. Nacarelli, E. Crowe, C. Torres, and C. Sell. 2014. "P62/SQSTM1 at the interface of aging, autophagy, and disease." Age (Dordr) 36 (3):9626. doi: 10.1007/s11357-014-9626-3.

Bjorkoy, G., T. Lamark, and T. Johansen. 2006. "p62/SQSTM1: a missing link between protein aggregates and the autophagy machinery." Autophagy 2 (2):138-9.

Brady, O. A., P. Meng, Y. Zheng, Y. Mao, and F. Hu. 2011. "Regulation of TDP-43 aggregation by phosphorylation and p62/SQSTM1." J Neurochem 116 (2):248-59. doi: 10.1111/j.1471-4159.2010.07098.x.

Bruchmann, A., C. Roller, T. V. Walther, G. Schafer, S. Lehmusvaara, T. Visakorpi, H. Klocker, A. C. Cato, and D. Maddalo. 2013. "Bcl-2 associated athanogene 5 (Bag5) is overexpressed in prostate cancer and inhibits ER-stress induced apoptosis." BMC Cancer 13:96. doi: 10.1186/1471-2407-13-96.

Bruchmann, Anja, Corinna Roller, Tamara Vanessa Walther, Georg Schäfer, Sara Lehmusvaara, Tapio Visakorpi, Helmut Klocker, Andrew CB Cato, and Danilo Maddalo. 2013. "Bcl-2 associated athanogene 5 (Bag5) is overexpressed in prostate cancer and inhibits ER-stress induced apoptosis." BMC cancer 13 (1):96.

Bukau, Bernd, and Arthur L Horwich. 1998. "The Hsp70 and Hsp60 chaperone machines." Cell 92 (3):351-366.

Burbulla, Lena F, Carina Schelling, Hiroki Kato, Doron Rapaport, Dirk Woitalla, Carola Schiesling, Claudia Schulte, Manu Sharma, Thomas Illig, and Peter Bauer. 2010. "Dissecting the role of the mitochondrial chaperone mortalin in Parkinson's disease: functional impact of disease-related variants on mitochondrial homeostasis." Human molecular genetics 19 (22):4437-4452.

Carroll, Richard G, Emilie Hollville, and Seamus J Martin. 2014. "Parkin sensitizes toward apoptosis induced by mitochondrial depolarization through promoting degradation of Mcl-1." Cell reports 9 (4):1538-1553.

Chang, H. C., M. Hull, and I. Mellman. 2004. "The J-domain protein Rme-8 interacts with Hsc70 to control clathrin-dependent endocytosis in Drosophila." J Cell Biol 164 (7):1055-64. doi: 10.1083/jcb.200311084.

91

Chen, J., and W. A. Weiss. 2015. "Alternative splicing in cancer: implications for biology and therapy." Oncogene 34 (1):1-14. doi: 10.1038/onc.2013.570.

Chen, L., Y. Ding, B. Cagniard, A. D. Van Laar, A. Mortimer, W. Chi, T. G. Hastings, U. J. Kang, and X. Zhuang. 2008. "Unregulated cytosolic dopamine causes neurodegeneration associated with oxidative stress in mice." J Neurosci 28 (2):425-33. doi: 10.1523/jneurosci.3602-07.2008.

Chen, Y., L. N. Yang, L. Cheng, S. Tu, S. J. Guo, H. Y. Le, Q. Xiong, R. Mo, C. Y. Li, J. S. Jeong, L. Jiang, S. Blackshaw, L. J. Bi, H. Zhu, S. C. Tao, and F. Ge. 2013. "Bcl2-associated athanogene 3 interactome analysis reveals a new role in modulating proteasome activity." Mol Cell Proteomics 12 (10):2804-19. doi: 10.1074/mcp.M112.025882.

Chu, Y., and J. H. Kordower. 2015. "The prion hypothesis of Parkinson's disease." Curr Neurol Neurosci Rep 15 (5):28. doi: 10.1007/s11910-015-0549-x.

Ciechanover, A., and Y. T. Kwon. 2017. "Protein Quality Control by Molecular Chaperones in Neurodegeneration." Front Neurosci 11:185. doi: 10.3389/fnins.2017.00185.

Cohen-Kaplan, V., I. Livneh, N. Avni, B. Fabre, T. Ziv, Y. T. Kwon, and A. Ciechanover. 2016. "p62- and ubiquitin-dependent stress-induced autophagy of the mammalian 26S proteasome." Proc Natl Acad Sci U S A 113 (47):E7490-e7499. doi: 10.1073/pnas.1615455113.

Cooper, O., A. Astradsson, P. Hallett, H. Robertson, I. Mendez, and O. Isacson. 2009. "Lack of functional relevance of isolated cell damage in transplants of Parkinson's disease patients." J Neurol 256 Suppl 3:310-6. doi: 10.1007/s00415-009-5242-z.

Cuervo, Ana Maria, Leonidas Stefanis, Ross Fredenburg, Peter T Lansbury, and David Sulzer. 2004. "Impaired degradation of mutant α-synuclein by chaperone-mediated autophagy." Science 305 (5688):1292-1295.

Das, A. T., L. Tenenbaum, and B. Berkhout. 2016. "Tet-On Systems For Doxycycline-inducible Gene Expression." Curr Gene Ther 16 (3):156-67.

Dauer, William, Nikolai Kholodilov, Miquel Vila, Anne-Cecile Trillat, Rose Goodchild, Kristin E Larsen, Roland Staal, Kim Tieu, Yvonne Schmitz, and Chao Annie Yuan. 2002. "Resistance of α-synuclein null mice to the parkinsonian neurotoxin MPTP." Proceedings of the National Academy of Sciences 99 (22):14524-14529.

De Mena, Lorena, Eliecer Coto, Elena Sánchez-Ferrero, René Ribacoba, Luis M Guisasola, Carlos Salvador, Marta Blázquez, and Victoria Alvarez. 2009. "Mutational screening of the mortalin gene (HSPA9) in Parkinson’s disease." Journal of neural transmission 116 (10):1289-1293.

Deng, H., P. Wang, and J. Jankovic. 2017. "The genetics of Parkinson disease." Ageing Res Rev 42:72-85. doi: 10.1016/j.arr.2017.12.007.

92

Devi, L., V. Raghavendran, B. M. Prabhu, N. G. Avadhani, and H. K. Anandatheerthavarada. 2008. "Mitochondrial import and accumulation of alpha-synuclein impair complex I in human dopaminergic neuronal cultures and Parkinson disease brain." J Biol Chem 283 (14):9089-100. doi: 10.1074/jbc.M710012200.

Di Maio, R., P. J. Barrett, E. K. Hoffman, C. W. Barrett, A. Zharikov, A. Borah, X. Hu, J. McCoy, C. T. Chu, E. A. Burton, T. G. Hastings, and J. T. Greenamyre. 2016. "alpha-Synuclein binds to TOM20 and inhibits mitochondrial protein import in Parkinson's disease." Sci Transl Med 8 (342):342ra78. doi: 10.1126/scitranslmed.aaf3634.

Dong, Zhizhong, David P Wolfer, Hans-Peter Lipp, and Hansruedi Büeler. 2005. "Hsp70 gene transfer by adeno-associated virus inhibits MPTP-induced nigrostriatal degeneration in the mouse model of Parkinson disease." Molecular therapy 11 (1):80-88.

Eyal, A., R. Szargel, E. Avraham, E. Liani, J. Haskin, R. Rott, and S. Engelender. 2006. "Synphilin-1A: an aggregation-prone isoform of synphilin-1 that causes neuronal death and is present in aggregates from alpha-synucleinopathy patients." Proc Natl Acad Sci U S A 103 (15):5917-22. doi: 10.1073/pnas.0509707103.

Flower, Todd R, Liudmila S Chesnokova, Clifford A Froelich, Cheryl Dixon, and Stephan N Witt. 2005. "Heat shock prevents alpha-synuclein-induced apoptosis in a yeast model of Parkinson's disease." Journal of molecular biology 351 (5):1081-1100.

Freeman, C. L., G. Hesketh, and M. N. Seaman. 2014. "RME-8 coordinates the activity of the WASH complex with the function of the retromer SNX dimer to control endosomal tubulation." J Cell Sci 127 (Pt 9):2053-70. doi: 10.1242/jcs.144659.

Freimann, Karen, Katja Zschiedrich, Norbert Brüggemann, Anne Grünewald, Heike Pawlack, Johann Hagenah, Katja Lohmann, Christine Klein, and Ana Westenberger. 2013. "Mortalin mutations are not a frequent cause of early-onset Parkinson disease." Neurobiology of aging 34 (11):2694. e19-2694. e20.

Friesen, E. L., M. L. De Snoo, L. Rajendran, L. V. Kalia, and S. K. Kalia. 2017. "Chaperone-Based Therapies for Disease Modification in Parkinson's Disease." Parkinsons Dis 2017:5015307. doi: 10.1155/2017/5015307.

Gamerdinger, M., P. Hajieva, A. M. Kaya, U. Wolfrum, F. U. Hartl, and C. Behl. 2009. "Protein quality control during aging involves recruitment of the macroautophagy pathway by BAG3." Embo j 28 (7):889-901. doi: 10.1038/emboj.2009.29.

Gao, Xuechao, Marta Carroni, Carmen Nussbaum-Krammer, Axel Mogk, Nadinath B Nillegoda, Anna Szlachcic, D Lys Guilbride, Helen R Saibil, Matthias P Mayer, and Bernd Bukau. 2015. "Human Hsp70 disaggregase reverses Parkinson’s-linked α-synuclein amyloid fibrils." Molecular cell 59 (5):781-793.

Girard, M., and P. S. McPherson. 2008. "RME-8 regulates trafficking of the epidermal growth factor receptor." FEBS Lett 582 (6):961-6. doi: 10.1016/j.febslet.2008.02.042.

93

Girard, M., V. Poupon, F. Blondeau, and P. S. McPherson. 2005. "The DnaJ-domain protein RME-8 functions in endosomal trafficking." J Biol Chem 280 (48):40135-43. doi: 10.1074/jbc.M505036200.

Goloubinoff, Pierre, and Paolo De Los Rios. 2007. "The mechanism of Hsp70 chaperones:(entropic) pulling the models together." Trends in biochemical sciences 32 (8):372-380.

Guo, K., L. Li, G. Yin, X. Zi, and L. Liu. 2015a. "Bag5 protects neuronal cells from amyloid beta-induced cell death." J Mol Neurosci 55 (4):815-20. doi: 10.1007/s12031-014-0433-1.

Guo, Ke, Liuhong Li, Gang Yin, Xiaohong Zi, and Lei Liu. 2015b. "Bag5 Protects Neuronal Cells from Amyloid β-induced Cell Death." Journal of Molecular Neuroscience 55 (4):815-820.

Gupta, M. K., F. G. Tahrir, T. Knezevic, M. K. White, J. Gordon, J. Y. Cheung, K. Khalili, and A. M. Feldman. 2016. "GRP78 Interacting Partner Bag5 Responds to ER Stress and Protects Cardiomyocytes From ER Stress-Induced Apoptosis." J Cell Biochem 117 (8):1813-21. doi: 10.1002/jcb.25481.

Hadizadeh Esfahani, A., A. Sverchkova, J. Saez-Rodriguez, A. A. Schuppert, and M. Brehme. 2018. "A systematic atlas of chaperome deregulation topologies across the human cancer landscape." PLoS Comput Biol 14 (1):e1005890. doi: 10.1371/journal.pcbi.1005890.

Hasson, Samuel A., Lesley A. Kane, Koji Yamano, Chiu-Hui Huang, Danielle A. Sliter, Eugen Buehler, Chunxin Wang, Sabrina M. Heman-Ackah, Tara Hessa, and Rajarshi Guha. 2013. "High-content genome-wide RNAi screens identify regulators of parkin upstream of mitophagy." Nature 504 (7479):291-295.

Höhfeld, Jörg, and Stefan Jentsch. 1997. "GrpE‐like regulation of the Hsc70 chaperone by the anti‐apoptotic protein BAG‐1." The EMBO journal 16 (20):6209-6216.

Imai, Yuzuru, Mariko Soda, Shigetsugu Hatakeyama, Takumi Akagi, Tsutomu Hashikawa, Kei-Ichi Nakayama, and Ryosuke Takahashi. 2002. "CHIP is associated with Parkin, a gene responsible for familial Parkinson's disease, and enhances its ubiquitin ligase activity." Molecular cell 10 (1):55-67.

Iwai, A., E. Masliah, M. Yoshimoto, N. Ge, L. Flanagan, H. A. de Silva, A. Kittel, and T. Saitoh. 1995. "The precursor protein of non-A beta component of Alzheimer's disease amyloid is a presynaptic protein of the central nervous system." Neuron 14 (2):467-75.

Jenner, P., D. T. Dexter, J. Sian, A. H. Schapira, and C. D. Marsden. 1992. "Oxidative stress as a cause of nigral cell death in Parkinson's disease and incidental Lewy body disease. The Royal Kings and Queens Parkinson's Disease Research Group." Ann Neurol 32 Suppl:S82-7.

94

Jiang, T., B. Harder, M. Rojo de la Vega, P. K. Wong, E. Chapman, and D. D. Zhang. 2015. "p62 links autophagy and Nrf2 signaling." Free Radic Biol Med 88 (Pt B):199-204. doi: 10.1016/j.freeradbiomed.2015.06.014.

Jones, D. R., M. Delenclos, A. T. Baine, M. DeTure, M. E. Murray, D. W. Dickson, and P. J. McLean. 2015. "Transmission of Soluble and Insoluble alpha-Synuclein to Mice." J Neuropathol Exp Neurol 74 (12):1158-69. doi: 10.1097/nen.0000000000000262.

K Kalia, S, L V Kalia, and P J McLean. 2010. "Molecular chaperones as rational drug targets for Parkinson's disease therapeutics." CNS & Neurological Disorders-Drug Targets (Formerly Current Drug Targets-CNS & Neurological Disorders) 9 (6):741-753.

Kabbage, M., and M. B. Dickman. 2008a. "The BAG proteins: a ubiquitous family of chaperone regulators." Cellular and Molecular Life Sciences 65 (9):1390-1402.

Kabbage, M., and M. B. Dickman. 2008b. "The BAG proteins: a ubiquitous family of chaperone regulators." Cell Mol Life Sci 65 (9):1390-402. doi: 10.1007/s00018-008-7535-2.

Kalia, L. V., S. K. Kalia, H. Chau, A. M. Lozano, B. T. Hyman, and P. J. McLean. 2011. "Ubiquitinylation of alpha-synuclein by carboxyl terminus Hsp70-interacting protein (CHIP) is regulated by Bcl-2-associated athanogene 5 (BAG5)." PLoS One 6 (2):e14695. doi: 10.1371/journal.pone.0014695.

Kalia, L. V., A. E. Lang, L. N. Hazrati, S. Fujioka, Z. K. Wszolek, D. W. Dickson, O. A. Ross, V. M. Van Deerlin, J. Q. Trojanowski, H. I. Hurtig, R. N. Alcalay, K. S. Marder, L. N. Clark, C. Gaig, E. Tolosa, J. Ruiz-Martinez, J. F. Marti-Masso, I. Ferrer, A. Lopez de Munain, S. M. Goldman, B. Schule, J. W. Langston, J. O. Aasly, M. T. Giordana, V. Bonifati, A. Puschmann, M. Canesi, G. Pezzoli, A. Maues De Paula, K. Hasegawa, C. Duyckaerts, A. Brice, A. J. Stoessl, and C. Marras. 2015. "Clinical correlations with Lewy body pathology in LRRK2-related Parkinson disease." JAMA Neurol 72 (1):100-5. doi: 10.1001/jamaneurol.2014.2704.

Kalia, Lorraine V, Suneil K Kalia, Pamela J McLean, Andres M Lozano, and Anthony E Lang. 2013. "α‐Synuclein oligomers and clinical implications for Parkinson disease." Annals of neurology 73 (2):155-169.

Kalia, Lorraine V., and Anthony E. Lang. 2015. "Parkinson's disease." The Lancet 386 (9996):896-912. doi: 10.1016/s0140-6736(14)61393-3.

Kalia, S. K., S. Lee, P. D. Smith, L. Liu, S. J. Crocker, T. E. Thorarinsdottir, J. R. Glover, E. A. Fon, D. S. Park, and A. M. Lozano. 2004a. "BAG5 inhibits parkin and enhances dopaminergic neuron degeneration." Neuron 44 (6):931-45. doi: 10.1016/j.neuron.2004.11.026.

Kalia, Suneil K., Sang Lee, Patrice D. Smith, Li Liu, Stephen J. Crocker, Thorhildur E. Thorarinsdottir, John R. Glover, Edward A. Fon, David S. Park, and Andres M. Lozano. 2004b. "BAG5 inhibits parkin and enhances dopaminergic neuron degeneration." Neuron 44 (6):931-945.

95

Kampinga, Harm H, and Steven Bergink. 2016. "Heat shock proteins as potential targets for protective strategies in neurodegeneration." The Lancet Neurology 15 (7):748-759.

Kampinga, Harm H, Jurre Hageman, Michel J Vos, Hiroshi Kubota, Robert M Tanguay, Elspeth A Bruford, Michael E Cheetham, Bin Chen, and Lawrence E Hightower. 2009. "Guidelines for the nomenclature of the human heat shock proteins." Cell Stress and Chaperones 14 (1):105-111.

Karampetsou, M., M. T. Ardah, M. Semitekolou, A. Polissidis, M. Samiotaki, M. Kalomoiri, N. Majbour, G. Xanthou, O. M. A. El-Agnaf, and K. Vekrellis. 2017. "Phosphorylated exogenous alpha-synuclein fibrils exacerbate pathology and induce neuronal dysfunction in mice." Sci Rep 7 (1):16533. doi: 10.1038/s41598-017-15813-8.

Karpinar, D. P., M. B. Balija, S. Kugler, F. Opazo, N. Rezaei-Ghaleh, N. Wender, H. Y. Kim, G. Taschenberger, B. H. Falkenburger, H. Heise, A. Kumar, D. Riedel, L. Fichtner, A. Voigt, G. H. Braus, K. Giller, S. Becker, A. Herzig, M. Baldus, H. Jackle, S. Eimer, J. B. Schulz, C. Griesinger, and M. Zweckstetter. 2009. "Pre-fibrillar alpha-synuclein variants with impaired beta-structure increase neurotoxicity in Parkinson's disease models." Embo j 28 (20):3256-68. doi: 10.1038/emboj.2009.257.

Katsuragi, Y., Y. Ichimura, and M. Komatsu. 2015. "p62/SQSTM1 functions as a signaling hub and an autophagy adaptor." Febs j 282 (24):4672-8. doi: 10.1111/febs.13540.

Kelley, William L. 1999. "Molecular chaperones: how J domains turn on Hsp70s." Current Biology 9 (8):R305-R308.

Kett, L. R., and W. T. Dauer. 2016. "Endolysosomal dysfunction in Parkinson's disease: Recent developments and future challenges." Mov Disord 31 (10):1433-1443. doi: 10.1002/mds.26797.

Klucken, J., Y. Shin, B. T. Hyman, and P. J. McLean. 2004. "A single amino acid substitution differentiates Hsp70-dependent effects on alpha-synuclein degradation and toxicity." Biochem Biophys Res Commun 325 (1):367-73. doi: 10.1016/j.bbrc.2004.10.037.

Klucken, Jochen, Youngah Shin, Eliezer Masliah, Bradley T Hyman, and Pamela J McLean. 2004. "Hsp70 reduces α-synuclein aggregation and toxicity." Journal of Biological Chemistry 279 (24):25497-25502.

Komatsu, M., S. Waguri, M. Koike, Y. S. Sou, T. Ueno, T. Hara, N. Mizushima, J. Iwata, J. Ezaki, S. Murata, J. Hamazaki, Y. Nishito, S. Iemura, T. Natsume, T. Yanagawa, J. Uwayama, E. Warabi, H. Yoshida, T. Ishii, A. Kobayashi, M. Yamamoto, Z. Yue, Y. Uchiyama, E. Kominami, and K. Tanaka. 2007. "Homeostatic levels of p62 control cytoplasmic inclusion body formation in autophagy-deficient mice." Cell 131 (6):1149-63. doi: 10.1016/j.cell.2007.10.035.

Koprich, J. B., T. H. Johnston, M. G. Reyes, X. Sun, and J. M. Brotchie. 2010. "Expression of human A53T alpha-synuclein in the rat substantia nigra using a novel AAV1/2 vector produces a rapidly evolving pathology with protein aggregation, dystrophic neurite

96

architecture and nigrostriatal degeneration with potential to model the pathology of Parkinson's disease." Mol Neurodegener 5:43. doi: 10.1186/1750-1326-5-43.

Koprich, J. B., L. V. Kalia, and J. M. Brotchie. 2017. "Animal models of alpha-synucleinopathy for Parkinson disease drug development." Nat Rev Neurosci 18 (9):515-529. doi: 10.1038/nrn.2017.75.

Kumaran, R., and M. R. Cookson. 2015. "Pathways to Parkinsonism Redux: convergent pathobiological mechanisms in genetics of Parkinson's disease." Hum Mol Genet 24 (R1):R32-44. doi: 10.1093/hmg/ddv236.

La Cognata, V., V. D'Agata, F. Cavalcanti, and S. Cavallaro. 2015. "Splicing: is there an alternative contribution to Parkinson's disease?" Neurogenetics 16 (4):245-63. doi: 10.1007/s10048-015-0449-x.

Langston, JW, P Ballard, JW Tetrud, and I Irwin. 1983. "Chronic Parkinsonism in humans due to a product of meperidine-analog synthesis." Science 219 (4587):979-980. doi: 10.1126/science.6823561.

Lazaro, D. F., E. F. Rodrigues, R. Langohr, H. Shahpasandzadeh, T. Ribeiro, P. Guerreiro, E. Gerhardt, K. Krohnert, J. Klucken, M. D. Pereira, B. Popova, N. Kruse, B. Mollenhauer, S. O. Rizzoli, G. H. Braus, K. M. Danzer, and T. F. Outeiro. 2014. "Systematic comparison of the effects of alpha-synuclein mutations on its oligomerization and aggregation." PLoS Genet 10 (11):e1004741. doi: 10.1371/journal.pgen.1004741.

Lesage, Suzanne, and Alexis Brice. 2009. "Parkinson's disease: from monogenic forms to genetic susceptibility factors." Human Molecular Genetics 18 (R1):R48-R59. doi: 10.1093/hmg/ddp012.

Li, J. Y., E. Englund, J. L. Holton, D. Soulet, P. Hagell, A. J. Lees, T. Lashley, N. P. Quinn, S. Rehncrona, A. Bjorklund, H. Widner, T. Revesz, O. Lindvall, and P. Brundin. 2008. "Lewy bodies in grafted neurons in subjects with Parkinson's disease suggest host-to-graft disease propagation." Nat Med 14 (5):501-3. doi: 10.1038/nm1746.

Liu, H., C. Dai, Y. Fan, B. Guo, K. Ren, T. Sun, and W. Wang. 2017. "From autophagy to mitophagy: the roles of P62 in neurodegenerative diseases." J Bioenerg Biomembr 49 (5):413-422. doi: 10.1007/s10863-017-9727-7.

Lonskaya, I., N. M. Desforges, M. L. Hebron, and C. E. Moussa. 2013. "Ubiquitination increases parkin activity to promote autophagic alpha-synuclein clearance." PLoS One 8 (12):e83914. doi: 10.1371/journal.pone.0083914.

Lozano, A. M., W. D. Hutchison, and S. K. Kalia. 2017. "What Have We Learned About Movement Disorders from Functional Neurosurgery?" Annu Rev Neurosci 40:453-477. doi: 10.1146/annurev-neuro-070815-013906.

Ma, Mingming, Xuejing Wang, Xuebing Ding, Jing Jing, Yaohua Ma, and Junfang Teng. 2012. "Protective effect of BAG5 on MPP+-induced apoptosis in PC12 cells." Neurological research 34 (10):977-983.

97

Mak, Sally K, Alison L McCormack, Amy B Manning-Boğ, Ana Maria Cuervo, and Donato A Di Monte. 2010. "Lysosomal degradation of α-synuclein in vivo." Journal of Biological Chemistry 285 (18):13621-13629.

Matsumoto, G., K. Wada, M. Okuno, M. Kurosawa, and N. Nukina. 2011. "Serine 403 phosphorylation of p62/SQSTM1 regulates selective autophagic clearance of ubiquitinated proteins." Mol Cell 44 (2):279-89. doi: 10.1016/j.molcel.2011.07.039.

McLean, P. J., J. Klucken, Y. Shin, and B. T. Hyman. 2004. "Geldanamycin induces Hsp70 and prevents alpha-synuclein aggregation and toxicity in vitro." Biochem Biophys Res Commun 321 (3):665-9. doi: 10.1016/j.bbrc.2004.07.021.

McLean, Pamela J, Hibiki Kawamata, Saadat Shariff, Jeffrey Hewett, Nutan Sharma, Kenji Ueda, Xandra O Breakefield, and Bradley T Hyman. 2002. "TorsinA and heat shock proteins act as molecular chaperones: suppression of α‐synuclein aggregation." Journal of neurochemistry 83 (4):846-854.

Meacham, Geoffrey C, Cam Patterson, Wenyue Zhang, J Michael Younger, and Douglas M Cyr. 2001. "The Hsc70 co-chaperone CHIP targets immature CFTR for proteasomal degradation." Nature cell biology 3 (1):100-105.

Moloney, Teresa C, Rhona Hyland, Daniel O'Toole, Alexia Paucard, Deniz Kirik, Aideen O'Doherty, Adrienne M Gorman, and Eilís Dowd. 2014. "Heat Shock Protein 70 Reduces α‐Synuclein‐Induced Predegenerative Neuronal Dystrophy in the α‐Synuclein Viral Gene Transfer Rat Model of Parkinson's Disease." CNS neuroscience & therapeutics 20 (1):50-58.

Morimoto, Richard I. 1998. "Regulation of the heat shock transcriptional response: cross talk between a family of heat shock factors, molecular chaperones, and negative regulators." Genes & development 12 (24):3788-3796.

Murata, Shigeo, Yasufumi Minami, Michiko Minami, Tomoki Chiba, and Keiji Tanaka. 2001. "CHIP is a chaperone‐dependent E3 ligase that ubiquitylates unfolded protein." EMBO reports 2 (12):1133-1138.

Murphy, Karen E, Amanda M Gysbers, Sarah K Abbott, Adena S Spiro, Akiko Furuta, Antony Cooper, Brett Garner, Tomohiro Kabuta, and Glenda M Halliday. 2015. "Lysosomal‐associated membrane protein 2 isoforms are differentially affected in early Parkinson's disease." Movement Disorders 30 (12):1639-1647.

Narendra, Derek, Atsushi Tanaka, Der-Fen Suen, and Richard J. Youle. 2008. "Parkin is recruited selectively to impaired mitochondria and promotes their autophagy." The Journal of cell biology 183 (5):795-803.

Nillegoda, N. B., and B. Bukau. 2015. "Metazoan Hsp70-based protein disaggregases: emergence and mechanisms." Front Mol Biosci 2:57. doi: 10.3389/fmolb.2015.00057.

Oceguera-Yanez, F., S. I. Kim, T. Matsumoto, G. W. Tan, L. Xiang, T. Hatani, T. Kondo, M. Ikeya, Y. Yoshida, H. Inoue, and K. Woltjen. 2016. "Engineering the AAVS1 locus for

98

consistent and scalable transgene expression in human iPSCs and their differentiated derivatives." Methods 101:43-55. doi: 10.1016/j.ymeth.2015.12.012.

Outeiro, T. F., P. Putcha, J. E. Tetzlaff, R. Spoelgen, M. Koker, F. Carvalho, B. T. Hyman, and P. J. McLean. 2008. "Formation of toxic oligomeric alpha-synuclein species in living cells." PLoS One 3 (4):e1867. doi: 10.1371/journal.pone.0001867.

Pankiv, S., T. Lamark, J. A. Bruun, A. Overvatn, G. Bjorkoy, and T. Johansen. 2010. "Nucleocytoplasmic shuttling of p62/SQSTM1 and its role in recruitment of nuclear polyubiquitinated proteins to promyelocytic leukemia bodies." J Biol Chem 285 (8):5941-53. doi: 10.1074/jbc.M109.039925.

Papagiannakis, Nikolaos, Maria Xilouri, Christos Koros, Maria Stamelou, Roubina Antonelou, Matina Maniati, Dimitra Papadimitriou, Marina Moraitou, Helen Michelakakis, and Leonidas Stefanis. 2015. "Lysosomal alterations in peripheral blood mononuclear cells of Parkinson's disease patients." Movement Disorders 30 (13):1830-1834.

Park, J. S., D. H. Kang, and S. H. Bae. 2015. "p62 prevents carbonyl cyanide m-chlorophenyl hydrazine (CCCP)-induced apoptotic cell death by activating Nrf2." Biochem Biophys Res Commun 464 (4):1139-44. doi: 10.1016/j.bbrc.2015.07.093.

Pickrell, Alicia M, and Richard J Youle. 2015. "The roles of PINK1, parkin, and mitochondrial fidelity in Parkinson’s disease." Neuron 85 (2):257-273.

Polymeropoulos, Mihael H, Christian Lavedan, Elisabeth Leroy, Susan E Ide, Anindya Dehejia, Amalia Dutra, Brian Pike, Holly Root, Jeffrey Rubenstein, and Rebecca Boyer. 1997. "Mutation in the α-synuclein gene identified in families with Parkinson's disease." science 276 (5321):2045-2047.

Putcha, P., K. M. Danzer, L. R. Kranich, A. Scott, M. Silinski, S. Mabbett, C. D. Hicks, J. M. Veal, P. M. Steed, B. T. Hyman, and P. J. McLean. 2010. "Brain-permeable small-molecule inhibitors of Hsp90 prevent alpha-synuclein oligomer formation and rescue alpha-synuclein-induced toxicity." J Pharmacol Exp Ther 332 (3):849-57. doi: 10.1124/jpet.109.158436.

Qu, Dianbo, Ali Hage, Katie Don-Carolis, En Huang, Alvin Joselin, Farzaneh Safarpour, Paul C. Marcogliese, Maxime W. C. Rousseaux, Sarah J. Hewitt, and Tianwen Huang. 2015. "BAG2 Gene-mediated Regulation of PINK1 Protein Is Critical for Mitochondrial Translocation of PARKIN and Neuronal Survival." Journal of Biological Chemistry 290 (51):30441-30452.

Quigney, Declan J, Adrienne M Gorman, and Afshin Samali. 2003. "Heat shock protects PC12 cells against MPP+ toxicity." Brain research 993 (1):133-139.

Rampelt, Heike, Janine Kirstein‐Miles, Nadinath B Nillegoda, Kang Chi, Sebastian R Scholz, Richard I Morimoto, and Bernd Bukau. 2012. "Metazoan Hsp70 machines use Hsp110 to power protein disaggregation." The EMBO journal 31 (21):4221-4235.

99

Ran, F. A., P. D. Hsu, C. Y. Lin, J. S. Gootenberg, S. Konermann, A. E. Trevino, D. A. Scott, A. Inoue, S. Matoba, Y. Zhang, and F. Zhang. 2013. "Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity." Cell 154 (6):1380-9. doi: 10.1016/j.cell.2013.08.021.

Remy, I., and S. W. Michnick. 2006. "A highly sensitive protein-protein interaction assay based on Gaussia luciferase." Nat Methods 3 (12):977-9. doi: 10.1038/nmeth979.

Rosborough, K., N. Patel, and L. V. Kalia. 2017. "alpha-Synuclein and Parkinsonism: Updates and Future Perspectives." Curr Neurol Neurosci Rep 17 (4):31. doi: 10.1007/s11910-017-0737-y.

Rüdiger, Stefan, Lothar Germeroth, Jens Schneider‐Mergener, and Bernd Bukau. 1997. "Substrate specificity of the DnaK chaperone determined by screening cellulose‐bound peptide libraries." The EMBO journal 16 (7):1501-1507.

Sadelain, M., E. P. Papapetrou, and F. D. Bushman. 2011. "Safe harbours for the integration of new DNA in the human genome." In Nat Rev Cancer, 51-8. England.

Sala, Gessica, Giovanni Stefanoni, Alessandro Arosio, Chiara Riva, Laura Melchionda, Enrico Saracchi, Silvia Fermi, Laura Brighina, and Carlo Ferrarese. 2014. "Reduced expression of the chaperone-mediated autophagy carrier hsc70 protein in lymphomonocytes of patients with Parkinson's disease." Brain research 1546:46-52.

Sauer, B. 2002. "Cre/lox: one more step in the taming of the genome." Endocrine 19 (3):221-8.

Schapira, A. H., J. M. Cooper, D. Dexter, J. B. Clark, P. Jenner, and C. D. Marsden. 1990. "Mitochondrial complex I deficiency in Parkinson's disease." J Neurochem 54 (3):823-7.

Schneider, S. A., and R. N. Alcalay. 2017. "Neuropathology of genetic synucleinopathies with parkinsonism: Review of the literature." Mov Disord 32 (11):1504-1523. doi: 10.1002/mds.27193.

Shi, A., L. Sun, R. Banerjee, M. Tobin, Y. Zhang, and B. D. Grant. 2009. "Regulation of endosomal clathrin and retromer-mediated endosome to Golgi retrograde transport by the J-domain protein RME-8." Embo j 28 (21):3290-302. doi: 10.1038/emboj.2009.272.

Shin, Youngah, Jochen Klucken, Cam Patterson, Bradley T Hyman, and Pamela J McLean. 2005. "The co-chaperone carboxyl terminus of Hsp70-interacting protein (CHIP) mediates α-synuclein degradation decisions between proteasomal and lysosomal pathways." Journal of Biological Chemistry 280 (25):23727-23734.

Song, P., S. Li, H. Wu, R. Gao, G. Rao, D. Wang, Z. Chen, B. Ma, H. Wang, N. Sui, H. Deng, Z. Zhang, T. Tang, Z. Tan, Z. Han, T. Lu, Y. Zhu, and Q. Chen. 2016. "Parkin promotes proteasomal degradation of p62: implication of selective vulnerability of neuronal cells in the pathogenesis of Parkinson's disease." Protein Cell 7 (2):114-29. doi: 10.1007/s13238-015-0230-9.

100

Spillantini, Maria Grazia, Marie Luise Schmidt, Virginia M-Y Lee, John Q Trojanowski, Ross Jakes, and Michel Goedert. 1997. "α-Synuclein in Lewy bodies." Nature 388 (6645):839-840.

Stefanis, L. 2012. "alpha-Synuclein in Parkinson's disease." Cold Spring Harb Perspect Med 2 (2):a009399. doi: 10.1101/cshperspect.a009399.

Takayama, S., D. N. Bimston, S. Matsuzawa, B. C. Freeman, C. Aime-Sempe, Z. Xie, R. I. Morimoto, and J. C. Reed. 1997. "BAG-1 modulates the chaperone activity of Hsp70/Hsc70." Embo j 16 (16):4887-96. doi: 10.1093/emboj/16.16.4887.

Takayama, S., T. Sato, S. Krajewski, K. Kochel, S. Irie, J. A. Millan, and J. C. Reed. 1995. "Cloning and functional analysis of BAG-1: a novel Bcl-2-binding protein with anti-cell death activity." Cell 80 (2):279-84.

Taldone, T., S. O. Ochiana, P. D. Patel, and G. Chiosis. 2014. "Selective targeting of the stress chaperome as a therapeutic strategy." Trends Pharmacol Sci 35 (11):592-603. doi: 10.1016/j.tips.2014.09.001.

Tanji, K., S. Odagiri, Y. Miki, A. Maruyama, Y. Nikaido, J. Mimura, F. Mori, E. Warabi, T. Yanagawa, S. Ueno, K. Itoh, and K. Wakabayashi. 2015. "p62 Deficiency Enhances alpha-Synuclein Pathology in Mice." Brain Pathol 25 (5):552-64. doi: 10.1111/bpa.12214.

Tanner, Caroline M., Freya Kamel, G. Webster Ross, Jane A. Hoppin, Samuel M. Goldman, Monica Korell, Connie Marras, Grace S. Bhudhikanok, Meike Kasten, Anabel R. Chade, Kathleen Comyns, Marie Barber Richards, Cheryl Meng, Benjamin Priestley, Hubert H. Fernandez, Franca Cambi, David M. Umbach, Aaron Blair, Dale P. Sandler, and J. William Langston. 2011. "Rotenone, Paraquat, and Parkinson’s Disease." Environmental Health Perspectives 119 (6):866-872. doi: 10.1289/ehp.1002839.

Vilariño-Güell, Carles, Alex Rajput, Austen J Milnerwood, Brinda Shah, Chelsea Szu-Tu, Joanne Trinh, Irene Yu, Mary Encarnacion, Lise N Munsie, and Lucia Tapia. 2014. "DNAJC13 mutations in Parkinson disease." Human molecular genetics 23 (7):1794-1801.

Visanji, N. P., P. L. Brooks, L. N. Hazrati, and A. E. Lang. 2013. "The prion hypothesis in Parkinson's disease: Braak to the future." Acta Neuropathol Commun 1:2. doi: 10.1186/2051-5960-1-2.

Volles, M. J., S. J. Lee, J. C. Rochet, M. D. Shtilerman, T. T. Ding, J. C. Kessler, and P. T. Lansbury, Jr. 2001. "Vesicle permeabilization by protofibrillar alpha-synuclein: implications for the pathogenesis and treatment of Parkinson's disease." Biochemistry 40 (26):7812-9.

Wadhwa, Renu, Jihoon Ryu, Hyo Min Ahn, Nishant Saxena, Anupama Chaudhary, Chae-Ok Yun, and Sunil C Kaul. 2015. "Functional significance of point mutations in stress chaperone mortalin and their relevance to Parkinson disease." Journal of Biological Chemistry 290 (13):8447-8456.

101

Wang, C., C. Zhao, D. Li, Z. Tian, Y. Lai, J. Diao, and C. Liu. 2016. "Versatile Structures of alpha-Synuclein." Front Mol Neurosci 9:48. doi: 10.3389/fnmol.2016.00048.

Wang, X., J. Guo, E. Fei, Y. Mu, S. He, X. Che, J. Tan, K. Xia, Z. Zhang, G. Wang, and B. Tang. 2014. "BAG5 protects against mitochondrial oxidative damage through regulating PINK1 degradation." PLoS One 9 (1):e86276. doi: 10.1371/journal.pone.0086276.

Watanabe, Y., H. Tatebe, K. Taguchi, Y. Endo, T. Tokuda, T. Mizuno, M. Nakagawa, and M. Tanaka. 2012. "p62/SQSTM1-dependent autophagy of Lewy body-like alpha-synuclein inclusions." PLoS One 7 (12):e52868. doi: 10.1371/journal.pone.0052868.

Winner, Beate, Roberto Jappelli, Samir K Maji, Paula A Desplats, Leah Boyer, Stefan Aigner, Claudia Hetzer, Thomas Loher, Marçal Vilar, and Silvia Campioni. 2011. "In vivo demonstration that α-synuclein oligomers are toxic." Proceedings of the National Academy of Sciences 108 (10):4194-4199.

Wong, Y. C., and D. Krainc. 2017. "alpha-synuclein toxicity in neurodegeneration: mechanism and therapeutic strategies." Nat Med 23 (2):1-13. doi: 10.1038/nm.4269.

Wu, Yih-Ru, Cheng-Kuang Wang, Chiung-Mei Chen, Yuying Hsu, Sih-Jing Lin, Yi-Ying Lin, Hon-Chung Fung, Kuo-Hsuan Chang, and Guey-Jen Lee-Chen. 2004. "Analysis of heat-shock protein 70 gene polymorphisms and the risk of Parkinson’s disease." Human genetics 114 (3):236-241.

Xiao, S., T. Sanelli, H. Chiang, Y. Sun, A. Chakrabartty, J. Keith, E. Rogaeva, L. Zinman, and J. Robertson. 2015. "Low molecular weight species of TDP-43 generated by abnormal splicing form inclusions in amyotrophic lateral sclerosis and result in motor neuron death." Acta Neuropathol 130 (1):49-61. doi: 10.1007/s00401-015-1412-5.

Xilouri, M., and L. Stefanis. 2015. "Chaperone mediated autophagy to the rescue: A new-fangled target for the treatment of neurodegenerative diseases." Mol Cell Neurosci 66 (Pt A):29-36. doi: 10.1016/j.mcn.2015.01.003.

Xilouri, Maria, Oeystein Roed Brekk, and Leonidas Stefanis. 2016. "Autophagy and Alpha‐Synuclein: Relevance to Parkinson's Disease and Related Synucleopathies." Movement Disorders 31 (2):178-192.

Xiong, Y., S. Neifert, S. S. Karuppagounder, J. N. Stankowski, B. D. Lee, J. C. Grima, G. Chen, H. S. Ko, Y. Lee, D. Swing, L. Tessarollo, T. M. Dawson, and V. L. Dawson. 2017. "Overexpression of Parkinson's Disease-Associated Mutation LRRK2 G2019S in Mouse Forebrain Induces Behavioral Deficits and alpha-Synuclein Pathology." eNeuro 4 (2). doi: 10.1523/eneuro.0004-17.2017.

Yoshida, S., T. Hasegawa, M. Suzuki, N. Sugeno, J. Kobayashi, M. Ueyama, M. Fukuda, A. Ido-Fujibayashi, K. Sekiguchi, M. Ezura, A. Kikuchi, T. Baba, A. Takeda, H. Mochizuki, Y. Nagai, and M. Aoki. 2018. "Parkinson's disease-linked DNAJC13 mutation aggravates alpha-synuclein-induced neurotoxicity through perturbation of endosomal trafficking." Hum Mol Genet. doi: 10.1093/hmg/ddy003.

102

Yue, X., Y. Zhao, G. Huang, J. Li, J. Zhu, Z. Feng, and W. Hu. 2016. "A novel mutant p53 binding partner BAG5 stabilizes mutant p53 and promotes mutant p53 GOFs in tumorigenesis." Cell Discov 2:16039. doi: 10.1038/celldisc.2016.39.

Zatloukal, K., C. Stumptner, A. Fuchsbichler, H. Heid, M. Schnoelzer, L. Kenner, R. Kleinert, M. Prinz, A. Aguzzi, and H. Denk. 2002. "p62 Is a common component of cytoplasmic inclusions in protein aggregation diseases." Am J Pathol 160 (1):255-63. doi: 10.1016/s0002-9440(10)64369-6.

Zhang, Conggang, Schuyler Lee, Yinghua Peng, Eric Bunker, Emilie Giaime, Jie Shen, Zongyao Zhou, and Xuedong Liu. 2014. "PINK1 triggers autocatalytic activation of Parkin to specify cell fate decisions." Current Biology 24 (16):1854-1865.

Zhang, Li, Peter Karsten, Sabine Hamm, Joe H Pogson, A Kathrin Müller-Rischart, Nicole Exner, Christian Haass, Alexander J Whitworth, Konstanze F Winklhofer, and Jörg B Schulz. 2013. "TRAP1 rescues PINK1 loss-of-function phenotypes." Human molecular genetics:ddt132.

Zhang, Zhelin, and Yan Cheng. 2014. "miR-16-1 promotes the aberrant α-synuclein accumulation in parkinson disease via targeting heat shock protein 70." The Scientific World Journal 2014.

Zou, Jiangying, Yongle Guo, Toumy Guettouche, David F Smith, and Richard Voellmy. 1998. "Repression of heat shock transcription factor HSF1 activation by HSP90 (HSP90 complex) that forms a stress-sensitive complex with HSF1." Cell 94 (4):471-480.

103

Appendices

Appendix 1 BAG5 Interactome: H4

Identified Proteins Gene Name

GFP IP (Spectrum

Counts)

GFP-BAG5 IP (Spectrum

Counts)

GFP-DARA IP (Spectrum

Counts)

Reclassified as BAG5

Interacting Protein

DnaJ homolog subfamily C member 13 DNAJC13 0 83 0 Isoform 2 of BAG family molecular chaperone

regulator 5 BAG5 0 66 0

Tubulin beta-2A chain TUBB2A 0 49 0

Very large A-kinase anchor protein CRYBG3 0 31 0

Isoform 2 of Microtubule-associated protein 1A MAP1A 0 30 0

Isoform Beta of Heat shock protein 105 kDa HSPH1 0 29 0

Heat shock 70 kDa protein 1-like HSPA1L 0 29 0

BAG family molecular chaperone regulator 3 BAG3 0 27 0

Isoform 5 of Protein transport protein Sec16A SEC16A 0 25 0

Aryl hydrocarbon receptor AHR 0 22 0

Heat shock 70 kDa protein 6 HSPA6 0 22 0 Isoform 2 of DnaJ homolog subfamily C member

7 DNAJC7 0 19 0

Isoform 3 of Nuclear receptor corepressor 2 NCOR2 0 19 0

Pre-mRNA-processing-splicing factor 8 PRPF8 0 18 0

Heat shock-related 70 kDa protein 2 HSPA2 0 18 0 U5 small nuclear ribonucleoprotein 200 kDa

helicase SNRNP200 0 17 0

Melanoma-associated antigen C1 MAGEC1 0 17 0

Myeloid leukemia factor 2 MLF2 0 16 0 F-box-like/WD repeat-containing protein

TBL1XR1 TBL1XR1 0 16 0

182 kDa tankyrase-1-binding protein TNKS1BP1 0 14 0

Microtubule-associated protein 1B MAP1B 0 14 0

DNA-directed RNA polymerase II subunit RPB2 POLR2B 0 12 0

E3 ubiquitin-protein ligase CHIP STUB1 0 12 0

Isoform 2 of Coatomer subunit alpha COPA 0 11 0

RuvB-like 2 RUVBL2 0 11 0

Isoform 4 of WD repeat-containing protein 62 WDR62 0 11 0 Isoform 2 of Rho guanine nucleotide exchange

factor 2 ARHGEF2 0 11 0

Forkhead box protein K1 FOXK1 0 10 0 Isoform 4 of Ankyrin repeat and KH domain-

containing protein 1 ANKHD1 0 10 0 Isoform 2 of 116 kDa U5 small nuclear

ribonucleoprotein component EFTUD2 0 10 0

Bifunctional glutamate/proline--tRNA ligase EPRS 0 9 0

X-ray repair cross-complementing protein 5 XRCC5 0 9 0

Holliday junction recognition protein HJURP 0 9 0

104

Aspartate--tRNA ligase, cytoplasmic DARS 0 8 0

Zinc finger protein 318 ZNF318 0 8 0 Isoform 2 of Enhancer of mRNA-decapping

protein 4 EDC4 0 8 0

Isoform 2 of Protein TANC1 TANC1 0 8 0

DnaJ homolog subfamily B member 6 DNAJB6 0 8 0

SNW domain-containing protein 1 SNW1 0 8 0

Pre-mRNA-processing factor 19 PRPF19 0 8 0


Isoform 2 of Histone deacetylase 2 HDAC2 0 7 0

Isoform 3 of Hsp70-binding protein 1 HSPBP1 0 7 0


Histone deacetylase 1 HDAC1 0 7 0 Isoform 2 of Ankyrin repeat domain-containing

protein 17 ANKRD17 0 7 0 Isoform Delta 10 of Calcium/calmodulin-

dependent protein kinase type II subunit delta CAMK2D 0 6 0

DnaJ homolog subfamily A member 2 DNAJA2 0 6 0

Isoform 2 of E3 ubiquitin-protein ligase RNF213 RNF213 0 6 0

Isoform 2 of CCR4-N CNOT1 0 6 0

Collagen alpha-1(VIII) chain COL8A1 0 6 0

Heat shock 70 kDa protein 4 HSPA4 0 6 0

Coatomer subunit beta COPB1 0 6 0 Isoform 2 of Calcium-binding mitochondrial

carrier protein Aralar2 SLC25A13 0 6 0

Isoform 2 of Protein PRRC2C PRRC2C 0 6 0 Isoform 10 of Calcium/calmodulin-dependent

protein kinase type II subunit gamma CAMK2G 0 6 0

Glutathione S-transferase Mu 3 GSTM3 0 5 0

Cell division cycle 5-like protein CDC5L 0 5 0

Isoform 2 of Vigilin HDLBP 0 5 0

Isoform 2 of Stromal interaction molecule 2 STIM2 0 5 0 Isoform 3 of Serine/threonine-protein phosphatase

6 regulatory ankyrin repeat subunit A ANKRD28 0 5 0

Isoform 2 of Pleiotropic regulator 1 PLRG1 0 5 0

Isoform 2 of Protein SEC13 homolog SEC13 0 5 0

Kynureninase KYNU 0 5 0

Isoform 2 of MIC IMMT 0 5 0 Transforming acidic coiled-coil-containing protein

3 TACC3 0 5 0

Isoform SV of 14-3-3 protein epsilon YWHAE 0 5 0 Isoform Heart of ATP synthase subunit gamma,

mitochondrial ATP5C1 0 4 0 Isoform 2 of KH domain-containing, RNA-

binding, signal transduction-associated protein 1 KHDRBS1 0 4 0

Isoform 2 of Stress-induced-phosphoprotein 1 STIP1 0 4 0

Emerin EMD 0 4 0

Endoplasmin HSP90B1 0 4 0

Ras-related protein Rab-13 RAB13 0 4 0

Acyl-protein thioesterase 2 LYPLA2 0 4 0

Isoform 10 of Glucocorticoid receptor NR3C1 0 4 0

105

Isoform 2 of Thrombospondin-1 THBS1 0 4 0

CAD protein CAD 0 4 0

Protein transport protein Sec23A SEC23A 0 4 0 Isoform 2 of Probable E3 ubiquitin-protein ligase

HERC4 HERC4 0 4 0

Isoform 3 of Sickle tail protein homolog KIAA1217 0 4 0 Isoform 3 of ADP-ribosylation factor GTPase-

activating protein 1 ARFGAP1 0 4 0

Isoform 2 of Polyhomeotic-like protein 3 PHC3 0 4 0

Isoform 2 of Drebrin-like protein DBNL 0 4 0 Serine/threonine-protein phosphatase 6 regulatory

subunit 1 PPP6R1 0 4 0

Glutaredoxin-1 GLRX 0 4 0

Melanoma-associated antigen 1 MAGEA1 0 4 0

Protein transport protein Sec23B SEC23B 0 4 0

14-3-3 protein gamma YWHAG 0 4 0

Isoform 2 of A-kinase anchor protein 13 AKAP13 0 3 0

Isoform 2 of Myoferlin MYOF 0 3 0

Cell division cycle protein 20 homolog CDC20 0 3 0

60S ribosomal protein L27 RPL27 0 3 0

Rho-related GTP-binding protein RhoC RHOC 0 3 0 Isoform 2 of Pyruvate dehydrogenase E1

component subunit alpha, somatic form, mitochondrial

PDHA1 0 3 0

Isoform 2 of Elongation factor 1-delta EEF1D 0 3 0

Protein disulfide-isomerase P4HB 0 3 0

Isoform 2 of Aminoacyl tRNA synthase complex-interacting multifunctional protein 1 AIMP1 0 3 0

OSMR 0 3 0

Isoform 2 of Nuclear receptor corepressor 1 NCOR1 0 3 0

HAUS augmin-like complex subunit 5 HAUS5 0 3 0

Protein disulfide-isomerase A3 PDIA3 0 3 0

Trifunctional enzyme subunit alpha, mitochondrial HADHA 0 3 0

Isoform 2 of Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform PPP2R2A 0 3 0

Isoform 10 of Aspartyl/asparaginyl beta-hydroxylase ASPH 0 3 0

Isoform 2 of KN motif and ankyrin repeat domain-containing protein 2 KANK2 0 3 0

Isoform 4 of F-box/LRR-repeat protein 18 FBXL18 0 3 0

Isoform 2 of BRCA1-A complex subunit RAP80 UIMC1 0 3 0

Heat shock protein beta-8 HSPB8 0 3 0

2'-5'-oligoadenylate synthase 3 OAS3 0 3 0

Isoform 2 of WD repeat-containing protein 1 WDR1 0 3 0

40S ribosomal protein S23 RPS23 0 3 0

Aldo-keto reductase family 1 member C1 AKR1C1 0 3 0

Mitochondrial glutamate carrier 1 SLC25A22 0 3 0

Cytoplasmic dynein 1 heavy chain 1 DYNC1H1 0 3 0

Glutathione S-transferase P GSTP1 0 3 0

Protein transport protein Sec24C SEC24C 0 3 0

106

Isoform 2 of Rap guanine nucleotide exchange factor 6 RAPGEF6 0 3 0

Cathepsin B CTSB 0 2 0

Histone H1.5 HIST1H1B 0 2 0

Destrin DSTN 0 2 0

Protein PRR14L PRR14L 0 2 0

Isoform 2 of Stomatin-like protein 2, mitochondrial STOML2 0 2 0

Insulin-like growth factor 2 mRNA-binding protein 3 IGF2BP3 0 2 0

Isoform 2 of Protein arginine N-methyltransferase 5 PRMT5 0 2 0

Eukaryotic translation initiation factor 2 subunit 3 EIF2S3 0 2 0

Isoform 2 of AP-2 complex subunit beta AP2B1 0 2 0

Isoform 2 of E3 ubiquitin-protein ligase TRIM22 TRIM22 0 2 0

Isoform 2 of SRA stem-loop-interacting RNA-binding protein, mitochondrial SLIRP 0 2 0

Very-long-chain enoyl-CoA reductase TECR 0 2 0

Isoform 2 of Splicing factor U2AF 65 kDa subunit U2AF2 0 2 0

Cyclin-dependent kinase 6 CDK6 0 2 0

Peptidyl-prolyl cis-trans isomerase-like 1 PPIL1 0 2 0

Isoform 2 of Thioredoxin domain-containing protein 5 TXNDC5 0 2 0

Isoform 2 of Vacuolar protein sorting-associated protein 13C VPS13C 0 2 0

Isoform 2 of Procollagen-lysine,2-oxoglutarate 5-dioxygenase 2 PLOD2 0 2 0

Isoform 2 of Histone deacetylase 3 HDAC3 0 2 0

Isoform 2 of Lysine-specific histone demethylase 1A KDM1A 0 2 0

Isoform 2 of Serine/threonine-protein phosphatase 6 regulatory subunit 2 PPP6R2 0 2 0

Actin-like protein 6A ACTL6A 0 2 0

Ferritin light chain FTL 0 2 0

Eukaryotic translation initiation factor 2 subunit 2 EIF2S2 0 2 0

Isoform 10 of Calpastatin CAST 0 2 0

Isoform PML-11 of Protein PML PML 0 2 0

Isoleucine--tRNA ligase, cytoplasmic IARS 0 2 0

Isoform 2 of Large proline-rich protein BAG6 BAG6 0 2 0

Ubiquitin-conjugating enzyme E2 A UBE2A 0 2 0

Isoform 2 of Host cell factor 1 HCFC1 0 2 0

Isoform B2 of Smoothelin SMTN 0 2 0

Isoform 2 of ATP synthase subunit f, mitochondrial ATP5J2 0 2 0

Serine/threonine-protein phosphatase 2A catalytic subunit beta isoform PPP2CB 0 2 0


Isoform 2 of 60S ribosomal protein L31 RPL31 0 2 0

S-phase kinase-associated protein 1 SKP1 0 2 0

Forkhead box protein F1 FOXF1 0 2 0

Aminoacyl tRNA synthase complex-interacting multifunctional protein 2 AIMP2 0 2 0

Isoform 2 of Reticulocalbin-2 RCN2 0 2 0

Isoform 2 of Protein disulfide-isomerase A6 PDIA6 0 2 0

107

Helicase SKI2W SKIV2L 0 2 0

Isoform 2 of Glutamine and serine-rich protein 1 QSER1 0 2 0

Rho GTPase-activating protein 31 ARHGAP31 0 2 0 Isoform 2 of Mitochondrial import inner

membrane translocase subunit TIM50 TIMM50 0 2 0

Isoform 2 of Centrosomal protein of 170 kDa CEP170 0 2 0

Zinc finger FYVE domain-containing protein 16 ZFYVE16 0 2 0 Isoform 2 of Pleckstrin homology-like domain

family B member 1 PHLDB1 0 2 0

Hermansky-Pudlak syndrome 6 protein HPS6 0 2 0

Spindle and kinetochore-associated protein 3 SKA3 0 2 0 Isoform 3 of Ubiquitin carboxyl-terminal

hydrolase 7 USP7 0 2 0

U5 small nuclear ribonucleoprotein 40 kDa protein SNRNP40 0 2 0

Isoform 2 of Lysophospholipid acyltransferase 7 MBOAT7 0 2 0

Isoform 3 of Endophilin-A2 SH3GL1 0 2 0

Isoform 2 of A-kinase anchor protein 2 AKAP2 0 2 0

Isoform 3 of Centrosomal protein P POC5 0 2 0

AP-5 complex subunit zeta-1 AP5Z1 0 2 0

DARA 0 0 471

Actin, alpha cardiac muscle 1 ACTC1 0 0 41

Isoform 6 of Myosin-14 MYH14 0 0 30

Tubulin alpha-1A chain TUBA1A 0 0 27

Tropomyosin alpha-3 chain TPM3 0 0 22

Isoform 5 of Tropomyosin alpha-3 chain TPM3 0 0 21

Myosin phosphatase Rho-interacting protein MPRIP 0 0 19

Nuclear pore complex protein Nup155 NUP155 0 0 15

Isoform 2 of Ankycorbin RAI14 0 0 14

DNA-dependent protein kinase catalytic subunit PRKDC 0 0 12

Myosin light chain 6B MYL6B 0 0 12 Isoform MLC3 of Myosin light chain 1/3, skeletal

muscle isoform MYL1 0 0 11

Keratin, type I cytoskeletal 17 KRT17 0 0 11

Isoform 2 of Collagen alpha-3(VI) chain COL6A3 0 0 7

Isoform 3 of Treacle protein TCOF1 0 0 7 Isoform 10 of LIM and calponin homology

domains-containing protein 1 LIMCH1 0 0 6

Proteasome activator complex subunit 1 PSME1 0 0 6 Isoform B of Ras GTPase-activating protein-

binding protein 2 G3BP2 0 0 6

Isoform 2 of Caprin-1 CAPRIN1 0 0 6 Isoform 2 of Proteasome activator complex

subunit 3 PSME3 0 0 6 Nuclear fragile X mental retardation-interacting

protein 2 NUFIP2 0 0 6

T-complex protein 1 subunit zeta CCT6A 0 0 5

Ras-related protein Rab-7a RAB7A 0 0 5

Actin-binding protein anillin ANLN 0 0 5 Isoform 2 of Ribose-phosphate pyrophosphokinase

2 PRPS2 0 0 5

Beta-1,3-galactosyltransferase 6 B3GALT6 0 0 5

108

Ribose-phosphate pyrophosphokinase 1 PRPS1 0 0 5 Isoform 2 of Guanine nucleotide-binding protein

G(I)/G(S)/G(T) subunit beta-1 GNB1 0 0 4

Proteasome activator complex subunit 2 PSME2 0 0 4

Isoform 2 of Ubiquitin-conjugating enzyme E2 D3 UBE2D3 0 0 4

Tropomodulin-3 TMOD3 0 0 4

Ras-related protein Rab-8A RAB8A 0 0 4

Barrier-to-autointegration factor BANF1 0 0 4 Leucine-rich PPR motif-containing protein,

mitochondrial LRPPRC 0 0 4

Crk-like protein CRKL 0 0 4

Brain acid soluble protein 1 BASP1 0 0 4

Uncharacterized protein C19orf43 TRIR 0 0 4

Isoform 2 of Cysteine--tRNA ligase, cytoplasmic CARS 0 0 3 Isoform 2 of Cullin-associated NEDD8-dissociated

protein 1 CAND1 0 0 3

Inosine-5'-monophosphate dehydrogenase 2 IMPDH2 0 0 3

Nicotinamide N-methyltransferase NNMT 0 0 3 Isoform B of Histone acetyltransferase type B

catalytic subunit HAT1 0 0 3

Long-chain-fatty-acid--CoA ligase 3 ACSL3 0 0 3

Isoform 3 of 60S ribosomal protein L17 RPL17 0 0 3

S-adenosylmethionine synthase isoform type-2 MAT2A 0 0 3

DnaJ homolog subfamily A member 1 DNAJA1 0 0 3

Isoform 2 of PDZ and LIM domain protein 4 PDLIM4 0 0 3

Vesicular integral-membrane protein VIP36 LMAN2 0 0 3

TAR DNA-binding protein 43 TARDBP 0 0 3 Isoform 2 of Leucine-rich repeat flightless-

interacting protein 1 LRRFIP1 0 0 3

Isoform 2 of Kinesin-like protein KIF2C KIF2C 0 0 3 Isoform 2 of BUB3-interacting and GLEBS motif-

containing protein ZNF207 ZNF207 0 0 3

Heat shock protein beta-1 HSPB1 0 0 3

Isoform 2 of Integrin beta-1 ITGB1 0 0 3

C-1-tetrahydrofolate synthase, cytoplasmic MTHFD1 0 0 3

Isoform 2 of Multifunctional protein ADE2 PAICS 0 0 3

Valine--tRNA ligase VARS 0 0 3

Importin subunit alpha-1 KPNA2 0 0 3

PRKC apoptosis WT1 regulator protein PAWR 0 0 3 Isoform 2 of Chromosome-associated kinesin

KIF4A KIF4A 0 0 3

Beta-2-microglobulin B2M 0 0 2


Ras-related protein Rap-1b-like protein 0 0 2 Membrane-associated progesterone receptor

component 1 PGRMC1 0 0 2

Actin-related protein 2/3 complex subunit 3 ARPC3 0 0 2

Isoform 2 of Surfeit locus protein 4 SURF4 0 0 2 Isoform sGi2 of Guanine nucleotide-binding

protein G(i) subunit alpha-2 GNAI2 0 0 2

X-ray repair cross-complementing protein 6 XRCC6 0 0 2

109

Adenosylhomocysteinase AHCY 0 0 2

Isoform 2 of Ras-related protein Rab-5C RAB5C 0 0 2 Isoform 2 of Nucleosome assembly protein 1-like

1 NAP1L1 0 0 2

Isoform 2 of 26S protease regulatory subunit 8 PSMC5 0 0 2


Transcription intermediary factor 1-beta TRIM28 0 0 2 Isoform 2 of Spectrin alpha chain, non-

erythrocytic 1 SPTAN1 0 0 2

Neutral amino acid transporter B(0) SLC1A5 0 0 2

Glutaredoxin-related protein 5, mitochondrial GLRX5 0 0 2

Isoform 1 of Unconventional myosin-VI MYO6 0 0 2

Histone H3.1 HIST1H3A 0 0 2 Basic leucine zipper and W2 domain-containing

protein 2 BZW2 0 0 2

Exportin-1 XPO1 0 0 2

Isoform 3BC of Catenin delta-1 CTNND1 0 0 2 Isoform 3 of Sodium/potassium-transporting

ATPase subunit alpha-1 ATP1A1 0 0 2

Splicing factor, proline- and glutamine-rich SFPQ 0 0 2

Isoform 3 of Exportin-2 CSE1L 0 0 2 Isoform 2 of Ubiquitin carboxyl-terminal

hydrolase 10 USP10 0 0 2

Isoform 2 of LIM domain only protein 7 LMO7 0 0 2

Isoform 3 of Palladin PALLD 0 0 2 Isoform 5 of Myeloid differentiation primary

response protein MyD88 MYD88 0 0 2 Isoform 2 of Protein arginine N-methyltransferase

1 PRMT1 0 0 2

Protein syndesmos NUDT16L1 0 0 2

Ras-related protein Ral-A RALA 0 0 2



Heat shock cognate 71 kDa protein HSPA8 0 54 3 Yes

Tubulin beta-3 chain TUBB3 0 38 30

Tensin-3 TNS3 0 35 3 Yes

Tubulin beta-6 chain TUBB6 0 34 20

BAG family molecular chaperone regulator 2 BAG2 0 30 2 Yes

Sequestosome-1 SQSTM1 0 26 14

Isoform 2 of Dedicator of cytokinesis protein 7 DOCK7 0 23 3 Yes

Isoform 6 of Microtubule-associated protein 4 MAP4 0 20 4 Yes

ADP/ATP translocase 2 SLC25A5 0 19 13

Elongation factor Tu, mitochondrial TUFM 0 19 10

Leucine zipper protein 1 LUZP1 0 16 8

Tubulin alpha-1C chain TUBA1C 0 15 26 HLA class I histocompatibility antigen, A-3 alpha

chain HLA-A 0 15 11

Isoform 2 of Polyadenylate-binding protein 1 PABPC1 0 9 13 Dolichyl-diphosphooligosaccharide--protein

glycosyltransferase subunit 1 RPN1 0 9 13

Voltage-dependent anion-selective channel protein VDAC1 0 9 10

110

1

60S ribosomal protein L4 RPL4 0 9 8 Isoform B of Phosphate carrier protein,

mitochondrial SLC25A3 0 9 5 Isoform LCRMP-4 of Dihydropyrimidinase-

related protein 3 DPYSL3 0 8 15

Glycine--tRNA ligase GARS 0 8 9

Ubiquitin carboxyl-terminal hydrolase isozyme L1 UCHL1 0 8 9

Nucleolin NCL 0 8 9

Ubiquitin/ISG15-conjugating enzyme E2 L6 UBE2L6 0 8 7

Lamina-associated polypeptide 2, isoform alpha TMPO 0 8 7 Serine/threonine-protein phosphatase 2A 65 kDa

regulatory subunit A alpha isoform PPP2R1A 0 8 6 Pre-mRNA-splicing factor ATP-dependent RNA

helicase DHX15 DHX15 0 8 2 Yes

Arginine--tRNA ligase, cytoplasmic RARS 0 8 2 Yes

Isoform 10 of Tropomyosin alpha-1 chain TPM1 0 7 28

Isoform 2 of T-complex protein 1 subunit gamma CCT3 0 7 8

40S ribosomal protein S3a RPS3A 0 7 7

60S ribosomal protein L7a RPL7A 0 7 7

40S ribosomal protein S17 RPS17 0 7 6 Isoform 2 of DNA replication licensing factor

MCM3 MCM3 0 7 5

Nuclease-sensitive element-binding protein 1 YBX1 0 7 5 Isoform Short of Heterogeneous nuclear

ribonucleoprotein U HNRNPU 0 7 5 Isoform 2 of Glutamine--fructose-6-phosphate

aminotransferase [isomerizing] 1 GFPT1 0 7 4

14-3-3 protein zeta/delta YWHAZ 0 7 4

Isoform 3 of ATP-dependent RNA helicase DDX1 DDX1 0 7 3 Yes Isoform 3 of 26S proteasome non-ATPase regulatory subunit 2 PSMD2 0 7 3 Yes

Transferrin receptor protein 1 TFRC 0 6 14

60S ribosomal protein L3 RPL3 0 6 8 Lamina-associated polypeptide 2, isoforms

beta/gamma TMPO 0 6 8

Dihydropyrimidinase-related protein 2 DPYSL2 0 6 7

T-complex protein 1 subunit alpha TCP1 0 6 6


Four and a half LIM domains protein 2 FHL2 0 6 3

Isoform 2 of Thioredoxin reductase 1, cytoplasmic TXNRD1 0 6 3

Ubiquitin-like protein ISG15 ISG15 0 6 2 Yes

Isoform 2 of Splicing factor 1 SF1 0 6 2 Yes Vesicle-associated membrane protein-associated protein A VAPA 0 6 2 Yes

Isoform 2 of Unconventional myosin-Ic MYO1C 0 5 14

Isoform 2 of Cellular nucleic acid-binding protein CNBP 0 5 7

F-actin-capping protein subunit alpha-2 CAPZA2 0 5 7 Isoform A1-A of Heterogeneous nuclear

ribonucleoprotein A1 HNRNPA1 0 5 6

Isoform 2 of Y-box-binding protein 3 YBX3 0 5 5

T-complex protein 1 subunit theta CCT8 0 5 4

111


Isoform 2 of Mitotic checkpoint protein BUB3 BUB3 0 5 3

Isoform 2 of Histone-binding protein RBBP7 RBBP7 0 5 3

PDZ and LIM domain protein 7 PDLIM7 0 5 3

60S acidic ribosomal protein P2 RPLP2 0 5 2 Yes

Unconventional myosin-Ib MYO1B 0 4 26

Aspartyl aminopeptidase DNPEP 0 4 17

Isoform 2 of Reticulon-4 RTN4 0 4 7


Isoform ADelta10 of Prelamin-A/C LMNA 0 4 5



40S ribosomal protein S9 RPS9 0 4 4 Isoform 2 of Dolichyl-diphosphooligosaccharide--

protein glycosyltransferase subunit 2 RPN2 0 4 4 Isoform 1 of Voltage-dependent anion-selective

channel protein 2 VDAC2 0 4 4



Protein deglycase DJ-1 PARK7 0 4 3

DNA replication licensing factor MCM5 MCM5 0 4 3

Isoform 2 of Caldesmon CALD1 0 4 2

Histone H1.4 HIST1H1E 0 4 2 Serine/threonine-protein phosphatase PP1-beta

catalytic subunit PPP1CB 0 4 2 Complement component 1 Q subcomponent-

binding protein, mitochondrial C1QBP 0 4 2

Dynein light chain 1, cytoplasmic DYNLL1 0 4 2

Isoform 2 of Ataxin-2-like protein ATXN2L 0 3 7

Ras GTPase-activating protein-binding protein 1 G3BP1 0 3 6



Peroxiredoxin-6 PRDX6 0 3 5

Isoform 2 of Bifunctional coenzyme A synthase COASY 0 3 5

Prohibitin-2 PHB2 0 3 5

Phenylalanine--tRNA ligase beta subunit FARSB 0 3 5

40S ribosomal protein SA RPSA 0 3 4

Isoform 2 of 40S ribosomal protein S24 RPS24 0 3 4

tRNA-splicing ligase RtcB homolog RTCB 0 3 4

ATP-dependent 6-phosphofructokinase, liver type PFKL 0 3 4

60S acidic ribosomal protein P0 RPLP0 0 3 3

Translocon-associated protein subunit delta SSR4 0 3 3

Isoform 2 of ATP-citrate synthase ACLY 0 3 3

60S ribosomal protein L30 RPL30 0 3 3 Isoform 2 of Phenylalanine--tRNA ligase alpha

subunit FARSA 0 3 2



112

Solute carrier family 2, facilitated glucose transporter member 1 SLC2A1 0 3 2

Malectin MLEC 0 3 2

Isoform 2 of Asparagine synthetase [glutamine-hydrolyzing] ASNS 0 3 2

Protein transport protein Sec61 subunit alpha isoform 1 SEC61A1 0 3 2


Isoform B of Eukaryotic translation initiation factor 4 gamma 1 EIF4G1 0 3 2

Leucine-rich repeat-containing protein 47 LRRC47 0 3 2

FAS-associated factor 2 FAF2 0 3 2

Sideroflexin-1 SFXN1 0 3 2

Leukocyte elastase inhibitor SERPINB1 0 3 2


CPOX 0 2 6

Tumor susceptibility gene 101 protein TSG101 0 2 5

Probable ATP-dependent RNA helicase DDX6 DDX6 0 2 4

Vesicle-trafficking protein SEC22b SEC22B 0 2 4

DNA replication licensing factor MCM7 MCM7 0 2 4

Isoform 2 of Protein flightless-1 homolog FLII 0 2 4

E3 ubiquitin/ISG15 ligase TRIM25 TRIM25 0 2 3

26S protease regulatory subunit 6A PSMC3 0 2 3


Serpin B6 SERPINB6 0 2 3

Isoform Del-701 of Signal transducer and activator of transcription 3 STAT3 0 2 3

Hypoxanthine-guanine phosphoribosyltransferase HPRT1 0 2 3

Ubiquitin-conjugating enzyme E2 N UBE2N 0 2 3

Isoform 3 of Cytoskeleton-associated protein 5 CKAP5 0 2 3

Isoform 2 of ATPase family AAA domain-containing protein 3A ATAD3A 0 2 3

Isoform Beta of Signal transducer and activator of transcription 1-alpha/beta STAT1 0 2 3



Alpha-actinin-4 ACTN4 0 2 2

60S acidic ribosomal protein P1 RPLP1 0 2 2

Elongation factor 1-beta EEF1B2 0 2 2

Protein transport protein Sec61 subunit beta SEC61B 0 2 2

Isoform 2 of Mannosyl-oligosaccharide glucosidase MOGS 0 2 2

RuvB-like 1 RUVBL1 0 2 2

Coatomer subunit gamma-1 COPG1 0 2 2


LanC-like protein 1 LANCL1 0 2 2

113

Appendix 2 BAG5 Interactome: SH-SY5Y

iTRAQ Abundance Relative to BAG5(3)

Description Gene BAG5

(1) BAG5

(2) BAG5

(3) DARA

(1) DARA

(2) DARA

(3) GFP(1) GFP(2)

Isoform 2 of BAG family molecular chaperone regulator 5 BAG5 1.349 0.916 1 0.659 0.741 0.806 0.019 0.01

BAG5DARA mutant DARA 4.14 2.469 1 76.56 85.407 100 0.225 0.01

Heat shock 70 kDa protein 1B HSPA1B 1.227 0.911 1 0.125 0.081 0.131 0.021 0.01

Heat shock cognate 71 kDa protein HSPA8 1.521 0.857 1 0.172 0.077 0.117 0.022 0.01

Tubulin beta chain TUBB 1.103 0.987 1 0.213 0.245 0.275 0.026 0.01

Tubulin beta-4B chain TUBB4B 1.141 0.965 1 0.555 0.221 0.297 0.022 0.01

Heat shock-related 70 kDa protein 2 HSPA2 1.25 1.015 1 0.414 0.151 0.412 0.1 0.133

Tubulin beta-2B chain TUBB2B 1.216 1.147 1 0.767 0.01 0.01 0.01 0.01

Isoform 2 of Tubulin alpha-1B chain TUBA1B 1.166 0.982 1 0.165 0.148 0.181 0.027 0.01

Tubulin alpha-3C/D chain TUBA3D 1.037 0.973 1 0.153 0.211 0.214 0.025 0.01

Tubulin alpha-4A chain TUBA4A 1.084 0.897 1 0.197 0.127 0.17 0.019 0.01

E3 ubiquitin-protein ligase CHIP STUB1 1.106 0.816 1 0.328 0.059 0.137 0.04 0.024

Heat shock 70 kDa protein 6 HSPA6 1.436 0.9 1 0.55 0.072 0.193 0.01 0.01

Non-P NONO 1.27 0.892 1 1.306 0.843 0.732 0.034 0.018 X-ray repair cross-complementing protein 6 XRCC6 1.147 0.981 1 0.885 0.712 0.644 0.022 0.011

40S ribosomal protein S17 RPS17 1.183 1.013 1 1.832 1.71 1.058 0.084 0.068

Poly [ADP-ribose] polymerase 1 PARP1 1.288 0.885 1 1.513 0.38 0.311 0.023 0.01

Nucleolin NCL 1.371 1.115 1 1.345 0.615 0.595 0.044 0.022

Myeloid leukemia factor 2 MLF2 0.993 0.862 1 0.74 0.035 0.349 0.01 0.01

Uncharacterized protein TUBB3 1.97 1.092 1 6.648 1.556 2.743 0.01 0.01


78 kDa glucose-regulated protein HSPA5 1.254 1.099 1 0.956 0.218 0.316 0.037 0.045 DnaJ homolog subfamily A member 1 DNAJA1 1.145 0.911 1 0.726 0.583 0.443 0.031 0.01

T-complex protein 1 subunit beta CCT2 1.121 0.954 1 3.123 0.625 0.791 0.01 0.01 U2 small nuclear ribonucleoprotein A' SNRPA1 1.11 0.863 1 2.405 1.104 1.006 0.069 0.033

Elongation factor 1-alpha 1 EEF1A1 1.173 0.926 1 0.703 0.73 0.62 0.02 0.011 X-ray repair cross-complementing protein 5 XRCC5 1.028 0.89 1 3.171 0.589 0.549 0.073 0.053

60S ribosomal protein L3 RPL3 1.267 1.026 1 0.756 0.479 0.338 0.027 0.01

Putative heat shock 70 kDa protein 7 HSPA7 3.058 1.136 1 7.978 0.01 0.01 0.01 0.01

TH ALYREF 1.33 1.017 1 2.551 0.826 0.886 0.064 0.061


40S ribosomal protein S10 RPS10 1.103 0.903 1 1.504 1.199 0.793 0.089 0.046 BAG family molecular chaperone regulator 2 BAG2 1.213 0.995 1 0.769 0.076 0.134 0.041 0.059

Serum albumin [Bos taurus] ALB 0.159 0.11 1 0.508 0.122 0.319 0.034 0.024

114

Isoform 2 of Stress-induced-phosphoprotein 1 STIP1 1.108 0.814 1 0.938 0.086 0.178 0.038 0.01

Nucleophosmin NPM1 1.17 1.101 1 1.369 0.791 0.797 0.047 0.01


Tubulin beta-8 chain TUBB8 1.566 0.276 1 3.426 2.048 0.316 0.01 0.01 60S ribosomal protein L7a (Fragment) RPL7A 1.15 0.996 1 1.225 1.299 0.927 0.052 0.041 Isoform 2 of Polyadenylate-binding protein 4 PABPC4 1.529 1.032 1 3.49 0.519 0.745 0.2 0.092

40S ribosomal protein S13 RPS13 1 1.026 1 1.818 1.336 0.652 0.099 0.032

Heat shock protein HSP 90-beta HSP90AB

1 1.272 0.881 1 1.329 0.158 0.25 0.18 0.139

60S ribosomal protein L23a RPL23A 1.158 0.969 1 1.879 1.448 1.02 0.06 0.049


Insulin receptor substrate 4 IRS4 1.599 1.108 1 1.675 0.01 0.696 0.28 0.221 Polypyrimidine tract-binding protein 1 PTBP1 1.028 0.857 1 0.622 0.538 0.355 0.019 0.01

40S ribosomal protein S15a RPS15A 1.239 1.034 1 2.133 0.918 0.607 0.068 0.037

Clathrin heavy chain 1 CLTC 1.612 1.318 1 2.411 0.874 0.764 0.032 0.034 Insulin-like growth factor 2 mRNA-binding protein 1 IGF2BP1 1.242 1.268 1 1.862 1.211 1.856 0.226 0.056






Histone H1.2 HIST1H1

C 0.989 1.048 1 1.87 1.175 0.944 0.063 0.026


E 1.572 6.325 1 10.567 0.01 0.01 0.01 0.01

Non-P NONO 2.008 0.935 1 1.18 0.01 1.581 0.01 0.01

Tubulin alpha-4A chain (Fragment) TUBA4A 1.668 1.086 1 5.575 0.795 0.956 0.01 0.01

Uncharacterized protein 0.885 1.714 1 2.295 1.801 1.34 0.033 0.035

40S ribosomal protein S7 RPS7 1.108 1.047 1 1.119 1.083 0.741 0.065 0.049 Nuclease-sensitive element-binding protein 1 (Fragment) YBX1 1.259 1.089 1 1.776 1.051 1.263 0.043 0.053


40S ribosomal protein S24 RPS24 1.126 1.04 1 1.69 1.026 0.515 0.043 0.01 Isoform 7 of Interleukin enhancer-binding factor 3 ILF3 1.258 0.872 1 1.736 0.461 0.51 0.039 0.044 Ubiquitin-40S ribosomal protein S27a RPS27A 1.075 0.915 1 0.719 0.836 0.885 0.104 0.05

Polyubiquitin-C (Fragment) UBC 2.153 0.705 1 2.38 0.01 1.401 0.477 0.487

Pre-mRNA-processing factor 19 PRPF19 1.249 0.982 1 0.165 0.213 0.152 0.01 0.037 Plasminogen activator inhibitor 1 RNA-binding protein SERBP1 0.927 0.707 1 0.987 0.564 0.72 0.052 0.052

Beta-casein CSN2 1.42 0.794 1 4.549 0.793 1.51 0.166 0.017

40S ribosomal protein S14 RPS14 1.168 1.058 1 1.69 0.631 0.83 0.01 0.01 Heterogeneous nuclear ribonucleoprotein D0 (Fragment) HNRNPD 1.076 0.857 1 0.41 0.322 0.396 0.038 0.026

Y-box-binding protein 2 YBX2 0.677 0.442 1 2.132 0.776 0.737 0.01 0.01

Alpha-S1-casein CSN1S1 1.544 0.769 1 12.379 1.322 2.056 0.355 0.01


40S ribosomal protein S3a RPS3A 0.966 0.858 1 1.213 0.693 0.706 0.041 0.013

115

60S ribosomal protein L31 (Fragment) RPL31 0.995 0.948 1 1.245 1.18 0.855 0.03 0.013


Cell division cycle 5-like protein CDC5L 1.15 1.216 1 1.653 0.01 1.715 0.01 0.116

60S ribosomal protein L10a RPL10A 1.076 2.011 1 1.454 1.015 0.89 0.047 0.039 Heterogeneous nuclear ribonucleoprotein F HNRNPF 1.33 1.01 1 1.675 0.809 1.058 0.01 0.01

T-complex protein 1 subunit delta CCT4 1.299 1.093 1 1.819 0.695 0.493 0.01 0.01 40S ribosomal protein S19 (Fragment) RPS19 1.269 0.294 1 8.54 1.673 0.621 0.516 0.154

T-complex protein 1 subunit alpha TCP1 1.114 0.95 1 1.559 0.629 0.403 0.01 0.01

Isoform 2 of Histone deacetylase 6 HDAC6 0.87 0.668 1 3 0.826 1.836 0.01 0.01

40S ribosomal protein S2 RPS2 1.172 0.978 1 1.45 0.644 0.451 0.041 0.014 60S ribosomal protein L27 (Fragment) RPL27 1.253 1.098 1 2.106 1.791 1.261 0.082 0.058


60S ribosomal protein L8 RPL8 1.308 1.086 1 1.846 1.038 0.898 0.121 0.017 Isoform B of DnaJ homolog subfamily B member 6 DNAJB6 1.401 1.038 1 0.146 0.071 0.125 0.014 0.01 Ras GTPase-activating protein-binding protein 1 G3BP1 1.555 1.243 1 4.406 0.785 0.725 0.098 0.056

Interleukin enhancer-binding factor 2 ILF2 1.525 1.229 1 1.382 0.696 0.434 0.01 0.083

Ribosomal protein L15 (Fragment) RPL15 1.172 0.85 1 1.332 0.892 0.569 0.034 0.037

T-complex protein 1 subunit zeta CCT6A 1.247 0.927 1 1.514 0.355 0.404 0.01 0.09



T-complex protein 1 subunit theta CCT8 1.422 1.018 1 1.136 0.76 0.855 0.022 0.01 Eukaryotic translation initiation factor 2 subunit 2 EIF2S2 1.281 0.762 1 6.383 1.324 1.764 0.01 0.01



A 2.408 0.376 1 1.948 1.492 5.125 0.523 0.01

Histone H1t HIST1H1

T 0.644 0.741 1 1.204 0.517 0.552 0.01 0.01

Transmembrane protein 263 C12orf23 0.946 1.101 1 1.903 1.633 1.012 0.125 0.079

Isoform 6 of Ankyrin repeat and KH domain-containing protein 1

ANKHD1-

EIF4EBP3 2.086 2.166 1 3.391 0.75 0.963 0.01 0.01

40S ribosomal protein S11 RPS11 1.051 0.944 1 1.261 1.138 0.934 0.054 0.05 60S ribosomal protein L18 (Fragment) RPL18 1.223 1.003 1 1.225 0.953 0.668 0.046 0.082 60S acidic ribosomal protein P2 (Fragment) RPLP2 1.199 0.849 1 1.993 1.278 1.13 0.131 0.065 Heterogeneous nuclear ribonucleoprotein H

HNRNPH1 1.413 2.078 1 0.01 0.01 0.01 0.01 0.01

Isoform 2 of Heterogeneous nuclear ribonucleoprotein K HNRNPK 1.682 1.329 1 0.814 0.918 0.884 0.11 0.01

60S ribosomal protein L22 RPL22 1.256 1.088 1 2.004 1.496 0.739 0.09 0.051 Heterogeneous nuclear ribonucleoprotein U HNRNPU 2.148 1.136 1 7.176 1.061 1.503 0.055 0.183 DNA-dependent protein kinase catalytic subunit PRKDC 1.541 0.967 1 5.694 0.672 0.686 0.239 0.267

Ribonucleoprotein PTB-binding 1 RAVER1 1.108 0.968 1 1.639 0.514 0.477 0.204 0.06

60S ribosomal protein L38 RPL38 1.032 0.844 1 2.037 2.507 2.111 0.124 0.201 Insulin-like growth factor 2 mRNA-binding protein 3 IGF2BP3 0.738 0.668 1 2.205 1.352 0.24 0.01 0.01


116

40S ribosomal protein S5 RPS5 0.874 1.283 1 0.748 0.294 0.474 0.25 0.099 Coiled-coil domain-containing protein 124 CCDC124 0.375 0.327 1 0.402 0.359 0.406 0.056 0.077

Elongation factor 2 EEF2 2.087 1.213 1 1.104 0.463 0.502 0.01 0.01

Prefoldin subunit 2 PFDN2 0.883 0.734 1 0.873 0.01 0.388 0.01 0.01 Heterogeneous nuclear ribonucleoprotein A1-like 2

HNRNPA1L2 0.993 1.032 1 0.745 0.705 0.589 0.153 0.111


Peroxiredoxin-1 (Fragment) PRDX1 1.736 1.181 1 1.575 1.332 1.305 0.196 0.158

Programmed cell death protein 5 PDCD5 1.182 1.033 1 8.588 2.217 2.424 0.116 0.166

Protein AF1q MLLT11 3.838 0.668 1 4.017 2.367 2.104 0.163 0.193 Isoform 5 of Ubiquitin-associated protein 2-like UBAP2L 1.223 0.868 1 2.504 0.758 0.691 0.655 0.058

60S ribosomal protein L21 RPL21 1.022 0.89 1 1.727 0.879 0.76 0.01 0.025 Heterogeneous nuclear ribonucleoprotein A1 (Fragment)

HNRNPA1 1.681 1.708 1 4.744 7.169 1.493 0.01 0.01

40S ribosomal protein S30 FAU 1.028 1.034 1 1.611 1.382 1.062 0.103 0.096

60S ribosomal protein L10 RPL10 1.222 0.851 1 1.791 0.587 0.585 0.348 0.354 Isoform 2 of 60S ribosomal protein L15 RPL15 3.851 1.82 1 16.748 0.01 0.01 0.01 0.01 Ankyrin repeat domain-containing protein 17

ANKRD17 1.273 1.16 1 1.925 2.343 0.361 0.108 0.123


Fatty acid synthase FASN 1.462 0.789 1 2.147 0.619 0.79 0.601 0.233

40S ribosomal protein S27 RPS27L 1.271 0.86 1 0.704 0.01 0.164 0.01 0.01 DnaJ homolog subfamily B member 1 DNAJB1 1.377 0.802 1 1.696 0.814 1.307 0.252 0.068



Transforming protein RhoA RHOA 1.256 0.748 1 5.744 0.01 2.167 0.01 0.01

Cytoskeleton-associated protein 5 CKAP5 1.332 0.857 1 2.781 0.685 0.675 0.169 0.072 Putative heat shock protein HSP 90-alpha A4

HSP90AA4P 0.149 0.01 1 0.938 0.01 0.913 0.01 0.01

Microtubule-associated protein MAP4 0.968 0.705 1 0.324 0.091 0.137 0.066 0.01

Clathrin heavy chain 2 CLTCL1 0.387 0.623 1 2.961 0.675 0.576 0.01 0.01 Ubiquitin-60S ribosomal protein L40 (Fragment) UBA52 2.372 0.829 1 0.536 0.658 0.01 0.01 0.01

Alpha-2-HS-glycoprotein AHSG 1.827 1.091 1 2.119 1.543 2.053 0.264 0.052 Heterogeneous nuclear ribonucleoprotein A0

HNRNPA0 1.494 1.996 1 6.676 0.01 2.127 0.01 0.01

ATP-dependent RNA helicase DDX3X DDX3X 1.115 0.797 1 2.919 0.873 0.919 0.01 0.01

Isoform 6 of Protein PRRC2C PRR2C 2.439 1.299 1 4.894 0.481 0.355 0.238 0.215 Heterogeneous nuclear ribonucleoproteins A2/B1

HNRNPA2B1 0.368 0.398 1 3.554 0.01 0.01 0.01 0.01

Heterogeneous nuclear ribonucleoprotein Q SYNCRIP 1.141 0.78 1 4.933 0.679 0.975 0.352 0.205 Insulin-like growth factor 2 mRNA-binding protein 2 IGF2BP2 2.059 0.765 1 0.01 0.01 0.01 0.01 0.01


40S ribosomal protein S27 RPS27 1.576 1.299 1 0.607 0.273 0.384 0.01 0.01 Nucleosome assembly protein 1-like 1 (Fragment) NAP1L1 1.124 0.264 1 1.88 0.01 0.01 0.01 0.01

Matrin-3 MATR3 1.249 1.148 1 7.784 0.01 1.473 0.118 0.116

Protein dpy-30 homolog DPY30 0.634 0.563 1 0.412 0.342 0.29 0.01 0.01

117

Prefoldin subunit 6 PFDN6 0.718 0.367 1 1.836 0.59 0.241 0.018 0.023 116 kDa U5 small nuclear ribonucleoprotein component EFTUD2 1.161 1.062 1 0.625 0.137 0.186 0.01 0.01

Programmed cell death protein 5 PDCD5 1.636 0.639 1 14.293 0.01 0.01 0.01 0.01 Interleukin enhancer-binding factor 3 (Fragment) ILF3 0.01 0.01 1 4.302 0.01 0.01 0.01 0.01

Isoform 6 of Splicing factor 1 SF1 1.761 0.513 1 2.668 0.01 0.449 0.01 0.01

Myosin-9 MYH9 0.561 0.496 1 4.641 1.622 1.012 0.01 0.01

RuvB-like 1 RUVBL1 1.226 1.019 1 1.275 0.01 0.285 0.065 0.01

Transcription factor BTF3 BTF3 4.971 1.24 1 5.528 3.611 2.818 0.01 0.01

Histone H2B HIST1H2

BN 2.169 7.418 1 2.425 1.293 3.248 0.01 0.01

Hemoglobin subunit alpha HBA2 3.836 2.897 1 3.759 2.839 1.713 0.132 0.199

Histone H2AX H2AFX 0.01 1.064 1 14.555 0.01 0.01 0.01 0.01

60S ribosomal protein L18a RPL18A 1.078 0.96 1 1.667 1.379 1.267 0.043 0.037 Probable ATP-dependent RNA helicase DDX5 DDX5 1.39 0.662 1 6.73 3.312 0.01 0.01 0.01

Serum albumin ALB 1.94 0.954 1 0.01 0.01 2.57 0.01 0.01 Isoform 2 of TAR DNA-binding protein 43 TARDBP 0.01 0.01 1 8.349 0.01 0.01 0.01 0.01 Heterogeneous nuclear ribonucleoprotein A/B

HNRNPAB 1.121 0.909 1 0.82 0.322 0.769 0.01 0.01

Heterogeneous nuclear ribonucleoprotein M

HNRNPM 1.725 1.1 1 6.787 0.85 1.355 0.337 0.346

Isoform 2 of Reticulocalbin-2 RCN2 1.656 1.901 1 0.01 0.01 0.01 0.01 0.01



40S ribosomal protein S16 RPS16 1.008 1.001 1 0.995 1.1 0.568 0.041 0.04 Nascent polypeptide-associated complex subunit alpha-2 NACA2 1.996 0.809 1 4.87 4.802 3.916 0.01 0.622

Heat shock protein HSP 90-alpha A2 HSP90A

A2 0.929 1.012 1 0.781 0.01 0.398 0.01 0.01

60S ribosomal protein L29 RPL29 1.021 0.969 1 1.877 1.274 1.127 0.046 0.068 Isoform 2 of Putative eukaryotic translation initiation factor 2 subunit 3-like protein EIF2S3L 2.77 1.887 1 64.717 2.874 3.095 0.01 0.01 Isoform 2 of T-complex protein 1 subunit epsilon CCT5 1.945 1.987 1 2.727 2.273 0.01 0.01 0.01 Isoform 2 of Eukaryotic translation initiation factor 3 subunit B EIF3B 2.22 2.912 1 20.221 0.01 0.01 0.01 0.01

Tetratricopeptide repeat protein 1 TTC1 4.53 2.298 1 9.933 0.01 0.01 0.01 0.01

Uncharacterized protein C11orf98 LOC1022

88414 1.46 1.132 1 4.924 0.01 0.01 0.01 0.01

Paraspeckle component 1 PSPC1 0.696 0.879 1 1.834 0.235 0.827 0.01 0.01 Isoform 2 of 40S ribosomal protein S20 RPS20 0.983 0.848 1 0.944 0.568 0.584 0.057 0.059

Isoform 4 of Myosin-10 MYH10 1.596 1.106 1 7.394 0.243 0.607 0.088 0.01

Dermcidin DCD 1.109 1.134 1 1.391 0.684 3.94 0.332 0.14

60S ribosomal protein L34 RPL34 1.136 0.983 1 1.615 1.117 0.715 0.053 0.042 DnaJ homolog subfamily C member 9 DNAJC9 0.979 1.05 1 0.139 0.01 0.293 0.01 0.01 Probable ATP-dependent RNA helicase DDX17 DDX17 0.636 1.037 1 4.605 0.01 0.252 0.01 0.01

Myosin light polypeptide 6 MYL6 1.584 1.006 1 4.213 1.433 0.751 0.01 0.01 Heterogeneous nuclear ribonucleoprotein D-like

HNRNPDL 1.001 0.872 1 1.777 0.678 0.845 0.054 0.01

P POTEF 1.098 1.058 1 2.681 1.356 1.045 0.01 0.01

118

40S ribosomal protein S9 RPS9 1.169 1.166 1 2.863 0.708 1.078 0.01 0.01 Eukaryotic translation initiation factor 3 subunit F EIF3F 1.366 0.97 1 1.4 0.01 0.01 0.01 0.01

SNW domain-containing protein 1 SNW1 0.987 0.787 1 1.891 0.711 0.42 0.684 0.01



60S ribosomal protein L37a RPL37A 0.972 1 1 3.171 1.797 1.174 0.058 0.038

ATP-dependent RNA helicase A DHX9 1.427 1.723 1 8.046 1.623 2.535 0.01 0.01 Bifunctional glutamate/proline--tRNA ligase EPRS 1.287 0.977 1 4.894 0.51 1.81 0.01 0.01

14-3-3 protein zeta/delta (Fragment) YWHAZ 0.383 0.552 1 3.151 1.613 0.386 0.125 0.01 Signal recognition particle 14 kDa protein SRP14 1.188 1.059 1 2.628 0.997 0.626 0.01 0.01

Nucleolar RNA helicase 2 DDX21 0.763 0.605 1 3.985 0.355 0.605 0.22 0.375

Histone deacetylase 6 (Fragment) HDAC6 1.227 0.816 1 2.527 2.01 1.588 0.125 0.15

Histone H4 HIST1H4

A 1.705 0.996 1 4.911 1.07 0.946 0.269 0.339

Histone H2B type 1-A HIST1H2

BA 0.991 1.639 1 2.078 2.232 1.48 0.094 0.055


Ubiquitin-associated protein 2 UBAP2 0.667 0.455 1 0.748 0.523 0.483 0.213 0.426 Histone deacetylase complex subunit SAP18 SAP18 0.861 0.01 1 3.34 0.01 0.01 0.01 0.01

Lupus La protein SSB 0.96 0.949 1 2.009 0.892 0.348 0.437 0.393 Spermatid perinuclear RNA-binding protein STRBP 0.622 0.413 1 1.906 0.214 0.71 0.01 0.261

Histone-binding protein RBBP4 RBBP4 0.741 0.927 1 0.01 0.01 0.01 0.01 0.01

Alpha-synuclein SNCA 0.738 1.431 1 2.961 0.595 0.836 0.01 0.01 Double-stranded RNA-binding protein Staufen homolog 1 STAU1 0.665 0.656 1 2.134 0.526 0.638 0.107 0.054

60S ribosomal protein L35a RPL35A 1.196 1.03 1 1.59 1.151 0.599 0.01 0.044 Ribonucleoprotein PTB-binding 1 (Fragment) RAVER1 2.074 0.748 1 16.29 2.728 1.702 0.01 0.01 Eukaryotic translation initiation factor 4 gamma 1 EIF4G1 1.343 1.144 1 3.584 0.803 0.454 0.01 0.01 Small nuclear ribonucleoprotein Sm D1 SNRPD1 0.912 1.095 1 2.131 0.01 0.01 0.01 0.01

119

Appendix 3 Contributions

Xinzhu (Louisa) Wang generated the CRISPR-Cas9 edited SH-SY5Y cells and created the

backbone of the replacement plasmid used by me to subsequently insert the GFP-BAG5

transgenes into the AAVS1 safe harbor (outlined in Chapter 2).

Declan Williams conducted the mass spectrometry sample preparation, the iTRAQ mass

spectrometry run and the subsequent peptide identification (Chapter 2).

Shirley Zhang helped to generate the p62-HA deletion constructs outlined in Figure 10. She also

provided significant technical assistance with the immunohistochemistry experiments, helped to

create Figure 13, and contributed to the PCA assay results presented in Chapter 4.

Victoria Agapova helped to generate the p62-HA deletion constructs outlined in Figure 10.

Mitch De Snoo provided technical assistance with cell culture and western blotting.

120

Copyright Acknowledgements

Figure 1 and Sections 1.2.1, 1.2.2 & 1.2.3 were all derived from the following source:

Erik L. Friesen, Mitch L. De Snoo, Luckshi Rajendran, Lorraine V. Kalia, and Suneil K. Kalia,

“Chaperone-Based Therapies for Disease Modification in Parkinson’s Disease,” Parkinson’s

Disease, vol. 2017, Article ID 5015307, 11 pages, 2017. doi:10.1155/2017/5015307.

Characterizing the Bcl-2 Associated Athanogene 5 ...

Documents

Transcript of Characterizing the Bcl-2 Associated Athanogene 5 ...